{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where experiment.library_source = \"TRANSCRIPTOMIC\", technology = \"smartseq\" and tissue_curation_coarse = \"Nervous System\"", "rows": [[10237, "ERR7131169", "ERX6698608", "ERS8070397", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F8 Nega", "SAMEA10418613", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418613|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F8 Nega|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry /GFP |genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 8|organism part:olfactory bulb|sample name:E MTAB 11083:F8 Nega|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F8 Nega s", "F8 Nega s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry /GFP ", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F22-1_210715_D00404_0538_BCD91CANXX_TCGACGTC-CTAAGCCT_L006_R1_001.fastq.gz", "fastq", 658093749.0, 12903799.0, "E MTAB 11083:2874F22 1 210715 D00404 0538 BCD91CANXX TCGACGTC CTAAGCCT L006", "0:51 1:0", "A:173355262;C:152464129;G:147489024;T:184739885;N:45449", 51, 0, null, null, 173355262, 152464129, 147489024, 184739885, 45449, "ERX6698608", "ERS8070397", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.78328, null, 0.15147, null, 0.71289, null, 0.53671, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10238, "ERR7131170", "ERX6698608", "ERS8070397", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F8 Nega", "SAMEA10418613", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418613|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F8 Nega|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry /GFP |genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 8|organism part:olfactory bulb|sample name:E MTAB 11083:F8 Nega|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F8 Nega s", "F8 Nega s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry /GFP ", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F22-2_210715_D00404_0538_BCD91CANXX_TCGACGTC-CTAAGCCT_L007_R1_001.fastq.gz", "fastq", 661103769.0, 12962819.0, "E MTAB 11083:2874F22 2 210715 D00404 0538 BCD91CANXX TCGACGTC CTAAGCCT L007", "0:51 1:0", "A:174223249;C:153223284;G:148276805;T:185335092;N:45339", 51, 0, null, null, 174223249, 153223284, 148276805, 185335092, 45339, "ERX6698608", "ERS8070397", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.78539, null, 0.15054, null, 0.70897, null, 0.5322, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10239, "ERR7131167", "ERX6698607", "ERS8070396", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F8 mCherry GFP", "SAMEA10418612", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418612|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F8 mCherry GFP|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP+|genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 8|organism part:olfactory bulb|sample name:E MTAB 11083:F8 mCherry GFP|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F8 mCherry GFP s", "F8 mCherry GFP s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry+/GFP+", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F24-1_210715_D00404_0538_BCD91CANXX_TCGACGTC-TCTCTCCG_L006_R1_001.fastq.gz", "fastq", 693183636.0, 13591836.0, "E MTAB 11083:2874F24 1 210715 D00404 0538 BCD91CANXX TCGACGTC TCTCTCCG L006", "0:51 1:0", "A:183977687;C:159275153;G:153149826;T:196732022;N:48948", 51, 0, null, null, 183977687, 159275153, 153149826, 196732022, 48948, "ERX6698607", "ERS8070396", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.68942, null, 0.15593, null, 0.75828, null, 0.51858, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10240, "ERR7131168", "ERX6698607", "ERS8070396", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F8 mCherry GFP", "SAMEA10418612", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418612|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F8 mCherry GFP|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP+|genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 8|organism part:olfactory bulb|sample name:E MTAB 11083:F8 mCherry GFP|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F8 mCherry GFP s", "F8 mCherry GFP s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry+/GFP+", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F24-2_210715_D00404_0538_BCD91CANXX_TCGACGTC-TCTCTCCG_L007_R1_001.fastq.gz", "fastq", 696648678.0, 13659778.0, "E MTAB 11083:2874F24 2 210715 D00404 0538 BCD91CANXX TCGACGTC TCTCTCCG L007", "0:51 1:0", "A:184971832;C:160126524;G:154012023;T:197490098;N:48201", 51, 0, null, null, 184971832, 160126524, 154012023, 197490098, 48201, "ERX6698607", "ERS8070396", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.6906, null, 0.15634, null, 0.75909, null, 0.51346, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10241, "ERR7131165", "ERX6698606", "ERS8070395", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F8 mCherry", "SAMEA10418611", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418611|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F8 mCherry|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP |genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 8|organism part:olfactory bulb|sample name:E MTAB 11083:F8 mCherry|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F8 mCherry s", "F8 mCherry s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry+/GFP ", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F23-1_210715_D00404_0538_BCD91CANXX_TCGACGTC-CGTCTAAT_L006_R1_001.fastq.gz", "fastq", 667760646.0, 13093346.0, "E MTAB 11083:2874F23 1 210715 D00404 0538 BCD91CANXX TCGACGTC CGTCTAAT L006", "0:51 1:0", "A:179948739;C:150541918;G:145038845;T:192184092;N:47052", 51, 0, null, null, 179948739, 150541918, 145038845, 192184092, 47052, "ERX6698606", "ERS8070395", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.71661, null, 0.19774, null, 0.74576, null, 0.52117, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10242, "ERR7131166", "ERX6698606", "ERS8070395", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F8 mCherry", "SAMEA10418611", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418611|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F8 mCherry|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP |genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 8|organism part:olfactory bulb|sample name:E MTAB 11083:F8 mCherry|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F8 mCherry s", "F8 mCherry s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry+/GFP ", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F23-2_210715_D00404_0538_BCD91CANXX_TCGACGTC-CGTCTAAT_L007_R1_001.fastq.gz", "fastq", 670970484.0, 13156284.0, "E MTAB 11083:2874F23 2 210715 D00404 0538 BCD91CANXX TCGACGTC CGTCTAAT L007", "0:51 1:0", "A:180906557;C:151329492;G:145816347;T:192872804;N:45284", 51, 0, null, null, 180906557, 151329492, 145816347, 192872804, 45284, "ERX6698606", "ERS8070395", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.71682, null, 0.19902, null, 0.74517, null, 0.52618, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10243, "ERR7131163", "ERX6698605", "ERS8070394", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F7 Nega", "SAMEA10418610", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418610|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F7 Nega|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry /GFP |genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 7|organism part:olfactory bulb|sample name:E MTAB 11083:F7 Nega|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F7 Nega s", "F7 Nega s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry /GFP ", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F19-1_210715_D00404_0538_BCD91CANXX_TCGACGTC-GTAAGGAG_L006_R1_001.fastq.gz", "fastq", 652205238.0, 12788338.0, "E MTAB 11083:2874F19 1 210715 D00404 0538 BCD91CANXX TCGACGTC GTAAGGAG L006", "0:51 1:0", "A:173730405;C:149044598;G:145436777;T:183946928;N:46530", 51, 0, null, null, 173730405, 149044598, 145436777, 183946928, 46530, "ERX6698605", "ERS8070394", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.80595, null, 0.17309, null, 0.71003, null, 0.53696, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10244, "ERR7131164", "ERX6698605", "ERS8070394", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F7 Nega", "SAMEA10418610", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418610|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F7 Nega|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry /GFP |genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 7|organism part:olfactory bulb|sample name:E MTAB 11083:F7 Nega|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F7 Nega s", "F7 Nega s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry /GFP ", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F19-2_210715_D00404_0538_BCD91CANXX_TCGACGTC-GTAAGGAG_L007_R1_001.fastq.gz", "fastq", 655593423.0, 12854773.0, "E MTAB 11083:2874F19 2 210715 D00404 0538 BCD91CANXX TCGACGTC GTAAGGAG L007", "0:51 1:0", "A:174715119;C:149844974;G:146250446;T:184737535;N:45349", 51, 0, null, null, 174715119, 149844974, 146250446, 184737535, 45349, "ERX6698605", "ERS8070394", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.80585, null, 0.17497, null, 0.71078, null, 0.53767, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10245, "ERR7131161", "ERX6698604", "ERS8070393", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F7 mCherry GFP", "SAMEA10418609", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418609|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F7 mCherry GFP|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP+|genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 7|organism part:olfactory bulb|sample name:E MTAB 11083:F7 mCherry GFP|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F7 mCherry GFP s", "F7 mCherry GFP s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry+/GFP+", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F21-1_210715_D00404_0538_BCD91CANXX_TCGACGTC-AAGGAGTA_L006_R1_001.fastq.gz", "fastq", 661067151.0, 12962101.0, "E MTAB 11083:2874F21 1 210715 D00404 0538 BCD91CANXX TCGACGTC AAGGAGTA L006", "0:51 1:0", "A:168281419;C:157701209;G:153487197;T:181550252;N:47074", 51, 0, null, null, 168281419, 157701209, 153487197, 181550252, 47074, "ERX6698604", "ERS8070393", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.39074, null, 0.11592, null, 0.82615, null, 0.5252, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10246, "ERR7131162", "ERX6698604", "ERS8070393", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F7 mCherry GFP", "SAMEA10418609", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418609|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F7 mCherry GFP|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP+|genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 7|organism part:olfactory bulb|sample name:E MTAB 11083:F7 mCherry GFP|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F7 mCherry GFP s", "F7 mCherry GFP s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry+/GFP+", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F21-2_210715_D00404_0538_BCD91CANXX_TCGACGTC-AAGGAGTA_L007_R1_001.fastq.gz", "fastq", 665709018.0, 13053118.0, "E MTAB 11083:2874F21 2 210715 D00404 0538 BCD91CANXX TCGACGTC AAGGAGTA L007", "0:51 1:0", "A:169539998;C:158884603;G:154624803;T:182614264;N:45350", 51, 0, null, null, 169539998, 158884603, 154624803, 182614264, 45350, "ERX6698604", "ERS8070393", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.38966, null, 0.1152, null, 0.8258, null, 0.53305, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10247, "ERR7131159", "ERX6698603", "ERS8070392", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F7 mCherry", "SAMEA10418608", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418608|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F7 mCherry|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP |genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 7|organism part:olfactory bulb|sample name:E MTAB 11083:F7 mCherry|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F7 mCherry s", "F7 mCherry s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry+/GFP ", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F20-1_210715_D00404_0538_BCD91CANXX_TCGACGTC-ACTGCATA_L006_R1_001.fastq.gz", "fastq", 657813402.0, 12898302.0, "E MTAB 11083:2874F20 1 210715 D00404 0538 BCD91CANXX TCGACGTC ACTGCATA L006", "0:51 1:0", "A:175873489;C:149476129;G:143987770;T:188429588;N:46426", 51, 0, null, null, 175873489, 149476129, 143987770, 188429588, 46426, "ERX6698603", "ERS8070392", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.70507, null, 0.2048, null, 0.75923, null, 0.52828, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10248, "ERR7131160", "ERX6698603", "ERS8070392", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F7 mCherry", "SAMEA10418608", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418608|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F7 mCherry|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP |genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 7|organism part:olfactory bulb|sample name:E MTAB 11083:F7 mCherry|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F7 mCherry s", "F7 mCherry s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry+/GFP ", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F20-2_210715_D00404_0538_BCD91CANXX_TCGACGTC-ACTGCATA_L007_R1_001.fastq.gz", "fastq", 660303426.0, 12947126.0, "E MTAB 11083:2874F20 2 210715 D00404 0538 BCD91CANXX TCGACGTC ACTGCATA L007", "0:51 1:0", "A:176607119;C:150065781;G:144613110;T:188972809;N:44607", 51, 0, null, null, 176607119, 150065781, 144613110, 188972809, 44607, "ERX6698603", "ERS8070392", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.70705, null, 0.20314, null, 0.75852, null, 0.52949, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10249, "ERR7131157", "ERX6698602", "ERS8070391", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F6 Nega", "SAMEA10418607", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418607|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F6 Nega|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry /GFP |genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 6|organism part:olfactory bulb|sample name:E MTAB 11083:F6 Nega|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F6 Nega s", "F6 Nega s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry /GFP ", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F16-1_210715_D00404_0538_BCD91CANXX_TGCAGCTA-TCTCTCCG_L006_R1_001.fastq.gz", "fastq", 669627450.0, 13129950.0, "E MTAB 11083:2874F16 1 210715 D00404 0538 BCD91CANXX TGCAGCTA TCTCTCCG L006", "0:51 1:0", "A:177483937;C:154097051;G:148063012;T:189935690;N:47760", 51, 0, null, null, 177483937, 154097051, 148063012, 189935690, 47760, "ERX6698602", "ERS8070391", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.77183, null, 0.16001, null, 0.71467, null, 0.53352, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10250, "ERR7131158", "ERX6698602", "ERS8070391", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F6 Nega", "SAMEA10418607", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418607|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F6 Nega|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry /GFP |genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 6|organism part:olfactory bulb|sample name:E MTAB 11083:F6 Nega|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F6 Nega s", "F6 Nega s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry /GFP ", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F16-2_210715_D00404_0538_BCD91CANXX_TGCAGCTA-TCTCTCCG_L007_R1_001.fastq.gz", "fastq", 671615073.0, 13168923.0, "E MTAB 11083:2874F16 2 210715 D00404 0538 BCD91CANXX TGCAGCTA TCTCTCCG L007", "0:51 1:0", "A:178109157;C:154619024;G:148595207;T:190246469;N:45216", 51, 0, null, null, 178109157, 154619024, 148595207, 190246469, 45216, "ERX6698602", "ERS8070391", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.77284, null, 0.15963, null, 0.71569, null, 0.53038, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10251, "ERR7131155", "ERX6698601", "ERS8070390", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F6 mCherry GFP", "SAMEA10418606", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418606|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F6 mCherry GFP|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP+|genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 6|organism part:olfactory bulb|sample name:E MTAB 11083:F6 mCherry GFP|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F6 mCherry GFP s", "F6 mCherry GFP s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry+/GFP+", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F18-1_210715_D00404_0538_BCD91CANXX_TCGACGTC-TATCCTCT_L006_R1_001.fastq.gz", "fastq", 667663542.0, 13091442.0, "E MTAB 11083:2874F18 1 210715 D00404 0538 BCD91CANXX TCGACGTC TATCCTCT L006", "0:51 1:0", "A:177646483;C:152747528;G:146388226;T:190833951;N:47354", 51, 0, null, null, 177646483, 152747528, 146388226, 190833951, 47354, "ERX6698601", "ERS8070390", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.67964, null, 0.18123, null, 0.77193, null, 0.53313, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10252, "ERR7131156", "ERX6698601", "ERS8070390", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F6 mCherry GFP", "SAMEA10418606", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418606|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F6 mCherry GFP|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP+|genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 6|organism part:olfactory bulb|sample name:E MTAB 11083:F6 mCherry GFP|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F6 mCherry GFP s", "F6 mCherry GFP s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry+/GFP+", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F18-2_210715_D00404_0538_BCD91CANXX_TCGACGTC-TATCCTCT_L007_R1_001.fastq.gz", "fastq", 670170141.0, 13140591.0, "E MTAB 11083:2874F18 2 210715 D00404 0538 BCD91CANXX TCGACGTC TATCCTCT L007", "0:51 1:0", "A:178425395;C:153363855;G:147033779;T:191300976;N:46136", 51, 0, null, null, 178425395, 153363855, 147033779, 191300976, 46136, "ERX6698601", "ERS8070390", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.67922, null, 0.18101, null, 0.77141, null, 0.53601, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10253, "ERR7131153", "ERX6698600", "ERS8070389", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F6 mCherry", "SAMEA10418605", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418605|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F6 mCherry|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP |genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 6|organism part:olfactory bulb|sample name:E MTAB 11083:F6 mCherry|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F6 mCherry s", "F6 mCherry s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry+/GFP ", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F17-1_210715_D00404_0538_BCD91CANXX_TCGACGTC-CTCTCTAT_L006_R1_001.fastq.gz", "fastq", 677617008.0, 13286608.0, "E MTAB 11083:2874F17 1 210715 D00404 0538 BCD91CANXX TCGACGTC CTCTCTAT L006", "0:51 1:0", "A:181785899;C:152797687;G:147070676;T:195914808;N:47938", 51, 0, null, null, 181785899, 152797687, 147070676, 195914808, 47938, "ERX6698600", "ERS8070389", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.68298, null, 0.1953, null, 0.76292, null, 0.5395, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10254, "ERR7131154", "ERX6698600", "ERS8070389", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F6 mCherry", "SAMEA10418605", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418605|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F6 mCherry|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP |genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 6|organism part:olfactory bulb|sample name:E MTAB 11083:F6 mCherry|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F6 mCherry s", "F6 mCherry s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry+/GFP ", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F17-2_210715_D00404_0538_BCD91CANXX_TCGACGTC-CTCTCTAT_L007_R1_001.fastq.gz", "fastq", 679922973.0, 13331823.0, "E MTAB 11083:2874F17 2 210715 D00404 0538 BCD91CANXX TCGACGTC CTCTCTAT L007", "0:51 1:0", "A:182567819;C:153380607;G:147589890;T:196337722;N:46935", 51, 0, null, null, 182567819, 153380607, 147589890, 196337722, 46935, "ERX6698600", "ERS8070389", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.68391, null, 0.19726, null, 0.76299, null, 0.54099, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10255, "ERR7131151", "ERX6698599", "ERS8070388", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F5 Nega", "SAMEA10418604", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418604|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F5 Nega|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry /GFP |genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 5|organism part:olfactory bulb|sample name:E MTAB 11083:F5 Nega|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F5 Nega s", "F5 Nega s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry /GFP ", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F13-1_210715_D00404_0538_BCD91CANXX_TGCAGCTA-AAGGAGTA_L006_R1_001.fastq.gz", "fastq", 620316315.0, 12163065.0, "E MTAB 11083:2874F13 1 210715 D00404 0538 BCD91CANXX TGCAGCTA AAGGAGTA L006", "0:51 1:0", "A:165967355;C:141072216;G:136931219;T:176301963;N:43562", 51, 0, null, null, 165967355, 141072216, 136931219, 176301963, 43562, "ERX6698599", "ERS8070388", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.78924, null, 0.17457, null, 0.71934, null, 0.53563, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10256, "ERR7131152", "ERX6698599", "ERS8070388", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F5 Nega", "SAMEA10418604", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418604|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F5 Nega|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry /GFP |genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 5|organism part:olfactory bulb|sample name:E MTAB 11083:F5 Nega|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F5 Nega s", "F5 Nega s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry /GFP ", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F13-2_210715_D00404_0538_BCD91CANXX_TGCAGCTA-AAGGAGTA_L007_R1_001.fastq.gz", "fastq", 623905338.0, 12233438.0, "E MTAB 11083:2874F13 2 210715 D00404 0538 BCD91CANXX TGCAGCTA AAGGAGTA L007", "0:51 1:0", "A:166996253;C:141937637;G:137825206;T:177103504;N:42738", 51, 0, null, null, 166996253, 141937637, 137825206, 177103504, 42738, "ERX6698599", "ERS8070388", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.78975, null, 0.17387, null, 0.72153, null, 0.54149, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10257, "ERR7131149", "ERX6698598", "ERS8070387", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F5 mCherry GFP", "SAMEA10418603", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418603|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F5 mCherry GFP|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP+|genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 5|organism part:olfactory bulb|sample name:E MTAB 11083:F5 mCherry GFP|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F5 mCherry GFP s", "F5 mCherry GFP s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry+/GFP+", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F15-1_210715_D00404_0538_BCD91CANXX_TGCAGCTA-CGTCTAAT_L006_R1_001.fastq.gz", "fastq", 670154841.0, 13140291.0, "E MTAB 11083:2874F15 1 210715 D00404 0538 BCD91CANXX TGCAGCTA CGTCTAAT L006", "0:51 1:0", "A:182457480;C:149175456;G:144548173;T:193927470;N:46262", 51, 0, null, null, 182457480, 149175456, 144548173, 193927470, 46262, "ERX6698598", "ERS8070387", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.71875, null, 0.18671, null, 0.76047, null, 0.52398, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10258, "ERR7131150", "ERX6698598", "ERS8070387", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F5 mCherry GFP", "SAMEA10418603", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418603|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F5 mCherry GFP|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP+|genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 5|organism part:olfactory bulb|sample name:E MTAB 11083:F5 mCherry GFP|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F5 mCherry GFP s", "F5 mCherry GFP s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry+/GFP+", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F15-2_210715_D00404_0538_BCD91CANXX_TGCAGCTA-CGTCTAAT_L007_R1_001.fastq.gz", "fastq", 674202048.0, 13219648.0, "E MTAB 11083:2874F15 2 210715 D00404 0538 BCD91CANXX TGCAGCTA CGTCTAAT L007", "0:51 1:0", "A:183639511;C:150168226;G:145502071;T:194847755;N:44485", 51, 0, null, null, 183639511, 150168226, 145502071, 194847755, 44485, "ERX6698598", "ERS8070387", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.72111, null, 0.18813, null, 0.76378, null, 0.5258, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10259, "ERR7131147", "ERX6698597", "ERS8070386", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F5 mCherry", "SAMEA10418602", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418602|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F5 mCherry|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP |genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 5|organism part:olfactory bulb|sample name:E MTAB 11083:F5 mCherry|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F5 mCherry s", "F5 mCherry s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry+/GFP ", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F14-1_210715_D00404_0538_BCD91CANXX_TGCAGCTA-CTAAGCCT_L006_R1_001.fastq.gz", "fastq", 615458259.0, 12067809.0, "E MTAB 11083:2874F14 1 210715 D00404 0538 BCD91CANXX TGCAGCTA CTAAGCCT L006", "0:51 1:0", "A:165108582;C:139178883;G:134070672;T:177059757;N:40365", 51, 0, null, null, 165108582, 139178883, 134070672, 177059757, 40365, "ERX6698597", "ERS8070386", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.69017, null, 0.1977, null, 0.77193, null, 0.53352, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10260, "ERR7131148", "ERX6698597", "ERS8070386", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F5 mCherry", "SAMEA10418602", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418602|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F5 mCherry|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP |genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 5|organism part:olfactory bulb|sample name:E MTAB 11083:F5 mCherry|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F5 mCherry s", "F5 mCherry s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry+/GFP ", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F14-2_210715_D00404_0538_BCD91CANXX_TGCAGCTA-CTAAGCCT_L007_R1_001.fastq.gz", "fastq", 619061613.0, 12138463.0, "E MTAB 11083:2874F14 2 210715 D00404 0538 BCD91CANXX TGCAGCTA CTAAGCCT L007", "0:51 1:0", "A:166167516;C:140058774;G:134972850;T:177822733;N:39740", 51, 0, null, null, 166167516, 140058774, 134972850, 177822733, 39740, "ERX6698597", "ERS8070386", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.69118, null, 0.20019, null, 0.7707, null, 0.52174, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10261, "ERR7131145", "ERX6698596", "ERS8070385", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F4 Nega", "SAMEA10418601", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418601|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F4 Nega|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry /GFP |genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 4|organism part:olfactory bulb|sample name:E MTAB 11083:F4 Nega|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F4 Nega s", "F4 Nega s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry /GFP ", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F10-1_210715_D00404_0538_BCD91CANXX_TGCAGCTA-TATCCTCT_L006_R1_001.fastq.gz", "fastq", 652536687.0, 12794837.0, "E MTAB 11083:2874F10 1 210715 D00404 0538 BCD91CANXX TGCAGCTA TATCCTCT L006", "0:51 1:0", "A:178033231;C:144661707;G:139876661;T:189921085;N:44003", 51, 0, null, null, 178033231, 144661707, 139876661, 189921085, 44003, "ERX6698596", "ERS8070385", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.76201, null, 0.2508, null, 0.71299, null, 0.53379, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10262, "ERR7131146", "ERX6698596", "ERS8070385", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F4 Nega", "SAMEA10418601", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418601|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F4 Nega|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry /GFP |genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 4|organism part:olfactory bulb|sample name:E MTAB 11083:F4 Nega|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F4 Nega s", "F4 Nega s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry /GFP ", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F10-2_210715_D00404_0538_BCD91CANXX_TGCAGCTA-TATCCTCT_L007_R1_001.fastq.gz", "fastq", 655278957.0, 12848607.0, "E MTAB 11083:2874F10 2 210715 D00404 0538 BCD91CANXX TGCAGCTA TATCCTCT L007", "0:51 1:0", "A:178938002;C:145332613;G:140527756;T:190437189;N:43397", 51, 0, null, null, 178938002, 145332613, 140527756, 190437189, 43397, "ERX6698596", "ERS8070385", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.76188, null, 0.25356, null, 0.71344, null, 0.53081, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10263, "ERR7131143", "ERX6698595", "ERS8070384", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F4 mCherry GFP", "SAMEA10418600", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418600|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F4 mCherry GFP|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP+|genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 4|organism part:olfactory bulb|sample name:E MTAB 11083:F4 mCherry GFP|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F4 mCherry GFP s", "F4 mCherry GFP s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry+/GFP+", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F12-1_210715_D00404_0538_BCD91CANXX_TGCAGCTA-ACTGCATA_L006_R1_001.fastq.gz", "fastq", 297921855.0, 5841605.0, "E MTAB 11083:2874F12 1 210715 D00404 0538 BCD91CANXX TGCAGCTA ACTGCATA L006", "0:51 1:0", "A:82400724;C:65517496;G:64603058;T:85384480;N:16097", 51, 0, null, null, 82400724, 65517496, 64603058, 85384480, 16097, "ERX6698595", "ERS8070384", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.72496, null, 0.20794, null, 0.81223, null, 0.52529, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10264, "ERR7131144", "ERX6698595", "ERS8070384", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F4 mCherry GFP", "SAMEA10418600", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418600|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F4 mCherry GFP|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP+|genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 4|organism part:olfactory bulb|sample name:E MTAB 11083:F4 mCherry GFP|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F4 mCherry GFP s", "F4 mCherry GFP s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry+/GFP+", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F12-2_210715_D00404_0538_BCD91CANXX_TGCAGCTA-ACTGCATA_L007_R1_001.fastq.gz", "fastq", 309412971.0, 6066921.0, "E MTAB 11083:2874F12 2 210715 D00404 0538 BCD91CANXX TGCAGCTA ACTGCATA L007", "0:51 1:0", "A:85531271;C:68164437;G:67129209;T:88573210;N:14844", 51, 0, null, null, 85531271, 68164437, 67129209, 88573210, 14844, "ERX6698595", "ERS8070384", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.7245, null, 0.20724, null, 0.80468, null, 0.52791, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10265, "ERR7131141", "ERX6698594", "ERS8070383", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F4 mCherry", "SAMEA10418599", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418599|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F4 mCherry|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP |genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 4|organism part:olfactory bulb|sample name:E MTAB 11083:F4 mCherry|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F4 mCherry s", "F4 mCherry s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry+/GFP ", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F11-1_210715_D00404_0538_BCD91CANXX_TGCAGCTA-GTAAGGAG_L006_R1_001.fastq.gz", "fastq", 672319791.0, 13182741.0, "E MTAB 11083:2874F11 1 210715 D00404 0538 BCD91CANXX TGCAGCTA GTAAGGAG L006", "0:51 1:0", "A:181508034;C:150928549;G:146124085;T:193711358;N:47765", 51, 0, null, null, 181508034, 150928549, 146124085, 193711358, 47765, "ERX6698594", "ERS8070383", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.71726, null, 0.19842, null, 0.74986, null, 0.53363, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10266, "ERR7131142", "ERX6698594", "ERS8070383", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F4 mCherry", "SAMEA10418599", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418599|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F4 mCherry|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP |genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 4|organism part:olfactory bulb|sample name:E MTAB 11083:F4 mCherry|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F4 mCherry s", "F4 mCherry s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry+/GFP ", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F11-2_210715_D00404_0538_BCD91CANXX_TGCAGCTA-GTAAGGAG_L007_R1_001.fastq.gz", "fastq", 675486075.0, 13244825.0, "E MTAB 11083:2874F11 2 210715 D00404 0538 BCD91CANXX TGCAGCTA GTAAGGAG L007", "0:51 1:0", "A:182462261;C:151688554;G:146902713;T:194385945;N:46602", 51, 0, null, null, 182462261, 151688554, 146902713, 194385945, 46602, "ERX6698594", "ERS8070383", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.71745, null, 0.19727, null, 0.74805, null, 0.53092, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10267, "ERR7131139", "ERX6698593", "ERS8070382", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F3 Nega", "SAMEA10418598", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418598|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F3 Nega|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry /GFP |genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 3|organism part:olfactory bulb|sample name:E MTAB 11083:F3 Nega|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F3 Nega s", "F3 Nega s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry /GFP ", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F7-1_210715_D00404_0538_BCD91CANXX_CGATCAGT-CGTCTAAT_L006_R1_001.fastq.gz", "fastq", 630093627.0, 12354777.0, "E MTAB 11083:2874F7 1 210715 D00404 0538 BCD91CANXX CGATCAGT CGTCTAAT L006", "0:51 1:0", "A:165132739;C:146179836;G:142796880;T:175940613;N:43559", 51, 0, null, null, 165132739, 146179836, 142796880, 175940613, 43559, "ERX6698593", "ERS8070382", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.81672, null, 0.15219, null, 0.71277, null, 0.52461, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10268, "ERR7131140", "ERX6698593", "ERS8070382", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F3 Nega", "SAMEA10418598", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418598|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F3 Nega|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry /GFP |genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 3|organism part:olfactory bulb|sample name:E MTAB 11083:F3 Nega|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F3 Nega s", "F3 Nega s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry /GFP ", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F7-2_210715_D00404_0538_BCD91CANXX_CGATCAGT-CGTCTAAT_L007_R1_001.fastq.gz", "fastq", 632305242.0, 12398142.0, "E MTAB 11083:2874F7 2 210715 D00404 0538 BCD91CANXX CGATCAGT CGTCTAAT L007", "0:51 1:0", "A:165832174;C:146751895;G:143384539;T:176293313;N:43321", 51, 0, null, null, 165832174, 146751895, 143384539, 176293313, 43321, "ERX6698593", "ERS8070382", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.81791, null, 0.15444, null, 0.7151, null, 0.52585, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10269, "ERR7131137", "ERX6698592", "ERS8070381", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F3 mCherry GFP", "SAMEA10418597", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418597|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F3 mCherry GFP|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP+|genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 3|organism part:olfactory bulb|sample name:E MTAB 11083:F3 mCherry GFP|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F3 mCherry GFP s", "F3 mCherry GFP s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry+/GFP+", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F9-1_210715_D00404_0538_BCD91CANXX_TGCAGCTA-CTCTCTAT_L006_R1_001.fastq.gz", "fastq", 660379620.0, 12948620.0, "E MTAB 11083:2874F9 1 210715 D00404 0538 BCD91CANXX TGCAGCTA CTCTCTAT L006", "0:51 1:0", "A:178482695;C:147417787;G:143797476;T:190635173;N:46489", 51, 0, null, null, 178482695, 147417787, 143797476, 190635173, 46489, "ERX6698592", "ERS8070381", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.65635, null, 0.17778, null, 0.76899, null, 0.52957, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10270, "ERR7131138", "ERX6698592", "ERS8070381", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F3 mCherry GFP", "SAMEA10418597", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418597|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F3 mCherry GFP|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP+|genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 3|organism part:olfactory bulb|sample name:E MTAB 11083:F3 mCherry GFP|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F3 mCherry GFP s", "F3 mCherry GFP s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry+/GFP+", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F9-2_210715_D00404_0538_BCD91CANXX_TGCAGCTA-CTCTCTAT_L007_R1_001.fastq.gz", "fastq", 662411307.0, 12988457.0, "E MTAB 11083:2874F9 2 210715 D00404 0538 BCD91CANXX TGCAGCTA CTCTCTAT L007", "0:51 1:0", "A:179158323;C:147942300;G:144319925;T:190945370;N:45389", 51, 0, null, null, 179158323, 147942300, 144319925, 190945370, 45389, "ERX6698592", "ERS8070381", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.65813, null, 0.17896, null, 0.77076, null, 0.52835, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10271, "ERR7131135", "ERX6698591", "ERS8070380", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F3 mCherry", "SAMEA10418596", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418596|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F3 mCherry|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP |genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 3|organism part:olfactory bulb|sample name:E MTAB 11083:F3 mCherry|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F3 mCherry s", "F3 mCherry s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry+/GFP ", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F8-1_210715_D00404_0538_BCD91CANXX_CGATCAGT-TCTCTCCG_L006_R1_001.fastq.gz", "fastq", 698608353.0, 13698203.0, "E MTAB 11083:2874F8 1 210715 D00404 0538 BCD91CANXX CGATCAGT TCTCTCCG L006", "0:51 1:0", "A:188718612;C:156814081;G:151125083;T:201901570;N:49007", 51, 0, null, null, 188718612, 156814081, 151125083, 201901570, 49007, "ERX6698591", "ERS8070380", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.70185, null, 0.21547, null, 0.75588, null, 0.53853, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10272, "ERR7131136", "ERX6698591", "ERS8070380", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F3 mCherry", "SAMEA10418596", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418596|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F3 mCherry|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP |genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 3|organism part:olfactory bulb|sample name:E MTAB 11083:F3 mCherry|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F3 mCherry s", "F3 mCherry s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry+/GFP ", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F8-2_210715_D00404_0538_BCD91CANXX_CGATCAGT-TCTCTCCG_L007_R1_001.fastq.gz", "fastq", 699869175.0, 13722925.0, "E MTAB 11083:2874F8 2 210715 D00404 0538 BCD91CANXX CGATCAGT TCTCTCCG L007", "0:51 1:0", "A:189192315;C:157176897;G:151498983;T:201952867;N:48113", 51, 0, null, null, 189192315, 157176897, 151498983, 201952867, 48113, "ERX6698591", "ERS8070380", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.70221, null, 0.21684, null, 0.75621, null, 0.53787, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10273, "ERR7131133", "ERX6698590", "ERS8070379", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F2 Nega", "SAMEA10418595", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418595|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F2 Nega|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry /GFP |genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 2|organism part:olfactory bulb|sample name:E MTAB 11083:F2 Nega|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F2 Nega s", "F2 Nega s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry /GFP ", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F4-1_210715_D00404_0538_BCD91CANXX_CGATCAGT-ACTGCATA_L006_R1_001.fastq.gz", "fastq", 573812985.0, 11251235.0, "E MTAB 11083:2874F4 1 210715 D00404 0538 BCD91CANXX CGATCAGT ACTGCATA L006", "0:51 1:0", "A:150716404;C:132203167;G:129732968;T:161120057;N:40389", 51, 0, null, null, 150716404, 132203167, 129732968, 161120057, 40389, "ERX6698590", "ERS8070379", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.81899, null, 0.17302, null, 0.72281, null, 0.54315, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10274, "ERR7131134", "ERX6698590", "ERS8070379", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F2 Nega", "SAMEA10418595", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418595|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F2 Nega|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry /GFP |genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 2|organism part:olfactory bulb|sample name:E MTAB 11083:F2 Nega|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F2 Nega s", "F2 Nega s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry /GFP ", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F4-2_210715_D00404_0538_BCD91CANXX_CGATCAGT-ACTGCATA_L007_R1_001.fastq.gz", "fastq", 576184587.0, 11297737.0, "E MTAB 11083:2874F4 2 210715 D00404 0538 BCD91CANXX CGATCAGT ACTGCATA L007", "0:51 1:0", "A:151387408;C:132788210;G:130392043;T:161577529;N:39397", 51, 0, null, null, 151387408, 132788210, 130392043, 161577529, 39397, "ERX6698590", "ERS8070379", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.81999, null, 0.17082, null, 0.72196, null, 0.54505, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10275, "ERR7131131", "ERX6698589", "ERS8070378", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F2 mCherry GFP", "SAMEA10418594", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418594|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F2 mCherry GFP|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP+|genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 2|organism part:olfactory bulb|sample name:E MTAB 11083:F2 mCherry GFP|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F2 mCherry GFP s", "F2 mCherry GFP s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry+/GFP+", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F6-1_210715_D00404_0538_BCD91CANXX_CGATCAGT-CTAAGCCT_L006_R1_001.fastq.gz", "fastq", 654811032.0, 12839432.0, "E MTAB 11083:2874F6 1 210715 D00404 0538 BCD91CANXX CGATCAGT CTAAGCCT L006", "0:51 1:0", "A:177403486;C:146202733;G:142207545;T:188951373;N:45895", 51, 0, null, null, 177403486, 146202733, 142207545, 188951373, 45895, "ERX6698589", "ERS8070378", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.67854, null, 0.21407, null, 0.76104, null, 0.52713, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10276, "ERR7131132", "ERX6698589", "ERS8070378", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F2 mCherry GFP", "SAMEA10418594", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418594|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F2 mCherry GFP|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP+|genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 2|organism part:olfactory bulb|sample name:E MTAB 11083:F2 mCherry GFP|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F2 mCherry GFP s", "F2 mCherry GFP s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry+/GFP+", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F6-2_210715_D00404_0538_BCD91CANXX_CGATCAGT-CTAAGCCT_L007_R1_001.fastq.gz", "fastq", 656911926.0, 12880626.0, "E MTAB 11083:2874F6 2 210715 D00404 0538 BCD91CANXX CGATCAGT CTAAGCCT L007", "0:51 1:0", "A:178119212;C:146730132;G:142725348;T:189293212;N:44022", 51, 0, null, null, 178119212, 146730132, 142725348, 189293212, 44022, "ERX6698589", "ERS8070378", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.68162, null, 0.21431, null, 0.761, null, 0.5071, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10277, "ERR7131129", "ERX6698588", "ERS8070377", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F2 mCherry", "SAMEA10418593", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418593|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F2 mCherry|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP |genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 2|organism part:olfactory bulb|sample name:E MTAB 11083:F2 mCherry|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F2 mCherry s", "F2 mCherry s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry+/GFP ", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F5-1_210715_D00404_0538_BCD91CANXX_CGATCAGT-AAGGAGTA_L006_R1_001.fastq.gz", "fastq", 607851558.0, 11918658.0, "E MTAB 11083:2874F5 1 210715 D00404 0538 BCD91CANXX CGATCAGT AAGGAGTA L006", "0:51 1:0", "A:164814138;C:136071648;G:132945950;T:173976881;N:42941", 51, 0, null, null, 164814138, 136071648, 132945950, 173976881, 42941, "ERX6698588", "ERS8070377", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.78967, null, 0.18905, null, 0.73241, null, 0.52347, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10278, "ERR7131130", "ERX6698588", "ERS8070377", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F2 mCherry", "SAMEA10418593", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418593|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F2 mCherry|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP |genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 2|organism part:olfactory bulb|sample name:E MTAB 11083:F2 mCherry|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F2 mCherry s", "F2 mCherry s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry+/GFP ", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F5-2_210715_D00404_0538_BCD91CANXX_CGATCAGT-AAGGAGTA_L007_R1_001.fastq.gz", "fastq", 610931805.0, 11979055.0, "E MTAB 11083:2874F5 2 210715 D00404 0538 BCD91CANXX CGATCAGT AAGGAGTA L007", "0:51 1:0", "A:165714775;C:136822925;G:133684294;T:174667814;N:41997", 51, 0, null, null, 165714775, 136822925, 133684294, 174667814, 41997, "ERX6698588", "ERS8070377", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.78869, null, 0.18885, null, 0.73156, null, 0.51691, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10279, "ERR7131127", "ERX6698587", "ERS8070376", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F1 Nega", "SAMEA10418592", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418592|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F1 Nega|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry /GFP |genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 1|organism part:olfactory bulb|sample name:E MTAB 11083:F1 Nega|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F1 Nega s", "F1 Nega s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry /GFP ", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F1-1_210715_D00404_0538_BCD91CANXX_CGATCAGT-CTCTCTAT_L006_R1_001.fastq.gz", "fastq", 619561872.0, 12148272.0, "E MTAB 11083:2874F1 1 210715 D00404 0538 BCD91CANXX CGATCAGT CTCTCTAT L006", "0:51 1:0", "A:164385545;C:141746313;G:138163219;T:175223323;N:43472", 51, 0, null, null, 164385545, 141746313, 138163219, 175223323, 43472, "ERX6698587", "ERS8070376", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.80258, null, 0.17703, null, 0.72614, null, 0.53483, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10280, "ERR7131128", "ERX6698587", "ERS8070376", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F1 Nega", "SAMEA10418592", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418592|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F1 Nega|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry /GFP |genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 1|organism part:olfactory bulb|sample name:E MTAB 11083:F1 Nega|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F1 Nega s", "F1 Nega s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry /GFP ", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F1-2_210715_D00404_0538_BCD91CANXX_CGATCAGT-CTCTCTAT_L007_R1_001.fastq.gz", "fastq", 621481971.0, 12185921.0, "E MTAB 11083:2874F1 2 210715 D00404 0538 BCD91CANXX CGATCAGT CTCTCTAT L007", "0:51 1:0", "A:165030774;C:142231469;G:138651078;T:175527080;N:41570", 51, 0, null, null, 165030774, 142231469, 138651078, 175527080, 41570, "ERX6698587", "ERS8070376", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.80248, null, 0.17699, null, 0.726, null, 0.53711, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10281, "ERR7131125", "ERX6698586", "ERS8070375", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F1 mCherry GFP", "SAMEA10418591", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418591|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F1 mCherry GFP|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP+|genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 1|organism part:olfactory bulb|sample name:E MTAB 11083:F1 mCherry GFP|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F1 mCherry GFP s", "F1 mCherry GFP s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry+/GFP+", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F3-1_210715_D00404_0538_BCD91CANXX_CGATCAGT-GTAAGGAG_L006_R1_001.fastq.gz", "fastq", 651189369.0, 12768419.0, "E MTAB 11083:2874F3 1 210715 D00404 0538 BCD91CANXX CGATCAGT GTAAGGAG L006", "0:51 1:0", "A:176398415;C:145659111;G:142137610;T:186948280;N:45953", 51, 0, null, null, 176398415, 145659111, 142137610, 186948280, 45953, "ERX6698586", "ERS8070375", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.69561, null, 0.18489, null, 0.75345, null, 0.52316, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10282, "ERR7131126", "ERX6698586", "ERS8070375", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F1 mCherry GFP", "SAMEA10418591", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418591|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F1 mCherry GFP|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP+|genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 1|organism part:olfactory bulb|sample name:E MTAB 11083:F1 mCherry GFP|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F1 mCherry GFP s", "F1 mCherry GFP s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry+/GFP+", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F3-2_210715_D00404_0538_BCD91CANXX_CGATCAGT-GTAAGGAG_L007_R1_001.fastq.gz", "fastq", 653398944.0, 12811744.0, "E MTAB 11083:2874F3 2 210715 D00404 0538 BCD91CANXX CGATCAGT GTAAGGAG L007", "0:51 1:0", "A:177139734;C:146171766;G:142707146;T:187335475;N:44823", 51, 0, null, null, 177139734, 146171766, 142707146, 187335475, 44823, "ERX6698586", "ERS8070375", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.69496, null, 0.18414, null, 0.75375, null, 0.52317, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10283, "ERR7131123", "ERX6698585", "ERS8070374", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F1 mCherry", "SAMEA10418590", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418590|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F1 mCherry|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP |genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 1|organism part:olfactory bulb|sample name:E MTAB 11083:F1 mCherry|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F1 mCherry s", "F1 mCherry s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry+/GFP ", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F2-1_210715_D00404_0538_BCD91CANXX_CGATCAGT-TATCCTCT_L006_R1_001.fastq.gz", "fastq", 613574319.0, 12030869.0, "E MTAB 11083:2874F2 1 210715 D00404 0538 BCD91CANXX CGATCAGT TATCCTCT L006", "0:51 1:0", "A:164891629;C:138401759;G:135818073;T:174419828;N:43030", 51, 0, null, null, 164891629, 138401759, 135818073, 174419828, 43030, "ERX6698585", "ERS8070374", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.79499, null, 0.21674, null, 0.73359, null, 0.52207, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [10284, "ERR7131124", "ERX6698585", "ERS8070374", "ERP132560", "PRJEB48218", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E-MTAB-11083", "Transcriptome Analysis", "To investigate the effects of rabies infection on neuronal gene expression  we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", null, "Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "F1 mCherry", "SAMEA10418590", "Friedrich Miescher Institute for Biomedical Research", "ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418590|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F1 mCherry|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP |genotype:Tg[gad1b:Gal4  UAS:TVA mCherry]|individual:pool 1|organism part:olfactory bulb|sample name:E MTAB 11083:F1 mCherry|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "E MTAB 11083:F1 mCherry s", "F1 mCherry s", "Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4  UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards  olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes  cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen  cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al  Nature protocol 2014  with the following modifications: For cDNA pre amplification  up to 10ng of RNA was used as input typically 1 3ng  and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific   50C for 10min  80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation  using in house purified Tn5 Picelli et al  Genome Research 2014 and Illumina Nextera primers.", "Experimental Factor: fraction:mCherry+/GFP ", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP132560", "Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb", "ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07", "2874F2-2_210715_D00404_0538_BCD91CANXX_CGATCAGT-TATCCTCT_L007_R1_001.fastq.gz", "fastq", 615666798.0, 12071898.0, "E MTAB 11083:2874F2 2 210715 D00404 0538 BCD91CANXX CGATCAGT TATCCTCT L007", "0:51 1:0", "A:165536502;C:138952758;G:136375193;T:174760659;N:41686", 51, 0, null, null, 165536502, 138952758, 136375193, 174760659, 41686, "ERX6698585", "ERS8070374", "ERA6757553", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", "Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive", 1, 0.7941, null, 0.21645, null, 0.73494, null, 0.50761, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Switzerland", "2021-12-01", "Adult", "Adult", "Brain", "Nervous System"], [24927, "SRR25557778", "SRX21286665", "SRS18536778", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant XI", "GSM7688794", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688794", "GSM7688794: Morphant XI; Danio rerio; RNA Seq", "GSM7688794 r1", "GSM7688794", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-XI_S7_L001_R1_001.fastq.gz", "fastq", 420092501.0, 5668059.0, "GSM7688794 r1", "0:74.12", "A:113006440;C:96725832;G:99320773;T:110915967;N:123489", 74, null, null, null, 113006440, 96725832, 99320773, 110915967, 123489, "SRX21286665", "SRS18536778", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94757, null, 0.06229, null, 0.72364, null, 0.46676, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24928, "SRR25557779", "SRX21286665", "SRS18536778", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant XI", "GSM7688794", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688794", "GSM7688794: Morphant XI; Danio rerio; RNA Seq", "GSM7688794 r1", "GSM7688794", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-XI_S7_L002_R1_001.fastq.gz", "fastq", 421869780.0, 5690053.0, "GSM7688794 r2", "0:74.14", "A:113530489;C:97144227;G:99697959;T:111388539;N:108566", 74, null, null, null, 113530489, 97144227, 99697959, 111388539, 108566, "SRX21286665", "SRS18536778", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94921, null, 0.06226, null, 0.72462, null, 0.4738, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24929, "SRR25557780", "SRX21286665", "SRS18536778", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant XI", "GSM7688794", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688794", "GSM7688794: Morphant XI; Danio rerio; RNA Seq", "GSM7688794 r1", "GSM7688794", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-XI_S7_L003_R1_001.fastq.gz", "fastq", 425064659.0, 5734041.0, "GSM7688794 r3", "0:74.13", "A:114342253;C:97873100;G:100532599;T:112196433;N:120274", 74, null, null, null, 114342253, 97873100, 100532599, 112196433, 120274, "SRX21286665", "SRS18536778", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94886, null, 0.06112, null, 0.72425, null, 0.47055, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24930, "SRR25557781", "SRX21286665", "SRS18536778", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant XI", "GSM7688794", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688794", "GSM7688794: Morphant XI; Danio rerio; RNA Seq", "GSM7688794 r1", "GSM7688794", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-XI_S7_L004_R1_001.fastq.gz", "fastq", 416990548.0, 5624902.0, "GSM7688794 r4", "0:74.13", "A:112153356;C:96009158;G:98613145;T:110097476;N:117413", 74, null, null, null, 112153356, 96009158, 98613145, 110097476, 117413, "SRX21286665", "SRS18536778", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94869, null, 0.06229, null, 0.72506, null, 0.47222, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24931, "SRR25557782", "SRX21286664", "SRS18536777", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant X", "GSM7688793", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688793", "GSM7688793: Morphant X; Danio rerio; RNA Seq", "GSM7688793 r1", "GSM7688793", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-X_S6_L001_R1_001.fastq.gz", "fastq", 434485284.0, 5881416.0, "GSM7688793 r1", "0:73.87", "A:116640351;C:100176557;G:102659919;T:114799536;N:208921", 73, null, null, null, 116640351, 100176557, 102659919, 114799536, 208921, "SRX21286664", "SRS18536777", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94533, null, 0.07176, null, 0.72464, null, 0.47632, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24932, "SRR25557783", "SRX21286664", "SRS18536777", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant X", "GSM7688793", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688793", "GSM7688793: Morphant X; Danio rerio; RNA Seq", "GSM7688793 r1", "GSM7688793", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-X_S6_L002_R1_001.fastq.gz", "fastq", 435203869.0, 5886556.0, "GSM7688793 r2", "0:73.93", "A:116869356;C:100363580;G:102830644;T:114973504;N:166785", 73, null, null, null, 116869356, 100363580, 102830644, 114973504, 166785, "SRX21286664", "SRS18536777", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94542, null, 0.07203, null, 0.72421, null, 0.47733, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24933, "SRR25557784", "SRX21286664", "SRS18536777", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant X", "GSM7688793", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688793", "GSM7688793: Morphant X; Danio rerio; RNA Seq", "GSM7688793 r1", "GSM7688793", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-X_S6_L003_R1_001.fastq.gz", "fastq", 439897269.0, 5951878.0, "GSM7688793 r3", "0:73.91", "A:118101648;C:101426657;G:103990006;T:116184480;N:194478", 73, null, null, null, 118101648, 101426657, 103990006, 116184480, 194478, "SRX21286664", "SRS18536777", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94486, null, 0.07224, null, 0.72448, null, 0.47915, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24934, "SRR25557785", "SRX21286664", "SRS18536777", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant X", "GSM7688793", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688793", "GSM7688793: Morphant X; Danio rerio; RNA Seq", "GSM7688793 r1", "GSM7688793", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-X_S6_L004_R1_001.fastq.gz", "fastq", 431385256.0, 5836029.0, "GSM7688793 r4", "0:73.92", "A:115804970;C:99459059;G:101962932;T:113975935;N:182360", 73, null, null, null, 115804970, 99459059, 101962932, 113975935, 182360, "SRX21286664", "SRS18536777", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94432, null, 0.07229, null, 0.7261, null, 0.47463, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24935, "SRR25557786", "SRX21286663", "SRS18536776", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant IX", "GSM7688792", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688792", "GSM7688792: Morphant IX; Danio rerio; RNA Seq", "GSM7688792 r1", "GSM7688792", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-IX_S16_L001_R1_001.fastq.gz", "fastq", 513309395.0, 6929648.0, "GSM7688792 r1", "0:74.07", "A:137428462;C:118688804;G:122019962;T:134991729;N:180438", 74, null, null, null, 137428462, 118688804, 122019962, 134991729, 180438, "SRX21286663", "SRS18536776", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94188, null, 0.07029, null, 0.73772, null, 0.47692, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24936, "SRR25557787", "SRX21286663", "SRS18536776", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant IX", "GSM7688792", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688792", "GSM7688792: Morphant IX; Danio rerio; RNA Seq", "GSM7688792 r1", "GSM7688792", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-IX_S16_L002_R1_001.fastq.gz", "fastq", 517356735.0, 6982196.0, "GSM7688792 r2", "0:74.10", "A:138524037;C:119650852;G:122965491;T:136056171;N:160184", 74, null, null, null, 138524037, 119650852, 122965491, 136056171, 160184, "SRX21286663", "SRS18536776", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94281, null, 0.06967, null, 0.73963, null, 0.48142, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24937, "SRR25557788", "SRX21286663", "SRS18536776", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant IX", "GSM7688792", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688792", "GSM7688792: Morphant IX; Danio rerio; RNA Seq", "GSM7688792 r1", "GSM7688792", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-IX_S16_L003_R1_001.fastq.gz", "fastq", 519422328.0, 7010631.0, "GSM7688792 r3", "0:74.09", "A:139040684;C:120128748;G:123529198;T:136551898;N:171800", 74, null, null, null, 139040684, 120128748, 123529198, 136551898, 171800, "SRX21286663", "SRS18536776", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94297, null, 0.06942, null, 0.73726, null, 0.47499, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24938, "SRR25557789", "SRX21286663", "SRS18536776", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant IX", "GSM7688792", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688792", "GSM7688792: Morphant IX; Danio rerio; RNA Seq", "GSM7688792 r1", "GSM7688792", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-IX_S16_L004_R1_001.fastq.gz", "fastq", 511640294.0, 6905748.0, "GSM7688792 r4", "0:74.09", "A:136914638;C:118302866;G:121704665;T:134543505;N:174620", 74, null, null, null, 136914638, 118302866, 121704665, 134543505, 174620, "SRX21286663", "SRS18536776", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94176, null, 0.07029, null, 0.73868, null, 0.47987, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24939, "SRR25557790", "SRX21286662", "SRS18536775", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VIII", "GSM7688791", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688791", "GSM7688791: Morphant VIII; Danio rerio; RNA Seq", "GSM7688791 r1", "GSM7688791", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VIII_S14_L001_R1_001.fastq.gz", "fastq", 429446821.0, 5803178.0, "GSM7688791 r1", "0:74.00", "A:114793535;C:99506379;G:102226914;T:112748761;N:171232", 74, null, null, null, 114793535, 99506379, 102226914, 112748761, 171232, "SRX21286662", "SRS18536775", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94175, null, 0.06669, null, 0.73673, null, 0.48179, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24940, "SRR25557791", "SRX21286662", "SRS18536775", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VIII", "GSM7688791", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688791", "GSM7688791: Morphant VIII; Danio rerio; RNA Seq", "GSM7688791 r1", "GSM7688791", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VIII_S14_L002_R1_001.fastq.gz", "fastq", 434629893.0, 5870828.0, "GSM7688791 r2", "0:74.03", "A:116216940;C:100703527;G:103463365;T:114092681;N:153380", 74, null, null, null, 116216940, 100703527, 103463365, 114092681, 153380, "SRX21286662", "SRS18536775", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94143, null, 0.0676, null, 0.73791, null, 0.48091, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24941, "SRR25557792", "SRX21286662", "SRS18536775", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VIII", "GSM7688791", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688791", "GSM7688791: Morphant VIII; Danio rerio; RNA Seq", "GSM7688791 r1", "GSM7688791", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VIII_S14_L003_R1_001.fastq.gz", "fastq", 435879881.0, 5888685.0, "GSM7688791 r3", "0:74.02", "A:116548094;C:100971153;G:103794902;T:114400770;N:164962", 74, null, null, null, 116548094, 100971153, 103794902, 114400770, 164962, "SRX21286662", "SRS18536775", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94195, null, 0.06686, null, 0.73785, null, 0.48044, null, 73, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24942, "SRR25557793", "SRX21286662", "SRS18536775", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VIII", "GSM7688791", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688791", "GSM7688791: Morphant VIII; Danio rerio; RNA Seq", "GSM7688791 r1", "GSM7688791", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VIII_S14_L004_R1_001.fastq.gz", "fastq", 429478475.0, 5801978.0, "GSM7688791 r4", "0:74.02", "A:114799280;C:99474677;G:102302775;T:112737475;N:164268", 74, null, null, null, 114799280, 99474677, 102302775, 112737475, 164268, "SRX21286662", "SRS18536775", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94118, null, 0.06706, null, 0.73892, null, 0.47732, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24943, "SRR25557794", "SRX21286661", "SRS18536774", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VII", "GSM7688790", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688790", "GSM7688790: Morphant VII; Danio rerio; RNA Seq", "GSM7688790 r1", "GSM7688790", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VII_S15_L001_R1_001.fastq.gz", "fastq", 459545188.0, 6215897.0, "GSM7688790 r1", "0:73.93", "A:121926568;C:107379723;G:110263606;T:119766429;N:208862", 73, null, null, null, 121926568, 107379723, 110263606, 119766429, 208862, "SRX21286661", "SRS18536774", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94273, null, 0.06072, null, 0.74582, null, 0.47499, null, 73, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24944, "SRR25557795", "SRX21286661", "SRS18536774", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VII", "GSM7688790", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688790", "GSM7688790: Morphant VII; Danio rerio; RNA Seq", "GSM7688790 r1", "GSM7688790", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VII_S15_L002_R1_001.fastq.gz", "fastq", 463143624.0, 6261406.0, "GSM7688790 r2", "0:73.97", "A:122917997;C:108229793;G:111099867;T:120713978;N:181989", 73, null, null, null, 122917997, 108229793, 111099867, 120713978, 181989, "SRX21286661", "SRS18536774", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94387, null, 0.06093, null, 0.74341, null, 0.47351, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24945, "SRR25557796", "SRX21286661", "SRS18536774", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VII", "GSM7688790", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688790", "GSM7688790: Morphant VII; Danio rerio; RNA Seq", "GSM7688790 r1", "GSM7688790", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VII_S15_L003_R1_001.fastq.gz", "fastq", 465959664.0, 6300929.0, "GSM7688790 r3", "0:73.95", "A:123689364;C:108847593;G:111847868;T:121377463;N:197376", 73, null, null, null, 123689364, 108847593, 111847868, 121377463, 197376, "SRX21286661", "SRS18536774", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94322, null, 0.06219, null, 0.74357, null, 0.47977, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24946, "SRR25557797", "SRX21286661", "SRS18536774", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VII", "GSM7688790", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688790", "GSM7688790: Morphant VII; Danio rerio; RNA Seq", "GSM7688790 r1", "GSM7688790", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VII_S15_L004_R1_001.fastq.gz", "fastq", 459075430.0, 6207363.0, "GSM7688790 r4", "0:73.96", "A:121797426;C:107221116;G:110209684;T:119657308;N:189896", 73, null, null, null, 121797426, 107221116, 110209684, 119657308, 189896, "SRX21286661", "SRS18536774", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94313, null, 0.06211, null, 0.74343, null, 0.47801, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24947, "SRR25557798", "SRX21286660", "SRS18536773", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control XI", "GSM7688787", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688787", "GSM7688787: Control XI; Danio rerio; RNA Seq", "GSM7688787 r1", "GSM7688787", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-XI_S2_L001_R1_001.fastq.gz", "fastq", 439719566.0, 5947052.0, "GSM7688787 r1", "0:73.94", "A:117482073;C:102083665;G:104685444;T:115272860;N:195524", 73, null, null, null, 117482073, 102083665, 104685444, 115272860, 195524, "SRX21286660", "SRS18536773", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94829, null, 0.06278, null, 0.72525, null, 0.46494, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24948, "SRR25557799", "SRX21286660", "SRS18536773", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control XI", "GSM7688787", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688787", "GSM7688787: Control XI; Danio rerio; RNA Seq", "GSM7688787 r1", "GSM7688787", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-XI_S2_L002_R1_001.fastq.gz", "fastq", 438533503.0, 5927990.0, "GSM7688787 r2", "0:73.98", "A:117199594;C:101810881;G:104402169;T:114946611;N:174248", 73, null, null, null, 117199594, 101810881, 104402169, 114946611, 174248, "SRX21286660", "SRS18536773", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94887, null, 0.06387, null, 0.72827, null, 0.46616, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24949, "SRR25557800", "SRX21286660", "SRS18536773", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control XI", "GSM7688787", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688787", "GSM7688787: Control XI; Danio rerio; RNA Seq", "GSM7688787 r1", "GSM7688787", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-XI_S2_L003_R1_001.fastq.gz", "fastq", 443995554.0, 6003540.0, "GSM7688787 r3", "0:73.96", "A:118663936;C:103031716;G:105723574;T:116387834;N:188494", 73, null, null, null, 118663936, 103031716, 105723574, 116387834, 188494, "SRX21286660", "SRS18536773", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94788, null, 0.06232, null, 0.72693, null, 0.46653, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24950, "SRR25557801", "SRX21286660", "SRS18536773", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control XI", "GSM7688787", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688787", "GSM7688787: Control XI; Danio rerio; RNA Seq", "GSM7688787 r1", "GSM7688787", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-XI_S2_L004_R1_001.fastq.gz", "fastq", 435088869.0, 5882642.0, "GSM7688787 r4", "0:73.96", "A:116261447;C:100986653;G:103615584;T:114042354;N:182831", 73, null, null, null, 116261447, 100986653, 103615584, 114042354, 182831, "SRX21286660", "SRS18536773", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94914, null, 0.06241, null, 0.72829, null, 0.4546, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24951, "SRR25557802", "SRX21286659", "SRS18536772", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control X", "GSM7688785", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688785", "GSM7688785: Control X; Danio rerio; RNA Seq", "GSM7688785 r1", "GSM7688785", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-X_S1_L001_R1_001.fastq.gz", "fastq", 395130702.0, 5338263.0, "GSM7688785 r1", "0:74.02", "A:107005793;C:90183031;G:92316770;T:105476481;N:148627", 74, null, null, null, 107005793, 90183031, 92316770, 105476481, 148627, "SRX21286659", "SRS18536772", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94534, null, 0.07625, null, 0.73888, null, 0.48135, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24952, "SRR25557803", "SRX21286659", "SRS18536772", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control X", "GSM7688785", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688785", "GSM7688785: Control X; Danio rerio; RNA Seq", "GSM7688785 r1", "GSM7688785", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-X_S1_L002_R1_001.fastq.gz", "fastq", 396764458.0, 5358448.0, "GSM7688785 r2", "0:74.04", "A:107513717;C:90540282;G:92658504;T:105917444;N:134511", 74, null, null, null, 107513717, 90540282, 92658504, 105917444, 134511, "SRX21286659", "SRS18536772", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94374, null, 0.07709, null, 0.73878, null, 0.47615, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24953, "SRR25557804", "SRX21286659", "SRS18536772", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control X", "GSM7688785", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688785", "GSM7688785: Control X; Danio rerio; RNA Seq", "GSM7688785 r1", "GSM7688785", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-X_S1_L003_R1_001.fastq.gz", "fastq", 399623551.0, 5397520.0, "GSM7688785 r3", "0:74.04", "A:108230540;C:91192011;G:93388052;T:106665106;N:147842", 74, null, null, null, 108230540, 91192011, 93388052, 106665106, 147842, "SRX21286659", "SRS18536772", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94399, null, 0.07657, null, 0.73797, null, 0.4794, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24954, "SRR25557805", "SRX21286659", "SRS18536772", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control X", "GSM7688785", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688785", "GSM7688785: Control X; Danio rerio; RNA Seq", "GSM7688785 r1", "GSM7688785", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-X_S1_L004_R1_001.fastq.gz", "fastq", 393298978.0, 5312101.0, "GSM7688785 r4", "0:74.04", "A:106518845;C:89734564;G:91901232;T:105004490;N:139847", 74, null, null, null, 106518845, 89734564, 91901232, 105004490, 139847, "SRX21286659", "SRS18536772", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94423, null, 0.07599, null, 0.73884, null, 0.47905, null, 71, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24955, "SRR25557806", "SRX21286658", "SRS18536771", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control IX", "GSM7688783", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688783", "GSM7688783: Control IX; Danio rerio; RNA Seq", "GSM7688783 r1", "GSM7688783", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-IX_S22_L001_R1_001.fastq.gz", "fastq", 366045799.0, 4944832.0, "GSM7688783 r1", "0:74.03", "A:98000119;C:84654222;G:86951226;T:96295351;N:144881", 74, null, null, null, 98000119, 84654222, 86951226, 96295351, 144881, "SRX21286658", "SRS18536771", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94303, null, 0.07499, null, 0.73085, null, 0.47881, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24956, "SRR25557807", "SRX21286658", "SRS18536771", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control IX", "GSM7688783", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688783", "GSM7688783: Control IX; Danio rerio; RNA Seq", "GSM7688783 r1", "GSM7688783", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-IX_S22_L002_R1_001.fastq.gz", "fastq", 369429068.0, 4988719.0, "GSM7688783 r2", "0:74.05", "A:98907882;C:85446993;G:87729593;T:97216477;N:128123", 74, null, null, null, 98907882, 85446993, 87729593, 97216477, 128123, "SRX21286658", "SRS18536771", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94261, null, 0.07335, null, 0.72969, null, 0.47867, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24957, "SRR25557808", "SRX21286658", "SRS18536771", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control IX", "GSM7688783", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688783", "GSM7688783: Control IX; Danio rerio; RNA Seq", "GSM7688783 r1", "GSM7688783", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-IX_S22_L003_R1_001.fastq.gz", "fastq", 369967330.0, 4996710.0, "GSM7688783 r3", "0:74.04", "A:99035743;C:85549878;G:87926587;T:97310812;N:144310", 74, null, null, null, 99035743, 85549878, 87926587, 97310812, 144310, "SRX21286658", "SRS18536771", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94328, null, 0.0743, null, 0.73034, null, 0.47133, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24958, "SRR25557809", "SRX21286658", "SRS18536771", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control IX", "GSM7688783", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688783", "GSM7688783: Control IX; Danio rerio; RNA Seq", "GSM7688783 r1", "GSM7688783", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-IX_S22_L004_R1_001.fastq.gz", "fastq", 365499176.0, 4936305.0, "GSM7688783 r4", "0:74.04", "A:97825658;C:84517732;G:86863655;T:96157429;N:134702", 74, null, null, null, 97825658, 84517732, 86863655, 96157429, 134702, "SRX21286658", "SRS18536771", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94286, null, 0.07288, null, 0.72999, null, 0.4783, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24959, "SRR25557810", "SRX21286657", "SRS18536770", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VIII", "GSM7688782", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688782", "GSM7688782: Control VIII; Danio rerio; RNA Seq", "GSM7688782 r1", "GSM7688782", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VIII_S20_L001_R1_001.fastq.gz", "fastq", 488585907.0, 6585668.0, "GSM7688782 r1", "0:74.19", "A:131727468;C:112349971;G:115189425;T:129203159;N:115884", 74, null, null, null, 131727468, 112349971, 115189425, 129203159, 115884, "SRX21286657", "SRS18536770", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.93794, null, 0.07381, null, 0.7315, null, 0.47355, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24960, "SRR25557811", "SRX21286657", "SRS18536770", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VIII", "GSM7688782", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688782", "GSM7688782: Control VIII; Danio rerio; RNA Seq", "GSM7688782 r1", "GSM7688782", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VIII_S20_L002_R1_001.fastq.gz", "fastq", 493766544.0, 6653820.0, "GSM7688782 r2", "0:74.21", "A:133135166;C:113551418;G:116398455;T:130575771;N:105734", 74, null, null, null, 133135166, 113551418, 116398455, 130575771, 105734, "SRX21286657", "SRS18536770", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.93729, null, 0.07312, null, 0.7307, null, 0.47966, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24961, "SRR25557812", "SRX21286657", "SRS18536770", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VIII", "GSM7688782", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688782", "GSM7688782: Control VIII; Danio rerio; RNA Seq", "GSM7688782 r1", "GSM7688782", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VIII_S20_L003_R1_001.fastq.gz", "fastq", 494935071.0, 6670024.0, "GSM7688782 r3", "0:74.20", "A:133406912;C:113769494;G:116771560;T:130871612;N:115493", 74, null, null, null, 133406912, 113769494, 116771560, 130871612, 115493, "SRX21286657", "SRS18536770", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.93847, null, 0.07383, null, 0.73194, null, 0.47646, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24962, "SRR25557813", "SRX21286657", "SRS18536770", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VIII", "GSM7688782", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688782", "GSM7688782: Control VIII; Danio rerio; RNA Seq", "GSM7688782 r1", "GSM7688782", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VIII_S20_L004_R1_001.fastq.gz", "fastq", 487644286.0, 6572100.0, "GSM7688782 r4", "0:74.20", "A:131423055;C:112092623;G:115067911;T:128945959;N:114738", 74, null, null, null, 131423055, 112092623, 115067911, 128945959, 114738, "SRX21286657", "SRS18536770", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.93708, null, 0.0732, null, 0.73186, null, 0.4781, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24963, "SRR25557814", "SRX21286656", "SRS18536769", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VII", "GSM7688781", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688781", "GSM7688781: Control VII; Danio rerio; RNA Seq", "GSM7688781 r1", "GSM7688781", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VII_S21_L001_R1_001.fastq.gz", "fastq", 419048369.0, 5664168.0, "GSM7688781 r1", "0:73.98", "A:111569757;C:97553687;G:100228004;T:109523480;N:173441", 73, null, null, null, 111569757, 97553687, 100228004, 109523480, 173441, "SRX21286656", "SRS18536769", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94179, null, 0.06596, null, 0.74499, null, 0.46809, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24964, "SRR25557815", "SRX21286656", "SRS18536769", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VII", "GSM7688781", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688781", "GSM7688781: Control VII; Danio rerio; RNA Seq", "GSM7688781 r1", "GSM7688781", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VII_S21_L002_R1_001.fastq.gz", "fastq", 422419362.0, 5707444.0, "GSM7688781 r2", "0:74.01", "A:112476977;C:98366185;G:101046586;T:110369882;N:159732", 74, null, null, null, 112476977, 98366185, 101046586, 110369882, 159732, "SRX21286656", "SRS18536769", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94275, null, 0.06539, null, 0.74523, null, 0.47247, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24965, "SRR25557816", "SRX21286656", "SRS18536769", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VII", "GSM7688781", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688781", "GSM7688781: Control VII; Danio rerio; RNA Seq", "GSM7688781 r1", "GSM7688781", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VII_S21_L003_R1_001.fastq.gz", "fastq", 424260551.0, 5733133.0, "GSM7688781 r3", "0:74.00", "A:112957538;C:98789480;G:101496747;T:110850186;N:166600", 74, null, null, null, 112957538, 98789480, 101496747, 110850186, 166600, "SRX21286656", "SRS18536769", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94174, null, 0.06482, null, 0.74304, null, 0.46935, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24966, "SRR25557817", "SRX21286656", "SRS18536769", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VII", "GSM7688781", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688781", "GSM7688781: Control VII; Danio rerio; RNA Seq", "GSM7688781 r1", "GSM7688781", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VII_S21_L004_R1_001.fastq.gz", "fastq", 417875320.0, 5646817.0, "GSM7688781 r4", "0:74.00", "A:111226895;C:97273168;G:100030641;T:109182520;N:162096", 74, null, null, null, 111226895, 97273168, 100030641, 109182520, 162096, "SRX21286656", "SRS18536769", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94352, null, 0.06524, null, 0.74442, null, 0.47095, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [29933, "SRR27592958", "SRX23261722", "SRS20163687", "SRP484215", "PRJNA1065838", "Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations", "GSE253405", "Transcriptome Analysis", "Hundreds of human mutations are linked to autism and related disorders  yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages  as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa  defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing  we further defined molecular drivers of the observed phenotypes  identifying targetable disruptions in neuropeptide signaling  neuronal maturation  and cell proliferation. This multi modal screen has nominated brain regions  cell types  and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism  which were generated using CRISPR/Cas9 mutagenesis.", null, null, null, "arid1b  adult  rep15", "GSM8020230", null, "source name:single dissected adult brain  male|tissue:single dissected adult brain  male|genotype:arid1b homozygous|geo loc name:missing|collection date:missing", "arid1b  adult  rep15", "Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR  in this record  were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.", "single dissected adult brain  male", null, "RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02  with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2  followed by Nextera XT Library Preparation FC 131 1096.", null, "tissue:single dissected adult brain  male|genotype:arid1b homozygous", "GSM8020230", "GSM8020230: arid1b  adult  rep15; Danio rerio; RNA Seq", "GSM8020230 r1", "GSM8020230", "1", "RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02  with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2  followed by Nextera XT Library Preparation FC 131 1096.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP484215", null, "loader:fastq load.py", "arid1b-adult-set2-hom_A8_S20_R1_001.fastq.gz", "fastq", 4265635010.0, 42234010.0, "GSM8020230 r1", "0:101", "A:1152569190;C:1002056793;G:969860357;T:1141141715;N:6955", 101, null, null, null, 1152569190, 1002056793, 969860357, 1141141715, 6955, "SRX23261722", "SRS20163687", "SRA1787174", "UMass Chan Medical School", "UMass Chan Medical School", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2024-01-16", "Adult", "Adult", "Brain", "Nervous System"], [29934, "SRR27592959", "SRX23261721", "SRS20163686", "SRP484215", "PRJNA1065838", "Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations", "GSE253405", "Transcriptome Analysis", "Hundreds of human mutations are linked to autism and related disorders  yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages  as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa  defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing  we further defined molecular drivers of the observed phenotypes  identifying targetable disruptions in neuropeptide signaling  neuronal maturation  and cell proliferation. This multi modal screen has nominated brain regions  cell types  and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism  which were generated using CRISPR/Cas9 mutagenesis.", null, null, null, "arid1b  adult  rep14", "GSM8020229", null, "source name:single dissected adult brain  male|tissue:single dissected adult brain  male|genotype:arid1b homozygous|geo loc name:missing|collection date:missing", "arid1b  adult  rep14", "Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR  in this record  were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.", "single dissected adult brain  male", null, "RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02  with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2  followed by Nextera XT Library Preparation FC 131 1096.", null, "tissue:single dissected adult brain  male|genotype:arid1b homozygous", "GSM8020229", "GSM8020229: arid1b  adult  rep14; Danio rerio; RNA Seq", "GSM8020229 r1", "GSM8020229", "1", "RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02  with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2  followed by Nextera XT Library Preparation FC 131 1096.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP484215", null, "loader:fastq load.py", "arid1b-adult-set2-hom_A6_S18_R1_001.fastq.gz", "fastq", 1422969608.0, 14088808.0, "GSM8020229 r1", "0:101", "A:389767872;C:327820009;G:327097969;T:378282090;N:1668", 101, null, null, null, 389767872, 327820009, 327097969, 378282090, 1668, "SRX23261721", "SRS20163686", "SRA1787174", "UMass Chan Medical School", "UMass Chan Medical School", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2024-01-16", "Adult", "Adult", "Brain", "Nervous System"], [29935, "SRR27592960", "SRX23261720", "SRS20163685", "SRP484215", "PRJNA1065838", "Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations", "GSE253405", "Transcriptome Analysis", "Hundreds of human mutations are linked to autism and related disorders  yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages  as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa  defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing  we further defined molecular drivers of the observed phenotypes  identifying targetable disruptions in neuropeptide signaling  neuronal maturation  and cell proliferation. This multi modal screen has nominated brain regions  cell types  and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism  which were generated using CRISPR/Cas9 mutagenesis.", null, null, null, "arid1b  adult  rep13", "GSM8020228", null, "source name:single dissected adult brain  male|tissue:single dissected adult brain  male|genotype:arid1b homozygous|geo loc name:missing|collection date:missing", "arid1b  adult  rep13", "Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR  in this record  were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.", "single dissected adult brain  male", null, "RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02  with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2  followed by Nextera XT Library Preparation FC 131 1096.", null, "tissue:single dissected adult brain  male|genotype:arid1b homozygous", "GSM8020228", "GSM8020228: arid1b  adult  rep13; Danio rerio; RNA Seq", "GSM8020228 r1", "GSM8020228", "1", "RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02  with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2  followed by Nextera XT Library Preparation FC 131 1096.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP484215", null, "loader:fastq load.py", "arid1b-adult-set2-hom_A4_S16_R1_001.fastq.gz", "fastq", 4331217239.0, 42883339.0, "GSM8020228 r1", "0:101", "A:1169654932;C:1016829715;G:986390612;T:1158335000;N:6980", 101, null, null, null, 1169654932, 1016829715, 986390612, 1158335000, 6980, "SRX23261720", "SRS20163685", "SRA1787174", "UMass Chan Medical School", "UMass Chan Medical School", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2024-01-16", "Adult", "Adult", "Brain", "Nervous System"], [29936, "SRR27592961", "SRX23261719", "SRS20163684", "SRP484215", "PRJNA1065838", "Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations", "GSE253405", "Transcriptome Analysis", "Hundreds of human mutations are linked to autism and related disorders  yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages  as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa  defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing  we further defined molecular drivers of the observed phenotypes  identifying targetable disruptions in neuropeptide signaling  neuronal maturation  and cell proliferation. This multi modal screen has nominated brain regions  cell types  and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism  which were generated using CRISPR/Cas9 mutagenesis.", null, null, null, "arid1b  adult  rep12", "GSM8020227", null, "source name:single dissected adult brain  male|tissue:single dissected adult brain  male|genotype:arid1b homozygous|geo loc name:missing|collection date:missing", "arid1b  adult  rep12", "Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR  in this record  were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.", "single dissected adult brain  male", null, "RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02  with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2  followed by Nextera XT Library Preparation FC 131 1096.", null, "tissue:single dissected adult brain  male|genotype:arid1b homozygous", "GSM8020227", "GSM8020227: arid1b  adult  rep12; Danio rerio; RNA Seq", "GSM8020227 r1", "GSM8020227", "1", "RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02  with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2  followed by Nextera XT Library Preparation FC 131 1096.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP484215", null, "loader:fastq load.py", "arid1b-adult-set2-hom_A2_S14_R1_001.fastq.gz", "fastq", 820969107.0, 8128407.0, "GSM8020227 r1", "0:101", "A:229523100;C:185511734;G:179068656;T:226864374;N:1243", 101, null, null, null, 229523100, 185511734, 179068656, 226864374, 1243, "SRX23261719", "SRS20163684", "SRA1787174", "UMass Chan Medical School", "UMass Chan Medical School", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2024-01-16", "Adult", "Adult", "Brain", "Nervous System"], [29937, "SRR27592962", "SRX23261718", "SRS20163683", "SRP484215", "PRJNA1065838", "Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations", "GSE253405", "Transcriptome Analysis", "Hundreds of human mutations are linked to autism and related disorders  yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages  as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa  defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing  we further defined molecular drivers of the observed phenotypes  identifying targetable disruptions in neuropeptide signaling  neuronal maturation  and cell proliferation. This multi modal screen has nominated brain regions  cell types  and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism  which were generated using CRISPR/Cas9 mutagenesis.", null, null, null, "arid1b  adult  rep11", "GSM8020226", null, "source name:single dissected adult brain  male|tissue:single dissected adult brain  male|genotype:arid1b heterozygous|geo loc name:missing|collection date:missing", "arid1b  adult  rep11", "Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR  in this record  were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.", "single dissected adult brain  male", null, "RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02  with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2  followed by Nextera XT Library Preparation FC 131 1096.", null, "tissue:single dissected adult brain  male|genotype:arid1b heterozygous", "GSM8020226", "GSM8020226: arid1b  adult  rep11; Danio rerio; RNA Seq", "GSM8020226 r1", "GSM8020226", "1", "RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02  with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2  followed by Nextera XT Library Preparation FC 131 1096.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP484215", null, "loader:fastq load.py", "arid1b-adult-set2-het_A7_S19_R1_001.fastq.gz", "fastq", 3609957150.0, 35742150.0, "GSM8020226 r1", "0:101", "A:997333826;C:818355353;G:803362992;T:990899286;N:5693", 101, null, null, null, 997333826, 818355353, 803362992, 990899286, 5693, "SRX23261718", "SRS20163683", "SRA1787174", "UMass Chan Medical School", "UMass Chan Medical School", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2024-01-16", "Adult", "Adult", "Brain", "Nervous System"], [29938, "SRR27592963", "SRX23261717", "SRS20163682", "SRP484215", "PRJNA1065838", "Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations", "GSE253405", "Transcriptome Analysis", "Hundreds of human mutations are linked to autism and related disorders  yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages  as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa  defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing  we further defined molecular drivers of the observed phenotypes  identifying targetable disruptions in neuropeptide signaling  neuronal maturation  and cell proliferation. This multi modal screen has nominated brain regions  cell types  and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism  which were generated using CRISPR/Cas9 mutagenesis.", null, null, null, "arid1b  adult  rep10", "GSM8020225", null, "source name:single dissected adult brain  male|tissue:single dissected adult brain  male|genotype:arid1b heterozygous|geo loc name:missing|collection date:missing", "arid1b  adult  rep10", "Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR  in this record  were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.", "single dissected adult brain  male", null, "RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02  with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2  followed by Nextera XT Library Preparation FC 131 1096.", null, "tissue:single dissected adult brain  male|genotype:arid1b heterozygous", "GSM8020225", "GSM8020225: arid1b  adult  rep10; Danio rerio; RNA Seq", "GSM8020225 r1", "GSM8020225", "1", "RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02  with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2  followed by Nextera XT Library Preparation FC 131 1096.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP484215", null, "loader:fastq load.py", "arid1b-adult-set2-het_A5_S17_R1_001.fastq.gz", "fastq", 3177521913.0, 31460613.0, "GSM8020225 r1", "0:101", "A:869322737;C:728803554;G:719191487;T:860199264;N:4871", 101, null, null, null, 869322737, 728803554, 719191487, 860199264, 4871, "SRX23261717", "SRS20163682", "SRA1787174", "UMass Chan Medical School", "UMass Chan Medical School", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2024-01-16", "Adult", "Adult", "Brain", "Nervous System"], [29939, "SRR27592964", "SRX23261716", "SRS20163681", "SRP484215", "PRJNA1065838", "Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations", "GSE253405", "Transcriptome Analysis", "Hundreds of human mutations are linked to autism and related disorders  yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages  as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa  defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing  we further defined molecular drivers of the observed phenotypes  identifying targetable disruptions in neuropeptide signaling  neuronal maturation  and cell proliferation. This multi modal screen has nominated brain regions  cell types  and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism  which were generated using CRISPR/Cas9 mutagenesis.", null, null, null, "arid1b  adult  rep9", "GSM8020224", null, "source name:single dissected adult brain  male|tissue:single dissected adult brain  male|genotype:arid1b heterozygous|geo loc name:missing|collection date:missing", "arid1b  adult  rep9", "Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR  in this record  were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.", "single dissected adult brain  male", null, "RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02  with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2  followed by Nextera XT Library Preparation FC 131 1096.", null, "tissue:single dissected adult brain  male|genotype:arid1b heterozygous", "GSM8020224", "GSM8020224: arid1b  adult  rep9; Danio rerio; RNA Seq", "GSM8020224 r1", "GSM8020224", "1", "RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02  with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2  followed by Nextera XT Library Preparation FC 131 1096.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP484215", null, "loader:fastq load.py", "arid1b-adult-set2-het_A3_S15_R1_001.fastq.gz", "fastq", 3681640688.0, 36451888.0, "GSM8020224 r1", "0:101", "A:972550652;C:881056608;G:858084187;T:969943492;N:5749", 101, null, null, null, 972550652, 881056608, 858084187, 969943492, 5749, "SRX23261716", "SRS20163681", "SRA1787174", "UMass Chan Medical School", "UMass Chan Medical School", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2024-01-16", "Adult", "Adult", "Brain", "Nervous System"], [29940, "SRR27592965", "SRX23261715", "SRS20163679", "SRP484215", "PRJNA1065838", "Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations", "GSE253405", "Transcriptome Analysis", "Hundreds of human mutations are linked to autism and related disorders  yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages  as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa  defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing  we further defined molecular drivers of the observed phenotypes  identifying targetable disruptions in neuropeptide signaling  neuronal maturation  and cell proliferation. This multi modal screen has nominated brain regions  cell types  and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism  which were generated using CRISPR/Cas9 mutagenesis.", null, null, null, "arid1b  adult  rep8", "GSM8020223", null, "source name:single dissected adult brain  male|tissue:single dissected adult brain  male|genotype:arid1b heterozygous|geo loc name:missing|collection date:missing", "arid1b  adult  rep8", "Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR  in this record  were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.", "single dissected adult brain  male", null, "RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02  with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2  followed by Nextera XT Library Preparation FC 131 1096.", null, "tissue:single dissected adult brain  male|genotype:arid1b heterozygous", "GSM8020223", "GSM8020223: arid1b  adult  rep8; Danio rerio; RNA Seq", "GSM8020223 r1", "GSM8020223", "1", "RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02  with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2  followed by Nextera XT Library Preparation FC 131 1096.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP484215", null, "loader:fastq load.py", "arid1b-adult-set2-het_A1_S13_R1_001.fastq.gz", "fastq", 2692714540.0, 26660540.0, "GSM8020223 r1", "0:101", "A:739519019;C:619307370;G:594887957;T:738995900;N:4294", 101, null, null, null, 739519019, 619307370, 594887957, 738995900, 4294, "SRX23261715", "SRS20163679", "SRA1787174", "UMass Chan Medical School", "UMass Chan Medical School", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2024-01-16", "Adult", "Adult", "Brain", "Nervous System"], [29941, "SRR27592966", "SRX23261714", "SRS20163680", "SRP484215", "PRJNA1065838", "Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations", "GSE253405", "Transcriptome Analysis", "Hundreds of human mutations are linked to autism and related disorders  yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages  as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa  defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing  we further defined molecular drivers of the observed phenotypes  identifying targetable disruptions in neuropeptide signaling  neuronal maturation  and cell proliferation. This multi modal screen has nominated brain regions  cell types  and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism  which were generated using CRISPR/Cas9 mutagenesis.", null, null, null, "arid1b  adult  rep7", "GSM8020222", null, "source name:single dissected adult brain  female|tissue:single dissected adult brain  female|genotype:arid1b homozygous|geo loc name:missing|collection date:missing", "arid1b  adult  rep7", "Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR  in this record  were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.", "single dissected adult brain  female", null, "RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02  with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2  followed by Nextera XT Library Preparation FC 131 1096.", null, "tissue:single dissected adult brain  female|genotype:arid1b homozygous", "GSM8020222", "GSM8020222: arid1b  adult  rep7; Danio rerio; RNA Seq", "GSM8020222 r1", "GSM8020222", "1", "RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02  with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2  followed by Nextera XT Library Preparation FC 131 1096.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP484215", null, "loader:fastq load.py", "arid1b-adult-set1-hom_8_S38_R1_001.fastq.gz", "fastq", 3385303153.0, 33517853.0, "GSM8020222 r1", "0:101", "A:922612734;C:831122592;G:725118400;T:906435529;N:13898", 101, null, null, null, 922612734, 831122592, 725118400, 906435529, 13898, "SRX23261714", "SRS20163680", "SRA1787174", "UMass Chan Medical School", "UMass Chan Medical School", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2024-01-16", "Adult", "Adult", "Brain", "Nervous System"], [29942, "SRR27592967", "SRX23261713", "SRS20163678", "SRP484215", "PRJNA1065838", "Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations", "GSE253405", "Transcriptome Analysis", "Hundreds of human mutations are linked to autism and related disorders  yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages  as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa  defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing  we further defined molecular drivers of the observed phenotypes  identifying targetable disruptions in neuropeptide signaling  neuronal maturation  and cell proliferation. This multi modal screen has nominated brain regions  cell types  and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism  which were generated using CRISPR/Cas9 mutagenesis.", null, null, null, "arid1b  adult  rep6", "GSM8020221", null, "source name:single dissected adult brain  female|tissue:single dissected adult brain  female|genotype:arid1b homozygous|geo loc name:missing|collection date:missing", "arid1b  adult  rep6", "Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR  in this record  were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.", "single dissected adult brain  female", null, "RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02  with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2  followed by Nextera XT Library Preparation FC 131 1096.", null, "tissue:single dissected adult brain  female|genotype:arid1b homozygous", "GSM8020221", "GSM8020221: arid1b  adult  rep6; Danio rerio; RNA Seq", "GSM8020221 r1", "GSM8020221", "1", "RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02  with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2  followed by Nextera XT Library Preparation FC 131 1096.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP484215", null, "loader:fastq load.py", "arid1b-adult-set1-hom_6_S36_R1_001.fastq.gz", "fastq", 4453651055.0, 44095555.0, "GSM8020221 r1", "0:101", "A:1190308155;C:1078598974;G:1012348343;T:1172377706;N:17877", 101, null, null, null, 1190308155, 1078598974, 1012348343, 1172377706, 17877, "SRX23261713", "SRS20163678", "SRA1787174", "UMass Chan Medical School", "UMass Chan Medical School", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2024-01-16", "Adult", "Adult", "Brain", "Nervous System"], [29943, "SRR27592968", "SRX23261712", "SRS20163677", "SRP484215", "PRJNA1065838", "Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations", "GSE253405", "Transcriptome Analysis", "Hundreds of human mutations are linked to autism and related disorders  yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages  as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa  defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing  we further defined molecular drivers of the observed phenotypes  identifying targetable disruptions in neuropeptide signaling  neuronal maturation  and cell proliferation. This multi modal screen has nominated brain regions  cell types  and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism  which were generated using CRISPR/Cas9 mutagenesis.", null, null, null, "arid1b  adult  rep5", "GSM8020220", null, "source name:single dissected adult brain  female|tissue:single dissected adult brain  female|genotype:arid1b homozygous|geo loc name:missing|collection date:missing", "arid1b  adult  rep5", "Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR  in this record  were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.", "single dissected adult brain  female", null, "RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02  with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2  followed by Nextera XT Library Preparation FC 131 1096.", null, "tissue:single dissected adult brain  female|genotype:arid1b homozygous", "GSM8020220", "GSM8020220: arid1b  adult  rep5; Danio rerio; RNA Seq", "GSM8020220 r1", "GSM8020220", "1", "RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02  with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2  followed by Nextera XT Library Preparation FC 131 1096.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP484215", null, "loader:fastq load.py", "arid1b-adult-set1-hom_5_S35_R1_001.fastq.gz", "fastq", 3607941998.0, 35722198.0, "GSM8020220 r1", "0:101", "A:986679637;C:834475298;G:801712371;T:985059988;N:14704", 101, null, null, null, 986679637, 834475298, 801712371, 985059988, 14704, "SRX23261712", "SRS20163677", "SRA1787174", "UMass Chan Medical School", "UMass Chan Medical School", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2024-01-16", "Adult", "Adult", "Brain", "Nervous System"], [29944, "SRR27592969", "SRX23261711", "SRS20163675", "SRP484215", "PRJNA1065838", "Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations", "GSE253405", "Transcriptome Analysis", "Hundreds of human mutations are linked to autism and related disorders  yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages  as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa  defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing  we further defined molecular drivers of the observed phenotypes  identifying targetable disruptions in neuropeptide signaling  neuronal maturation  and cell proliferation. This multi modal screen has nominated brain regions  cell types  and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism  which were generated using CRISPR/Cas9 mutagenesis.", null, null, null, "arid1b  adult  rep4", "GSM8020219", null, "source name:single dissected adult brain  female|tissue:single dissected adult brain  female|genotype:arid1b heterozygous|geo loc name:missing|collection date:missing", "arid1b  adult  rep4", "Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR  in this record  were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.", "single dissected adult brain  female", null, "RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02  with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2  followed by Nextera XT Library Preparation FC 131 1096.", null, "tissue:single dissected adult brain  female|genotype:arid1b heterozygous", "GSM8020219", "GSM8020219: arid1b  adult  rep4; Danio rerio; RNA Seq", "GSM8020219 r1", "GSM8020219", "1", "RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02  with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2  followed by Nextera XT Library Preparation FC 131 1096.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP484215", null, "loader:fastq load.py", "arid1b-adult-set1-het_4_S34_R1_001.fastq.gz", "fastq", 3406563249.0, 33728349.0, "GSM8020219 r1", "0:101", "A:929693102;C:825436822;G:742465339;T:908956167;N:11819", 101, null, null, null, 929693102, 825436822, 742465339, 908956167, 11819, "SRX23261711", "SRS20163675", "SRA1787174", "UMass Chan Medical School", "UMass Chan Medical School", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2024-01-16", "Adult", "Adult", "Brain", "Nervous System"]], "truncated": false, "filtered_table_rows_count": 1900, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"experiment.library_source\" = :p0 and \"technology\" = :p1 and \"tissue_curation_coarse\" = :p2 order by rowid limit 101", "params": {"p0": "TRANSCRIPTOMIC", "p1": "smartseq", "p2": "Nervous System"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System", "results": [{"value": "RNA-Seq", "label": "RNA-Seq", "count": 1900, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System&experiment.library_strategy=RNA-Seq", "selected": false}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 1900, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?technology=smartseq&tissue_curation_coarse=Nervous+System", "selected": true}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System", "results": [{"value": "cDNA", "label": "cDNA", "count": 1846, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System&experiment.library_selection=cDNA", "selected": false}, {"value": "Oligo-dT", "label": "Oligo-dT", "count": 54, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System&experiment.library_selection=Oligo-dT", "selected": false}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System", "results": [{"value": "PAIRED", "label": "PAIRED", "count": 1315, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System&experiment.library_layout=PAIRED", "selected": false}, {"value": "SINGLE", "label": "SINGLE", "count": 585, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System&experiment.library_layout=SINGLE", "selected": false}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System", "results": [{"value": "ILLUMINA", "label": "ILLUMINA", "count": 1900, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System&experiment.platform=ILLUMINA", "selected": false}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System", "results": [{"value": "Larval", "label": "Larval", "count": 1574, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System&devstage_curation_coarse=Larval", "selected": false}, {"value": "Adult", "label": "Adult", "count": 226, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System&devstage_curation_coarse=Adult", "selected": false}, {"value": "Embryo", "label": "Embryo", "count": 55, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System&devstage_curation_coarse=Embryo", "selected": false}, {"value": "Undetermined", "label": "Undetermined", "count": 30, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System&devstage_curation_coarse=Undetermined", "selected": false}, {"value": "Juvenile", "label": "Juvenile", "count": 11, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System&devstage_curation_coarse=Juvenile", "selected": false}, {"value": "Multi-stage", "label": "Multi-stage", "count": 4, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System&devstage_curation_coarse=Multi-stage", "selected": false}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System", "results": [{"value": "Larval", "label": "Larval", "count": 1574, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System&devstage_curation=Larval", "selected": false}, {"value": "Adult", "label": "Adult", "count": 219, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System&devstage_curation=Adult", "selected": false}, {"value": "Multi-stage", "label": "Multi-stage", "count": 44, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System&devstage_curation=Multi-stage", "selected": false}, {"value": "Undetermined", "label": "Undetermined", "count": 37, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System&devstage_curation=Undetermined", "selected": false}, {"value": "Pharyngula", "label": "Pharyngula", "count": 12, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System&devstage_curation=Pharyngula", "selected": false}, {"value": "Juvenile", "label": "Juvenile", "count": 11, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System&devstage_curation=Juvenile", "selected": false}, {"value": "Segmentation", "label": "Segmentation", "count": 3, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System&devstage_curation=Segmentation", "selected": false}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System", "results": [{"value": "Nervous System", "label": "Nervous System", "count": 1900, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq", "selected": true}], "truncated": false}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System", "results": [{"value": "Brain", "label": "Brain", "count": 1342, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System&tissue_curation=Brain", "selected": false}, {"value": "Spinal Cord", "label": "Spinal Cord", "count": 554, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System&tissue_curation=Spinal+Cord", "selected": false}, {"value": "Head", "label": "Head", "count": 4, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System&tissue_curation=Head", "selected": false}], "truncated": false}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System", "results": [{"value": "smartseq", "label": "smartseq", "count": 1900, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&tissue_curation_coarse=Nervous+System", "selected": true}], "truncated": false}}, "suggested_facets": [], "next": "29944", "next_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation_coarse=Nervous+System&_next=29944", "private": false, "allow_execute_sql": true, "query_ms": 126.41570300183957}