{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where experiment.library_source = \"TRANSCRIPTOMIC\", technology = \"smartseq\" and tissue_curation = \"Spinal Cord\"", "rows": [[24927, "SRR25557778", "SRX21286665", "SRS18536778", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant XI", "GSM7688794", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688794", "GSM7688794: Morphant XI; Danio rerio; RNA Seq", "GSM7688794 r1", "GSM7688794", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-XI_S7_L001_R1_001.fastq.gz", "fastq", 420092501.0, 5668059.0, "GSM7688794 r1", "0:74.12", "A:113006440;C:96725832;G:99320773;T:110915967;N:123489", 74, null, null, null, 113006440, 96725832, 99320773, 110915967, 123489, "SRX21286665", "SRS18536778", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94757, null, 0.06229, null, 0.72364, null, 0.46676, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24928, "SRR25557779", "SRX21286665", "SRS18536778", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant XI", "GSM7688794", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688794", "GSM7688794: Morphant XI; Danio rerio; RNA Seq", "GSM7688794 r1", "GSM7688794", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-XI_S7_L002_R1_001.fastq.gz", "fastq", 421869780.0, 5690053.0, "GSM7688794 r2", "0:74.14", "A:113530489;C:97144227;G:99697959;T:111388539;N:108566", 74, null, null, null, 113530489, 97144227, 99697959, 111388539, 108566, "SRX21286665", "SRS18536778", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94921, null, 0.06226, null, 0.72462, null, 0.4738, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24929, "SRR25557780", "SRX21286665", "SRS18536778", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant XI", "GSM7688794", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688794", "GSM7688794: Morphant XI; Danio rerio; RNA Seq", "GSM7688794 r1", "GSM7688794", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-XI_S7_L003_R1_001.fastq.gz", "fastq", 425064659.0, 5734041.0, "GSM7688794 r3", "0:74.13", "A:114342253;C:97873100;G:100532599;T:112196433;N:120274", 74, null, null, null, 114342253, 97873100, 100532599, 112196433, 120274, "SRX21286665", "SRS18536778", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94886, null, 0.06112, null, 0.72425, null, 0.47055, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24930, "SRR25557781", "SRX21286665", "SRS18536778", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant XI", "GSM7688794", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688794", "GSM7688794: Morphant XI; Danio rerio; RNA Seq", "GSM7688794 r1", "GSM7688794", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-XI_S7_L004_R1_001.fastq.gz", "fastq", 416990548.0, 5624902.0, "GSM7688794 r4", "0:74.13", "A:112153356;C:96009158;G:98613145;T:110097476;N:117413", 74, null, null, null, 112153356, 96009158, 98613145, 110097476, 117413, "SRX21286665", "SRS18536778", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94869, null, 0.06229, null, 0.72506, null, 0.47222, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24931, "SRR25557782", "SRX21286664", "SRS18536777", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant X", "GSM7688793", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688793", "GSM7688793: Morphant X; Danio rerio; RNA Seq", "GSM7688793 r1", "GSM7688793", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-X_S6_L001_R1_001.fastq.gz", "fastq", 434485284.0, 5881416.0, "GSM7688793 r1", "0:73.87", "A:116640351;C:100176557;G:102659919;T:114799536;N:208921", 73, null, null, null, 116640351, 100176557, 102659919, 114799536, 208921, "SRX21286664", "SRS18536777", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94533, null, 0.07176, null, 0.72464, null, 0.47632, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24932, "SRR25557783", "SRX21286664", "SRS18536777", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant X", "GSM7688793", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688793", "GSM7688793: Morphant X; Danio rerio; RNA Seq", "GSM7688793 r1", "GSM7688793", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-X_S6_L002_R1_001.fastq.gz", "fastq", 435203869.0, 5886556.0, "GSM7688793 r2", "0:73.93", "A:116869356;C:100363580;G:102830644;T:114973504;N:166785", 73, null, null, null, 116869356, 100363580, 102830644, 114973504, 166785, "SRX21286664", "SRS18536777", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94542, null, 0.07203, null, 0.72421, null, 0.47733, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24933, "SRR25557784", "SRX21286664", "SRS18536777", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant X", "GSM7688793", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688793", "GSM7688793: Morphant X; Danio rerio; RNA Seq", "GSM7688793 r1", "GSM7688793", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-X_S6_L003_R1_001.fastq.gz", "fastq", 439897269.0, 5951878.0, "GSM7688793 r3", "0:73.91", "A:118101648;C:101426657;G:103990006;T:116184480;N:194478", 73, null, null, null, 118101648, 101426657, 103990006, 116184480, 194478, "SRX21286664", "SRS18536777", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94486, null, 0.07224, null, 0.72448, null, 0.47915, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24934, "SRR25557785", "SRX21286664", "SRS18536777", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant X", "GSM7688793", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688793", "GSM7688793: Morphant X; Danio rerio; RNA Seq", "GSM7688793 r1", "GSM7688793", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-X_S6_L004_R1_001.fastq.gz", "fastq", 431385256.0, 5836029.0, "GSM7688793 r4", "0:73.92", "A:115804970;C:99459059;G:101962932;T:113975935;N:182360", 73, null, null, null, 115804970, 99459059, 101962932, 113975935, 182360, "SRX21286664", "SRS18536777", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94432, null, 0.07229, null, 0.7261, null, 0.47463, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24935, "SRR25557786", "SRX21286663", "SRS18536776", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant IX", "GSM7688792", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688792", "GSM7688792: Morphant IX; Danio rerio; RNA Seq", "GSM7688792 r1", "GSM7688792", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-IX_S16_L001_R1_001.fastq.gz", "fastq", 513309395.0, 6929648.0, "GSM7688792 r1", "0:74.07", "A:137428462;C:118688804;G:122019962;T:134991729;N:180438", 74, null, null, null, 137428462, 118688804, 122019962, 134991729, 180438, "SRX21286663", "SRS18536776", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94188, null, 0.07029, null, 0.73772, null, 0.47692, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24936, "SRR25557787", "SRX21286663", "SRS18536776", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant IX", "GSM7688792", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688792", "GSM7688792: Morphant IX; Danio rerio; RNA Seq", "GSM7688792 r1", "GSM7688792", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-IX_S16_L002_R1_001.fastq.gz", "fastq", 517356735.0, 6982196.0, "GSM7688792 r2", "0:74.10", "A:138524037;C:119650852;G:122965491;T:136056171;N:160184", 74, null, null, null, 138524037, 119650852, 122965491, 136056171, 160184, "SRX21286663", "SRS18536776", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94281, null, 0.06967, null, 0.73963, null, 0.48142, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24937, "SRR25557788", "SRX21286663", "SRS18536776", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant IX", "GSM7688792", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688792", "GSM7688792: Morphant IX; Danio rerio; RNA Seq", "GSM7688792 r1", "GSM7688792", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-IX_S16_L003_R1_001.fastq.gz", "fastq", 519422328.0, 7010631.0, "GSM7688792 r3", "0:74.09", "A:139040684;C:120128748;G:123529198;T:136551898;N:171800", 74, null, null, null, 139040684, 120128748, 123529198, 136551898, 171800, "SRX21286663", "SRS18536776", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94297, null, 0.06942, null, 0.73726, null, 0.47499, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24938, "SRR25557789", "SRX21286663", "SRS18536776", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant IX", "GSM7688792", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688792", "GSM7688792: Morphant IX; Danio rerio; RNA Seq", "GSM7688792 r1", "GSM7688792", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-IX_S16_L004_R1_001.fastq.gz", "fastq", 511640294.0, 6905748.0, "GSM7688792 r4", "0:74.09", "A:136914638;C:118302866;G:121704665;T:134543505;N:174620", 74, null, null, null, 136914638, 118302866, 121704665, 134543505, 174620, "SRX21286663", "SRS18536776", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94176, null, 0.07029, null, 0.73868, null, 0.47987, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24939, "SRR25557790", "SRX21286662", "SRS18536775", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VIII", "GSM7688791", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688791", "GSM7688791: Morphant VIII; Danio rerio; RNA Seq", "GSM7688791 r1", "GSM7688791", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VIII_S14_L001_R1_001.fastq.gz", "fastq", 429446821.0, 5803178.0, "GSM7688791 r1", "0:74.00", "A:114793535;C:99506379;G:102226914;T:112748761;N:171232", 74, null, null, null, 114793535, 99506379, 102226914, 112748761, 171232, "SRX21286662", "SRS18536775", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94175, null, 0.06669, null, 0.73673, null, 0.48179, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24940, "SRR25557791", "SRX21286662", "SRS18536775", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VIII", "GSM7688791", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688791", "GSM7688791: Morphant VIII; Danio rerio; RNA Seq", "GSM7688791 r1", "GSM7688791", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VIII_S14_L002_R1_001.fastq.gz", "fastq", 434629893.0, 5870828.0, "GSM7688791 r2", "0:74.03", "A:116216940;C:100703527;G:103463365;T:114092681;N:153380", 74, null, null, null, 116216940, 100703527, 103463365, 114092681, 153380, "SRX21286662", "SRS18536775", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94143, null, 0.0676, null, 0.73791, null, 0.48091, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24941, "SRR25557792", "SRX21286662", "SRS18536775", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VIII", "GSM7688791", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688791", "GSM7688791: Morphant VIII; Danio rerio; RNA Seq", "GSM7688791 r1", "GSM7688791", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VIII_S14_L003_R1_001.fastq.gz", "fastq", 435879881.0, 5888685.0, "GSM7688791 r3", "0:74.02", "A:116548094;C:100971153;G:103794902;T:114400770;N:164962", 74, null, null, null, 116548094, 100971153, 103794902, 114400770, 164962, "SRX21286662", "SRS18536775", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94195, null, 0.06686, null, 0.73785, null, 0.48044, null, 73, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24942, "SRR25557793", "SRX21286662", "SRS18536775", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VIII", "GSM7688791", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688791", "GSM7688791: Morphant VIII; Danio rerio; RNA Seq", "GSM7688791 r1", "GSM7688791", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VIII_S14_L004_R1_001.fastq.gz", "fastq", 429478475.0, 5801978.0, "GSM7688791 r4", "0:74.02", "A:114799280;C:99474677;G:102302775;T:112737475;N:164268", 74, null, null, null, 114799280, 99474677, 102302775, 112737475, 164268, "SRX21286662", "SRS18536775", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94118, null, 0.06706, null, 0.73892, null, 0.47732, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24943, "SRR25557794", "SRX21286661", "SRS18536774", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VII", "GSM7688790", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688790", "GSM7688790: Morphant VII; Danio rerio; RNA Seq", "GSM7688790 r1", "GSM7688790", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VII_S15_L001_R1_001.fastq.gz", "fastq", 459545188.0, 6215897.0, "GSM7688790 r1", "0:73.93", "A:121926568;C:107379723;G:110263606;T:119766429;N:208862", 73, null, null, null, 121926568, 107379723, 110263606, 119766429, 208862, "SRX21286661", "SRS18536774", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94273, null, 0.06072, null, 0.74582, null, 0.47499, null, 73, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24944, "SRR25557795", "SRX21286661", "SRS18536774", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VII", "GSM7688790", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688790", "GSM7688790: Morphant VII; Danio rerio; RNA Seq", "GSM7688790 r1", "GSM7688790", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VII_S15_L002_R1_001.fastq.gz", "fastq", 463143624.0, 6261406.0, "GSM7688790 r2", "0:73.97", "A:122917997;C:108229793;G:111099867;T:120713978;N:181989", 73, null, null, null, 122917997, 108229793, 111099867, 120713978, 181989, "SRX21286661", "SRS18536774", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94387, null, 0.06093, null, 0.74341, null, 0.47351, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24945, "SRR25557796", "SRX21286661", "SRS18536774", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VII", "GSM7688790", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688790", "GSM7688790: Morphant VII; Danio rerio; RNA Seq", "GSM7688790 r1", "GSM7688790", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VII_S15_L003_R1_001.fastq.gz", "fastq", 465959664.0, 6300929.0, "GSM7688790 r3", "0:73.95", "A:123689364;C:108847593;G:111847868;T:121377463;N:197376", 73, null, null, null, 123689364, 108847593, 111847868, 121377463, 197376, "SRX21286661", "SRS18536774", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94322, null, 0.06219, null, 0.74357, null, 0.47977, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24946, "SRR25557797", "SRX21286661", "SRS18536774", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VII", "GSM7688790", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688790", "GSM7688790: Morphant VII; Danio rerio; RNA Seq", "GSM7688790 r1", "GSM7688790", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VII_S15_L004_R1_001.fastq.gz", "fastq", 459075430.0, 6207363.0, "GSM7688790 r4", "0:73.96", "A:121797426;C:107221116;G:110209684;T:119657308;N:189896", 73, null, null, null, 121797426, 107221116, 110209684, 119657308, 189896, "SRX21286661", "SRS18536774", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94313, null, 0.06211, null, 0.74343, null, 0.47801, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24947, "SRR25557798", "SRX21286660", "SRS18536773", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control XI", "GSM7688787", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688787", "GSM7688787: Control XI; Danio rerio; RNA Seq", "GSM7688787 r1", "GSM7688787", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-XI_S2_L001_R1_001.fastq.gz", "fastq", 439719566.0, 5947052.0, "GSM7688787 r1", "0:73.94", "A:117482073;C:102083665;G:104685444;T:115272860;N:195524", 73, null, null, null, 117482073, 102083665, 104685444, 115272860, 195524, "SRX21286660", "SRS18536773", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94829, null, 0.06278, null, 0.72525, null, 0.46494, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24948, "SRR25557799", "SRX21286660", "SRS18536773", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control XI", "GSM7688787", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688787", "GSM7688787: Control XI; Danio rerio; RNA Seq", "GSM7688787 r1", "GSM7688787", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-XI_S2_L002_R1_001.fastq.gz", "fastq", 438533503.0, 5927990.0, "GSM7688787 r2", "0:73.98", "A:117199594;C:101810881;G:104402169;T:114946611;N:174248", 73, null, null, null, 117199594, 101810881, 104402169, 114946611, 174248, "SRX21286660", "SRS18536773", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94887, null, 0.06387, null, 0.72827, null, 0.46616, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24949, "SRR25557800", "SRX21286660", "SRS18536773", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control XI", "GSM7688787", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688787", "GSM7688787: Control XI; Danio rerio; RNA Seq", "GSM7688787 r1", "GSM7688787", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-XI_S2_L003_R1_001.fastq.gz", "fastq", 443995554.0, 6003540.0, "GSM7688787 r3", "0:73.96", "A:118663936;C:103031716;G:105723574;T:116387834;N:188494", 73, null, null, null, 118663936, 103031716, 105723574, 116387834, 188494, "SRX21286660", "SRS18536773", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94788, null, 0.06232, null, 0.72693, null, 0.46653, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24950, "SRR25557801", "SRX21286660", "SRS18536773", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control XI", "GSM7688787", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688787", "GSM7688787: Control XI; Danio rerio; RNA Seq", "GSM7688787 r1", "GSM7688787", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-XI_S2_L004_R1_001.fastq.gz", "fastq", 435088869.0, 5882642.0, "GSM7688787 r4", "0:73.96", "A:116261447;C:100986653;G:103615584;T:114042354;N:182831", 73, null, null, null, 116261447, 100986653, 103615584, 114042354, 182831, "SRX21286660", "SRS18536773", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94914, null, 0.06241, null, 0.72829, null, 0.4546, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24951, "SRR25557802", "SRX21286659", "SRS18536772", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control X", "GSM7688785", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688785", "GSM7688785: Control X; Danio rerio; RNA Seq", "GSM7688785 r1", "GSM7688785", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-X_S1_L001_R1_001.fastq.gz", "fastq", 395130702.0, 5338263.0, "GSM7688785 r1", "0:74.02", "A:107005793;C:90183031;G:92316770;T:105476481;N:148627", 74, null, null, null, 107005793, 90183031, 92316770, 105476481, 148627, "SRX21286659", "SRS18536772", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94534, null, 0.07625, null, 0.73888, null, 0.48135, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24952, "SRR25557803", "SRX21286659", "SRS18536772", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control X", "GSM7688785", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688785", "GSM7688785: Control X; Danio rerio; RNA Seq", "GSM7688785 r1", "GSM7688785", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-X_S1_L002_R1_001.fastq.gz", "fastq", 396764458.0, 5358448.0, "GSM7688785 r2", "0:74.04", "A:107513717;C:90540282;G:92658504;T:105917444;N:134511", 74, null, null, null, 107513717, 90540282, 92658504, 105917444, 134511, "SRX21286659", "SRS18536772", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94374, null, 0.07709, null, 0.73878, null, 0.47615, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24953, "SRR25557804", "SRX21286659", "SRS18536772", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control X", "GSM7688785", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688785", "GSM7688785: Control X; Danio rerio; RNA Seq", "GSM7688785 r1", "GSM7688785", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-X_S1_L003_R1_001.fastq.gz", "fastq", 399623551.0, 5397520.0, "GSM7688785 r3", "0:74.04", "A:108230540;C:91192011;G:93388052;T:106665106;N:147842", 74, null, null, null, 108230540, 91192011, 93388052, 106665106, 147842, "SRX21286659", "SRS18536772", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94399, null, 0.07657, null, 0.73797, null, 0.4794, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24954, "SRR25557805", "SRX21286659", "SRS18536772", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control X", "GSM7688785", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688785", "GSM7688785: Control X; Danio rerio; RNA Seq", "GSM7688785 r1", "GSM7688785", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-X_S1_L004_R1_001.fastq.gz", "fastq", 393298978.0, 5312101.0, "GSM7688785 r4", "0:74.04", "A:106518845;C:89734564;G:91901232;T:105004490;N:139847", 74, null, null, null, 106518845, 89734564, 91901232, 105004490, 139847, "SRX21286659", "SRS18536772", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94423, null, 0.07599, null, 0.73884, null, 0.47905, null, 71, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24955, "SRR25557806", "SRX21286658", "SRS18536771", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control IX", "GSM7688783", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688783", "GSM7688783: Control IX; Danio rerio; RNA Seq", "GSM7688783 r1", "GSM7688783", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-IX_S22_L001_R1_001.fastq.gz", "fastq", 366045799.0, 4944832.0, "GSM7688783 r1", "0:74.03", "A:98000119;C:84654222;G:86951226;T:96295351;N:144881", 74, null, null, null, 98000119, 84654222, 86951226, 96295351, 144881, "SRX21286658", "SRS18536771", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94303, null, 0.07499, null, 0.73085, null, 0.47881, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24956, "SRR25557807", "SRX21286658", "SRS18536771", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control IX", "GSM7688783", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688783", "GSM7688783: Control IX; Danio rerio; RNA Seq", "GSM7688783 r1", "GSM7688783", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-IX_S22_L002_R1_001.fastq.gz", "fastq", 369429068.0, 4988719.0, "GSM7688783 r2", "0:74.05", "A:98907882;C:85446993;G:87729593;T:97216477;N:128123", 74, null, null, null, 98907882, 85446993, 87729593, 97216477, 128123, "SRX21286658", "SRS18536771", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94261, null, 0.07335, null, 0.72969, null, 0.47867, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24957, "SRR25557808", "SRX21286658", "SRS18536771", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control IX", "GSM7688783", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688783", "GSM7688783: Control IX; Danio rerio; RNA Seq", "GSM7688783 r1", "GSM7688783", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-IX_S22_L003_R1_001.fastq.gz", "fastq", 369967330.0, 4996710.0, "GSM7688783 r3", "0:74.04", "A:99035743;C:85549878;G:87926587;T:97310812;N:144310", 74, null, null, null, 99035743, 85549878, 87926587, 97310812, 144310, "SRX21286658", "SRS18536771", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94328, null, 0.0743, null, 0.73034, null, 0.47133, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24958, "SRR25557809", "SRX21286658", "SRS18536771", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control IX", "GSM7688783", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688783", "GSM7688783: Control IX; Danio rerio; RNA Seq", "GSM7688783 r1", "GSM7688783", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-IX_S22_L004_R1_001.fastq.gz", "fastq", 365499176.0, 4936305.0, "GSM7688783 r4", "0:74.04", "A:97825658;C:84517732;G:86863655;T:96157429;N:134702", 74, null, null, null, 97825658, 84517732, 86863655, 96157429, 134702, "SRX21286658", "SRS18536771", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94286, null, 0.07288, null, 0.72999, null, 0.4783, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24959, "SRR25557810", "SRX21286657", "SRS18536770", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VIII", "GSM7688782", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688782", "GSM7688782: Control VIII; Danio rerio; RNA Seq", "GSM7688782 r1", "GSM7688782", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VIII_S20_L001_R1_001.fastq.gz", "fastq", 488585907.0, 6585668.0, "GSM7688782 r1", "0:74.19", "A:131727468;C:112349971;G:115189425;T:129203159;N:115884", 74, null, null, null, 131727468, 112349971, 115189425, 129203159, 115884, "SRX21286657", "SRS18536770", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.93794, null, 0.07381, null, 0.7315, null, 0.47355, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24960, "SRR25557811", "SRX21286657", "SRS18536770", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VIII", "GSM7688782", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688782", "GSM7688782: Control VIII; Danio rerio; RNA Seq", "GSM7688782 r1", "GSM7688782", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VIII_S20_L002_R1_001.fastq.gz", "fastq", 493766544.0, 6653820.0, "GSM7688782 r2", "0:74.21", "A:133135166;C:113551418;G:116398455;T:130575771;N:105734", 74, null, null, null, 133135166, 113551418, 116398455, 130575771, 105734, "SRX21286657", "SRS18536770", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.93729, null, 0.07312, null, 0.7307, null, 0.47966, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24961, "SRR25557812", "SRX21286657", "SRS18536770", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VIII", "GSM7688782", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688782", "GSM7688782: Control VIII; Danio rerio; RNA Seq", "GSM7688782 r1", "GSM7688782", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VIII_S20_L003_R1_001.fastq.gz", "fastq", 494935071.0, 6670024.0, "GSM7688782 r3", "0:74.20", "A:133406912;C:113769494;G:116771560;T:130871612;N:115493", 74, null, null, null, 133406912, 113769494, 116771560, 130871612, 115493, "SRX21286657", "SRS18536770", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.93847, null, 0.07383, null, 0.73194, null, 0.47646, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24962, "SRR25557813", "SRX21286657", "SRS18536770", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VIII", "GSM7688782", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688782", "GSM7688782: Control VIII; Danio rerio; RNA Seq", "GSM7688782 r1", "GSM7688782", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VIII_S20_L004_R1_001.fastq.gz", "fastq", 487644286.0, 6572100.0, "GSM7688782 r4", "0:74.20", "A:131423055;C:112092623;G:115067911;T:128945959;N:114738", 74, null, null, null, 131423055, 112092623, 115067911, 128945959, 114738, "SRX21286657", "SRS18536770", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.93708, null, 0.0732, null, 0.73186, null, 0.4781, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24963, "SRR25557814", "SRX21286656", "SRS18536769", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VII", "GSM7688781", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688781", "GSM7688781: Control VII; Danio rerio; RNA Seq", "GSM7688781 r1", "GSM7688781", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VII_S21_L001_R1_001.fastq.gz", "fastq", 419048369.0, 5664168.0, "GSM7688781 r1", "0:73.98", "A:111569757;C:97553687;G:100228004;T:109523480;N:173441", 73, null, null, null, 111569757, 97553687, 100228004, 109523480, 173441, "SRX21286656", "SRS18536769", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94179, null, 0.06596, null, 0.74499, null, 0.46809, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24964, "SRR25557815", "SRX21286656", "SRS18536769", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VII", "GSM7688781", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688781", "GSM7688781: Control VII; Danio rerio; RNA Seq", "GSM7688781 r1", "GSM7688781", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VII_S21_L002_R1_001.fastq.gz", "fastq", 422419362.0, 5707444.0, "GSM7688781 r2", "0:74.01", "A:112476977;C:98366185;G:101046586;T:110369882;N:159732", 74, null, null, null, 112476977, 98366185, 101046586, 110369882, 159732, "SRX21286656", "SRS18536769", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94275, null, 0.06539, null, 0.74523, null, 0.47247, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24965, "SRR25557816", "SRX21286656", "SRS18536769", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VII", "GSM7688781", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688781", "GSM7688781: Control VII; Danio rerio; RNA Seq", "GSM7688781 r1", "GSM7688781", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VII_S21_L003_R1_001.fastq.gz", "fastq", 424260551.0, 5733133.0, "GSM7688781 r3", "0:74.00", "A:112957538;C:98789480;G:101496747;T:110850186;N:166600", 74, null, null, null, 112957538, 98789480, 101496747, 110850186, 166600, "SRX21286656", "SRS18536769", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94174, null, 0.06482, null, 0.74304, null, 0.46935, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24966, "SRR25557817", "SRX21286656", "SRS18536769", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VII", "GSM7688781", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688781", "GSM7688781: Control VII; Danio rerio; RNA Seq", "GSM7688781 r1", "GSM7688781", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VII_S21_L004_R1_001.fastq.gz", "fastq", 417875320.0, 5646817.0, "GSM7688781 r4", "0:74.00", "A:111226895;C:97273168;G:100030641;T:109182520;N:162096", 74, null, null, null, 111226895, 97273168, 100030641, 109182520, 162096, "SRX21286656", "SRS18536769", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94352, null, 0.06524, null, 0.74442, null, 0.47095, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [61886, "SRR13074872", "SRX9521915", "SRS7729122", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 D12", "GSM4911711", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 D12", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911711", "GSM4911711: SDPL.1X 01 D12; Danio rerio; RNA Seq", "GSM4911711", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911711", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31855_Track-65510_R1.fastq.gz", "fastq", 34606372.0, 455347.0, "GSM4911711 r1", "0:76 1:0", "A:9797047;C:7514433;G:7529128;T:9765391;N:373", 76, 0, null, null, 9797047, 7514433, 7529128, 9765391, 373, "SRX9521915", "SRS7729122", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.88569, null, 0.07951, null, 0.91212, null, 0.42432, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61887, "SRR13074871", "SRX9521914", "SRS7729121", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 G10", "GSM4911710", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 G10", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911710", "GSM4911710: SDPL.1X 01 G10; Danio rerio; RNA Seq", "GSM4911710", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911710", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31846_Track-65507_R1.fastq.gz", "fastq", 40850608.0, 537508.0, "GSM4911710 r1", "0:76 1:0", "A:11503051;C:8892746;G:8924384;T:11530029;N:398", 76, 0, null, null, 11503051, 8892746, 8924384, 11530029, 398, "SRX9521914", "SRS7729121", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.87161, null, 0.06824, null, 0.94123, null, 0.43306, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61888, "SRR13074870", "SRX9521913", "SRS7729120", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 E11", "GSM4911709", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 E11", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911709", "GSM4911709: SDPL.1X 01 E11; Danio rerio; RNA Seq", "GSM4911709", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911709", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31850_Track-65519_R1.fastq.gz", "fastq", 50048660.0, 658535.0, "GSM4911709 r1", "0:76 1:0", "A:13622067;C:11406781;G:11303440;T:13715844;N:528", 76, 0, null, null, 13622067, 11406781, 11303440, 13715844, 528, "SRX9521913", "SRS7729120", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.86014, null, 0.09565, null, 0.96252, null, 0.45301, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61889, "SRR13074869", "SRX9521912", "SRS7729119", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 H10", "GSM4911708", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 H10", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911708", "GSM4911708: SDPL.1X 01 H10; Danio rerio; RNA Seq", "GSM4911708", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911708", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31847_Track-65513_R1.fastq.gz", "fastq", 54199552.0, 713152.0, "GSM4911708 r1", "0:76 1:0", "A:14613140;C:12664231;G:12481214;T:14440413;N:554", 76, 0, null, null, 14613140, 12664231, 12481214, 14440413, 554, "SRX9521912", "SRS7729119", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.83847, null, 0.0463, null, 0.95465, null, 0.4661, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61890, "SRR13074868", "SRX9521911", "SRS7729118", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 C11", "GSM4911707", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 C11", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911707", "GSM4911707: SDPL.1X 01 C11; Danio rerio; RNA Seq", "GSM4911707", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911707", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31848_Track-65516_R1.fastq.gz", "fastq", 50085216.0, 659016.0, "GSM4911707 r1", "0:76 1:0", "A:13748335;C:11332042;G:11277617;T:13726702;N:520", 76, 0, null, null, 13748335, 11332042, 11277617, 13726702, 520, "SRX9521911", "SRS7729118", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.85163, null, 0.06643, null, 0.94866, null, 0.41876, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61891, "SRR13074867", "SRX9521910", "SRS7729116", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 F10", "GSM4911706", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 F10", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911706", "GSM4911706: SDPL.1X 01 F10; Danio rerio; RNA Seq", "GSM4911706", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911706", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31845_Track-65521_R1.fastq.gz", "fastq", 62281620.0, 819495.0, "GSM4911706 r1", "0:76 1:0", "A:17609719;C:13581841;G:13554360;T:17535048;N:652", 76, 0, null, null, 17609719, 13581841, 13554360, 17535048, 652, "SRX9521910", "SRS7729116", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.888, null, 0.07076, null, 0.94373, null, 0.40445, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61892, "SRR13074866", "SRX9521909", "SRS7729117", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 D10", "GSM4911705", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 D10", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911705", "GSM4911705: SDPL.1X 01 D10; Danio rerio; RNA Seq", "GSM4911705", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911705", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31843_Track-65494_R1.fastq.gz", "fastq", 50016664.0, 658114.0, "GSM4911705 r1", "0:76 1:0", "A:13556216;C:11587501;G:11405855;T:13466527;N:565", 76, 0, null, null, 13556216, 11587501, 11405855, 13466527, 565, "SRX9521909", "SRS7729117", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.86173, null, 0.07254, null, 0.9585, null, 0.4398, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61893, "SRR13074865", "SRX9521908", "SRS7729115", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 H09", "GSM4911704", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 H09", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911704", "GSM4911704: SDPL.1X 01 H09; Danio rerio; RNA Seq", "GSM4911704", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911704", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31841_Track-65517_R1.fastq.gz", "fastq", 57497800.0, 756550.0, "GSM4911704 r1", "0:76 1:0", "A:15234361;C:13740258;G:13485376;T:15037204;N:601", 76, 0, null, null, 15234361, 13740258, 13485376, 15037204, 601, "SRX9521908", "SRS7729115", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.80337, null, 0.07149, null, 0.96197, null, 0.46562, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61894, "SRR13074864", "SRX9521907", "SRS7729114", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 D09", "GSM4911703", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 D09", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911703", "GSM4911703: SDPL.1X 01 D09; Danio rerio; RNA Seq", "GSM4911703", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911703", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31837_Track-65520_R1.fastq.gz", "fastq", 39290632.0, 516982.0, "GSM4911703 r1", "0:76 1:0", "A:10705956;C:9062965;G:9013523;T:10507818;N:370", 76, 0, null, null, 10705956, 9062965, 9013523, 10507818, 370, "SRX9521907", "SRS7729114", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.84931, null, 0.06191, null, 0.94844, null, 0.43923, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61895, "SRR13074863", "SRX9521906", "SRS7729113", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 E09", "GSM4911702", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 E09", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911702", "GSM4911702: SDPL.1X 01 E09; Danio rerio; RNA Seq", "GSM4911702", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911702", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31838_Track-65491_R1.fastq.gz", "fastq", 61965460.0, 815335.0, "GSM4911702 r1", "0:76 1:0", "A:16477650;C:14685380;G:14442373;T:16359327;N:730", 76, 0, null, null, 16477650, 14685380, 14442373, 16359327, 730, "SRX9521906", "SRS7729113", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.84168, null, 0.07136, null, 0.95994, null, 0.4496, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61896, "SRR13074862", "SRX9521905", "SRS7729112", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 H08", "GSM4911701", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 H08", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911701", "GSM4911701: SDPL.1X 01 H08; Danio rerio; RNA Seq", "GSM4911701", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911701", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31835_Track-65524_R1.fastq.gz", "fastq", 43124528.0, 567428.0, "GSM4911701 r1", "0:76 1:0", "A:12087543;C:9503663;G:9433604;T:12099295;N:423", 76, 0, null, null, 12087543, 9503663, 9433604, 12099295, 423, "SRX9521905", "SRS7729112", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.87346, null, 0.06823, null, 0.91319, null, 0.44132, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61897, "SRR13074861", "SRX9521904", "SRS7729111", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 G08", "GSM4911700", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 G08", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911700", "GSM4911700: SDPL.1X 01 G08; Danio rerio; RNA Seq", "GSM4911700", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911700", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31834_Track-65815_R1.fastq.gz", "fastq", 68812680.0, 905430.0, "GSM4911700 r1", "0:76 1:0", "A:18393172;C:16321163;G:16311394;T:17786188;N:763", 76, 0, null, null, 18393172, 16321163, 16311394, 17786188, 763, "SRX9521904", "SRS7729111", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.77544, null, 0.02505, null, 0.98599, null, 0.37319, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61898, "SRR13074860", "SRX9521903", "SRS7729110", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 F08", "GSM4911699", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 F08", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911699", "GSM4911699: SDPL.1X 01 F08; Danio rerio; RNA Seq", "GSM4911699", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911699", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31833_Track-65514_R1.fastq.gz", "fastq", 57341240.0, 754490.0, "GSM4911699 r1", "0:76 1:0", "A:16401241;C:12304778;G:12249825;T:16384848;N:548", 76, 0, null, null, 16401241, 12304778, 12249825, 16384848, 548, "SRX9521903", "SRS7729110", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.83611, null, 0.13643, null, 0.94211, null, 0.45347, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61899, "SRR13074859", "SRX9521902", "SRS7729109", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 B08", "GSM4911698", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 B08", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911698", "GSM4911698: SDPL.1X 01 B08; Danio rerio; RNA Seq", "GSM4911698", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911698", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31829_Track-65480_R1.fastq.gz", "fastq", 44584412.0, 586637.0, "GSM4911698 r1", "0:76 1:0", "A:12539371;C:9753168;G:9731686;T:12559767;N:420", 76, 0, null, null, 12539371, 9753168, 9731686, 12559767, 420, "SRX9521902", "SRS7729109", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.86975, null, 0.07528, null, 0.94381, null, 0.42299, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61900, "SRR13074858", "SRX9521901", "SRS7729108", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 G07", "GSM4911697", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 G07", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911697", "GSM4911697: SDPL.1X 01 G07; Danio rerio; RNA Seq", "GSM4911697", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911697", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31827_Track-65495_R1.fastq.gz", "fastq", 37037536.0, 487336.0, "GSM4911697 r1", "0:76 1:0", "A:10509543;C:7993320;G:8002174;T:10532156;N:343", 76, 0, null, null, 10509543, 7993320, 8002174, 10532156, 343, "SRX9521901", "SRS7729108", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.88425, null, 0.07297, null, 0.91778, null, 0.42613, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61901, "SRR13074857", "SRX9521900", "SRS7729107", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 F07", "GSM4911696", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 F07", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911696", "GSM4911696: SDPL.1X 01 F07; Danio rerio; RNA Seq", "GSM4911696", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911696", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31826_Track-65533_R1.fastq.gz", "fastq", 57925148.0, 762173.0, "GSM4911696 r1", "0:76 1:0", "A:16001688;C:12966467;G:12816135;T:16140226;N:632", 76, 0, null, null, 16001688, 12966467, 12816135, 16140226, 632, "SRX9521900", "SRS7729107", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.88397, null, 0.06671, null, 0.90544, null, 0.46916, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61902, "SRR13074856", "SRX9521899", "SRS7729106", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SHAM.1X 01 C03", "GSM4911695", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "SHAM.1X 01 C03", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "GSM4911695", "GSM4911695: SHAM.1X 01 C03; Danio rerio; RNA Seq", "GSM4911695", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911695", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31798_Track-65475_R1.fastq.gz", "fastq", 31934972.0, 420197.0, "GSM4911695 r1", "0:76 1:0", "A:8769567;C:7288144;G:7242972;T:8633980;N:309", 76, 0, null, null, 8769567, 7288144, 7242972, 8633980, 309, "SRX9521899", "SRS7729106", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.83696, null, 0.07569, null, 0.94564, null, 0.40838, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61903, "SRR13074855", "SRX9521898", "SRS7729105", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 G11", "GSM4911694", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 G11", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911694", "GSM4911694: SDPL.1X 01 G11; Danio rerio; RNA Seq", "GSM4911694", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911694", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31852_Track-65485_R1.fastq.gz", "fastq", 54897992.0, 722342.0, "GSM4911694 r1", "0:76 1:0", "A:14668879;C:12847119;G:12672757;T:14708712;N:525", 76, 0, null, null, 14668879, 12847119, 12672757, 14708712, 525, "SRX9521898", "SRS7729105", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.85646, null, 0.04938, null, 0.97061, null, 0.49581, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61904, "SRR13074854", "SRX9521897", "SRS7729104", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 H11", "GSM4911693", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 H11", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911693", "GSM4911693: SDPL.1X 01 H11; Danio rerio; RNA Seq", "GSM4911693", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911693", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31853_Track-65502_R1.fastq.gz", "fastq", 46178588.0, 607613.0, "GSM4911693 r1", "0:76 1:0", "A:12671327;C:10418553;G:10364180;T:12724067;N:461", 76, 0, null, null, 12671327, 10418553, 10364180, 12724067, 461, "SRX9521897", "SRS7729104", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.8753, null, 0.12822, null, 0.94217, null, 0.49382, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61905, "SRR13074853", "SRX9521896", "SRS7729103", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 C12", "GSM4911692", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 C12", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911692", "GSM4911692: SDPL.1X 01 C12; Danio rerio; RNA Seq", "GSM4911692", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911692", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31854_Track-65529_R1.fastq.gz", "fastq", 44095960.0, 580210.0, "GSM4911692 r1", "0:76 1:0", "A:12115895;C:9895007;G:9925959;T:12158661;N:438", 76, 0, null, null, 12115895, 9895007, 9925959, 12158661, 438, "SRX9521896", "SRS7729103", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.87833, null, 0.09359, null, 0.90989, null, 0.4896, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61906, "SRR13074852", "SRX9521895", "SRS7729102", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 G12", "GSM4911691", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 G12", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911691", "GSM4911691: SDPL.1X 01 G12; Danio rerio; RNA Seq", "GSM4911691", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911691", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31858_Track-65493_R1.fastq.gz", "fastq", 35644152.0, 469002.0, "GSM4911691 r1", "0:76 1:0", "A:9972531;C:7847245;G:7837313;T:9986717;N:346", 76, 0, null, null, 9972531, 7847245, 7837313, 9986717, 346, "SRX9521895", "SRS7729102", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.88663, null, 0.13068, null, 0.91494, null, 0.47588, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61907, "SRR13074851", "SRX9521894", "SRS7729101", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 E12", "GSM4911690", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 E12", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911690", "GSM4911690: SDPL.1X 01 E12; Danio rerio; RNA Seq", "GSM4911690", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911690", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31856_Track-65492_R1.fastq.gz", "fastq", 58951680.0, 775680.0, "GSM4911690 r1", "0:76 1:0", "A:16101283;C:13495044;G:13372556;T:15982231;N:566", 76, 0, null, null, 16101283, 13495044, 13372556, 15982231, 566, "SRX9521894", "SRS7729101", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.82873, null, 0.11796, null, 0.91232, null, 0.49392, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61908, "SRR13074850", "SRX9521893", "SRS7729100", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 D11", "GSM4911689", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 D11", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911689", "GSM4911689: SDPL.1X 01 D11; Danio rerio; RNA Seq", "GSM4911689", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911689", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31849_Track-65500_R1.fastq.gz", "fastq", 32125732.0, 422707.0, "GSM4911689 r1", "0:76 1:0", "A:9095116;C:6986874;G:7011682;T:9031744;N:316", 76, 0, null, null, 9095116, 6986874, 7011682, 9031744, 316, "SRX9521893", "SRS7729100", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.89242, null, 0.15095, null, 0.90078, null, 0.48473, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61909, "SRR13074849", "SRX9521892", "SRS7729099", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 E10", "GSM4911688", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 E10", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911688", "GSM4911688: SDPL.1X 01 E10; Danio rerio; RNA Seq", "GSM4911688", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911688", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31844_Track-65806_R1.fastq.gz", "fastq", 68832288.0, 905688.0, "GSM4911688 r1", "0:76 1:0", "A:17893744;C:16892912;G:16924773;T:17120132;N:727", 76, 0, null, null, 17893744, 16892912, 16924773, 17120132, 727, "SRX9521892", "SRS7729099", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.74462, null, 0.03896, null, 0.97983, null, 0.44767, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61910, "SRR13074848", "SRX9521891", "SRS7729098", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 C10", "GSM4911687", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 C10", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911687", "GSM4911687: SDPL.1X 01 C10; Danio rerio; RNA Seq", "GSM4911687", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911687", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31842_Track-65512_R1.fastq.gz", "fastq", 30740556.0, 404481.0, "GSM4911687 r1", "0:76 1:0", "A:8441463;C:6917208;G:6931159;T:8450350;N:376", 76, 0, null, null, 8441463, 6917208, 6931159, 8450350, 376, "SRX9521891", "SRS7729098", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.88369, null, 0.11101, null, 0.92908, null, 0.50616, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61911, "SRR13074847", "SRX9521890", "SRS7729097", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 F09", "GSM4911686", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 F09", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911686", "GSM4911686: SDPL.1X 01 F09; Danio rerio; RNA Seq", "GSM4911686", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911686", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31839_Track-65496_R1.fastq.gz", "fastq", 35958260.0, 473135.0, "GSM4911686 r1", "0:76 1:0", "A:9949741;C:8078433;G:8074393;T:9855320;N:373", 76, 0, null, null, 9949741, 8078433, 8074393, 9855320, 373, "SRX9521890", "SRS7729097", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.86855, null, 0.13924, null, 0.93736, null, 0.50494, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61912, "SRR13074846", "SRX9521889", "SRS7729096", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 C09", "GSM4911685", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 C09", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911685", "GSM4911685: SDPL.1X 01 C09; Danio rerio; RNA Seq", "GSM4911685", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911685", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31836_Track-65508_R1.fastq.gz", "fastq", 51294300.0, 674925.0, "GSM4911685 r1", "0:76 1:0", "A:13200626;C:12562426;G:12451686;T:13079030;N:532", 76, 0, null, null, 13200626, 12562426, 12451686, 13079030, 532, "SRX9521889", "SRS7729096", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.78263, null, 0.03013, null, 0.97749, null, 0.51229, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61913, "SRR13074845", "SRX9521888", "SRS7729095", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 C08", "GSM4911684", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 C08", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911684", "GSM4911684: SDPL.1X 01 C08; Danio rerio; RNA Seq", "GSM4911684", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911684", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31830_Track-65483_R1.fastq.gz", "fastq", 61584092.0, 810317.0, "GSM4911684 r1", "0:76 1:0", "A:16915960;C:13990555;G:13836939;T:16839980;N:658", 76, 0, null, null, 16915960, 13990555, 13836939, 16839980, 658, "SRX9521888", "SRS7729095", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.86082, null, 0.17168, null, 0.94564, null, 0.47355, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61914, "SRR13074844", "SRX9521887", "SRS7729093", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 H07", "GSM4911683", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 H07", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911683", "GSM4911683: SDPL.1X 01 H07; Danio rerio; RNA Seq", "GSM4911683", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911683", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31828_Track-65807_R1.fastq.gz", "fastq", 89178476.0, 1173401.0, "GSM4911683 r1", "0:76 1:0", "A:23100778;C:22204017;G:21583040;T:22289737;N:904", 76, 0, null, null, 23100778, 22204017, 21583040, 22289737, 904, "SRX9521887", "SRS7729093", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.68514, null, 0.03969, null, 0.9724, null, 0.4712, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61915, "SRR13074843", "SRX9521886", "SRS7729094", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 C07", "GSM4911682", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 C07", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911682", "GSM4911682: SDPL.1X 01 C07; Danio rerio; RNA Seq", "GSM4911682", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911682", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31823_Track-65504_R1.fastq.gz", "fastq", 45830584.0, 603034.0, "GSM4911682 r1", "0:76 1:0", "A:12701341;C:10164142;G:10136994;T:12827568;N:539", 76, 0, null, null, 12701341, 10164142, 10136994, 12827568, 539, "SRX9521886", "SRS7729094", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.89102, null, 0.12883, null, 0.91153, null, 0.49396, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61916, "SRR13074842", "SRX9521885", "SRS7729092", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 E07", "GSM4911681", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 E07", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911681", "GSM4911681: SDPL.1X 01 E07; Danio rerio; RNA Seq", "GSM4911681", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911681", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31825_Track-65488_R1.fastq.gz", "fastq", 59302268.0, 780293.0, "GSM4911681 r1", "0:76 1:0", "A:16528412;C:13077832;G:13063852;T:16631565;N:607", 76, 0, null, null, 16528412, 13077832, 13063852, 16631565, 607, "SRX9521885", "SRS7729092", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.88664, null, 0.12564, null, 0.92466, null, 0.50803, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61917, "SRR13074841", "SRX9521884", "SRS7729091", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 D07", "GSM4911680", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 D07", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911680", "GSM4911680: SDPL.1X 01 D07; Danio rerio; RNA Seq", "GSM4911680", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911680", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31824_Track-65486_R1.fastq.gz", "fastq", 43359444.0, 570519.0, "GSM4911680 r1", "0:76 1:0", "A:11871507;C:9804178;G:9782088;T:11901271;N:400", 76, 0, null, null, 11871507, 9804178, 9782088, 11901271, 400, "SRX9521884", "SRS7729091", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.86671, null, 0.04246, null, 0.91948, null, 0.5029, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61918, "SRR13074840", "SRX9521883", "SRS7729090", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SHAM.1X 01 C05", "GSM4911679", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "SHAM.1X 01 C05", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "GSM4911679", "GSM4911679: SHAM.1X 01 C05; Danio rerio; RNA Seq", "GSM4911679", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911679", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31810_Track-65501_R1.fastq.gz", "fastq", 49988316.0, 657741.0, "GSM4911679 r1", "0:76 1:0", "A:13864113;C:11107462;G:11067315;T:13948902;N:524", 76, 0, null, null, 13864113, 11107462, 11067315, 13948902, 524, "SRX9521883", "SRS7729090", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.88638, null, 0.15581, null, 0.93012, null, 0.49662, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61919, "SRR13074839", "SRX9521882", "SRS7729089", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SHAM.1X 01 F04", "GSM4911678", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "SHAM.1X 01 F04", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "GSM4911678", "GSM4911678: SHAM.1X 01 F04; Danio rerio; RNA Seq", "GSM4911678", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911678", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31807_Track-65489_R1.fastq.gz", "fastq", 50369076.0, 662751.0, "GSM4911678 r1", "0:76 1:0", "A:13780034;C:11462436;G:11378652;T:13747432;N:522", 76, 0, null, null, 13780034, 11462436, 11378652, 13747432, 522, "SRX9521882", "SRS7729089", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.87612, null, 0.13992, null, 0.94759, null, 0.48372, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61920, "SRR13074838", "SRX9521881", "SRS7729088", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SHAM.1X 01 F03", "GSM4911677", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "SHAM.1X 01 F03", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "GSM4911677", "GSM4911677: SHAM.1X 01 F03; Danio rerio; RNA Seq", "GSM4911677", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911677", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31801_Track-65498_R1.fastq.gz", "fastq", 51300000.0, 675000.0, "GSM4911677 r1", "0:76 1:0", "A:13602360;C:12207611;G:12079488;T:13410039;N:502", 76, 0, null, null, 13602360, 12207611, 12079488, 13410039, 502, "SRX9521881", "SRS7729088", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.86784, null, 0.04666, null, 0.94951, null, 0.47357, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61921, "SRR13074837", "SRX9521880", "SRS7729087", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SHAM.1X 01 G03", "GSM4911676", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "SHAM.1X 01 G03", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "GSM4911676", "GSM4911676: SHAM.1X 01 G03; Danio rerio; RNA Seq", "GSM4911676", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911676", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31802_Track-65477_R1.fastq.gz", "fastq", 36424444.0, 479269.0, "GSM4911676 r1", "0:76 1:0", "A:10492019;C:7707574;G:7746421;T:10478166;N:264", 76, 0, null, null, 10492019, 7707574, 7746421, 10478166, 264, "SRX9521880", "SRS7729087", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.85224, null, 0.29445, null, 0.94359, null, 0.49163, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61922, "SRR13074836", "SRX9521879", "SRS7729086", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SHAM.1X 01 E03", "GSM4911675", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "SHAM.1X 01 E03", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "GSM4911675", "GSM4911675: SHAM.1X 01 E03; Danio rerio; RNA Seq", "GSM4911675", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911675", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31800_Track-65505_R1.fastq.gz", "fastq", 69856084.0, 919159.0, "GSM4911675 r1", "0:76 1:0", "A:18973282;C:15972512;G:15817419;T:19092091;N:780", 76, 0, null, null, 18973282, 15972512, 15817419, 19092091, 780, "SRX9521879", "SRS7729086", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.87798, null, 0.11249, null, 0.95426, null, 0.49719, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61923, "SRR13074835", "SRX9521878", "SRS7729085", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SHAM.1X 01 B01", "GSM4911674", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "SHAM.1X 01 B01", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "GSM4911674", "GSM4911674: SHAM.1X 01 B01; Danio rerio; RNA Seq", "GSM4911674", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911674", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31784_Track-65478_R1.fastq.gz", "fastq", 36172808.0, 475958.0, "GSM4911674 r1", "0:76 1:0", "A:10101208;C:7982732;G:7982110;T:10106320;N:438", 76, 0, null, null, 10101208, 7982732, 7982110, 10106320, 438, "SRX9521878", "SRS7729085", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.87462, null, 0.13761, null, 0.92928, null, 0.48918, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61924, "SRR13074834", "SRX9521877", "SRS7729083", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 F11", "GSM4911673", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 F11", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911673", "GSM4911673: SDPL.1X 01 F11; Danio rerio; RNA Seq", "GSM4911673", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911673", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31851_Track-65509_R1.fastq.gz", "fastq", 60500636.0, 796061.0, "GSM4911673 r1", "0:76 1:0", "A:16366368;C:14139846;G:13869369;T:16124370;N:683", 76, 0, null, null, 16366368, 14139846, 13869369, 16124370, 683, "SRX9521877", "SRS7729083", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.81031, null, 0.06054, null, 0.96412, null, 0.4282, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61925, "SRR13074833", "SRX9521876", "SRS7729084", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SHAM.1X 01 E05", "GSM4911672", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "SHAM.1X 01 E05", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "GSM4911672", "GSM4911672: SHAM.1X 01 E05; Danio rerio; RNA Seq", "GSM4911672", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911672", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31812_Track-65487_R1.fastq.gz", "fastq", 63166792.0, 831142.0, "GSM4911672 r1", "0:76 1:0", "A:17384488;C:14266583;G:14143927;T:17371042;N:752", 76, 0, null, null, 17384488, 14266583, 14143927, 17371042, 752, "SRX9521876", "SRS7729084", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.86701, null, 0.07159, null, 0.96749, null, 0.42215, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61926, "SRR13074832", "SRX9521875", "SRS7729082", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SHAM.1X 01 D05", "GSM4911671", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "SHAM.1X 01 D05", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "GSM4911671", "GSM4911671: SHAM.1X 01 D05; Danio rerio; RNA Seq", "GSM4911671", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911671", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31811_Track-65497_R1.fastq.gz", "fastq", 60643592.0, 797942.0, "GSM4911671 r1", "0:76 1:0", "A:16513751;C:13996947;G:13713529;T:16418747;N:618", 76, 0, null, null, 16513751, 13996947, 13713529, 16418747, 618, "SRX9521875", "SRS7729082", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.86541, null, 0.06556, null, 0.96548, null, 0.41348, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61927, "SRR13074831", "SRX9521874", "SRS7729081", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SHAM.1X 01 H04", "GSM4911670", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "SHAM.1X 01 H04", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "GSM4911670", "GSM4911670: SHAM.1X 01 H04; Danio rerio; RNA Seq", "GSM4911670", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911670", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31809_Track-65808_R1.fastq.gz", "fastq", 70547608.0, 928258.0, "GSM4911670 r1", "0:76 1:0", "A:20097006;C:15116002;G:15152368;T:20181516;N:716", 76, 0, null, null, 20097006, 15116002, 15152368, 20181516, 716, "SRX9521874", "SRS7729081", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.88551, null, 0.0536, null, 0.94414, null, 0.3658, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61928, "SRR13074830", "SRX9521873", "SRS7729080", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SHAM.1X 01 F06", "GSM4911669", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "SHAM.1X 01 F06", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "GSM4911669", "GSM4911669: SHAM.1X 01 F06; Danio rerio; RNA Seq", "GSM4911669", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911669", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31819_Track-65810_R1.fastq.gz", "fastq", 69169348.0, 910123.0, "GSM4911669 r1", "0:76 1:0", "A:19140793;C:15718435;G:15809782;T:18499565;N:773", 76, 0, null, null, 19140793, 15718435, 15809782, 18499565, 773, "SRX9521873", "SRS7729080", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.81612, null, 0.11304, null, 0.97739, null, 0.4446, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61929, "SRR13074829", "SRX9521872", "SRS7729079", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SHAM.1X 01 G06", "GSM4911668", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "SHAM.1X 01 G06", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "GSM4911668", "GSM4911668: SHAM.1X 01 G06; Danio rerio; RNA Seq", "GSM4911668", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911668", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31820_Track-65490_R1.fastq.gz", "fastq", 73368880.0, 965380.0, "GSM4911668 r1", "0:76 1:0", "A:19970761;C:16886425;G:16582864;T:19928054;N:776", 76, 0, null, null, 19970761, 16886425, 16582864, 19928054, 776, "SRX9521872", "SRS7729079", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.83051, null, 0.09462, null, 0.96491, null, 0.41464, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61930, "SRR13074828", "SRX9521871", "SRS7729078", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SHAM.1X 01 G04", "GSM4911667", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "SHAM.1X 01 G04", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "GSM4911667", "GSM4911667: SHAM.1X 01 G04; Danio rerio; RNA Seq", "GSM4911667", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911667", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31808_Track-65481_R1.fastq.gz", "fastq", 74057972.0, 974447.0, "GSM4911667 r1", "0:76 1:0", "A:20426815;C:16642265;G:16509221;T:20478895;N:776", 76, 0, null, null, 20426815, 16642265, 16509221, 20478895, 776, "SRX9521871", "SRS7729078", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.87627, null, 0.07291, null, 0.95448, null, 0.42013, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61931, "SRR13074827", "SRX9521870", "SRS7729077", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SHAM.1X 01 F05", "GSM4911666", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "SHAM.1X 01 F05", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "GSM4911666", "GSM4911666: SHAM.1X 01 F05; Danio rerio; RNA Seq", "GSM4911666", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911666", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31813_Track-65526_R1.fastq.gz", "fastq", 62630004.0, 824079.0, "GSM4911666 r1", "0:76 1:0", "A:16973316;C:14550919;G:14222192;T:16882894;N:683", 76, 0, null, null, 16973316, 14550919, 14222192, 16882894, 683, "SRX9521870", "SRS7729077", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.86296, null, 0.08067, null, 0.96475, null, 0.41357, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61932, "SRR13074826", "SRX9521869", "SRS7729074", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SHAM.1X 01 E06", "GSM4911665", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "SHAM.1X 01 E06", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "GSM4911665", "GSM4911665: SHAM.1X 01 E06; Danio rerio; RNA Seq", "GSM4911665", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911665", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31818_Track-65530_R1.fastq.gz", "fastq", 76101156.0, 1001331.0, "GSM4911665 r1", "0:76 1:0", "A:20949535;C:17170191;G:16901781;T:21078916;N:733", 76, 0, null, null, 20949535, 17170191, 16901781, 21078916, 733, "SRX9521869", "SRS7729074", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.85996, null, 0.08409, null, 0.96404, null, 0.38674, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61933, "SRR13074825", "SRX9521868", "SRS7729076", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SHAM.1X 01 D06", "GSM4911664", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "SHAM.1X 01 D06", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "GSM4911664", "GSM4911664: SHAM.1X 01 D06; Danio rerio; RNA Seq", "GSM4911664", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911664", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31817_Track-65503_R1.fastq.gz", "fastq", 85606628.0, 1126403.0, "GSM4911664 r1", "0:76 1:0", "A:23092220;C:19962897;G:19477548;T:23073042;N:921", 76, 0, null, null, 23092220, 19962897, 19477548, 23073042, 921, "SRX9521868", "SRS7729076", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.86516, null, 0.09474, null, 0.96601, null, 0.43943, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61934, "SRR13074824", "SRX9521867", "SRS7729075", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SHAM.1X 01 C06", "GSM4911663", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "SHAM.1X 01 C06", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "GSM4911663", "GSM4911663: SHAM.1X 01 C06; Danio rerio; RNA Seq", "GSM4911663", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911663", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31816_Track-65527_R1.fastq.gz", "fastq", 66804380.0, 879005.0, "GSM4911663 r1", "0:76 1:0", "A:18111445;C:15360194;G:15073616;T:18258448;N:677", 76, 0, null, null, 18111445, 15360194, 15073616, 18258448, 677, "SRX9521867", "SRS7729075", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.87731, null, 0.08045, null, 0.96779, null, 0.40531, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61935, "SRR13074823", "SRX9521866", "SRS7729073", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SHAM.1X 01 H05", "GSM4911662", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "SHAM.1X 01 H05", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "GSM4911662", "GSM4911662: SHAM.1X 01 H05; Danio rerio; RNA Seq", "GSM4911662", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911662", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31815_Track-65484_R1.fastq.gz", "fastq", 76067716.0, 1000891.0, "GSM4911662 r1", "0:76 1:0", "A:20850548;C:17370200;G:17356425;T:20489837;N:706", 76, 0, null, null, 20850548, 17370200, 17356425, 20489837, 706, "SRX9521866", "SRS7729073", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.84934, null, 0.08537, null, 0.97175, null, 0.39742, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61936, "SRR13074822", "SRX9521865", "SRS7729072", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SHAM.1X 01 G05", "GSM4911661", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "SHAM.1X 01 G05", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "GSM4911661", "GSM4911661: SHAM.1X 01 G05; Danio rerio; RNA Seq", "GSM4911661", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911661", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31814_Track-65809_R1.fastq.gz", "fastq", 49672764.0, 653589.0, "GSM4911661 r1", "0:76 1:0", "A:13726006;C:11159262;G:11246824;T:13540279;N:393", 76, 0, null, null, 13726006, 11159262, 11246824, 13540279, 393, "SRX9521865", "SRS7729072", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.88007, null, 0.07979, null, 0.9726, null, 0.41653, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61937, "SRR13074821", "SRX9521864", "SRS7729071", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SHAM.1X 01 D04", "GSM4911660", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "SHAM.1X 01 D04", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "GSM4911660", "GSM4911660: SHAM.1X 01 D04; Danio rerio; RNA Seq", "GSM4911660", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911660", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31805_Track-65528_R1.fastq.gz", "fastq", 76179056.0, 1002356.0, "GSM4911660 r1", "0:76 1:0", "A:21167085;C:16991109;G:16855722;T:21164324;N:816", 76, 0, null, null, 21167085, 16991109, 16855722, 21164324, 816, "SRX9521864", "SRS7729071", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.8837, null, 0.07855, null, 0.9512, null, 0.41387, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61938, "SRR13074820", "SRX9521863", "SRS7729070", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SHAM.1X 01 E04", "GSM4911659", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "SHAM.1X 01 E04", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "GSM4911659", "GSM4911659: SHAM.1X 01 E04; Danio rerio; RNA Seq", "GSM4911659", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911659", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31806_Track-65511_R1.fastq.gz", "fastq", 84859624.0, 1116574.0, "GSM4911659 r1", "0:76 1:0", "A:22827723;C:19683208;G:19391549;T:22956186;N:958", 76, 0, null, null, 22827723, 19683208, 19391549, 22956186, 958, "SRX9521863", "SRS7729070", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.8723, null, 0.07867, null, 0.96771, null, 0.41404, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61939, "SRR13074819", "SRX9521862", "SRS7729069", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SHAM.1X 01 H03", "GSM4911658", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "SHAM.1X 01 H03", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "GSM4911658", "GSM4911658: SHAM.1X 01 H03; Danio rerio; RNA Seq", "GSM4911658", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911658", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31803_Track-65811_R1.fastq.gz", "fastq", 64502340.0, 848715.0, "GSM4911658 r1", "0:76 1:0", "A:17761988;C:14539522;G:14611277;T:17588877;N:676", 76, 0, null, null, 17761988, 14539522, 14611277, 17588877, 676, "SRX9521862", "SRS7729069", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.89295, null, 0.06303, null, 0.96641, null, 0.40073, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61940, "SRR13074818", "SRX9521861", "SRS7729068", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SHAM.1X 01 G02", "GSM4911657", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "SHAM.1X 01 G02", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "GSM4911657", "GSM4911657: SHAM.1X 01 G02; Danio rerio; RNA Seq", "GSM4911657", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911657", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31796_Track-65816_R1.fastq.gz", "fastq", 68210988.0, 897513.0, "GSM4911657 r1", "0:76 1:0", "A:18748765;C:15384890;G:15602789;T:18473820;N:724", 76, 0, null, null, 18748765, 15384890, 15602789, 18473820, 724, "SRX9521861", "SRS7729068", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.85355, null, 0.09065, null, 0.97305, null, 0.41827, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61941, "SRR13074817", "SRX9521860", "SRS7729067", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SHAM.1X 01 D01", "GSM4911656", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "SHAM.1X 01 D01", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "GSM4911656", "GSM4911656: SHAM.1X 01 D01; Danio rerio; RNA Seq", "GSM4911656", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911656", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31786_Track-65525_R1.fastq.gz", "fastq", 54672652.0, 719377.0, "GSM4911656 r1", "0:76 1:0", "A:14914589;C:12579519;G:12381424;T:14796537;N:583", 76, 0, null, null, 14914589, 12579519, 12381424, 14796537, 583, "SRX9521860", "SRS7729067", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.81427, null, 0.0742, null, 0.96497, null, 0.4042, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61942, "SRR13074816", "SRX9521859", "SRS7729066", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SHAM.1X 01 E02", "GSM4911655", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "SHAM.1X 01 E02", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "GSM4911655", "GSM4911655: SHAM.1X 01 E02; Danio rerio; RNA Seq", "GSM4911655", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911655", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31794_Track-65479_R1.fastq.gz", "fastq", 58877580.0, 774705.0, "GSM4911655 r1", "0:76 1:0", "A:16055129;C:13405095;G:13265300;T:16151460;N:596", 76, 0, null, null, 16055129, 13405095, 13265300, 16151460, 596, "SRX9521859", "SRS7729066", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.87122, null, 0.07978, null, 0.96126, null, 0.42313, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61943, "SRR13074815", "SRX9521858", "SRS7729065", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SHAM.1X 01 C02", "GSM4911654", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "SHAM.1X 01 C02", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "GSM4911654", "GSM4911654: SHAM.1X 01 C02; Danio rerio; RNA Seq", "GSM4911654", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911654", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31792_Track-65812_R1.fastq.gz", "fastq", 56470660.0, 743035.0, "GSM4911654 r1", "0:76 1:0", "A:15566345;C:12627451;G:12787437;T:15488812;N:615", 76, 0, null, null, 15566345, 12627451, 12787437, 15488812, 615, "SRX9521858", "SRS7729065", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.85961, null, 0.07793, null, 0.96903, null, 0.4233, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61944, "SRR13074814", "SRX9521857", "SRS7729064", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SHAM.1X 01 H01", "GSM4911653", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "SHAM.1X 01 H01", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "GSM4911653", "GSM4911653: SHAM.1X 01 H01; Danio rerio; RNA Seq", "GSM4911653", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911653", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31790_Track-65518_R1.fastq.gz", "fastq", 40340800.0, 530800.0, "GSM4911653 r1", "0:76 1:0", "A:11208779;C:8967461;G:8886941;T:11277187;N:432", 76, 0, null, null, 11208779, 8967461, 8886941, 11277187, 432, "SRX9521857", "SRS7729064", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.87219, null, 0.07105, null, 0.9457, null, 0.3863, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61945, "SRR13074813", "SRX9521856", "SRS7729063", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SHAM.1X 01 H02", "GSM4911652", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "SHAM.1X 01 H02", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "GSM4911652", "GSM4911652: SHAM.1X 01 H02; Danio rerio; RNA Seq", "GSM4911652", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911652", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31797_Track-65523_R1.fastq.gz", "fastq", 53571792.0, 704892.0, "GSM4911652 r1", "0:76 1:0", "A:14686683;C:12166166;G:11995488;T:14722912;N:543", 76, 0, null, null, 14686683, 12166166, 11995488, 14722912, 543, "SRX9521856", "SRS7729063", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.86485, null, 0.0668, null, 0.94416, null, 0.40319, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"]], "truncated": false, "filtered_table_rows_count": 554, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"experiment.library_source\" = :p0 and \"technology\" = :p1 and \"tissue_curation\" = :p2 order by rowid limit 101", "params": {"p0": "TRANSCRIPTOMIC", "p1": "smartseq", "p2": "Spinal Cord"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation=Spinal+Cord", "results": [{"value": "RNA-Seq", "label": "RNA-Seq", "count": 554, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation=Spinal+Cord&experiment.library_strategy=RNA-Seq", "selected": false}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation=Spinal+Cord", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 554, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?technology=smartseq&tissue_curation=Spinal+Cord", "selected": true}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation=Spinal+Cord", "results": [{"value": "cDNA", "label": "cDNA", "count": 554, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation=Spinal+Cord&experiment.library_selection=cDNA", "selected": false}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation=Spinal+Cord", "results": [{"value": "SINGLE", "label": "SINGLE", "count": 511, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation=Spinal+Cord&experiment.library_layout=SINGLE", "selected": false}, {"value": "PAIRED", "label": "PAIRED", "count": 43, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation=Spinal+Cord&experiment.library_layout=PAIRED", "selected": false}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation=Spinal+Cord", "results": [{"value": "ILLUMINA", "label": "ILLUMINA", "count": 554, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation=Spinal+Cord&experiment.platform=ILLUMINA", "selected": false}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation=Spinal+Cord", "results": [{"value": "Larval", "label": "Larval", "count": 394, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation=Spinal+Cord&devstage_curation_coarse=Larval", "selected": false}, {"value": "Adult", "label": "Adult", "count": 87, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation=Spinal+Cord&devstage_curation_coarse=Adult", "selected": false}, {"value": "Embryo", "label": "Embryo", "count": 40, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation=Spinal+Cord&devstage_curation_coarse=Embryo", "selected": false}, {"value": "Undetermined", "label": "Undetermined", "count": 22, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation=Spinal+Cord&devstage_curation_coarse=Undetermined", "selected": false}, {"value": "Juvenile", "label": "Juvenile", "count": 11, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation=Spinal+Cord&devstage_curation_coarse=Juvenile", "selected": false}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation=Spinal+Cord", "results": [{"value": "Larval", "label": "Larval", "count": 394, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation=Spinal+Cord&devstage_curation=Larval", "selected": false}, {"value": "Adult", "label": "Adult", "count": 87, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation=Spinal+Cord&devstage_curation=Adult", "selected": false}, {"value": "Multi-stage", "label": "Multi-stage", "count": 40, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation=Spinal+Cord&devstage_curation=Multi-stage", "selected": false}, {"value": "Undetermined", "label": "Undetermined", "count": 22, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation=Spinal+Cord&devstage_curation=Undetermined", "selected": false}, {"value": "Juvenile", "label": "Juvenile", "count": 11, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation=Spinal+Cord&devstage_curation=Juvenile", "selected": false}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation=Spinal+Cord", "results": [{"value": "Nervous System", "label": "Nervous System", "count": 554, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation=Spinal+Cord&tissue_curation_coarse=Nervous+System", "selected": false}], "truncated": false}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation=Spinal+Cord", "results": [{"value": "Spinal Cord", "label": "Spinal Cord", "count": 554, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq", "selected": true}], "truncated": false}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation=Spinal+Cord", "results": [{"value": "smartseq", "label": "smartseq", "count": 554, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&tissue_curation=Spinal+Cord", "selected": true}], "truncated": false}}, "suggested_facets": [], "next": "61945", "next_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=smartseq&tissue_curation=Spinal+Cord&_next=61945", "private": false, "allow_execute_sql": true, "query_ms": 121.82493400177918}