{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where experiment.library_source = \"TRANSCRIPTOMIC\", experiment.platform = \"ILLUMINA\" and tissue_curation = \"Spinal Cord\"", "rows": [[10177, "ERR5858456", "ERX5504345", "ERS6343449", "ERP128749", "PRJEB44676", "scRNAseq of her4.3+ cells from lesioned and unlesioned zebrafish larvae spinal cord", "E-MTAB-10390", "Transcriptome Analysis", "To analyse lesion induced gene regulation in progenitor cells at single cell resolution  we performed single cell RNAseq on FACS isolated her4.3:GFP progenitor cells from the spinal cord at 24 hours post lesion hpl post spinal injury at 3 dpf dpf  compared to age matched uninjured animals.", "ENA FIRST PUBLIC:2021 05 24|ENA LAST UPDATE:2021 05 24", null, "Protocols: Trunks containing the lesion sites or equivalent site from unlesioned fish are collected and kept in PBS on ice.Incubate the trunks up to 300 in 1 mL of 1X Trypsin EDTA at 37C for 5 7 mins.Stop dissociation by adding FBS to a final concentration of 5%.Centrifuge at 200g for 7 mins.Discard Sups.Resuspend in 500 uL of PBS.Add the cell suspension into a 40 uM cell strainer.Centrifuge at 200g for 7 mins.Resuspend in the buffer for FACS PBS 5% FBS Following cell dissociation and FAC sorting  samples were processed on the 10X Chromium platform using 10X Single Cell three prime v3 chemistry following the manufacturer's guidelines Following cell dissociation and FAC sorting  samples were processed on the 10X Chromium platform using 10X Single Cell three prime v3 chemistry following the manufacturer's guidelines.", "Lesi1d", "SAMEA8658903", "University Of Edinburgh", "ENA first public:2021 05 24|ENA last update:2021 05 24|External Id:SAMEA8658903|INSDC center alias:UOE|INSDC center name:University Of Edinburgh|INSDC first public:2021 05 24T00:14:32Z|INSDC last update:2021 05 24T00:14:32Z|INSDC status:public|Submitter Id:E MTAB 10390:Lesi1d|age:4|broker name:ArrayExpress|cell type:ependymo radial glial cell|common name:zebrafish|developmental stage:larval day 4|immunophenotype:Her4.3+ positive|injury:spinal injury lesion|organism part:spinal cord|sample name:E MTAB 10390:Lesi1d|sex:mixed|strain:WIK", null, null, null, null, null, null, null, null, "Illumina NovaSeq 6000 paired end sequencing; scRNAseq of her4.3+ cells from lesi1d and unlesi1d zebrafish larvae spinal cord", "E MTAB 10390:Lesioned p", "Lesioned p", "scRNAseq of her4.3+ cells from lesioned and unlesioned zebrafish larvae spinal cord", "Trunks containing the lesion sites or equivalent site from unlesioned fish are collected and kept in PBS on ice.Incubate the trunks up to 300 in 1 mL of 1X Trypsin EDTA at 37C for 5 7 mins.Stop dissociation by adding FBS to a final concentration of 5%.Centrifuge at 200g for 7 mins.Discard Sups.Resuspend in 500 uL of PBS.Add the cell suspension into a 40 uM cell strainer.Centrifuge at 200g for 7 mins.Resuspend in the buffer for FACS PBS 5% FBS Following cell dissociation and FAC sorting  samples were processed on the 10X Chromium platform using 10X Single Cell three prime v3 chemistry following the manufacturer's guidelines  Following cell dissociation and FAC sorting  samples were processed on the 10X Chromium platform using 10X Single Cell three prime v3 chemistry following the manufacturer's guidelines.", "Experimental Factor: injury:spinal injury lesion", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "ERP128749", "Illumina NovaSeq 6000 paired end sequencing; scRNAseq of her4.3+ cells from lesioned and unlesioned zebrafish larvae spinal cord", "ENA FIRST PUBLIC:2021 05 24|ENA LAST UPDATE:2021 05 24", "Lesioned.bam", "bam", 49902588630.0, 554473207.0, "E MTAB 10390:Lesioned", "0:90", "A:14713351178;C:10191139050;G:10897887675;T:14095967201;N:4243526", 90, null, null, null, 14713351178, 10191139050, 10897887675, 14095967201, 4243526, "ERX5504345", "ERS6343449", "ERA4142789", "University Of Edinburgh|European Nucleotide Archive", "University Of Edinburgh|European Nucleotide Archive", 1, 0.91197, null, 0.29137, null, 0.7568, null, 0.56523, null, 90, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "poly_a", "unknown", "sc", "single_cell_droplet", "10x", null, "United Kingdom", "2021-05-24", "Larval", "Larval", "Spinal Cord", "Nervous System"], [24927, "SRR25557778", "SRX21286665", "SRS18536778", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant XI", "GSM7688794", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688794", "GSM7688794: Morphant XI; Danio rerio; RNA Seq", "GSM7688794 r1", "GSM7688794", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-XI_S7_L001_R1_001.fastq.gz", "fastq", 420092501.0, 5668059.0, "GSM7688794 r1", "0:74.12", "A:113006440;C:96725832;G:99320773;T:110915967;N:123489", 74, null, null, null, 113006440, 96725832, 99320773, 110915967, 123489, "SRX21286665", "SRS18536778", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94757, null, 0.06229, null, 0.72364, null, 0.46676, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24928, "SRR25557779", "SRX21286665", "SRS18536778", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant XI", "GSM7688794", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688794", "GSM7688794: Morphant XI; Danio rerio; RNA Seq", "GSM7688794 r1", "GSM7688794", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-XI_S7_L002_R1_001.fastq.gz", "fastq", 421869780.0, 5690053.0, "GSM7688794 r2", "0:74.14", "A:113530489;C:97144227;G:99697959;T:111388539;N:108566", 74, null, null, null, 113530489, 97144227, 99697959, 111388539, 108566, "SRX21286665", "SRS18536778", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94921, null, 0.06226, null, 0.72462, null, 0.4738, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24929, "SRR25557780", "SRX21286665", "SRS18536778", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant XI", "GSM7688794", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688794", "GSM7688794: Morphant XI; Danio rerio; RNA Seq", "GSM7688794 r1", "GSM7688794", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-XI_S7_L003_R1_001.fastq.gz", "fastq", 425064659.0, 5734041.0, "GSM7688794 r3", "0:74.13", "A:114342253;C:97873100;G:100532599;T:112196433;N:120274", 74, null, null, null, 114342253, 97873100, 100532599, 112196433, 120274, "SRX21286665", "SRS18536778", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94886, null, 0.06112, null, 0.72425, null, 0.47055, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24930, "SRR25557781", "SRX21286665", "SRS18536778", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant XI", "GSM7688794", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688794", "GSM7688794: Morphant XI; Danio rerio; RNA Seq", "GSM7688794 r1", "GSM7688794", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-XI_S7_L004_R1_001.fastq.gz", "fastq", 416990548.0, 5624902.0, "GSM7688794 r4", "0:74.13", "A:112153356;C:96009158;G:98613145;T:110097476;N:117413", 74, null, null, null, 112153356, 96009158, 98613145, 110097476, 117413, "SRX21286665", "SRS18536778", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94869, null, 0.06229, null, 0.72506, null, 0.47222, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24931, "SRR25557782", "SRX21286664", "SRS18536777", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant X", "GSM7688793", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688793", "GSM7688793: Morphant X; Danio rerio; RNA Seq", "GSM7688793 r1", "GSM7688793", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-X_S6_L001_R1_001.fastq.gz", "fastq", 434485284.0, 5881416.0, "GSM7688793 r1", "0:73.87", "A:116640351;C:100176557;G:102659919;T:114799536;N:208921", 73, null, null, null, 116640351, 100176557, 102659919, 114799536, 208921, "SRX21286664", "SRS18536777", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94533, null, 0.07176, null, 0.72464, null, 0.47632, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24932, "SRR25557783", "SRX21286664", "SRS18536777", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant X", "GSM7688793", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688793", "GSM7688793: Morphant X; Danio rerio; RNA Seq", "GSM7688793 r1", "GSM7688793", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-X_S6_L002_R1_001.fastq.gz", "fastq", 435203869.0, 5886556.0, "GSM7688793 r2", "0:73.93", "A:116869356;C:100363580;G:102830644;T:114973504;N:166785", 73, null, null, null, 116869356, 100363580, 102830644, 114973504, 166785, "SRX21286664", "SRS18536777", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94542, null, 0.07203, null, 0.72421, null, 0.47733, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24933, "SRR25557784", "SRX21286664", "SRS18536777", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant X", "GSM7688793", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688793", "GSM7688793: Morphant X; Danio rerio; RNA Seq", "GSM7688793 r1", "GSM7688793", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-X_S6_L003_R1_001.fastq.gz", "fastq", 439897269.0, 5951878.0, "GSM7688793 r3", "0:73.91", "A:118101648;C:101426657;G:103990006;T:116184480;N:194478", 73, null, null, null, 118101648, 101426657, 103990006, 116184480, 194478, "SRX21286664", "SRS18536777", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94486, null, 0.07224, null, 0.72448, null, 0.47915, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24934, "SRR25557785", "SRX21286664", "SRS18536777", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant X", "GSM7688793", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688793", "GSM7688793: Morphant X; Danio rerio; RNA Seq", "GSM7688793 r1", "GSM7688793", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-X_S6_L004_R1_001.fastq.gz", "fastq", 431385256.0, 5836029.0, "GSM7688793 r4", "0:73.92", "A:115804970;C:99459059;G:101962932;T:113975935;N:182360", 73, null, null, null, 115804970, 99459059, 101962932, 113975935, 182360, "SRX21286664", "SRS18536777", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94432, null, 0.07229, null, 0.7261, null, 0.47463, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24935, "SRR25557786", "SRX21286663", "SRS18536776", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant IX", "GSM7688792", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688792", "GSM7688792: Morphant IX; Danio rerio; RNA Seq", "GSM7688792 r1", "GSM7688792", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-IX_S16_L001_R1_001.fastq.gz", "fastq", 513309395.0, 6929648.0, "GSM7688792 r1", "0:74.07", "A:137428462;C:118688804;G:122019962;T:134991729;N:180438", 74, null, null, null, 137428462, 118688804, 122019962, 134991729, 180438, "SRX21286663", "SRS18536776", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94188, null, 0.07029, null, 0.73772, null, 0.47692, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24936, "SRR25557787", "SRX21286663", "SRS18536776", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant IX", "GSM7688792", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688792", "GSM7688792: Morphant IX; Danio rerio; RNA Seq", "GSM7688792 r1", "GSM7688792", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-IX_S16_L002_R1_001.fastq.gz", "fastq", 517356735.0, 6982196.0, "GSM7688792 r2", "0:74.10", "A:138524037;C:119650852;G:122965491;T:136056171;N:160184", 74, null, null, null, 138524037, 119650852, 122965491, 136056171, 160184, "SRX21286663", "SRS18536776", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94281, null, 0.06967, null, 0.73963, null, 0.48142, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24937, "SRR25557788", "SRX21286663", "SRS18536776", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant IX", "GSM7688792", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688792", "GSM7688792: Morphant IX; Danio rerio; RNA Seq", "GSM7688792 r1", "GSM7688792", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-IX_S16_L003_R1_001.fastq.gz", "fastq", 519422328.0, 7010631.0, "GSM7688792 r3", "0:74.09", "A:139040684;C:120128748;G:123529198;T:136551898;N:171800", 74, null, null, null, 139040684, 120128748, 123529198, 136551898, 171800, "SRX21286663", "SRS18536776", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94297, null, 0.06942, null, 0.73726, null, 0.47499, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24938, "SRR25557789", "SRX21286663", "SRS18536776", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant IX", "GSM7688792", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688792", "GSM7688792: Morphant IX; Danio rerio; RNA Seq", "GSM7688792 r1", "GSM7688792", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-IX_S16_L004_R1_001.fastq.gz", "fastq", 511640294.0, 6905748.0, "GSM7688792 r4", "0:74.09", "A:136914638;C:118302866;G:121704665;T:134543505;N:174620", 74, null, null, null, 136914638, 118302866, 121704665, 134543505, 174620, "SRX21286663", "SRS18536776", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94176, null, 0.07029, null, 0.73868, null, 0.47987, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24939, "SRR25557790", "SRX21286662", "SRS18536775", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VIII", "GSM7688791", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688791", "GSM7688791: Morphant VIII; Danio rerio; RNA Seq", "GSM7688791 r1", "GSM7688791", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VIII_S14_L001_R1_001.fastq.gz", "fastq", 429446821.0, 5803178.0, "GSM7688791 r1", "0:74.00", "A:114793535;C:99506379;G:102226914;T:112748761;N:171232", 74, null, null, null, 114793535, 99506379, 102226914, 112748761, 171232, "SRX21286662", "SRS18536775", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94175, null, 0.06669, null, 0.73673, null, 0.48179, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24940, "SRR25557791", "SRX21286662", "SRS18536775", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VIII", "GSM7688791", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688791", "GSM7688791: Morphant VIII; Danio rerio; RNA Seq", "GSM7688791 r1", "GSM7688791", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VIII_S14_L002_R1_001.fastq.gz", "fastq", 434629893.0, 5870828.0, "GSM7688791 r2", "0:74.03", "A:116216940;C:100703527;G:103463365;T:114092681;N:153380", 74, null, null, null, 116216940, 100703527, 103463365, 114092681, 153380, "SRX21286662", "SRS18536775", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94143, null, 0.0676, null, 0.73791, null, 0.48091, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24941, "SRR25557792", "SRX21286662", "SRS18536775", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VIII", "GSM7688791", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688791", "GSM7688791: Morphant VIII; Danio rerio; RNA Seq", "GSM7688791 r1", "GSM7688791", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VIII_S14_L003_R1_001.fastq.gz", "fastq", 435879881.0, 5888685.0, "GSM7688791 r3", "0:74.02", "A:116548094;C:100971153;G:103794902;T:114400770;N:164962", 74, null, null, null, 116548094, 100971153, 103794902, 114400770, 164962, "SRX21286662", "SRS18536775", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94195, null, 0.06686, null, 0.73785, null, 0.48044, null, 73, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24942, "SRR25557793", "SRX21286662", "SRS18536775", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VIII", "GSM7688791", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688791", "GSM7688791: Morphant VIII; Danio rerio; RNA Seq", "GSM7688791 r1", "GSM7688791", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VIII_S14_L004_R1_001.fastq.gz", "fastq", 429478475.0, 5801978.0, "GSM7688791 r4", "0:74.02", "A:114799280;C:99474677;G:102302775;T:112737475;N:164268", 74, null, null, null, 114799280, 99474677, 102302775, 112737475, 164268, "SRX21286662", "SRS18536775", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94118, null, 0.06706, null, 0.73892, null, 0.47732, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24943, "SRR25557794", "SRX21286661", "SRS18536774", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VII", "GSM7688790", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688790", "GSM7688790: Morphant VII; Danio rerio; RNA Seq", "GSM7688790 r1", "GSM7688790", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VII_S15_L001_R1_001.fastq.gz", "fastq", 459545188.0, 6215897.0, "GSM7688790 r1", "0:73.93", "A:121926568;C:107379723;G:110263606;T:119766429;N:208862", 73, null, null, null, 121926568, 107379723, 110263606, 119766429, 208862, "SRX21286661", "SRS18536774", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94273, null, 0.06072, null, 0.74582, null, 0.47499, null, 73, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24944, "SRR25557795", "SRX21286661", "SRS18536774", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VII", "GSM7688790", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688790", "GSM7688790: Morphant VII; Danio rerio; RNA Seq", "GSM7688790 r1", "GSM7688790", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VII_S15_L002_R1_001.fastq.gz", "fastq", 463143624.0, 6261406.0, "GSM7688790 r2", "0:73.97", "A:122917997;C:108229793;G:111099867;T:120713978;N:181989", 73, null, null, null, 122917997, 108229793, 111099867, 120713978, 181989, "SRX21286661", "SRS18536774", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94387, null, 0.06093, null, 0.74341, null, 0.47351, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24945, "SRR25557796", "SRX21286661", "SRS18536774", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VII", "GSM7688790", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688790", "GSM7688790: Morphant VII; Danio rerio; RNA Seq", "GSM7688790 r1", "GSM7688790", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VII_S15_L003_R1_001.fastq.gz", "fastq", 465959664.0, 6300929.0, "GSM7688790 r3", "0:73.95", "A:123689364;C:108847593;G:111847868;T:121377463;N:197376", 73, null, null, null, 123689364, 108847593, 111847868, 121377463, 197376, "SRX21286661", "SRS18536774", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94322, null, 0.06219, null, 0.74357, null, 0.47977, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24946, "SRR25557797", "SRX21286661", "SRS18536774", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VII", "GSM7688790", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688790", "GSM7688790: Morphant VII; Danio rerio; RNA Seq", "GSM7688790 r1", "GSM7688790", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VII_S15_L004_R1_001.fastq.gz", "fastq", 459075430.0, 6207363.0, "GSM7688790 r4", "0:73.96", "A:121797426;C:107221116;G:110209684;T:119657308;N:189896", 73, null, null, null, 121797426, 107221116, 110209684, 119657308, 189896, "SRX21286661", "SRS18536774", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94313, null, 0.06211, null, 0.74343, null, 0.47801, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24947, "SRR25557798", "SRX21286660", "SRS18536773", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control XI", "GSM7688787", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688787", "GSM7688787: Control XI; Danio rerio; RNA Seq", "GSM7688787 r1", "GSM7688787", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-XI_S2_L001_R1_001.fastq.gz", "fastq", 439719566.0, 5947052.0, "GSM7688787 r1", "0:73.94", "A:117482073;C:102083665;G:104685444;T:115272860;N:195524", 73, null, null, null, 117482073, 102083665, 104685444, 115272860, 195524, "SRX21286660", "SRS18536773", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94829, null, 0.06278, null, 0.72525, null, 0.46494, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24948, "SRR25557799", "SRX21286660", "SRS18536773", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control XI", "GSM7688787", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688787", "GSM7688787: Control XI; Danio rerio; RNA Seq", "GSM7688787 r1", "GSM7688787", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-XI_S2_L002_R1_001.fastq.gz", "fastq", 438533503.0, 5927990.0, "GSM7688787 r2", "0:73.98", "A:117199594;C:101810881;G:104402169;T:114946611;N:174248", 73, null, null, null, 117199594, 101810881, 104402169, 114946611, 174248, "SRX21286660", "SRS18536773", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94887, null, 0.06387, null, 0.72827, null, 0.46616, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24949, "SRR25557800", "SRX21286660", "SRS18536773", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control XI", "GSM7688787", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688787", "GSM7688787: Control XI; Danio rerio; RNA Seq", "GSM7688787 r1", "GSM7688787", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-XI_S2_L003_R1_001.fastq.gz", "fastq", 443995554.0, 6003540.0, "GSM7688787 r3", "0:73.96", "A:118663936;C:103031716;G:105723574;T:116387834;N:188494", 73, null, null, null, 118663936, 103031716, 105723574, 116387834, 188494, "SRX21286660", "SRS18536773", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94788, null, 0.06232, null, 0.72693, null, 0.46653, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24950, "SRR25557801", "SRX21286660", "SRS18536773", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control XI", "GSM7688787", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688787", "GSM7688787: Control XI; Danio rerio; RNA Seq", "GSM7688787 r1", "GSM7688787", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-XI_S2_L004_R1_001.fastq.gz", "fastq", 435088869.0, 5882642.0, "GSM7688787 r4", "0:73.96", "A:116261447;C:100986653;G:103615584;T:114042354;N:182831", 73, null, null, null, 116261447, 100986653, 103615584, 114042354, 182831, "SRX21286660", "SRS18536773", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94914, null, 0.06241, null, 0.72829, null, 0.4546, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24951, "SRR25557802", "SRX21286659", "SRS18536772", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control X", "GSM7688785", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688785", "GSM7688785: Control X; Danio rerio; RNA Seq", "GSM7688785 r1", "GSM7688785", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-X_S1_L001_R1_001.fastq.gz", "fastq", 395130702.0, 5338263.0, "GSM7688785 r1", "0:74.02", "A:107005793;C:90183031;G:92316770;T:105476481;N:148627", 74, null, null, null, 107005793, 90183031, 92316770, 105476481, 148627, "SRX21286659", "SRS18536772", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94534, null, 0.07625, null, 0.73888, null, 0.48135, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24952, "SRR25557803", "SRX21286659", "SRS18536772", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control X", "GSM7688785", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688785", "GSM7688785: Control X; Danio rerio; RNA Seq", "GSM7688785 r1", "GSM7688785", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-X_S1_L002_R1_001.fastq.gz", "fastq", 396764458.0, 5358448.0, "GSM7688785 r2", "0:74.04", "A:107513717;C:90540282;G:92658504;T:105917444;N:134511", 74, null, null, null, 107513717, 90540282, 92658504, 105917444, 134511, "SRX21286659", "SRS18536772", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94374, null, 0.07709, null, 0.73878, null, 0.47615, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24953, "SRR25557804", "SRX21286659", "SRS18536772", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control X", "GSM7688785", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688785", "GSM7688785: Control X; Danio rerio; RNA Seq", "GSM7688785 r1", "GSM7688785", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-X_S1_L003_R1_001.fastq.gz", "fastq", 399623551.0, 5397520.0, "GSM7688785 r3", "0:74.04", "A:108230540;C:91192011;G:93388052;T:106665106;N:147842", 74, null, null, null, 108230540, 91192011, 93388052, 106665106, 147842, "SRX21286659", "SRS18536772", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94399, null, 0.07657, null, 0.73797, null, 0.4794, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24954, "SRR25557805", "SRX21286659", "SRS18536772", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control X", "GSM7688785", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688785", "GSM7688785: Control X; Danio rerio; RNA Seq", "GSM7688785 r1", "GSM7688785", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-X_S1_L004_R1_001.fastq.gz", "fastq", 393298978.0, 5312101.0, "GSM7688785 r4", "0:74.04", "A:106518845;C:89734564;G:91901232;T:105004490;N:139847", 74, null, null, null, 106518845, 89734564, 91901232, 105004490, 139847, "SRX21286659", "SRS18536772", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94423, null, 0.07599, null, 0.73884, null, 0.47905, null, 71, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24955, "SRR25557806", "SRX21286658", "SRS18536771", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control IX", "GSM7688783", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688783", "GSM7688783: Control IX; Danio rerio; RNA Seq", "GSM7688783 r1", "GSM7688783", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-IX_S22_L001_R1_001.fastq.gz", "fastq", 366045799.0, 4944832.0, "GSM7688783 r1", "0:74.03", "A:98000119;C:84654222;G:86951226;T:96295351;N:144881", 74, null, null, null, 98000119, 84654222, 86951226, 96295351, 144881, "SRX21286658", "SRS18536771", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94303, null, 0.07499, null, 0.73085, null, 0.47881, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24956, "SRR25557807", "SRX21286658", "SRS18536771", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control IX", "GSM7688783", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688783", "GSM7688783: Control IX; Danio rerio; RNA Seq", "GSM7688783 r1", "GSM7688783", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-IX_S22_L002_R1_001.fastq.gz", "fastq", 369429068.0, 4988719.0, "GSM7688783 r2", "0:74.05", "A:98907882;C:85446993;G:87729593;T:97216477;N:128123", 74, null, null, null, 98907882, 85446993, 87729593, 97216477, 128123, "SRX21286658", "SRS18536771", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94261, null, 0.07335, null, 0.72969, null, 0.47867, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24957, "SRR25557808", "SRX21286658", "SRS18536771", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control IX", "GSM7688783", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688783", "GSM7688783: Control IX; Danio rerio; RNA Seq", "GSM7688783 r1", "GSM7688783", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-IX_S22_L003_R1_001.fastq.gz", "fastq", 369967330.0, 4996710.0, "GSM7688783 r3", "0:74.04", "A:99035743;C:85549878;G:87926587;T:97310812;N:144310", 74, null, null, null, 99035743, 85549878, 87926587, 97310812, 144310, "SRX21286658", "SRS18536771", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94328, null, 0.0743, null, 0.73034, null, 0.47133, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24958, "SRR25557809", "SRX21286658", "SRS18536771", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control IX", "GSM7688783", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688783", "GSM7688783: Control IX; Danio rerio; RNA Seq", "GSM7688783 r1", "GSM7688783", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-IX_S22_L004_R1_001.fastq.gz", "fastq", 365499176.0, 4936305.0, "GSM7688783 r4", "0:74.04", "A:97825658;C:84517732;G:86863655;T:96157429;N:134702", 74, null, null, null, 97825658, 84517732, 86863655, 96157429, 134702, "SRX21286658", "SRS18536771", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94286, null, 0.07288, null, 0.72999, null, 0.4783, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24959, "SRR25557810", "SRX21286657", "SRS18536770", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VIII", "GSM7688782", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688782", "GSM7688782: Control VIII; Danio rerio; RNA Seq", "GSM7688782 r1", "GSM7688782", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VIII_S20_L001_R1_001.fastq.gz", "fastq", 488585907.0, 6585668.0, "GSM7688782 r1", "0:74.19", "A:131727468;C:112349971;G:115189425;T:129203159;N:115884", 74, null, null, null, 131727468, 112349971, 115189425, 129203159, 115884, "SRX21286657", "SRS18536770", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.93794, null, 0.07381, null, 0.7315, null, 0.47355, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24960, "SRR25557811", "SRX21286657", "SRS18536770", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VIII", "GSM7688782", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688782", "GSM7688782: Control VIII; Danio rerio; RNA Seq", "GSM7688782 r1", "GSM7688782", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VIII_S20_L002_R1_001.fastq.gz", "fastq", 493766544.0, 6653820.0, "GSM7688782 r2", "0:74.21", "A:133135166;C:113551418;G:116398455;T:130575771;N:105734", 74, null, null, null, 133135166, 113551418, 116398455, 130575771, 105734, "SRX21286657", "SRS18536770", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.93729, null, 0.07312, null, 0.7307, null, 0.47966, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24961, "SRR25557812", "SRX21286657", "SRS18536770", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VIII", "GSM7688782", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688782", "GSM7688782: Control VIII; Danio rerio; RNA Seq", "GSM7688782 r1", "GSM7688782", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VIII_S20_L003_R1_001.fastq.gz", "fastq", 494935071.0, 6670024.0, "GSM7688782 r3", "0:74.20", "A:133406912;C:113769494;G:116771560;T:130871612;N:115493", 74, null, null, null, 133406912, 113769494, 116771560, 130871612, 115493, "SRX21286657", "SRS18536770", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.93847, null, 0.07383, null, 0.73194, null, 0.47646, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24962, "SRR25557813", "SRX21286657", "SRS18536770", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VIII", "GSM7688782", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688782", "GSM7688782: Control VIII; Danio rerio; RNA Seq", "GSM7688782 r1", "GSM7688782", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VIII_S20_L004_R1_001.fastq.gz", "fastq", 487644286.0, 6572100.0, "GSM7688782 r4", "0:74.20", "A:131423055;C:112092623;G:115067911;T:128945959;N:114738", 74, null, null, null, 131423055, 112092623, 115067911, 128945959, 114738, "SRX21286657", "SRS18536770", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.93708, null, 0.0732, null, 0.73186, null, 0.4781, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24963, "SRR25557814", "SRX21286656", "SRS18536769", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VII", "GSM7688781", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688781", "GSM7688781: Control VII; Danio rerio; RNA Seq", "GSM7688781 r1", "GSM7688781", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VII_S21_L001_R1_001.fastq.gz", "fastq", 419048369.0, 5664168.0, "GSM7688781 r1", "0:73.98", "A:111569757;C:97553687;G:100228004;T:109523480;N:173441", 73, null, null, null, 111569757, 97553687, 100228004, 109523480, 173441, "SRX21286656", "SRS18536769", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94179, null, 0.06596, null, 0.74499, null, 0.46809, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24964, "SRR25557815", "SRX21286656", "SRS18536769", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VII", "GSM7688781", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688781", "GSM7688781: Control VII; Danio rerio; RNA Seq", "GSM7688781 r1", "GSM7688781", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VII_S21_L002_R1_001.fastq.gz", "fastq", 422419362.0, 5707444.0, "GSM7688781 r2", "0:74.01", "A:112476977;C:98366185;G:101046586;T:110369882;N:159732", 74, null, null, null, 112476977, 98366185, 101046586, 110369882, 159732, "SRX21286656", "SRS18536769", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94275, null, 0.06539, null, 0.74523, null, 0.47247, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24965, "SRR25557816", "SRX21286656", "SRS18536769", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VII", "GSM7688781", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688781", "GSM7688781: Control VII; Danio rerio; RNA Seq", "GSM7688781 r1", "GSM7688781", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VII_S21_L003_R1_001.fastq.gz", "fastq", 424260551.0, 5733133.0, "GSM7688781 r3", "0:74.00", "A:112957538;C:98789480;G:101496747;T:110850186;N:166600", 74, null, null, null, 112957538, 98789480, 101496747, 110850186, 166600, "SRX21286656", "SRS18536769", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94174, null, 0.06482, null, 0.74304, null, 0.46935, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24966, "SRR25557817", "SRX21286656", "SRS18536769", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VII", "GSM7688781", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688781", "GSM7688781: Control VII; Danio rerio; RNA Seq", "GSM7688781 r1", "GSM7688781", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VII_S21_L004_R1_001.fastq.gz", "fastq", 417875320.0, 5646817.0, "GSM7688781 r4", "0:74.00", "A:111226895;C:97273168;G:100030641;T:109182520;N:162096", 74, null, null, null, 111226895, 97273168, 100030641, 109182520, 162096, "SRX21286656", "SRS18536769", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94352, null, 0.06524, null, 0.74442, null, 0.47095, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [40356, "SRR3109810", "SRX1538264", "SRS1254843", "SRP068656", "PRJNA309293", "RNA sequencing of adult zebrafish spinal cord", "GSE77025", "Transcriptome Analysis", "The goal of this study is to determine gene expression changes in the adult zebrafish spinal cord at 2 weeks post complete transection. Overall design: 2 samples were analyzed in duplicates:  sham injured spinal cord and transected spinal cord at 2 xxx post injury", null, "pubmed:27811277", null, "transected spinal cord b", "GSM2042684", null, "source name:spinal cord  transected  2 xxx post injury|age:6 month|tissue:spinal cord|tratment:2 weeks post transection injury", "transected spinal cord b", "Quality QC using Fastx Trimming of adapters and short sequences using Fastx Mapping using Bowtie2 Assembly using Cufflinks Quantification using Cuffdiff Genome build: zebrafish Zv9 genome Supplementary files format and content: gene exp.diff file includes gene expression data of injured spinal cord tissue relative to sham injured control tissue", "spinal cord  transected  2 xxx post injury", "Animals underwent complete cervical spinal cord transection  and spinal cord tissue was collected 2 xxx post injury.  Control animals were sham injured and spinal cord was collected at 2 wks post sham.", "RNA was extracted with Trizol reagent  followed by clean up and DNase I treatment with QIAGEN RNeasy mini kit in accordance with the prescribed protocol provided with the kit. Quality control was performed with Agilent Bioanalyser. TruSeq libraries were constructed according to manufacturer's instructions", "Adult  6 mpf wild type zebrafish were used for this study", "age:6 month|tissue:spinal cord|tratment:2 weeks post transection injury", "GSM2042684", "GSM2042684: transected spinal cord b; Danio rerio; RNA Seq", "GSM2042684", null, "1", "RNA was extracted with Trizol reagent  followed by clean up and DNase I treatment with QIAGEN RNeasy mini kit in accordance with the prescribed protocol provided with the kit. Quality control was performed with Agilent Bioanalyser. TruSeq libraries were constructed according to manufacturer's instructions", "GEO Accession:GSM2042684", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP068656", null, null, "Sample_mm4b.bam", "bam", 1171337622.0, 23961004.0, "GSM2042684 r1", "0:48.89", "A:316224903;C:272433131;G:255385026;T:327251225;N:43337", 48, null, null, null, 316224903, 272433131, 255385026, 327251225, 43337, "SRX1538264", "SRS1254843", "SRA336740", "GEO", "Ken Poss Lab, Cell Biology, Duke University Medical Center", 1, 0.95542, null, 0.0725, null, 0.68816, null, 0.45919, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2016-01-20", "Adult", "Adult", "Spinal Cord", "Nervous System"], [40357, "SRR3109809", "SRX1538263", "SRS1254842", "SRP068656", "PRJNA309293", "RNA sequencing of adult zebrafish spinal cord", "GSE77025", "Transcriptome Analysis", "The goal of this study is to determine gene expression changes in the adult zebrafish spinal cord at 2 weeks post complete transection. Overall design: 2 samples were analyzed in duplicates:  sham injured spinal cord and transected spinal cord at 2 xxx post injury", null, "pubmed:27811277", null, "transected spinal cord a", "GSM2042683", null, "source name:spinal cord  transected  2 xxx post injury|age:6 month|tissue:spinal cord|tratment:2 weeks post transection injury", "transected spinal cord a", "Quality QC using Fastx Trimming of adapters and short sequences using Fastx Mapping using Bowtie2 Assembly using Cufflinks Quantification using Cuffdiff Genome build: zebrafish Zv9 genome Supplementary files format and content: gene exp.diff file includes gene expression data of injured spinal cord tissue relative to sham injured control tissue", "spinal cord  transected  2 xxx post injury", "Animals underwent complete cervical spinal cord transection  and spinal cord tissue was collected 2 xxx post injury.  Control animals were sham injured and spinal cord was collected at 2 wks post sham.", "RNA was extracted with Trizol reagent  followed by clean up and DNase I treatment with QIAGEN RNeasy mini kit in accordance with the prescribed protocol provided with the kit. Quality control was performed with Agilent Bioanalyser. TruSeq libraries were constructed according to manufacturer's instructions", "Adult  6 mpf wild type zebrafish were used for this study", "age:6 month|tissue:spinal cord|tratment:2 weeks post transection injury", "GSM2042683", "GSM2042683: transected spinal cord a; Danio rerio; RNA Seq", "GSM2042683", null, "1", "RNA was extracted with Trizol reagent  followed by clean up and DNase I treatment with QIAGEN RNeasy mini kit in accordance with the prescribed protocol provided with the kit. Quality control was performed with Agilent Bioanalyser. TruSeq libraries were constructed according to manufacturer's instructions", "GEO Accession:GSM2042683", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP068656", null, null, "Sample_mm4a.bam", "bam", 906559320.0, 18557265.0, "GSM2042683 r1", null, null, null, null, null, null, null, null, null, null, null, "SRX1538263", "SRS1254842", "SRA336740", "GEO", "Ken Poss Lab, Cell Biology, Duke University Medical Center", 1, 0.9696, null, 0.06993, null, 0.68913, null, 0.4662, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2016-01-20", "Adult", "Adult", "Spinal Cord", "Nervous System"], [40358, "SRR3109808", "SRX1538262", "SRS1254844", "SRP068656", "PRJNA309293", "RNA sequencing of adult zebrafish spinal cord", "GSE77025", "Transcriptome Analysis", "The goal of this study is to determine gene expression changes in the adult zebrafish spinal cord at 2 weeks post complete transection. Overall design: 2 samples were analyzed in duplicates:  sham injured spinal cord and transected spinal cord at 2 xxx post injury", null, "pubmed:27811277", null, "sham spinal cord b", "GSM2042682", null, "source name:spinal cord  sham control  2 wks post sham|age:6 month|tissue:spinal cord|tratment:2 wks post sham injury", "sham spinal cord b", "Quality QC using Fastx Trimming of adapters and short sequences using Fastx Mapping using Bowtie2 Assembly using Cufflinks Quantification using Cuffdiff Genome build: zebrafish Zv9 genome Supplementary files format and content: gene exp.diff file includes gene expression data of injured spinal cord tissue relative to sham injured control tissue", "spinal cord  sham control  2 wks post sham", "Animals underwent complete cervical spinal cord transection  and spinal cord tissue was collected 2 xxx post injury.  Control animals were sham injured and spinal cord was collected at 2 wks post sham.", "RNA was extracted with Trizol reagent  followed by clean up and DNase I treatment with QIAGEN RNeasy mini kit in accordance with the prescribed protocol provided with the kit. Quality control was performed with Agilent Bioanalyser. TruSeq libraries were constructed according to manufacturer's instructions", "Adult  6 mpf wild type zebrafish were used for this study", "age:6 month|tissue:spinal cord|tratment:2 wks post sham injury", "GSM2042682", "GSM2042682: sham spinal cord b; Danio rerio; RNA Seq", "GSM2042682", null, "1", "RNA was extracted with Trizol reagent  followed by clean up and DNase I treatment with QIAGEN RNeasy mini kit in accordance with the prescribed protocol provided with the kit. Quality control was performed with Agilent Bioanalyser. TruSeq libraries were constructed according to manufacturer's instructions", "GEO Accession:GSM2042682", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP068656", null, null, "Sample_mm2b.bam", "bam", 976598317.0, 19979953.0, "GSM2042682 r1", "0:48.88", "A:269123614;C:222873099;G:208746430;T:275819417;N:35757", 48, null, null, null, 269123614, 222873099, 208746430, 275819417, 35757, "SRX1538262", "SRS1254844", "SRA336740", "GEO", "Ken Poss Lab, Cell Biology, Duke University Medical Center", 1, 0.95785, null, 0.09352, null, 0.71433, null, 0.48637, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2016-01-20", "Adult", "Adult", "Spinal Cord", "Nervous System"], [40359, "SRR3109807", "SRX1538261", "SRS1254845", "SRP068656", "PRJNA309293", "RNA sequencing of adult zebrafish spinal cord", "GSE77025", "Transcriptome Analysis", "The goal of this study is to determine gene expression changes in the adult zebrafish spinal cord at 2 weeks post complete transection. Overall design: 2 samples were analyzed in duplicates:  sham injured spinal cord and transected spinal cord at 2 xxx post injury", null, "pubmed:27811277", null, "sham spinal cord a", "GSM2042681", null, "source name:spinal cord  sham control  2 wks post sham|age:6 month|tissue:spinal cord|tratment:2 wks post sham injury", "sham spinal cord a", "Quality QC using Fastx Trimming of adapters and short sequences using Fastx Mapping using Bowtie2 Assembly using Cufflinks Quantification using Cuffdiff Genome build: zebrafish Zv9 genome Supplementary files format and content: gene exp.diff file includes gene expression data of injured spinal cord tissue relative to sham injured control tissue", "spinal cord  sham control  2 wks post sham", "Animals underwent complete cervical spinal cord transection  and spinal cord tissue was collected 2 xxx post injury.  Control animals were sham injured and spinal cord was collected at 2 wks post sham.", "RNA was extracted with Trizol reagent  followed by clean up and DNase I treatment with QIAGEN RNeasy mini kit in accordance with the prescribed protocol provided with the kit. Quality control was performed with Agilent Bioanalyser. TruSeq libraries were constructed according to manufacturer's instructions", "Adult  6 mpf wild type zebrafish were used for this study", "age:6 month|tissue:spinal cord|tratment:2 wks post sham injury", "GSM2042681", "GSM2042681: sham spinal cord a; Danio rerio; RNA Seq", "GSM2042681", null, "1", "RNA was extracted with Trizol reagent  followed by clean up and DNase I treatment with QIAGEN RNeasy mini kit in accordance with the prescribed protocol provided with the kit. Quality control was performed with Agilent Bioanalyser. TruSeq libraries were constructed according to manufacturer's instructions", "GEO Accession:GSM2042681", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP068656", null, null, "Sample_mm2a.bam", "bam", 1576837523.0, 32234481.0, "GSM2042681 r1", "0:48.92", "A:437851706;C:356136709;G:337965564;T:444822016;N:61528", 48, null, null, null, 437851706, 356136709, 337965564, 444822016, 61528, "SRX1538261", "SRS1254845", "SRA336740", "GEO", "Ken Poss Lab, Cell Biology, Duke University Medical Center", 1, 0.95904, null, 0.09551, null, 0.71486, null, 0.48699, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2016-01-20", "Adult", "Adult", "Spinal Cord", "Nervous System"], [42545, "SRR5805915", "SRX2985081", "SRS2337741", "SRP111129", "PRJNA393181", "Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro", "GSE100821", "Transcriptome Analysis", "Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded  and therefore vulnerable  axons. Demyelination is the result of a primary insult and secondary injury  leading to conduction blocks and long term degeneration of the axons  which subsequently can lead to the loss of their neuron. In response to SCI  dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore  researchers strive to control OPC responses  and utilize small molecule screening approaches in order to identify mechanisms of OPC activation  proliferation  migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations  5 biological replicates per population", null, "pubmed:28959189", null, "OL5", "GSM2694027", null, "tissue:adult spinal cord|cell type:oligodendrocyte", "OL5", "basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments  were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID  Chromosom  Exon Start Coordinates  Exon End Coordinates  Gene Length; Counts from the 2 Conditions and their 5 replicates", "adult spinal cord", null, "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", null, "cell type:oligodendrocyte", "GSM2694027", "GSM2694027: OL5; Danio rerio; RNA Seq", "GSM2694027", null, "1", "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", "GEO Accession:GSM2694027", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP111129", null, null, "L13381_Track-36588_R1.fastq.gz", "fastq", 367232608.0, 4832008.0, "GSM2694027 r1", "0:76", "A:108020448;C:77176838;G:77161902;T:104867470;N:5950", 76, null, null, null, 108020448, 77176838, 77161902, 104867470, 5950, "SRX2985081", "SRS2337741", "SRA584085", "GEO", "Reimer Lab, CRT Dresden, TU Dresden", 1, 0.90504, null, 0.10694, null, 0.81897, null, 0.34015, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2017-07-05", "Adult", "Adult", "Spinal Cord", "Nervous System"], [42546, "SRR5805916", "SRX2985081", "SRS2337741", "SRP111129", "PRJNA393181", "Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro", "GSE100821", "Transcriptome Analysis", "Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded  and therefore vulnerable  axons. Demyelination is the result of a primary insult and secondary injury  leading to conduction blocks and long term degeneration of the axons  which subsequently can lead to the loss of their neuron. In response to SCI  dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore  researchers strive to control OPC responses  and utilize small molecule screening approaches in order to identify mechanisms of OPC activation  proliferation  migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations  5 biological replicates per population", null, "pubmed:28959189", null, "OL5", "GSM2694027", null, "tissue:adult spinal cord|cell type:oligodendrocyte", "OL5", "basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments  were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID  Chromosom  Exon Start Coordinates  Exon End Coordinates  Gene Length; Counts from the 2 Conditions and their 5 replicates", "adult spinal cord", null, "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", null, "cell type:oligodendrocyte", "GSM2694027", "GSM2694027: OL5; Danio rerio; RNA Seq", "GSM2694027", null, "1", "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", "GEO Accession:GSM2694027", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP111129", null, null, "L13381_Track-36601_R1.fastq.gz", "fastq", 1112803020.0, 14642145.0, "GSM2694027 r2", "0:76", "A:327618064;C:233631080;G:233528495;T:318005605;N:19776", 76, null, null, null, 327618064, 233631080, 233528495, 318005605, 19776, "SRX2985081", "SRS2337741", "SRA584085", "GEO", "Reimer Lab, CRT Dresden, TU Dresden", 1, 0.90398, null, 0.10742, null, 0.81895, null, 0.3387, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2017-07-05", "Adult", "Adult", "Spinal Cord", "Nervous System"], [42547, "SRR5805917", "SRX2985081", "SRS2337741", "SRP111129", "PRJNA393181", "Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro", "GSE100821", "Transcriptome Analysis", "Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded  and therefore vulnerable  axons. Demyelination is the result of a primary insult and secondary injury  leading to conduction blocks and long term degeneration of the axons  which subsequently can lead to the loss of their neuron. In response to SCI  dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore  researchers strive to control OPC responses  and utilize small molecule screening approaches in order to identify mechanisms of OPC activation  proliferation  migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations  5 biological replicates per population", null, "pubmed:28959189", null, "OL5", "GSM2694027", null, "tissue:adult spinal cord|cell type:oligodendrocyte", "OL5", "basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments  were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID  Chromosom  Exon Start Coordinates  Exon End Coordinates  Gene Length; Counts from the 2 Conditions and their 5 replicates", "adult spinal cord", null, "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", null, "cell type:oligodendrocyte", "GSM2694027", "GSM2694027: OL5; Danio rerio; RNA Seq", "GSM2694027", null, "1", "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", "GEO Accession:GSM2694027", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP111129", null, null, "L13381_Track-36721_R1.fastq.gz", "fastq", 1366015412.0, 17973887.0, "GSM2694027 r3", "0:76", "A:404748086;C:283771453;G:285083287;T:392327918;N:84668", 76, null, null, null, 404748086, 283771453, 285083287, 392327918, 84668, "SRX2985081", "SRS2337741", "SRA584085", "GEO", "Reimer Lab, CRT Dresden, TU Dresden", 1, 0.90185, null, 0.11132, null, 0.82154, null, 0.34006, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2017-07-05", "Adult", "Adult", "Spinal Cord", "Nervous System"], [42548, "SRR5805912", "SRX2985080", "SRS2337740", "SRP111129", "PRJNA393181", "Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro", "GSE100821", "Transcriptome Analysis", "Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded  and therefore vulnerable  axons. Demyelination is the result of a primary insult and secondary injury  leading to conduction blocks and long term degeneration of the axons  which subsequently can lead to the loss of their neuron. In response to SCI  dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore  researchers strive to control OPC responses  and utilize small molecule screening approaches in order to identify mechanisms of OPC activation  proliferation  migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations  5 biological replicates per population", null, "pubmed:28959189", null, "OL4", "GSM2694026", null, "tissue:adult spinal cord|cell type:oligodendrocyte", "OL4", "basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments  were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID  Chromosom  Exon Start Coordinates  Exon End Coordinates  Gene Length; Counts from the 2 Conditions and their 5 replicates", "adult spinal cord", null, "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", null, "cell type:oligodendrocyte", "GSM2694026", "GSM2694026: OL4; Danio rerio; RNA Seq", "GSM2694026", null, "1", "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", "GEO Accession:GSM2694026", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP111129", null, null, "L13380_Track-36587_R1.fastq.gz", "fastq", 360675556.0, 4745731.0, "GSM2694026 r1", "0:76", "A:106025824;C:75705006;G:76148954;T:102789747;N:6025", 76, null, null, null, 106025824, 75705006, 76148954, 102789747, 6025, "SRX2985080", "SRS2337740", "SRA584085", "GEO", "Reimer Lab, CRT Dresden, TU Dresden", 1, 0.86855, null, 0.08794, null, 0.82112, null, 0.32375, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2017-07-05", "Adult", "Adult", "Spinal Cord", "Nervous System"], [42549, "SRR5805913", "SRX2985080", "SRS2337740", "SRP111129", "PRJNA393181", "Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro", "GSE100821", "Transcriptome Analysis", "Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded  and therefore vulnerable  axons. Demyelination is the result of a primary insult and secondary injury  leading to conduction blocks and long term degeneration of the axons  which subsequently can lead to the loss of their neuron. In response to SCI  dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore  researchers strive to control OPC responses  and utilize small molecule screening approaches in order to identify mechanisms of OPC activation  proliferation  migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations  5 biological replicates per population", null, "pubmed:28959189", null, "OL4", "GSM2694026", null, "tissue:adult spinal cord|cell type:oligodendrocyte", "OL4", "basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments  were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID  Chromosom  Exon Start Coordinates  Exon End Coordinates  Gene Length; Counts from the 2 Conditions and their 5 replicates", "adult spinal cord", null, "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", null, "cell type:oligodendrocyte", "GSM2694026", "GSM2694026: OL4; Danio rerio; RNA Seq", "GSM2694026", null, "1", "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", "GEO Accession:GSM2694026", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP111129", null, null, "L13380_Track-36600_R1.fastq.gz", "fastq", 1098926332.0, 14459557.0, "GSM2694026 r2", "0:76", "A:323251709;C:230498299;G:231757231;T:313399836;N:19257", 76, null, null, null, 323251709, 230498299, 231757231, 313399836, 19257, "SRX2985080", "SRS2337740", "SRA584085", "GEO", "Reimer Lab, CRT Dresden, TU Dresden", 1, 0.90618, null, 0.09414, null, 0.82215, null, 0.32432, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2017-07-05", "Adult", "Adult", "Spinal Cord", "Nervous System"], [42550, "SRR5805914", "SRX2985080", "SRS2337740", "SRP111129", "PRJNA393181", "Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro", "GSE100821", "Transcriptome Analysis", "Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded  and therefore vulnerable  axons. Demyelination is the result of a primary insult and secondary injury  leading to conduction blocks and long term degeneration of the axons  which subsequently can lead to the loss of their neuron. In response to SCI  dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore  researchers strive to control OPC responses  and utilize small molecule screening approaches in order to identify mechanisms of OPC activation  proliferation  migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations  5 biological replicates per population", null, "pubmed:28959189", null, "OL4", "GSM2694026", null, "tissue:adult spinal cord|cell type:oligodendrocyte", "OL4", "basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments  were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID  Chromosom  Exon Start Coordinates  Exon End Coordinates  Gene Length; Counts from the 2 Conditions and their 5 replicates", "adult spinal cord", null, "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", null, "cell type:oligodendrocyte", "GSM2694026", "GSM2694026: OL4; Danio rerio; RNA Seq", "GSM2694026", null, "1", "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", "GEO Accession:GSM2694026", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP111129", null, null, "L13380_Track-36720_R1.fastq.gz", "fastq", 1193782464.0, 15707664.0, "GSM2694026 r3", "0:76", "A:353125594;C:247908840;G:250316138;T:342359001;N:72891", 76, null, null, null, 353125594, 247908840, 250316138, 342359001, 72891, "SRX2985080", "SRS2337740", "SRA584085", "GEO", "Reimer Lab, CRT Dresden, TU Dresden", 1, 0.90544, null, 0.09556, null, 0.82233, null, 0.32116, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2017-07-05", "Adult", "Adult", "Spinal Cord", "Nervous System"], [42551, "SRR5805909", "SRX2985079", "SRS2337739", "SRP111129", "PRJNA393181", "Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro", "GSE100821", "Transcriptome Analysis", "Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded  and therefore vulnerable  axons. Demyelination is the result of a primary insult and secondary injury  leading to conduction blocks and long term degeneration of the axons  which subsequently can lead to the loss of their neuron. In response to SCI  dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore  researchers strive to control OPC responses  and utilize small molecule screening approaches in order to identify mechanisms of OPC activation  proliferation  migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations  5 biological replicates per population", null, "pubmed:28959189", null, "OL3", "GSM2694025", null, "tissue:adult spinal cord|cell type:oligodendrocyte", "OL3", "basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments  were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID  Chromosom  Exon Start Coordinates  Exon End Coordinates  Gene Length; Counts from the 2 Conditions and their 5 replicates", "adult spinal cord", null, "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", null, "cell type:oligodendrocyte", "GSM2694025", "GSM2694025: OL3; Danio rerio; RNA Seq", "GSM2694025", null, "1", "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", "GEO Accession:GSM2694025", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP111129", null, null, "L13379_Track-36586_R1.fastq.gz", "fastq", 312102360.0, 4106610.0, "GSM2694025 r1", "0:76", "A:91621229;C:65883338;G:65770808;T:88821893;N:5092", 76, null, null, null, 91621229, 65883338, 65770808, 88821893, 5092, "SRX2985079", "SRS2337739", "SRA584085", "GEO", "Reimer Lab, CRT Dresden, TU Dresden", 1, 0.86402, null, 0.09444, null, 0.82181, null, 0.33279, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2017-07-05", "Adult", "Adult", "Spinal Cord", "Nervous System"], [42552, "SRR5805910", "SRX2985079", "SRS2337739", "SRP111129", "PRJNA393181", "Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro", "GSE100821", "Transcriptome Analysis", "Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded  and therefore vulnerable  axons. Demyelination is the result of a primary insult and secondary injury  leading to conduction blocks and long term degeneration of the axons  which subsequently can lead to the loss of their neuron. In response to SCI  dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore  researchers strive to control OPC responses  and utilize small molecule screening approaches in order to identify mechanisms of OPC activation  proliferation  migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations  5 biological replicates per population", null, "pubmed:28959189", null, "OL3", "GSM2694025", null, "tissue:adult spinal cord|cell type:oligodendrocyte", "OL3", "basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments  were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID  Chromosom  Exon Start Coordinates  Exon End Coordinates  Gene Length; Counts from the 2 Conditions and their 5 replicates", "adult spinal cord", null, "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", null, "cell type:oligodendrocyte", "GSM2694025", "GSM2694025: OL3; Danio rerio; RNA Seq", "GSM2694025", null, "1", "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", "GEO Accession:GSM2694025", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP111129", null, null, "L13379_Track-36599_R1.fastq.gz", "fastq", 994629328.0, 13087228.0, "GSM2694025 r2", "0:76", "A:292173588;C:209769693;G:209444134;T:283224496;N:17417", 76, null, null, null, 292173588, 209769693, 209444134, 283224496, 17417, "SRX2985079", "SRS2337739", "SRA584085", "GEO", "Reimer Lab, CRT Dresden, TU Dresden", 1, 0.90872, null, 0.10051, null, 0.82233, null, 0.32123, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2017-07-05", "Adult", "Adult", "Spinal Cord", "Nervous System"], [42553, "SRR5805911", "SRX2985079", "SRS2337739", "SRP111129", "PRJNA393181", "Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro", "GSE100821", "Transcriptome Analysis", "Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded  and therefore vulnerable  axons. Demyelination is the result of a primary insult and secondary injury  leading to conduction blocks and long term degeneration of the axons  which subsequently can lead to the loss of their neuron. In response to SCI  dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore  researchers strive to control OPC responses  and utilize small molecule screening approaches in order to identify mechanisms of OPC activation  proliferation  migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations  5 biological replicates per population", null, "pubmed:28959189", null, "OL3", "GSM2694025", null, "tissue:adult spinal cord|cell type:oligodendrocyte", "OL3", "basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments  were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID  Chromosom  Exon Start Coordinates  Exon End Coordinates  Gene Length; Counts from the 2 Conditions and their 5 replicates", "adult spinal cord", null, "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", null, "cell type:oligodendrocyte", "GSM2694025", "GSM2694025: OL3; Danio rerio; RNA Seq", "GSM2694025", null, "1", "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", "GEO Accession:GSM2694025", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP111129", null, null, "L13379_Track-36719_R1.fastq.gz", "fastq", 1183535688.0, 15572838.0, "GSM2694025 r3", "0:76", "A:349531521;C:247172348;G:248019907;T:338738175;N:73737", 76, null, null, null, 349531521, 247172348, 248019907, 338738175, 73737, "SRX2985079", "SRS2337739", "SRA584085", "GEO", "Reimer Lab, CRT Dresden, TU Dresden", 1, 0.90617, null, 0.10315, null, 0.82329, null, 0.33103, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2017-07-05", "Adult", "Adult", "Spinal Cord", "Nervous System"], [42554, "SRR5805906", "SRX2985078", "SRS2337738", "SRP111129", "PRJNA393181", "Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro", "GSE100821", "Transcriptome Analysis", "Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded  and therefore vulnerable  axons. Demyelination is the result of a primary insult and secondary injury  leading to conduction blocks and long term degeneration of the axons  which subsequently can lead to the loss of their neuron. In response to SCI  dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore  researchers strive to control OPC responses  and utilize small molecule screening approaches in order to identify mechanisms of OPC activation  proliferation  migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations  5 biological replicates per population", null, "pubmed:28959189", null, "OL2", "GSM2694024", null, "tissue:adult spinal cord|cell type:oligodendrocyte", "OL2", "basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments  were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID  Chromosom  Exon Start Coordinates  Exon End Coordinates  Gene Length; Counts from the 2 Conditions and their 5 replicates", "adult spinal cord", null, "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", null, "cell type:oligodendrocyte", "GSM2694024", "GSM2694024: OL2; Danio rerio; RNA Seq", "GSM2694024", null, "1", "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", "GEO Accession:GSM2694024", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP111129", null, null, "L13378_Track-36585_R1.fastq.gz", "fastq", 405537748.0, 5336023.0, "GSM2694024 r1", "0:76", "A:118435711;C:85437254;G:85942337;T:115715820;N:6626", 76, null, null, null, 118435711, 85437254, 85942337, 115715820, 6626, "SRX2985078", "SRS2337738", "SRA584085", "GEO", "Reimer Lab, CRT Dresden, TU Dresden", 1, 0.8695, null, 0.09795, null, 0.82189, null, 0.33413, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2017-07-05", "Adult", "Adult", "Spinal Cord", "Nervous System"], [42555, "SRR5805907", "SRX2985078", "SRS2337738", "SRP111129", "PRJNA393181", "Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro", "GSE100821", "Transcriptome Analysis", "Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded  and therefore vulnerable  axons. Demyelination is the result of a primary insult and secondary injury  leading to conduction blocks and long term degeneration of the axons  which subsequently can lead to the loss of their neuron. In response to SCI  dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore  researchers strive to control OPC responses  and utilize small molecule screening approaches in order to identify mechanisms of OPC activation  proliferation  migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations  5 biological replicates per population", null, "pubmed:28959189", null, "OL2", "GSM2694024", null, "tissue:adult spinal cord|cell type:oligodendrocyte", "OL2", "basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments  were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID  Chromosom  Exon Start Coordinates  Exon End Coordinates  Gene Length; Counts from the 2 Conditions and their 5 replicates", "adult spinal cord", null, "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", null, "cell type:oligodendrocyte", "GSM2694024", "GSM2694024: OL2; Danio rerio; RNA Seq", "GSM2694024", null, "1", "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", "GEO Accession:GSM2694024", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP111129", null, null, "L13378_Track-36598_R1.fastq.gz", "fastq", 1228952756.0, 16170431.0, "GSM2694024 r2", "0:76", "A:359305067;C:258652975;G:260090708;T:350882129;N:21877", 76, null, null, null, 359305067, 258652975, 260090708, 350882129, 21877, "SRX2985078", "SRS2337738", "SRA584085", "GEO", "Reimer Lab, CRT Dresden, TU Dresden", 1, 0.90938, null, 0.10251, null, 0.82031, null, 0.32861, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2017-07-05", "Adult", "Adult", "Spinal Cord", "Nervous System"], [42556, "SRR5805908", "SRX2985078", "SRS2337738", "SRP111129", "PRJNA393181", "Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro", "GSE100821", "Transcriptome Analysis", "Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded  and therefore vulnerable  axons. Demyelination is the result of a primary insult and secondary injury  leading to conduction blocks and long term degeneration of the axons  which subsequently can lead to the loss of their neuron. In response to SCI  dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore  researchers strive to control OPC responses  and utilize small molecule screening approaches in order to identify mechanisms of OPC activation  proliferation  migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations  5 biological replicates per population", null, "pubmed:28959189", null, "OL2", "GSM2694024", null, "tissue:adult spinal cord|cell type:oligodendrocyte", "OL2", "basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments  were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID  Chromosom  Exon Start Coordinates  Exon End Coordinates  Gene Length; Counts from the 2 Conditions and their 5 replicates", "adult spinal cord", null, "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", null, "cell type:oligodendrocyte", "GSM2694024", "GSM2694024: OL2; Danio rerio; RNA Seq", "GSM2694024", null, "1", "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", "GEO Accession:GSM2694024", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP111129", null, null, "L13378_Track-36718_R1.fastq.gz", "fastq", 1468733440.0, 19325440.0, "GSM2694024 r3", "0:76", "A:431919690;C:306294778;G:309065028;T:421362107;N:91837", 76, null, null, null, 431919690, 306294778, 309065028, 421362107, 91837, "SRX2985078", "SRS2337738", "SRA584085", "GEO", "Reimer Lab, CRT Dresden, TU Dresden", 1, 0.90756, null, 0.10615, null, 0.81949, null, 0.33644, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2017-07-05", "Adult", "Adult", "Spinal Cord", "Nervous System"], [42557, "SRR5805903", "SRX2985077", "SRS2337737", "SRP111129", "PRJNA393181", "Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro", "GSE100821", "Transcriptome Analysis", "Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded  and therefore vulnerable  axons. Demyelination is the result of a primary insult and secondary injury  leading to conduction blocks and long term degeneration of the axons  which subsequently can lead to the loss of their neuron. In response to SCI  dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore  researchers strive to control OPC responses  and utilize small molecule screening approaches in order to identify mechanisms of OPC activation  proliferation  migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations  5 biological replicates per population", null, "pubmed:28959189", null, "OL1", "GSM2694023", null, "tissue:adult spinal cord|cell type:oligodendrocyte", "OL1", "basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments  were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID  Chromosom  Exon Start Coordinates  Exon End Coordinates  Gene Length; Counts from the 2 Conditions and their 5 replicates", "adult spinal cord", null, "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", null, "cell type:oligodendrocyte", "GSM2694023", "GSM2694023: OL1; Danio rerio; RNA Seq", "GSM2694023", null, "1", "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", "GEO Accession:GSM2694023", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP111129", null, null, "L13377_Track-36584_R1.fastq.gz", "fastq", 466135360.0, 6133360.0, "GSM2694023 r1", "0:76", "A:135755208;C:99052881;G:99001624;T:132317853;N:7794", 76, null, null, null, 135755208, 99052881, 99001624, 132317853, 7794, "SRX2985077", "SRS2337737", "SRA584085", "GEO", "Reimer Lab, CRT Dresden, TU Dresden", 1, 0.87348, null, 0.07763, null, 0.81844, null, 0.31419, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2017-07-05", "Adult", "Adult", "Spinal Cord", "Nervous System"], [42558, "SRR5805904", "SRX2985077", "SRS2337737", "SRP111129", "PRJNA393181", "Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro", "GSE100821", "Transcriptome Analysis", "Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded  and therefore vulnerable  axons. Demyelination is the result of a primary insult and secondary injury  leading to conduction blocks and long term degeneration of the axons  which subsequently can lead to the loss of their neuron. In response to SCI  dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore  researchers strive to control OPC responses  and utilize small molecule screening approaches in order to identify mechanisms of OPC activation  proliferation  migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations  5 biological replicates per population", null, "pubmed:28959189", null, "OL1", "GSM2694023", null, "tissue:adult spinal cord|cell type:oligodendrocyte", "OL1", "basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments  were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID  Chromosom  Exon Start Coordinates  Exon End Coordinates  Gene Length; Counts from the 2 Conditions and their 5 replicates", "adult spinal cord", null, "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", null, "cell type:oligodendrocyte", "GSM2694023", "GSM2694023: OL1; Danio rerio; RNA Seq", "GSM2694023", null, "1", "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", "GEO Accession:GSM2694023", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP111129", null, null, "L13377_Track-36597_R1.fastq.gz", "fastq", 1411330868.0, 18570143.0, "GSM2694023 r2", "0:76", "A:411208825;C:299646339;G:299445590;T:401005116;N:24998", 76, null, null, null, 411208825, 299646339, 299445590, 401005116, 24998, "SRX2985077", "SRS2337737", "SRA584085", "GEO", "Reimer Lab, CRT Dresden, TU Dresden", 1, 0.91442, null, 0.08129, null, 0.81868, null, 0.31098, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2017-07-05", "Adult", "Adult", "Spinal Cord", "Nervous System"], [42559, "SRR5805905", "SRX2985077", "SRS2337737", "SRP111129", "PRJNA393181", "Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro", "GSE100821", "Transcriptome Analysis", "Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded  and therefore vulnerable  axons. Demyelination is the result of a primary insult and secondary injury  leading to conduction blocks and long term degeneration of the axons  which subsequently can lead to the loss of their neuron. In response to SCI  dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore  researchers strive to control OPC responses  and utilize small molecule screening approaches in order to identify mechanisms of OPC activation  proliferation  migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations  5 biological replicates per population", null, "pubmed:28959189", null, "OL1", "GSM2694023", null, "tissue:adult spinal cord|cell type:oligodendrocyte", "OL1", "basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments  were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID  Chromosom  Exon Start Coordinates  Exon End Coordinates  Gene Length; Counts from the 2 Conditions and their 5 replicates", "adult spinal cord", null, "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", null, "cell type:oligodendrocyte", "GSM2694023", "GSM2694023: OL1; Danio rerio; RNA Seq", "GSM2694023", null, "1", "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", "GEO Accession:GSM2694023", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP111129", null, null, "L13377_Track-36717_R1.fastq.gz", "fastq", 1694230988.0, 22292513.0, "GSM2694023 r3", "0:76", "A:496435234;C:356390144;G:357718951;T:483580476;N:106183", 76, null, null, null, 496435234, 356390144, 357718951, 483580476, 106183, "SRX2985077", "SRS2337737", "SRA584085", "GEO", "Reimer Lab, CRT Dresden, TU Dresden", 1, 0.91116, null, 0.0827, null, 0.81854, null, 0.31198, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2017-07-05", "Adult", "Adult", "Spinal Cord", "Nervous System"], [42560, "SRR5805900", "SRX2985076", "SRS2337736", "SRP111129", "PRJNA393181", "Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro", "GSE100821", "Transcriptome Analysis", "Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded  and therefore vulnerable  axons. Demyelination is the result of a primary insult and secondary injury  leading to conduction blocks and long term degeneration of the axons  which subsequently can lead to the loss of their neuron. In response to SCI  dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore  researchers strive to control OPC responses  and utilize small molecule screening approaches in order to identify mechanisms of OPC activation  proliferation  migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations  5 biological replicates per population", null, "pubmed:28959189", null, "OPC5", "GSM2694022", null, "tissue:adult spinal cord|cell type:oligodendrocyte precursor cell", "OPC5", "basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments  were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID  Chromosom  Exon Start Coordinates  Exon End Coordinates  Gene Length; Counts from the 2 Conditions and their 5 replicates", "adult spinal cord", null, "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", null, "cell type:oligodendrocyte precursor cell", "GSM2694022", "GSM2694022: OPC5; Danio rerio; RNA Seq", "GSM2694022", null, "1", "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", "GEO Accession:GSM2694022", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP111129", null, null, "L13376_Track-36583_R1.fastq.gz", "fastq", 280153404.0, 3686229.0, "GSM2694022 r1", "0:76", "A:81451669;C:59566227;G:59669362;T:79461530;N:4616", 76, null, null, null, 81451669, 59566227, 59669362, 79461530, 4616, "SRX2985076", "SRS2337736", "SRA584085", "GEO", "Reimer Lab, CRT Dresden, TU Dresden", 1, 0.87692, null, 0.11958, null, 0.78683, null, 0.37449, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2017-07-05", "Adult", "Adult", "Spinal Cord", "Nervous System"], [42561, "SRR5805901", "SRX2985076", "SRS2337736", "SRP111129", "PRJNA393181", "Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro", "GSE100821", "Transcriptome Analysis", "Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded  and therefore vulnerable  axons. Demyelination is the result of a primary insult and secondary injury  leading to conduction blocks and long term degeneration of the axons  which subsequently can lead to the loss of their neuron. In response to SCI  dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore  researchers strive to control OPC responses  and utilize small molecule screening approaches in order to identify mechanisms of OPC activation  proliferation  migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations  5 biological replicates per population", null, "pubmed:28959189", null, "OPC5", "GSM2694022", null, "tissue:adult spinal cord|cell type:oligodendrocyte precursor cell", "OPC5", "basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments  were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID  Chromosom  Exon Start Coordinates  Exon End Coordinates  Gene Length; Counts from the 2 Conditions and their 5 replicates", "adult spinal cord", null, "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", null, "cell type:oligodendrocyte precursor cell", "GSM2694022", "GSM2694022: OPC5; Danio rerio; RNA Seq", "GSM2694022", null, "1", "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", "GEO Accession:GSM2694022", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP111129", null, null, "L13376_Track-36596_R1.fastq.gz", "fastq", 905919164.0, 11919989.0, "GSM2694022 r2", "0:76", "A:263683260;C:192386277;G:192756447;T:257077269;N:15911", 76, null, null, null, 263683260, 192386277, 192756447, 257077269, 15911, "SRX2985076", "SRS2337736", "SRA584085", "GEO", "Reimer Lab, CRT Dresden, TU Dresden", 1, 0.91322, null, 0.12482, null, 0.78695, null, 0.38581, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2017-07-05", "Adult", "Adult", "Spinal Cord", "Nervous System"], [42562, "SRR5805902", "SRX2985076", "SRS2337736", "SRP111129", "PRJNA393181", "Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro", "GSE100821", "Transcriptome Analysis", "Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded  and therefore vulnerable  axons. Demyelination is the result of a primary insult and secondary injury  leading to conduction blocks and long term degeneration of the axons  which subsequently can lead to the loss of their neuron. In response to SCI  dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore  researchers strive to control OPC responses  and utilize small molecule screening approaches in order to identify mechanisms of OPC activation  proliferation  migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations  5 biological replicates per population", null, "pubmed:28959189", null, "OPC5", "GSM2694022", null, "tissue:adult spinal cord|cell type:oligodendrocyte precursor cell", "OPC5", "basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments  were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID  Chromosom  Exon Start Coordinates  Exon End Coordinates  Gene Length; Counts from the 2 Conditions and their 5 replicates", "adult spinal cord", null, "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", null, "cell type:oligodendrocyte precursor cell", "GSM2694022", "GSM2694022: OPC5; Danio rerio; RNA Seq", "GSM2694022", null, "1", "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", "GEO Accession:GSM2694022", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP111129", null, null, "L13376_Track-36716_R1.fastq.gz", "fastq", 1102695932.0, 14509157.0, "GSM2694022 r3", "0:76", "A:322423795;C:232167818;G:233489197;T:314545918;N:69204", 76, null, null, null, 322423795, 232167818, 233489197, 314545918, 69204, "SRX2985076", "SRS2337736", "SRA584085", "GEO", "Reimer Lab, CRT Dresden, TU Dresden", 1, 0.91113, null, 0.12832, null, 0.78902, null, 0.38324, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2017-07-05", "Adult", "Adult", "Spinal Cord", "Nervous System"], [42563, "SRR5805897", "SRX2985075", "SRS2337735", "SRP111129", "PRJNA393181", "Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro", "GSE100821", "Transcriptome Analysis", "Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded  and therefore vulnerable  axons. Demyelination is the result of a primary insult and secondary injury  leading to conduction blocks and long term degeneration of the axons  which subsequently can lead to the loss of their neuron. In response to SCI  dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore  researchers strive to control OPC responses  and utilize small molecule screening approaches in order to identify mechanisms of OPC activation  proliferation  migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations  5 biological replicates per population", null, "pubmed:28959189", null, "OPC4", "GSM2694021", null, "tissue:adult spinal cord|cell type:oligodendrocyte precursor cell", "OPC4", "basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments  were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID  Chromosom  Exon Start Coordinates  Exon End Coordinates  Gene Length; Counts from the 2 Conditions and their 5 replicates", "adult spinal cord", null, "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", null, "cell type:oligodendrocyte precursor cell", "GSM2694021", "GSM2694021: OPC4; Danio rerio; RNA Seq", "GSM2694021", null, "1", "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", "GEO Accession:GSM2694021", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP111129", null, null, "L13375_Track-36582_R1.fastq.gz", "fastq", 281755636.0, 3707311.0, "GSM2694021 r1", "0:76", "A:82997556;C:58935470;G:59188963;T:80628803;N:4844", 76, null, null, null, 82997556, 58935470, 59188963, 80628803, 4844, "SRX2985075", "SRS2337735", "SRA584085", "GEO", "Reimer Lab, CRT Dresden, TU Dresden", 1, 0.87083, null, 0.12585, null, 0.79042, null, 0.35633, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2017-07-05", "Adult", "Adult", "Spinal Cord", "Nervous System"], [42564, "SRR5805898", "SRX2985075", "SRS2337735", "SRP111129", "PRJNA393181", "Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro", "GSE100821", "Transcriptome Analysis", "Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded  and therefore vulnerable  axons. Demyelination is the result of a primary insult and secondary injury  leading to conduction blocks and long term degeneration of the axons  which subsequently can lead to the loss of their neuron. In response to SCI  dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore  researchers strive to control OPC responses  and utilize small molecule screening approaches in order to identify mechanisms of OPC activation  proliferation  migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations  5 biological replicates per population", null, "pubmed:28959189", null, "OPC4", "GSM2694021", null, "tissue:adult spinal cord|cell type:oligodendrocyte precursor cell", "OPC4", "basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments  were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID  Chromosom  Exon Start Coordinates  Exon End Coordinates  Gene Length; Counts from the 2 Conditions and their 5 replicates", "adult spinal cord", null, "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", null, "cell type:oligodendrocyte precursor cell", "GSM2694021", "GSM2694021: OPC4; Danio rerio; RNA Seq", "GSM2694021", null, "1", "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", "GEO Accession:GSM2694021", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP111129", null, null, "L13375_Track-36595_R1.fastq.gz", "fastq", 856872336.0, 11274636.0, "GSM2694021 r2", "0:76", "A:252638777;C:179079271;G:179782360;T:245356644;N:15284", 76, null, null, null, 252638777, 179079271, 179782360, 245356644, 15284, "SRX2985075", "SRS2337735", "SRA584085", "GEO", "Reimer Lab, CRT Dresden, TU Dresden", 1, 0.91479, null, 0.1324, null, 0.78959, null, 0.36277, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2017-07-05", "Adult", "Adult", "Spinal Cord", "Nervous System"], [42565, "SRR5805899", "SRX2985075", "SRS2337735", "SRP111129", "PRJNA393181", "Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro", "GSE100821", "Transcriptome Analysis", "Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded  and therefore vulnerable  axons. Demyelination is the result of a primary insult and secondary injury  leading to conduction blocks and long term degeneration of the axons  which subsequently can lead to the loss of their neuron. In response to SCI  dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore  researchers strive to control OPC responses  and utilize small molecule screening approaches in order to identify mechanisms of OPC activation  proliferation  migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations  5 biological replicates per population", null, "pubmed:28959189", null, "OPC4", "GSM2694021", null, "tissue:adult spinal cord|cell type:oligodendrocyte precursor cell", "OPC4", "basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments  were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID  Chromosom  Exon Start Coordinates  Exon End Coordinates  Gene Length; Counts from the 2 Conditions and their 5 replicates", "adult spinal cord", null, "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", null, "cell type:oligodendrocyte precursor cell", "GSM2694021", "GSM2694021: OPC4; Danio rerio; RNA Seq", "GSM2694021", null, "1", "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", "GEO Accession:GSM2694021", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP111129", null, null, "L13375_Track-36715_R1.fastq.gz", "fastq", 1067787080.0, 14049830.0, "GSM2694021 r3", "0:76", "A:316592408;C:220986701;G:222738880;T:307403458;N:65633", 76, null, null, null, 316592408, 220986701, 222738880, 307403458, 65633, "SRX2985075", "SRS2337735", "SRA584085", "GEO", "Reimer Lab, CRT Dresden, TU Dresden", 1, 0.91223, null, 0.13673, null, 0.78957, null, 0.36042, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2017-07-05", "Adult", "Adult", "Spinal Cord", "Nervous System"], [42566, "SRR5805894", "SRX2985074", "SRS2337734", "SRP111129", "PRJNA393181", "Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro", "GSE100821", "Transcriptome Analysis", "Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded  and therefore vulnerable  axons. Demyelination is the result of a primary insult and secondary injury  leading to conduction blocks and long term degeneration of the axons  which subsequently can lead to the loss of their neuron. In response to SCI  dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore  researchers strive to control OPC responses  and utilize small molecule screening approaches in order to identify mechanisms of OPC activation  proliferation  migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations  5 biological replicates per population", null, "pubmed:28959189", null, "OPC3", "GSM2694020", null, "tissue:adult spinal cord|cell type:oligodendrocyte precursor cell", "OPC3", "basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments  were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID  Chromosom  Exon Start Coordinates  Exon End Coordinates  Gene Length; Counts from the 2 Conditions and their 5 replicates", "adult spinal cord", null, "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", null, "cell type:oligodendrocyte precursor cell", "GSM2694020", "GSM2694020: OPC3; Danio rerio; RNA Seq", "GSM2694020", null, "1", "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", "GEO Accession:GSM2694020", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP111129", null, null, "L13374_Track-36581_R1.fastq.gz", "fastq", 258394604.0, 3399929.0, "GSM2694020 r1", "0:76", "A:75988348;C:54232048;G:54304534;T:73865549;N:4125", 76, null, null, null, 75988348, 54232048, 54304534, 73865549, 4125, "SRX2985074", "SRS2337734", "SRA584085", "GEO", "Reimer Lab, CRT Dresden, TU Dresden", 1, 0.86675, null, 0.10485, null, 0.79166, null, 0.35524, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2017-07-05", "Adult", "Adult", "Spinal Cord", "Nervous System"], [42567, "SRR5805895", "SRX2985074", "SRS2337734", "SRP111129", "PRJNA393181", "Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro", "GSE100821", "Transcriptome Analysis", "Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded  and therefore vulnerable  axons. Demyelination is the result of a primary insult and secondary injury  leading to conduction blocks and long term degeneration of the axons  which subsequently can lead to the loss of their neuron. In response to SCI  dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore  researchers strive to control OPC responses  and utilize small molecule screening approaches in order to identify mechanisms of OPC activation  proliferation  migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations  5 biological replicates per population", null, "pubmed:28959189", null, "OPC3", "GSM2694020", null, "tissue:adult spinal cord|cell type:oligodendrocyte precursor cell", "OPC3", "basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments  were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID  Chromosom  Exon Start Coordinates  Exon End Coordinates  Gene Length; Counts from the 2 Conditions and their 5 replicates", "adult spinal cord", null, "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", null, "cell type:oligodendrocyte precursor cell", "GSM2694020", "GSM2694020: OPC3; Danio rerio; RNA Seq", "GSM2694020", null, "1", "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", "GEO Accession:GSM2694020", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP111129", null, null, "L13374_Track-36594_R1.fastq.gz", "fastq", 802809356.0, 10563281.0, "GSM2694020 r2", "0:76", "A:236297052;C:168384708;G:168556277;T:229557436;N:13883", 76, null, null, null, 236297052, 168384708, 168556277, 229557436, 13883, "SRX2985074", "SRS2337734", "SRA584085", "GEO", "Reimer Lab, CRT Dresden, TU Dresden", 1, 0.90891, null, 0.11028, null, 0.79115, null, 0.35162, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2017-07-05", "Adult", "Adult", "Spinal Cord", "Nervous System"], [42568, "SRR5805896", "SRX2985074", "SRS2337734", "SRP111129", "PRJNA393181", "Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro", "GSE100821", "Transcriptome Analysis", "Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded  and therefore vulnerable  axons. Demyelination is the result of a primary insult and secondary injury  leading to conduction blocks and long term degeneration of the axons  which subsequently can lead to the loss of their neuron. In response to SCI  dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore  researchers strive to control OPC responses  and utilize small molecule screening approaches in order to identify mechanisms of OPC activation  proliferation  migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations  5 biological replicates per population", null, "pubmed:28959189", null, "OPC3", "GSM2694020", null, "tissue:adult spinal cord|cell type:oligodendrocyte precursor cell", "OPC3", "basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments  were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID  Chromosom  Exon Start Coordinates  Exon End Coordinates  Gene Length; Counts from the 2 Conditions and their 5 replicates", "adult spinal cord", null, "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", null, "cell type:oligodendrocyte precursor cell", "GSM2694020", "GSM2694020: OPC3; Danio rerio; RNA Seq", "GSM2694020", null, "1", "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", "GEO Accession:GSM2694020", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP111129", null, null, "L13374_Track-36714_R1.fastq.gz", "fastq", 996263860.0, 13108735.0, "GSM2694020 r3", "0:76", "A:294853084;C:206867581;G:208047523;T:286432957;N:62715", 76, null, null, null, 294853084, 206867581, 208047523, 286432957, 62715, "SRX2985074", "SRS2337734", "SRA584085", "GEO", "Reimer Lab, CRT Dresden, TU Dresden", 1, 0.90671, null, 0.1148, null, 0.78993, null, 0.36115, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2017-07-05", "Adult", "Adult", "Spinal Cord", "Nervous System"], [42569, "SRR5805891", "SRX2985073", "SRS2337733", "SRP111129", "PRJNA393181", "Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro", "GSE100821", "Transcriptome Analysis", "Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded  and therefore vulnerable  axons. Demyelination is the result of a primary insult and secondary injury  leading to conduction blocks and long term degeneration of the axons  which subsequently can lead to the loss of their neuron. In response to SCI  dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore  researchers strive to control OPC responses  and utilize small molecule screening approaches in order to identify mechanisms of OPC activation  proliferation  migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations  5 biological replicates per population", null, "pubmed:28959189", null, "OPC2", "GSM2694019", null, "tissue:adult spinal cord|cell type:oligodendrocyte precursor cell", "OPC2", "basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments  were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID  Chromosom  Exon Start Coordinates  Exon End Coordinates  Gene Length; Counts from the 2 Conditions and their 5 replicates", "adult spinal cord", null, "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", null, "cell type:oligodendrocyte precursor cell", "GSM2694019", "GSM2694019: OPC2; Danio rerio; RNA Seq", "GSM2694019", null, "1", "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", "GEO Accession:GSM2694019", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP111129", null, null, "L13373_Track-36580_R1.fastq.gz", "fastq", 290268624.0, 3819324.0, "GSM2694019 r1", "0:76", "A:83225179;C:62931491;G:62628688;T:81478215;N:5051", 76, null, null, null, 83225179, 62931491, 62628688, 81478215, 5051, "SRX2985073", "SRS2337733", "SRA584085", "GEO", "Reimer Lab, CRT Dresden, TU Dresden", 1, 0.84469, null, 0.11786, null, 0.78742, null, 0.38555, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2017-07-05", "Adult", "Adult", "Spinal Cord", "Nervous System"], [42570, "SRR5805892", "SRX2985073", "SRS2337733", "SRP111129", "PRJNA393181", "Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro", "GSE100821", "Transcriptome Analysis", "Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded  and therefore vulnerable  axons. Demyelination is the result of a primary insult and secondary injury  leading to conduction blocks and long term degeneration of the axons  which subsequently can lead to the loss of their neuron. In response to SCI  dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore  researchers strive to control OPC responses  and utilize small molecule screening approaches in order to identify mechanisms of OPC activation  proliferation  migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations  5 biological replicates per population", null, "pubmed:28959189", null, "OPC2", "GSM2694019", null, "tissue:adult spinal cord|cell type:oligodendrocyte precursor cell", "OPC2", "basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments  were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID  Chromosom  Exon Start Coordinates  Exon End Coordinates  Gene Length; Counts from the 2 Conditions and their 5 replicates", "adult spinal cord", null, "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", null, "cell type:oligodendrocyte precursor cell", "GSM2694019", "GSM2694019: OPC2; Danio rerio; RNA Seq", "GSM2694019", null, "1", "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", "GEO Accession:GSM2694019", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP111129", null, null, "L13373_Track-36593_R1.fastq.gz", "fastq", 872053640.0, 11474390.0, "GSM2694019 r2", "0:76", "A:250248044;C:188809860;G:187959005;T:245021560;N:15171", 76, null, null, null, 250248044, 188809860, 187959005, 245021560, 15171, "SRX2985073", "SRS2337733", "SRA584085", "GEO", "Reimer Lab, CRT Dresden, TU Dresden", 1, 0.87823, null, 0.12293, null, 0.78699, null, 0.38395, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2017-07-05", "Adult", "Adult", "Spinal Cord", "Nervous System"], [42571, "SRR5805893", "SRX2985073", "SRS2337733", "SRP111129", "PRJNA393181", "Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro", "GSE100821", "Transcriptome Analysis", "Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded  and therefore vulnerable  axons. Demyelination is the result of a primary insult and secondary injury  leading to conduction blocks and long term degeneration of the axons  which subsequently can lead to the loss of their neuron. In response to SCI  dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore  researchers strive to control OPC responses  and utilize small molecule screening approaches in order to identify mechanisms of OPC activation  proliferation  migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations  5 biological replicates per population", null, "pubmed:28959189", null, "OPC2", "GSM2694019", null, "tissue:adult spinal cord|cell type:oligodendrocyte precursor cell", "OPC2", "basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments  were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID  Chromosom  Exon Start Coordinates  Exon End Coordinates  Gene Length; Counts from the 2 Conditions and their 5 replicates", "adult spinal cord", null, "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", null, "cell type:oligodendrocyte precursor cell", "GSM2694019", "GSM2694019: OPC2; Danio rerio; RNA Seq", "GSM2694019", null, "1", "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", "GEO Accession:GSM2694019", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP111129", null, null, "L13373_Track-36713_R1.fastq.gz", "fastq", 1035504180.0, 13625055.0, "GSM2694019 r3", "0:76", "A:298790829;C:222016282;G:222262419;T:292369013;N:65637", 76, null, null, null, 298790829, 222016282, 222262419, 292369013, 65637, "SRX2985073", "SRS2337733", "SRA584085", "GEO", "Reimer Lab, CRT Dresden, TU Dresden", 1, 0.88262, null, 0.12859, null, 0.78707, null, 0.36444, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2017-07-05", "Adult", "Adult", "Spinal Cord", "Nervous System"], [42572, "SRR5805888", "SRX2985072", "SRS2337732", "SRP111129", "PRJNA393181", "Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro", "GSE100821", "Transcriptome Analysis", "Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded  and therefore vulnerable  axons. Demyelination is the result of a primary insult and secondary injury  leading to conduction blocks and long term degeneration of the axons  which subsequently can lead to the loss of their neuron. In response to SCI  dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore  researchers strive to control OPC responses  and utilize small molecule screening approaches in order to identify mechanisms of OPC activation  proliferation  migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations  5 biological replicates per population", null, "pubmed:28959189", null, "OPC1", "GSM2694018", null, "tissue:adult spinal cord|cell type:oligodendrocyte precursor cell", "OPC1", "basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments  were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID  Chromosom  Exon Start Coordinates  Exon End Coordinates  Gene Length; Counts from the 2 Conditions and their 5 replicates", "adult spinal cord", null, "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", null, "cell type:oligodendrocyte precursor cell", "GSM2694018", "GSM2694018: OPC1; Danio rerio; RNA Seq", "GSM2694018", null, "1", "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", "GEO Accession:GSM2694018", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP111129", null, null, "L13372_Track-36579_R1.fastq.gz", "fastq", 275307568.0, 3622468.0, "GSM2694018 r1", "0:76", "A:80768745;C:57628302;G:57760609;T:79145252;N:4660", 76, null, null, null, 80768745, 57628302, 57760609, 79145252, 4660, "SRX2985072", "SRS2337732", "SRA584085", "GEO", "Reimer Lab, CRT Dresden, TU Dresden", 1, 0.87887, null, 0.12197, null, 0.79807, null, 0.35871, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2017-07-05", "Adult", "Adult", "Spinal Cord", "Nervous System"], [42573, "SRR5805889", "SRX2985072", "SRS2337732", "SRP111129", "PRJNA393181", "Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro", "GSE100821", "Transcriptome Analysis", "Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded  and therefore vulnerable  axons. Demyelination is the result of a primary insult and secondary injury  leading to conduction blocks and long term degeneration of the axons  which subsequently can lead to the loss of their neuron. In response to SCI  dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore  researchers strive to control OPC responses  and utilize small molecule screening approaches in order to identify mechanisms of OPC activation  proliferation  migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations  5 biological replicates per population", null, "pubmed:28959189", null, "OPC1", "GSM2694018", null, "tissue:adult spinal cord|cell type:oligodendrocyte precursor cell", "OPC1", "basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments  were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID  Chromosom  Exon Start Coordinates  Exon End Coordinates  Gene Length; Counts from the 2 Conditions and their 5 replicates", "adult spinal cord", null, "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", null, "cell type:oligodendrocyte precursor cell", "GSM2694018", "GSM2694018: OPC1; Danio rerio; RNA Seq", "GSM2694018", null, "1", "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", "GEO Accession:GSM2694018", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP111129", null, null, "L13372_Track-36592_R1.fastq.gz", "fastq", 844153204.0, 11107279.0, "GSM2694018 r2", "0:76", "A:247798416;C:176560506;G:176978398;T:242800972;N:14912", 76, null, null, null, 247798416, 176560506, 176978398, 242800972, 14912, "SRX2985072", "SRS2337732", "SRA584085", "GEO", "Reimer Lab, CRT Dresden, TU Dresden", 1, 0.912, null, 0.12665, null, 0.79742, null, 0.36358, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2017-07-05", "Adult", "Adult", "Spinal Cord", "Nervous System"], [42574, "SRR5805890", "SRX2985072", "SRS2337732", "SRP111129", "PRJNA393181", "Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro", "GSE100821", "Transcriptome Analysis", "Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded  and therefore vulnerable  axons. Demyelination is the result of a primary insult and secondary injury  leading to conduction blocks and long term degeneration of the axons  which subsequently can lead to the loss of their neuron. In response to SCI  dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore  researchers strive to control OPC responses  and utilize small molecule screening approaches in order to identify mechanisms of OPC activation  proliferation  migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations  5 biological replicates per population", null, "pubmed:28959189", null, "OPC1", "GSM2694018", null, "tissue:adult spinal cord|cell type:oligodendrocyte precursor cell", "OPC1", "basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments  were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID  Chromosom  Exon Start Coordinates  Exon End Coordinates  Gene Length; Counts from the 2 Conditions and their 5 replicates", "adult spinal cord", null, "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", null, "cell type:oligodendrocyte precursor cell", "GSM2694018", "GSM2694018: OPC1; Danio rerio; RNA Seq", "GSM2694018", null, "1", "Spinal cord dissection  tissue dissociation and nuclear labelling:  Adult zebrafish were terminally anesthetized  their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks\u00b4 Buffered Salt Solution HBSS  Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature  the tissue was incubated for 3 min with 100 \u00b5L 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 \u00b5L pipette during the whole incubation time avoiding the formation of air bubbles. Then  tissue digestion was stopped by adding 100 \u00b5L of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 \u00b5L HBSS. postwards the cell suspension was allowed to sit for 5\u2019 at on ice  before it was applied to a 20 \u00b5m OPCs  Miltenyi Biotec  # 130 101 812 or a 35 \u00b5m OL  Corning  # 352235 cell strainer  respectively. post washing with 9 ml of HBSS  the cells were pelleted by centrifugation for 5\u2019 at RT at 300g. The supernatant was removed  cells were resuspended in 1 ml HBSS including 1 \u00b5l Vybrant\u2122 DyeCycle\u2122 Violet Stain Molecular Probes  Invitrogen  V35003 and incubated for 30\u00b4 at 28 \u00b0C to stain cellular nuclei.  FACsorting of myelin rich spinal cord tissue:  Cell suspensions were sorted directly into 96 well plates  filled with culture media only  or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant\u2122 DyeCycle\u2122 Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection  all events that showed incorporation of the Vybrant\u2122 DyeCycle\u2122 Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the RNAseq experiment  the SMARTer Ultra Low Input RNA for Illumina Sequencing Kit   HV from Clontech was used to reverse transcribe the RNA and amplify full length cDNA according to the user manual. Therefore  2000 cells from five biological replicates of both lines Tgolig2:eGFP and Tgmbp:GFP where directly FACsorted in 5ul reaction buffer containing RNAse Inhibitor. post amplification of cDNA using 12 cycles  the cDNA was sheared to 200bp fragment length with 8 micro TUBE strip in the ultrasonicator Covaris LE220  followed by a library prep using NEBNext Ultra DNA Library Prep Kit for Illumina NEB.", "GEO Accession:GSM2694018", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP111129", null, null, "L13372_Track-36712_R1.fastq.gz", "fastq", 990996528.0, 13039428.0, "GSM2694018 r3", "0:76", "A:292539296;C:205334965;G:206678725;T:286381798;N:61744", 76, null, null, null, 292539296, 205334965, 206678725, 286381798, 61744, "SRX2985072", "SRS2337732", "SRA584085", "GEO", "Reimer Lab, CRT Dresden, TU Dresden", 1, 0.90825, null, 0.1314, null, 0.80004, null, 0.3635, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2017-07-05", "Adult", "Adult", "Spinal Cord", "Nervous System"], [60587, "SRR12424278", "SRX8920145", "SRS7176693", "SRP276929", "PRJNA656271", "Single cell RNA seq analysis of pMN neural progenitors from zebrafish", "GSE155988", "Transcriptome Analysis", "The goal of this study was to identify distinct cell populations that arise from ventral spinal cord pMN progenitors. To do so  we sorted fluorescently marked pMN cells obtained from Tgolig2:EGFP zebrafish embryos at 24  36 hpf and 48 hpf and performed 10X Chromium single cell RNA seq. Overall design: Three samples obtained from wild type zebrafish embryos at three developmental timepoints were analyzed.", null, "pubmed:32680935", null, "scRNAseq olig2 eGFP 48hpf", "GSM4718658", null, "tissue:spinal cord cells|developmental stage:48 hpf ZFIN ID: ZDB ALT 041129 8", "scRNAseq olig2 eGFP 48hpf", "Raw sequencing reads were demultiplexed  mapped to the zebrafish reference genome and summarized into gene expression matrices using CellRanger version 3.0.1 Count matrices were further filtered in Seurat 3.1.0 https://satijalab.org/seurat/ to remove cell barcodes with fewer than 250 detectable genes  more than 5% of UMIs derived from mitochondrial genes  or more than 50 000 UMIs to exclude putative doublets Standard Seurat normalization and PCA was run using the 1 291 most variable genes Applied Harmony https://doi.org/10.1038/s41592 019 0619 0 alignment theta = 2 to correct for inter sample variation  chose 20 Harmony dimensions and applied Seurat UMAP reduction Genome build: GRCz11 Supplementary files format and content: gzipped csv file of matrix of normalized gene expression by cell for merged 3 scRNAseq samples Supplementary files format and content: gzipped csv file of metadata for cells", "spinal cord cells", "No treatment was applied to the samples.", "24  36  and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 \u03bcl of pre chilled Ca free Ringers solution 116 mM NaCl  2.6 mM KCl  5 mM HEPES  pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 \u03bcl of protease solution 10 mg/ml BI protease  125 U/ml DNase  2.5 mM EDTA  1X PBS was added  to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 \u03bcl of STOP solution 30% FBS  0.8 mM CaCl2  1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4\u00b0C and supernatant was removed. On ice  1 ml of chilled suspension media 1% FBS  0.8 mM CaCl2  50 U/ml Penicillin  0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4\u00b0C. Supernatant was removed  and 400 \u03bcl of chilled suspension media was added and solution was filtered through a 35 \u03bcm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 \u03bcl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075.\u00a0 Libraries were sequenced on the Illumina NovaSEQ6000 Instrument.\u00a0", "Embryos were raised at 28.5\u00b0C in E3 media 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4 at pH 7.4  with sodium bicarbonate  sorted for good health and staged accordingly to developmental morphological features and hpf", "developmental stage:48 hpf ZFIN ID: ZDB ALT 041129 8", "GSM4718658", "GSM4718658: scRNAseq olig2 eGFP 48hpf; Danio rerio; RNA Seq", "GSM4718658", null, "1", "24  36  and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 \u03bcl of pre chilled Ca free Ringers solution 116 mM NaCl  2.6 mM KCl  5 mM HEPES  pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 \u03bcl of protease solution 10 mg/ml BI protease  125 U/ml DNase  2.5 mM EDTA  1X PBS was added  to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 \u03bcl of STOP solution 30% FBS  0.8 mM CaCl2  1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4\u00b0C and supernatant was removed. On ice  1 ml of chilled suspension media 1% FBS  0.8 mM CaCl2  50 U/ml Penicillin  0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4\u00b0C. Supernatant was removed  and 400 \u03bcl of chilled suspension media was added and solution was filtered through a 35 \u03bcm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 \u03bcl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075.  Libraries were sequenced on the Illumina NovaSEQ6000 Instrument.", "GEO Accession:GSM4718658", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP276929", null, null, "olig2_egfp_48hpf_1_S41_L001_R1_001.fastq.gz olig2_egfp_48hpf_1_S41_L001_R2_001.fastq.gz", "fastq fastq", 18778651430.0, 62180965.0, "GSM4718658 r1", "0:151 1:151", "A:6542554044;C:3515052559;G:3489753648;T:5231107020;N:184159", 151, 151, null, null, 6542554044, 3515052559, 3489753648, 5231107020, 184159, "SRX8920145", "SRS7176693", "SRA1111061", "GEO", "University of Colorado School of Medicine", 2, 0.0, 0.90055, 0.0, 0.21162, 1.0, 0.77776, null, 0.53718, 151, 151, "T", "B", "mate1 technical by mapping diff", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_droplet", "10x", null, "United States", "2020-08-10", "Hatching", "Embryo", "Spinal Cord", "Nervous System"], [60588, "SRR12424279", "SRX8920145", "SRS7176693", "SRP276929", "PRJNA656271", "Single cell RNA seq analysis of pMN neural progenitors from zebrafish", "GSE155988", "Transcriptome Analysis", "The goal of this study was to identify distinct cell populations that arise from ventral spinal cord pMN progenitors. To do so  we sorted fluorescently marked pMN cells obtained from Tgolig2:EGFP zebrafish embryos at 24  36 hpf and 48 hpf and performed 10X Chromium single cell RNA seq. Overall design: Three samples obtained from wild type zebrafish embryos at three developmental timepoints were analyzed.", null, "pubmed:32680935", null, "scRNAseq olig2 eGFP 48hpf", "GSM4718658", null, "tissue:spinal cord cells|developmental stage:48 hpf ZFIN ID: ZDB ALT 041129 8", "scRNAseq olig2 eGFP 48hpf", "Raw sequencing reads were demultiplexed  mapped to the zebrafish reference genome and summarized into gene expression matrices using CellRanger version 3.0.1 Count matrices were further filtered in Seurat 3.1.0 https://satijalab.org/seurat/ to remove cell barcodes with fewer than 250 detectable genes  more than 5% of UMIs derived from mitochondrial genes  or more than 50 000 UMIs to exclude putative doublets Standard Seurat normalization and PCA was run using the 1 291 most variable genes Applied Harmony https://doi.org/10.1038/s41592 019 0619 0 alignment theta = 2 to correct for inter sample variation  chose 20 Harmony dimensions and applied Seurat UMAP reduction Genome build: GRCz11 Supplementary files format and content: gzipped csv file of matrix of normalized gene expression by cell for merged 3 scRNAseq samples Supplementary files format and content: gzipped csv file of metadata for cells", "spinal cord cells", "No treatment was applied to the samples.", "24  36  and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 \u03bcl of pre chilled Ca free Ringers solution 116 mM NaCl  2.6 mM KCl  5 mM HEPES  pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 \u03bcl of protease solution 10 mg/ml BI protease  125 U/ml DNase  2.5 mM EDTA  1X PBS was added  to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 \u03bcl of STOP solution 30% FBS  0.8 mM CaCl2  1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4\u00b0C and supernatant was removed. On ice  1 ml of chilled suspension media 1% FBS  0.8 mM CaCl2  50 U/ml Penicillin  0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4\u00b0C. Supernatant was removed  and 400 \u03bcl of chilled suspension media was added and solution was filtered through a 35 \u03bcm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 \u03bcl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075.\u00a0 Libraries were sequenced on the Illumina NovaSEQ6000 Instrument.\u00a0", "Embryos were raised at 28.5\u00b0C in E3 media 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4 at pH 7.4  with sodium bicarbonate  sorted for good health and staged accordingly to developmental morphological features and hpf", "developmental stage:48 hpf ZFIN ID: ZDB ALT 041129 8", "GSM4718658", "GSM4718658: scRNAseq olig2 eGFP 48hpf; Danio rerio; RNA Seq", "GSM4718658", null, "1", "24  36  and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 \u03bcl of pre chilled Ca free Ringers solution 116 mM NaCl  2.6 mM KCl  5 mM HEPES  pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 \u03bcl of protease solution 10 mg/ml BI protease  125 U/ml DNase  2.5 mM EDTA  1X PBS was added  to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 \u03bcl of STOP solution 30% FBS  0.8 mM CaCl2  1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4\u00b0C and supernatant was removed. On ice  1 ml of chilled suspension media 1% FBS  0.8 mM CaCl2  50 U/ml Penicillin  0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4\u00b0C. Supernatant was removed  and 400 \u03bcl of chilled suspension media was added and solution was filtered through a 35 \u03bcm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 \u03bcl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075.  Libraries were sequenced on the Illumina NovaSEQ6000 Instrument.", "GEO Accession:GSM4718658", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP276929", null, null, "olig2_egfp_48hpf_2_S42_L001_R1_001.fastq.gz olig2_egfp_48hpf_2_S42_L001_R2_001.fastq.gz", "fastq fastq", 22242782898.0, 73651599.0, "GSM4718658 r2", "0:151 1:151", "A:7753674261;C:4160150132;G:4127581173;T:6201157562;N:219770", 151, 151, null, null, 7753674261, 4160150132, 4127581173, 6201157562, 219770, "SRX8920145", "SRS7176693", "SRA1111061", "GEO", "University of Colorado School of Medicine", 2, 0.0, 0.90097, 0.0, 0.2127, 1.0, 0.77966, null, 0.54192, 151, 151, "T", "B", "mate1 technical by mapping diff", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_droplet", "10x", null, "United States", "2020-08-10", "Hatching", "Embryo", "Spinal Cord", "Nervous System"], [60589, "SRR12424280", "SRX8920145", "SRS7176693", "SRP276929", "PRJNA656271", "Single cell RNA seq analysis of pMN neural progenitors from zebrafish", "GSE155988", "Transcriptome Analysis", "The goal of this study was to identify distinct cell populations that arise from ventral spinal cord pMN progenitors. To do so  we sorted fluorescently marked pMN cells obtained from Tgolig2:EGFP zebrafish embryos at 24  36 hpf and 48 hpf and performed 10X Chromium single cell RNA seq. Overall design: Three samples obtained from wild type zebrafish embryos at three developmental timepoints were analyzed.", null, "pubmed:32680935", null, "scRNAseq olig2 eGFP 48hpf", "GSM4718658", null, "tissue:spinal cord cells|developmental stage:48 hpf ZFIN ID: ZDB ALT 041129 8", "scRNAseq olig2 eGFP 48hpf", "Raw sequencing reads were demultiplexed  mapped to the zebrafish reference genome and summarized into gene expression matrices using CellRanger version 3.0.1 Count matrices were further filtered in Seurat 3.1.0 https://satijalab.org/seurat/ to remove cell barcodes with fewer than 250 detectable genes  more than 5% of UMIs derived from mitochondrial genes  or more than 50 000 UMIs to exclude putative doublets Standard Seurat normalization and PCA was run using the 1 291 most variable genes Applied Harmony https://doi.org/10.1038/s41592 019 0619 0 alignment theta = 2 to correct for inter sample variation  chose 20 Harmony dimensions and applied Seurat UMAP reduction Genome build: GRCz11 Supplementary files format and content: gzipped csv file of matrix of normalized gene expression by cell for merged 3 scRNAseq samples Supplementary files format and content: gzipped csv file of metadata for cells", "spinal cord cells", "No treatment was applied to the samples.", "24  36  and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 \u03bcl of pre chilled Ca free Ringers solution 116 mM NaCl  2.6 mM KCl  5 mM HEPES  pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 \u03bcl of protease solution 10 mg/ml BI protease  125 U/ml DNase  2.5 mM EDTA  1X PBS was added  to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 \u03bcl of STOP solution 30% FBS  0.8 mM CaCl2  1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4\u00b0C and supernatant was removed. On ice  1 ml of chilled suspension media 1% FBS  0.8 mM CaCl2  50 U/ml Penicillin  0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4\u00b0C. Supernatant was removed  and 400 \u03bcl of chilled suspension media was added and solution was filtered through a 35 \u03bcm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 \u03bcl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075.\u00a0 Libraries were sequenced on the Illumina NovaSEQ6000 Instrument.\u00a0", "Embryos were raised at 28.5\u00b0C in E3 media 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4 at pH 7.4  with sodium bicarbonate  sorted for good health and staged accordingly to developmental morphological features and hpf", "developmental stage:48 hpf ZFIN ID: ZDB ALT 041129 8", "GSM4718658", "GSM4718658: scRNAseq olig2 eGFP 48hpf; Danio rerio; RNA Seq", "GSM4718658", null, "1", "24  36  and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 \u03bcl of pre chilled Ca free Ringers solution 116 mM NaCl  2.6 mM KCl  5 mM HEPES  pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 \u03bcl of protease solution 10 mg/ml BI protease  125 U/ml DNase  2.5 mM EDTA  1X PBS was added  to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 \u03bcl of STOP solution 30% FBS  0.8 mM CaCl2  1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4\u00b0C and supernatant was removed. On ice  1 ml of chilled suspension media 1% FBS  0.8 mM CaCl2  50 U/ml Penicillin  0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4\u00b0C. Supernatant was removed  and 400 \u03bcl of chilled suspension media was added and solution was filtered through a 35 \u03bcm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 \u03bcl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075.  Libraries were sequenced on the Illumina NovaSEQ6000 Instrument.", "GEO Accession:GSM4718658", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP276929", null, null, "olig2_egfp_48hpf_3_S43_L001_R2_001.fastq.gz olig2_egfp_48hpf_3_S43_L001_R1_001.fastq.gz", "fastq fastq", 25591190986.0, 84739043.0, "GSM4718658 r3", "0:151 1:151", "A:8917343424;C:4797392797;G:4757647263;T:7118554564;N:252938", 151, 151, null, null, 8917343424, 4797392797, 4757647263, 7118554564, 252938, "SRX8920145", "SRS7176693", "SRA1111061", "GEO", "University of Colorado School of Medicine", 2, 0.0, 0.90089, 0.0, 0.2095, 1.0, 0.78078, null, 0.53755, 151, 151, "T", "B", "mate1 technical by mapping diff", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_droplet", "10x", null, "United States", "2020-08-10", "Hatching", "Embryo", "Spinal Cord", "Nervous System"], [60590, "SRR12424281", "SRX8920145", "SRS7176693", "SRP276929", "PRJNA656271", "Single cell RNA seq analysis of pMN neural progenitors from zebrafish", "GSE155988", "Transcriptome Analysis", "The goal of this study was to identify distinct cell populations that arise from ventral spinal cord pMN progenitors. To do so  we sorted fluorescently marked pMN cells obtained from Tgolig2:EGFP zebrafish embryos at 24  36 hpf and 48 hpf and performed 10X Chromium single cell RNA seq. Overall design: Three samples obtained from wild type zebrafish embryos at three developmental timepoints were analyzed.", null, "pubmed:32680935", null, "scRNAseq olig2 eGFP 48hpf", "GSM4718658", null, "tissue:spinal cord cells|developmental stage:48 hpf ZFIN ID: ZDB ALT 041129 8", "scRNAseq olig2 eGFP 48hpf", "Raw sequencing reads were demultiplexed  mapped to the zebrafish reference genome and summarized into gene expression matrices using CellRanger version 3.0.1 Count matrices were further filtered in Seurat 3.1.0 https://satijalab.org/seurat/ to remove cell barcodes with fewer than 250 detectable genes  more than 5% of UMIs derived from mitochondrial genes  or more than 50 000 UMIs to exclude putative doublets Standard Seurat normalization and PCA was run using the 1 291 most variable genes Applied Harmony https://doi.org/10.1038/s41592 019 0619 0 alignment theta = 2 to correct for inter sample variation  chose 20 Harmony dimensions and applied Seurat UMAP reduction Genome build: GRCz11 Supplementary files format and content: gzipped csv file of matrix of normalized gene expression by cell for merged 3 scRNAseq samples Supplementary files format and content: gzipped csv file of metadata for cells", "spinal cord cells", "No treatment was applied to the samples.", "24  36  and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 \u03bcl of pre chilled Ca free Ringers solution 116 mM NaCl  2.6 mM KCl  5 mM HEPES  pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 \u03bcl of protease solution 10 mg/ml BI protease  125 U/ml DNase  2.5 mM EDTA  1X PBS was added  to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 \u03bcl of STOP solution 30% FBS  0.8 mM CaCl2  1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4\u00b0C and supernatant was removed. On ice  1 ml of chilled suspension media 1% FBS  0.8 mM CaCl2  50 U/ml Penicillin  0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4\u00b0C. Supernatant was removed  and 400 \u03bcl of chilled suspension media was added and solution was filtered through a 35 \u03bcm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 \u03bcl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075.\u00a0 Libraries were sequenced on the Illumina NovaSEQ6000 Instrument.\u00a0", "Embryos were raised at 28.5\u00b0C in E3 media 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4 at pH 7.4  with sodium bicarbonate  sorted for good health and staged accordingly to developmental morphological features and hpf", "developmental stage:48 hpf ZFIN ID: ZDB ALT 041129 8", "GSM4718658", "GSM4718658: scRNAseq olig2 eGFP 48hpf; Danio rerio; RNA Seq", "GSM4718658", null, "1", "24  36  and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 \u03bcl of pre chilled Ca free Ringers solution 116 mM NaCl  2.6 mM KCl  5 mM HEPES  pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 \u03bcl of protease solution 10 mg/ml BI protease  125 U/ml DNase  2.5 mM EDTA  1X PBS was added  to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 \u03bcl of STOP solution 30% FBS  0.8 mM CaCl2  1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4\u00b0C and supernatant was removed. On ice  1 ml of chilled suspension media 1% FBS  0.8 mM CaCl2  50 U/ml Penicillin  0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4\u00b0C. Supernatant was removed  and 400 \u03bcl of chilled suspension media was added and solution was filtered through a 35 \u03bcm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 \u03bcl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075.  Libraries were sequenced on the Illumina NovaSEQ6000 Instrument.", "GEO Accession:GSM4718658", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP276929", null, null, "olig2_egfp_48hpf_4_S44_L001_R1_001.fastq.gz olig2_egfp_48hpf_4_S44_L001_R2_001.fastq.gz", "fastq fastq", 25546281170.0, 84590335.0, "GSM4718658 r4", "0:151 1:151", "A:8905009196;C:4774524700;G:4734395060;T:7132103501;N:248713", 151, 151, null, null, 8905009196, 4774524700, 4734395060, 7132103501, 248713, "SRX8920145", "SRS7176693", "SRA1111061", "GEO", "University of Colorado School of Medicine", 2, 0.0, 0.90169, 0.0, 0.21158, 1.0, 0.77697, null, 0.54006, 151, 151, "T", "B", "mate1 technical by mapping diff", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_droplet", "10x", null, "United States", "2020-08-10", "Hatching", "Embryo", "Spinal Cord", "Nervous System"], [60591, "SRR12424274", "SRX8920144", "SRS7176692", "SRP276929", "PRJNA656271", "Single cell RNA seq analysis of pMN neural progenitors from zebrafish", "GSE155988", "Transcriptome Analysis", "The goal of this study was to identify distinct cell populations that arise from ventral spinal cord pMN progenitors. To do so  we sorted fluorescently marked pMN cells obtained from Tgolig2:EGFP zebrafish embryos at 24  36 hpf and 48 hpf and performed 10X Chromium single cell RNA seq. Overall design: Three samples obtained from wild type zebrafish embryos at three developmental timepoints were analyzed.", null, "pubmed:32680935", null, "scRNAseq olig2 eGFP 36hpf", "GSM4718657", null, "tissue:spinal cord cells|developmental stage:36 hpf ZFIN ID: ZDB ALT 041129 8", "scRNAseq olig2 eGFP 36hpf", "Raw sequencing reads were demultiplexed  mapped to the zebrafish reference genome and summarized into gene expression matrices using CellRanger version 3.0.1 Count matrices were further filtered in Seurat 3.1.0 https://satijalab.org/seurat/ to remove cell barcodes with fewer than 250 detectable genes  more than 5% of UMIs derived from mitochondrial genes  or more than 50 000 UMIs to exclude putative doublets Standard Seurat normalization and PCA was run using the 1 291 most variable genes Applied Harmony https://doi.org/10.1038/s41592 019 0619 0 alignment theta = 2 to correct for inter sample variation  chose 20 Harmony dimensions and applied Seurat UMAP reduction Genome build: GRCz11 Supplementary files format and content: gzipped csv file of matrix of normalized gene expression by cell for merged 3 scRNAseq samples Supplementary files format and content: gzipped csv file of metadata for cells", "spinal cord cells", "No treatment was applied to the samples.", "24  36  and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 \u03bcl of pre chilled Ca free Ringers solution 116 mM NaCl  2.6 mM KCl  5 mM HEPES  pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 \u03bcl of protease solution 10 mg/ml BI protease  125 U/ml DNase  2.5 mM EDTA  1X PBS was added  to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 \u03bcl of STOP solution 30% FBS  0.8 mM CaCl2  1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4\u00b0C and supernatant was removed. On ice  1 ml of chilled suspension media 1% FBS  0.8 mM CaCl2  50 U/ml Penicillin  0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4\u00b0C. Supernatant was removed  and 400 \u03bcl of chilled suspension media was added and solution was filtered through a 35 \u03bcm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 \u03bcl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075.\u00a0 Libraries were sequenced on the Illumina NovaSEQ6000 Instrument.\u00a0", "Embryos were raised at 28.5\u00b0C in E3 media 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4 at pH 7.4  with sodium bicarbonate  sorted for good health and staged accordingly to developmental morphological features and hpf", "developmental stage:36 hpf ZFIN ID: ZDB ALT 041129 8", "GSM4718657", "GSM4718657: scRNAseq olig2 eGFP 36hpf; Danio rerio; RNA Seq", "GSM4718657", null, "1", "24  36  and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 \u03bcl of pre chilled Ca free Ringers solution 116 mM NaCl  2.6 mM KCl  5 mM HEPES  pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 \u03bcl of protease solution 10 mg/ml BI protease  125 U/ml DNase  2.5 mM EDTA  1X PBS was added  to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 \u03bcl of STOP solution 30% FBS  0.8 mM CaCl2  1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4\u00b0C and supernatant was removed. On ice  1 ml of chilled suspension media 1% FBS  0.8 mM CaCl2  50 U/ml Penicillin  0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4\u00b0C. Supernatant was removed  and 400 \u03bcl of chilled suspension media was added and solution was filtered through a 35 \u03bcm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 \u03bcl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075.  Libraries were sequenced on the Illumina NovaSEQ6000 Instrument.", "GEO Accession:GSM4718657", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP276929", null, null, "Olig2_eGFP_36hfp_1_S69_L001_R1_001.fastq.gz Olig2_eGFP_36hfp_1_S69_L001_R2_001.fastq.gz", "fastq fastq", 13366864582.0, 44261141.0, "GSM4718657 r1", "0:151 1:151", "A:3721647646;C:2385939960;G:3494552257;T:3764514262;N:210457", 151, 151, null, null, 3721647646, 2385939960, 3494552257, 3764514262, 210457, "SRX8920144", "SRS7176692", "SRA1111061", "GEO", "University of Colorado School of Medicine", 2, 0.0, 0.85449, 0.0, 0.08264, 1.0, 0.84086, null, 0.50156, 151, 151, "T", "B", "mate1 technical by mapping diff", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_droplet", "10x", null, "United States", "2020-08-10", "Pharyngula", "Embryo", "Spinal Cord", "Nervous System"], [60592, "SRR12424275", "SRX8920144", "SRS7176692", "SRP276929", "PRJNA656271", "Single cell RNA seq analysis of pMN neural progenitors from zebrafish", "GSE155988", "Transcriptome Analysis", "The goal of this study was to identify distinct cell populations that arise from ventral spinal cord pMN progenitors. To do so  we sorted fluorescently marked pMN cells obtained from Tgolig2:EGFP zebrafish embryos at 24  36 hpf and 48 hpf and performed 10X Chromium single cell RNA seq. Overall design: Three samples obtained from wild type zebrafish embryos at three developmental timepoints were analyzed.", null, "pubmed:32680935", null, "scRNAseq olig2 eGFP 36hpf", "GSM4718657", null, "tissue:spinal cord cells|developmental stage:36 hpf ZFIN ID: ZDB ALT 041129 8", "scRNAseq olig2 eGFP 36hpf", "Raw sequencing reads were demultiplexed  mapped to the zebrafish reference genome and summarized into gene expression matrices using CellRanger version 3.0.1 Count matrices were further filtered in Seurat 3.1.0 https://satijalab.org/seurat/ to remove cell barcodes with fewer than 250 detectable genes  more than 5% of UMIs derived from mitochondrial genes  or more than 50 000 UMIs to exclude putative doublets Standard Seurat normalization and PCA was run using the 1 291 most variable genes Applied Harmony https://doi.org/10.1038/s41592 019 0619 0 alignment theta = 2 to correct for inter sample variation  chose 20 Harmony dimensions and applied Seurat UMAP reduction Genome build: GRCz11 Supplementary files format and content: gzipped csv file of matrix of normalized gene expression by cell for merged 3 scRNAseq samples Supplementary files format and content: gzipped csv file of metadata for cells", "spinal cord cells", "No treatment was applied to the samples.", "24  36  and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 \u03bcl of pre chilled Ca free Ringers solution 116 mM NaCl  2.6 mM KCl  5 mM HEPES  pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 \u03bcl of protease solution 10 mg/ml BI protease  125 U/ml DNase  2.5 mM EDTA  1X PBS was added  to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 \u03bcl of STOP solution 30% FBS  0.8 mM CaCl2  1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4\u00b0C and supernatant was removed. On ice  1 ml of chilled suspension media 1% FBS  0.8 mM CaCl2  50 U/ml Penicillin  0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4\u00b0C. Supernatant was removed  and 400 \u03bcl of chilled suspension media was added and solution was filtered through a 35 \u03bcm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 \u03bcl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075.\u00a0 Libraries were sequenced on the Illumina NovaSEQ6000 Instrument.\u00a0", "Embryos were raised at 28.5\u00b0C in E3 media 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4 at pH 7.4  with sodium bicarbonate  sorted for good health and staged accordingly to developmental morphological features and hpf", "developmental stage:36 hpf ZFIN ID: ZDB ALT 041129 8", "GSM4718657", "GSM4718657: scRNAseq olig2 eGFP 36hpf; Danio rerio; RNA Seq", "GSM4718657", null, "1", "24  36  and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 \u03bcl of pre chilled Ca free Ringers solution 116 mM NaCl  2.6 mM KCl  5 mM HEPES  pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 \u03bcl of protease solution 10 mg/ml BI protease  125 U/ml DNase  2.5 mM EDTA  1X PBS was added  to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 \u03bcl of STOP solution 30% FBS  0.8 mM CaCl2  1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4\u00b0C and supernatant was removed. On ice  1 ml of chilled suspension media 1% FBS  0.8 mM CaCl2  50 U/ml Penicillin  0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4\u00b0C. Supernatant was removed  and 400 \u03bcl of chilled suspension media was added and solution was filtered through a 35 \u03bcm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 \u03bcl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075.  Libraries were sequenced on the Illumina NovaSEQ6000 Instrument.", "GEO Accession:GSM4718657", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP276929", null, null, "Olig2_eGFP_36hfp_2_S70_L001_R1_001.fastq.gz Olig2_eGFP_36hfp_2_S70_L001_R2_001.fastq.gz", "fastq fastq", 10606211914.0, 35119907.0, "GSM4718657 r2", "0:151 1:151", "A:2974656607;C:1869869441;G:2750621038;T:3010898673;N:166155", 151, 151, null, null, 2974656607, 1869869441, 2750621038, 3010898673, 166155, "SRX8920144", "SRS7176692", "SRA1111061", "GEO", "University of Colorado School of Medicine", 2, 0.0, 0.84822, 0.0, 0.08456, 1.0, 0.83719, null, 0.51503, 151, 151, "T", "B", "mate1 technical by mapping diff", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_droplet", "10x", null, "United States", "2020-08-10", "Pharyngula", "Embryo", "Spinal Cord", "Nervous System"], [60593, "SRR12424276", "SRX8920144", "SRS7176692", "SRP276929", "PRJNA656271", "Single cell RNA seq analysis of pMN neural progenitors from zebrafish", "GSE155988", "Transcriptome Analysis", "The goal of this study was to identify distinct cell populations that arise from ventral spinal cord pMN progenitors. To do so  we sorted fluorescently marked pMN cells obtained from Tgolig2:EGFP zebrafish embryos at 24  36 hpf and 48 hpf and performed 10X Chromium single cell RNA seq. Overall design: Three samples obtained from wild type zebrafish embryos at three developmental timepoints were analyzed.", null, "pubmed:32680935", null, "scRNAseq olig2 eGFP 36hpf", "GSM4718657", null, "tissue:spinal cord cells|developmental stage:36 hpf ZFIN ID: ZDB ALT 041129 8", "scRNAseq olig2 eGFP 36hpf", "Raw sequencing reads were demultiplexed  mapped to the zebrafish reference genome and summarized into gene expression matrices using CellRanger version 3.0.1 Count matrices were further filtered in Seurat 3.1.0 https://satijalab.org/seurat/ to remove cell barcodes with fewer than 250 detectable genes  more than 5% of UMIs derived from mitochondrial genes  or more than 50 000 UMIs to exclude putative doublets Standard Seurat normalization and PCA was run using the 1 291 most variable genes Applied Harmony https://doi.org/10.1038/s41592 019 0619 0 alignment theta = 2 to correct for inter sample variation  chose 20 Harmony dimensions and applied Seurat UMAP reduction Genome build: GRCz11 Supplementary files format and content: gzipped csv file of matrix of normalized gene expression by cell for merged 3 scRNAseq samples Supplementary files format and content: gzipped csv file of metadata for cells", "spinal cord cells", "No treatment was applied to the samples.", "24  36  and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 \u03bcl of pre chilled Ca free Ringers solution 116 mM NaCl  2.6 mM KCl  5 mM HEPES  pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 \u03bcl of protease solution 10 mg/ml BI protease  125 U/ml DNase  2.5 mM EDTA  1X PBS was added  to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 \u03bcl of STOP solution 30% FBS  0.8 mM CaCl2  1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4\u00b0C and supernatant was removed. On ice  1 ml of chilled suspension media 1% FBS  0.8 mM CaCl2  50 U/ml Penicillin  0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4\u00b0C. Supernatant was removed  and 400 \u03bcl of chilled suspension media was added and solution was filtered through a 35 \u03bcm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 \u03bcl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075.\u00a0 Libraries were sequenced on the Illumina NovaSEQ6000 Instrument.\u00a0", "Embryos were raised at 28.5\u00b0C in E3 media 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4 at pH 7.4  with sodium bicarbonate  sorted for good health and staged accordingly to developmental morphological features and hpf", "developmental stage:36 hpf ZFIN ID: ZDB ALT 041129 8", "GSM4718657", "GSM4718657: scRNAseq olig2 eGFP 36hpf; Danio rerio; RNA Seq", "GSM4718657", null, "1", "24  36  and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 \u03bcl of pre chilled Ca free Ringers solution 116 mM NaCl  2.6 mM KCl  5 mM HEPES  pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 \u03bcl of protease solution 10 mg/ml BI protease  125 U/ml DNase  2.5 mM EDTA  1X PBS was added  to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 \u03bcl of STOP solution 30% FBS  0.8 mM CaCl2  1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4\u00b0C and supernatant was removed. On ice  1 ml of chilled suspension media 1% FBS  0.8 mM CaCl2  50 U/ml Penicillin  0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4\u00b0C. Supernatant was removed  and 400 \u03bcl of chilled suspension media was added and solution was filtered through a 35 \u03bcm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 \u03bcl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075.  Libraries were sequenced on the Illumina NovaSEQ6000 Instrument.", "GEO Accession:GSM4718657", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP276929", null, null, "Olig2_eGFP_36hfp_3_S71_L001_R1_001.fastq.gz Olig2_eGFP_36hfp_3_S71_L001_R2_001.fastq.gz", "fastq fastq", 15614508642.0, 51703671.0, "GSM4718657 r3", "0:151 1:151", "A:4330312984;C:2826855730;G:4093245712;T:4363847925;N:246291", 151, 151, null, null, 4330312984, 2826855730, 4093245712, 4363847925, 246291, "SRX8920144", "SRS7176692", "SRA1111061", "GEO", "University of Colorado School of Medicine", 2, 0.0, 0.8543, 0.0, 0.08219, 1.0, 0.83727, null, 0.51892, 151, 151, "T", "B", "mate1 technical by mapping diff", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_droplet", "10x", null, "United States", "2020-08-10", "Pharyngula", "Embryo", "Spinal Cord", "Nervous System"], [60594, "SRR12424277", "SRX8920144", "SRS7176692", "SRP276929", "PRJNA656271", "Single cell RNA seq analysis of pMN neural progenitors from zebrafish", "GSE155988", "Transcriptome Analysis", "The goal of this study was to identify distinct cell populations that arise from ventral spinal cord pMN progenitors. To do so  we sorted fluorescently marked pMN cells obtained from Tgolig2:EGFP zebrafish embryos at 24  36 hpf and 48 hpf and performed 10X Chromium single cell RNA seq. Overall design: Three samples obtained from wild type zebrafish embryos at three developmental timepoints were analyzed.", null, "pubmed:32680935", null, "scRNAseq olig2 eGFP 36hpf", "GSM4718657", null, "tissue:spinal cord cells|developmental stage:36 hpf ZFIN ID: ZDB ALT 041129 8", "scRNAseq olig2 eGFP 36hpf", "Raw sequencing reads were demultiplexed  mapped to the zebrafish reference genome and summarized into gene expression matrices using CellRanger version 3.0.1 Count matrices were further filtered in Seurat 3.1.0 https://satijalab.org/seurat/ to remove cell barcodes with fewer than 250 detectable genes  more than 5% of UMIs derived from mitochondrial genes  or more than 50 000 UMIs to exclude putative doublets Standard Seurat normalization and PCA was run using the 1 291 most variable genes Applied Harmony https://doi.org/10.1038/s41592 019 0619 0 alignment theta = 2 to correct for inter sample variation  chose 20 Harmony dimensions and applied Seurat UMAP reduction Genome build: GRCz11 Supplementary files format and content: gzipped csv file of matrix of normalized gene expression by cell for merged 3 scRNAseq samples Supplementary files format and content: gzipped csv file of metadata for cells", "spinal cord cells", "No treatment was applied to the samples.", "24  36  and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 \u03bcl of pre chilled Ca free Ringers solution 116 mM NaCl  2.6 mM KCl  5 mM HEPES  pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 \u03bcl of protease solution 10 mg/ml BI protease  125 U/ml DNase  2.5 mM EDTA  1X PBS was added  to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 \u03bcl of STOP solution 30% FBS  0.8 mM CaCl2  1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4\u00b0C and supernatant was removed. On ice  1 ml of chilled suspension media 1% FBS  0.8 mM CaCl2  50 U/ml Penicillin  0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4\u00b0C. Supernatant was removed  and 400 \u03bcl of chilled suspension media was added and solution was filtered through a 35 \u03bcm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 \u03bcl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075.\u00a0 Libraries were sequenced on the Illumina NovaSEQ6000 Instrument.\u00a0", "Embryos were raised at 28.5\u00b0C in E3 media 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4 at pH 7.4  with sodium bicarbonate  sorted for good health and staged accordingly to developmental morphological features and hpf", "developmental stage:36 hpf ZFIN ID: ZDB ALT 041129 8", "GSM4718657", "GSM4718657: scRNAseq olig2 eGFP 36hpf; Danio rerio; RNA Seq", "GSM4718657", null, "1", "24  36  and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 \u03bcl of pre chilled Ca free Ringers solution 116 mM NaCl  2.6 mM KCl  5 mM HEPES  pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 \u03bcl of protease solution 10 mg/ml BI protease  125 U/ml DNase  2.5 mM EDTA  1X PBS was added  to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 \u03bcl of STOP solution 30% FBS  0.8 mM CaCl2  1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4\u00b0C and supernatant was removed. On ice  1 ml of chilled suspension media 1% FBS  0.8 mM CaCl2  50 U/ml Penicillin  0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4\u00b0C. Supernatant was removed  and 400 \u03bcl of chilled suspension media was added and solution was filtered through a 35 \u03bcm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 \u03bcl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075.  Libraries were sequenced on the Illumina NovaSEQ6000 Instrument.", "GEO Accession:GSM4718657", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP276929", null, null, "Olig2_eGFP_36hfp_4_S72_L001_R1_001.fastq.gz Olig2_eGFP_36hfp_4_S72_L001_R2_001.fastq.gz", "fastq fastq", 10707787198.0, 35456249.0, "GSM4718657 r4", "0:151 1:151", "A:2981466900;C:1909696186;G:2797297473;T:3019156550;N:170089", 151, 151, null, null, 2981466900, 1909696186, 2797297473, 3019156550, 170089, "SRX8920144", "SRS7176692", "SRA1111061", "GEO", "University of Colorado School of Medicine", 2, 0.0, 0.85466, 0.0, 0.08381, 1.0, 0.83562, null, 0.51035, 151, 151, "T", "B", "mate1 technical by mapping diff", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_droplet", "10x", null, "United States", "2020-08-10", "Pharyngula", "Embryo", "Spinal Cord", "Nervous System"], [60595, "SRR12424270", "SRX8920143", "SRS7176691", "SRP276929", "PRJNA656271", "Single cell RNA seq analysis of pMN neural progenitors from zebrafish", "GSE155988", "Transcriptome Analysis", "The goal of this study was to identify distinct cell populations that arise from ventral spinal cord pMN progenitors. To do so  we sorted fluorescently marked pMN cells obtained from Tgolig2:EGFP zebrafish embryos at 24  36 hpf and 48 hpf and performed 10X Chromium single cell RNA seq. Overall design: Three samples obtained from wild type zebrafish embryos at three developmental timepoints were analyzed.", null, "pubmed:32680935", null, "scRNAseq olig2 eGFP 24hpf", "GSM4718656", null, "tissue:spinal cord cells|developmental stage:24 hpf ZFIN ID: ZDB ALT 041129 8", "scRNAseq olig2 eGFP 24hpf", "Raw sequencing reads were demultiplexed  mapped to the zebrafish reference genome and summarized into gene expression matrices using CellRanger version 3.0.1 Count matrices were further filtered in Seurat 3.1.0 https://satijalab.org/seurat/ to remove cell barcodes with fewer than 250 detectable genes  more than 5% of UMIs derived from mitochondrial genes  or more than 50 000 UMIs to exclude putative doublets Standard Seurat normalization and PCA was run using the 1 291 most variable genes Applied Harmony https://doi.org/10.1038/s41592 019 0619 0 alignment theta = 2 to correct for inter sample variation  chose 20 Harmony dimensions and applied Seurat UMAP reduction Genome build: GRCz11 Supplementary files format and content: gzipped csv file of matrix of normalized gene expression by cell for merged 3 scRNAseq samples Supplementary files format and content: gzipped csv file of metadata for cells", "spinal cord cells", "No treatment was applied to the samples.", "24  36  and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 \u03bcl of pre chilled Ca free Ringers solution 116 mM NaCl  2.6 mM KCl  5 mM HEPES  pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 \u03bcl of protease solution 10 mg/ml BI protease  125 U/ml DNase  2.5 mM EDTA  1X PBS was added  to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 \u03bcl of STOP solution 30% FBS  0.8 mM CaCl2  1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4\u00b0C and supernatant was removed. On ice  1 ml of chilled suspension media 1% FBS  0.8 mM CaCl2  50 U/ml Penicillin  0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4\u00b0C. Supernatant was removed  and 400 \u03bcl of chilled suspension media was added and solution was filtered through a 35 \u03bcm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 \u03bcl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075.\u00a0 Libraries were sequenced on the Illumina NovaSEQ6000 Instrument.\u00a0", "Embryos were raised at 28.5\u00b0C in E3 media 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4 at pH 7.4  with sodium bicarbonate  sorted for good health and staged accordingly to developmental morphological features and hpf", "developmental stage:24 hpf ZFIN ID: ZDB ALT 041129 8", "GSM4718656", "GSM4718656: scRNAseq olig2 eGFP 24hpf; Danio rerio; RNA Seq", "GSM4718656", null, "1", "24  36  and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 \u03bcl of pre chilled Ca free Ringers solution 116 mM NaCl  2.6 mM KCl  5 mM HEPES  pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 \u03bcl of protease solution 10 mg/ml BI protease  125 U/ml DNase  2.5 mM EDTA  1X PBS was added  to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 \u03bcl of STOP solution 30% FBS  0.8 mM CaCl2  1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4\u00b0C and supernatant was removed. On ice  1 ml of chilled suspension media 1% FBS  0.8 mM CaCl2  50 U/ml Penicillin  0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4\u00b0C. Supernatant was removed  and 400 \u03bcl of chilled suspension media was added and solution was filtered through a 35 \u03bcm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 \u03bcl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075.  Libraries were sequenced on the Illumina NovaSEQ6000 Instrument.", "GEO Accession:GSM4718656", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP276929", null, null, "Olig2_eGFP_24hfp_1_S10_L001_R1_001.fastq.gz Olig2_eGFP_24hfp_1_S10_L001_R2_001.fastq.gz", "fastq fastq", 21279021170.0, 70460335.0, "GSM4718656 r1", "0:151 1:151", "A:5842145219;C:3712477572;G:5933108587;T:5790922441;N:367351", 151, 151, null, null, 5842145219, 3712477572, 5933108587, 5790922441, 367351, "SRX8920143", "SRS7176691", "SRA1111061", "GEO", "University of Colorado School of Medicine", 2, 0.0, 0.83071, 0.0, 0.06828, 1.0, 0.8406, null, 0.5078, 151, 151, "T", "B", "mate1 technical by mapping diff", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_droplet", "10x", null, "United States", "2020-08-10", "Pharyngula", "Embryo", "Spinal Cord", "Nervous System"], [60596, "SRR12424271", "SRX8920143", "SRS7176691", "SRP276929", "PRJNA656271", "Single cell RNA seq analysis of pMN neural progenitors from zebrafish", "GSE155988", "Transcriptome Analysis", "The goal of this study was to identify distinct cell populations that arise from ventral spinal cord pMN progenitors. To do so  we sorted fluorescently marked pMN cells obtained from Tgolig2:EGFP zebrafish embryos at 24  36 hpf and 48 hpf and performed 10X Chromium single cell RNA seq. Overall design: Three samples obtained from wild type zebrafish embryos at three developmental timepoints were analyzed.", null, "pubmed:32680935", null, "scRNAseq olig2 eGFP 24hpf", "GSM4718656", null, "tissue:spinal cord cells|developmental stage:24 hpf ZFIN ID: ZDB ALT 041129 8", "scRNAseq olig2 eGFP 24hpf", "Raw sequencing reads were demultiplexed  mapped to the zebrafish reference genome and summarized into gene expression matrices using CellRanger version 3.0.1 Count matrices were further filtered in Seurat 3.1.0 https://satijalab.org/seurat/ to remove cell barcodes with fewer than 250 detectable genes  more than 5% of UMIs derived from mitochondrial genes  or more than 50 000 UMIs to exclude putative doublets Standard Seurat normalization and PCA was run using the 1 291 most variable genes Applied Harmony https://doi.org/10.1038/s41592 019 0619 0 alignment theta = 2 to correct for inter sample variation  chose 20 Harmony dimensions and applied Seurat UMAP reduction Genome build: GRCz11 Supplementary files format and content: gzipped csv file of matrix of normalized gene expression by cell for merged 3 scRNAseq samples Supplementary files format and content: gzipped csv file of metadata for cells", "spinal cord cells", "No treatment was applied to the samples.", "24  36  and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 \u03bcl of pre chilled Ca free Ringers solution 116 mM NaCl  2.6 mM KCl  5 mM HEPES  pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 \u03bcl of protease solution 10 mg/ml BI protease  125 U/ml DNase  2.5 mM EDTA  1X PBS was added  to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 \u03bcl of STOP solution 30% FBS  0.8 mM CaCl2  1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4\u00b0C and supernatant was removed. On ice  1 ml of chilled suspension media 1% FBS  0.8 mM CaCl2  50 U/ml Penicillin  0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4\u00b0C. Supernatant was removed  and 400 \u03bcl of chilled suspension media was added and solution was filtered through a 35 \u03bcm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 \u03bcl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075.\u00a0 Libraries were sequenced on the Illumina NovaSEQ6000 Instrument.\u00a0", "Embryos were raised at 28.5\u00b0C in E3 media 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4 at pH 7.4  with sodium bicarbonate  sorted for good health and staged accordingly to developmental morphological features and hpf", "developmental stage:24 hpf ZFIN ID: ZDB ALT 041129 8", "GSM4718656", "GSM4718656: scRNAseq olig2 eGFP 24hpf; Danio rerio; RNA Seq", "GSM4718656", null, "1", "24  36  and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 \u03bcl of pre chilled Ca free Ringers solution 116 mM NaCl  2.6 mM KCl  5 mM HEPES  pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 \u03bcl of protease solution 10 mg/ml BI protease  125 U/ml DNase  2.5 mM EDTA  1X PBS was added  to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 \u03bcl of STOP solution 30% FBS  0.8 mM CaCl2  1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4\u00b0C and supernatant was removed. On ice  1 ml of chilled suspension media 1% FBS  0.8 mM CaCl2  50 U/ml Penicillin  0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4\u00b0C. Supernatant was removed  and 400 \u03bcl of chilled suspension media was added and solution was filtered through a 35 \u03bcm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 \u03bcl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075.  Libraries were sequenced on the Illumina NovaSEQ6000 Instrument.", "GEO Accession:GSM4718656", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP276929", null, null, "Olig2_eGFP_24hfp_2_S20_L001_R1_001.fastq.gz Olig2_eGFP_24hfp_2_S20_L001_R2_001.fastq.gz", "fastq fastq", 22414094210.0, 74218855.0, "GSM4718656 r2", "0:151 1:151", "A:6145677154;C:3904876630;G:6254105391;T:6109049174;N:385861", 151, 151, null, null, 6145677154, 3904876630, 6254105391, 6109049174, 385861, "SRX8920143", "SRS7176691", "SRA1111061", "GEO", "University of Colorado School of Medicine", 2, 0.0, 0.83148, 0.0, 0.06914, 1.0, 0.84033, null, 0.49666, 151, 151, "T", "B", "mate1 technical by mapping diff", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_droplet", "10x", null, "United States", "2020-08-10", "Pharyngula", "Embryo", "Spinal Cord", "Nervous System"], [60597, "SRR12424272", "SRX8920143", "SRS7176691", "SRP276929", "PRJNA656271", "Single cell RNA seq analysis of pMN neural progenitors from zebrafish", "GSE155988", "Transcriptome Analysis", "The goal of this study was to identify distinct cell populations that arise from ventral spinal cord pMN progenitors. To do so  we sorted fluorescently marked pMN cells obtained from Tgolig2:EGFP zebrafish embryos at 24  36 hpf and 48 hpf and performed 10X Chromium single cell RNA seq. Overall design: Three samples obtained from wild type zebrafish embryos at three developmental timepoints were analyzed.", null, "pubmed:32680935", null, "scRNAseq olig2 eGFP 24hpf", "GSM4718656", null, "tissue:spinal cord cells|developmental stage:24 hpf ZFIN ID: ZDB ALT 041129 8", "scRNAseq olig2 eGFP 24hpf", "Raw sequencing reads were demultiplexed  mapped to the zebrafish reference genome and summarized into gene expression matrices using CellRanger version 3.0.1 Count matrices were further filtered in Seurat 3.1.0 https://satijalab.org/seurat/ to remove cell barcodes with fewer than 250 detectable genes  more than 5% of UMIs derived from mitochondrial genes  or more than 50 000 UMIs to exclude putative doublets Standard Seurat normalization and PCA was run using the 1 291 most variable genes Applied Harmony https://doi.org/10.1038/s41592 019 0619 0 alignment theta = 2 to correct for inter sample variation  chose 20 Harmony dimensions and applied Seurat UMAP reduction Genome build: GRCz11 Supplementary files format and content: gzipped csv file of matrix of normalized gene expression by cell for merged 3 scRNAseq samples Supplementary files format and content: gzipped csv file of metadata for cells", "spinal cord cells", "No treatment was applied to the samples.", "24  36  and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 \u03bcl of pre chilled Ca free Ringers solution 116 mM NaCl  2.6 mM KCl  5 mM HEPES  pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 \u03bcl of protease solution 10 mg/ml BI protease  125 U/ml DNase  2.5 mM EDTA  1X PBS was added  to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 \u03bcl of STOP solution 30% FBS  0.8 mM CaCl2  1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4\u00b0C and supernatant was removed. On ice  1 ml of chilled suspension media 1% FBS  0.8 mM CaCl2  50 U/ml Penicillin  0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4\u00b0C. Supernatant was removed  and 400 \u03bcl of chilled suspension media was added and solution was filtered through a 35 \u03bcm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 \u03bcl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075.\u00a0 Libraries were sequenced on the Illumina NovaSEQ6000 Instrument.\u00a0", "Embryos were raised at 28.5\u00b0C in E3 media 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4 at pH 7.4  with sodium bicarbonate  sorted for good health and staged accordingly to developmental morphological features and hpf", "developmental stage:24 hpf ZFIN ID: ZDB ALT 041129 8", "GSM4718656", "GSM4718656: scRNAseq olig2 eGFP 24hpf; Danio rerio; RNA Seq", "GSM4718656", null, "1", "24  36  and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 \u03bcl of pre chilled Ca free Ringers solution 116 mM NaCl  2.6 mM KCl  5 mM HEPES  pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 \u03bcl of protease solution 10 mg/ml BI protease  125 U/ml DNase  2.5 mM EDTA  1X PBS was added  to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 \u03bcl of STOP solution 30% FBS  0.8 mM CaCl2  1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4\u00b0C and supernatant was removed. On ice  1 ml of chilled suspension media 1% FBS  0.8 mM CaCl2  50 U/ml Penicillin  0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4\u00b0C. Supernatant was removed  and 400 \u03bcl of chilled suspension media was added and solution was filtered through a 35 \u03bcm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 \u03bcl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075.  Libraries were sequenced on the Illumina NovaSEQ6000 Instrument.", "GEO Accession:GSM4718656", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP276929", null, null, "Olig2_eGFP_24hfp_3_S30_L001_R1_001.fastq.gz Olig2_eGFP_24hfp_3_S30_L001_R2_001.fastq.gz", "fastq fastq", 16406166006.0, 54325053.0, "GSM4718656 r3", "0:151 1:151", "A:4513103872;C:2865727260;G:4569430659;T:4457621166;N:283049", 151, 151, null, null, 4513103872, 2865727260, 4569430659, 4457621166, 283049, "SRX8920143", "SRS7176691", "SRA1111061", "GEO", "University of Colorado School of Medicine", 2, 0.0, 0.82928, 0.0, 0.06878, 1.0, 0.83989, null, 0.4916, 151, 151, "T", "B", "mate1 technical by mapping diff", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_droplet", "10x", null, "United States", "2020-08-10", "Pharyngula", "Embryo", "Spinal Cord", "Nervous System"], [60598, "SRR12424273", "SRX8920143", "SRS7176691", "SRP276929", "PRJNA656271", "Single cell RNA seq analysis of pMN neural progenitors from zebrafish", "GSE155988", "Transcriptome Analysis", "The goal of this study was to identify distinct cell populations that arise from ventral spinal cord pMN progenitors. To do so  we sorted fluorescently marked pMN cells obtained from Tgolig2:EGFP zebrafish embryos at 24  36 hpf and 48 hpf and performed 10X Chromium single cell RNA seq. Overall design: Three samples obtained from wild type zebrafish embryos at three developmental timepoints were analyzed.", null, "pubmed:32680935", null, "scRNAseq olig2 eGFP 24hpf", "GSM4718656", null, "tissue:spinal cord cells|developmental stage:24 hpf ZFIN ID: ZDB ALT 041129 8", "scRNAseq olig2 eGFP 24hpf", "Raw sequencing reads were demultiplexed  mapped to the zebrafish reference genome and summarized into gene expression matrices using CellRanger version 3.0.1 Count matrices were further filtered in Seurat 3.1.0 https://satijalab.org/seurat/ to remove cell barcodes with fewer than 250 detectable genes  more than 5% of UMIs derived from mitochondrial genes  or more than 50 000 UMIs to exclude putative doublets Standard Seurat normalization and PCA was run using the 1 291 most variable genes Applied Harmony https://doi.org/10.1038/s41592 019 0619 0 alignment theta = 2 to correct for inter sample variation  chose 20 Harmony dimensions and applied Seurat UMAP reduction Genome build: GRCz11 Supplementary files format and content: gzipped csv file of matrix of normalized gene expression by cell for merged 3 scRNAseq samples Supplementary files format and content: gzipped csv file of metadata for cells", "spinal cord cells", "No treatment was applied to the samples.", "24  36  and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 \u03bcl of pre chilled Ca free Ringers solution 116 mM NaCl  2.6 mM KCl  5 mM HEPES  pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 \u03bcl of protease solution 10 mg/ml BI protease  125 U/ml DNase  2.5 mM EDTA  1X PBS was added  to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 \u03bcl of STOP solution 30% FBS  0.8 mM CaCl2  1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4\u00b0C and supernatant was removed. On ice  1 ml of chilled suspension media 1% FBS  0.8 mM CaCl2  50 U/ml Penicillin  0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4\u00b0C. Supernatant was removed  and 400 \u03bcl of chilled suspension media was added and solution was filtered through a 35 \u03bcm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 \u03bcl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075.\u00a0 Libraries were sequenced on the Illumina NovaSEQ6000 Instrument.\u00a0", "Embryos were raised at 28.5\u00b0C in E3 media 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4 at pH 7.4  with sodium bicarbonate  sorted for good health and staged accordingly to developmental morphological features and hpf", "developmental stage:24 hpf ZFIN ID: ZDB ALT 041129 8", "GSM4718656", "GSM4718656: scRNAseq olig2 eGFP 24hpf; Danio rerio; RNA Seq", "GSM4718656", null, "1", "24  36  and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 \u03bcl of pre chilled Ca free Ringers solution 116 mM NaCl  2.6 mM KCl  5 mM HEPES  pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 \u03bcl of protease solution 10 mg/ml BI protease  125 U/ml DNase  2.5 mM EDTA  1X PBS was added  to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 \u03bcl of STOP solution 30% FBS  0.8 mM CaCl2  1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4\u00b0C and supernatant was removed. On ice  1 ml of chilled suspension media 1% FBS  0.8 mM CaCl2  50 U/ml Penicillin  0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4\u00b0C. Supernatant was removed  and 400 \u03bcl of chilled suspension media was added and solution was filtered through a 35 \u03bcm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 \u03bcl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075.  Libraries were sequenced on the Illumina NovaSEQ6000 Instrument.", "GEO Accession:GSM4718656", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP276929", null, null, "Olig2_eGFP_24hfp_4_S40_L001_R1_001.fastq.gz Olig2_eGFP_24hfp_4_S40_L001_R2_001.fastq.gz", "fastq fastq", 17382967792.0, 57559496.0, "GSM4718656 r4", "0:151 1:151", "A:4767137063;C:3044788720;G:4846983492;T:4723757048;N:301469", 151, 151, null, null, 4767137063, 3044788720, 4846983492, 4723757048, 301469, "SRX8920143", "SRS7176691", "SRA1111061", "GEO", "University of Colorado School of Medicine", 2, 0.0, 0.83084, 0.0, 0.06779, 1.0, 0.83948, null, 0.49689, 151, 151, "T", "B", "mate1 technical by mapping diff", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_droplet", "10x", null, "United States", "2020-08-10", "Pharyngula", "Embryo", "Spinal Cord", "Nervous System"], [61886, "SRR13074872", "SRX9521915", "SRS7729122", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 D12", "GSM4911711", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 D12", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911711", "GSM4911711: SDPL.1X 01 D12; Danio rerio; RNA Seq", "GSM4911711", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911711", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31855_Track-65510_R1.fastq.gz", "fastq", 34606372.0, 455347.0, "GSM4911711 r1", "0:76 1:0", "A:9797047;C:7514433;G:7529128;T:9765391;N:373", 76, 0, null, null, 9797047, 7514433, 7529128, 9765391, 373, "SRX9521915", "SRS7729122", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.88569, null, 0.07951, null, 0.91212, null, 0.42432, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61887, "SRR13074871", "SRX9521914", "SRS7729121", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 G10", "GSM4911710", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 G10", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911710", "GSM4911710: SDPL.1X 01 G10; Danio rerio; RNA Seq", "GSM4911710", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911710", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31846_Track-65507_R1.fastq.gz", "fastq", 40850608.0, 537508.0, "GSM4911710 r1", "0:76 1:0", "A:11503051;C:8892746;G:8924384;T:11530029;N:398", 76, 0, null, null, 11503051, 8892746, 8924384, 11530029, 398, "SRX9521914", "SRS7729121", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.87161, null, 0.06824, null, 0.94123, null, 0.43306, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61888, "SRR13074870", "SRX9521913", "SRS7729120", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 E11", "GSM4911709", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 E11", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911709", "GSM4911709: SDPL.1X 01 E11; Danio rerio; RNA Seq", "GSM4911709", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911709", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31850_Track-65519_R1.fastq.gz", "fastq", 50048660.0, 658535.0, "GSM4911709 r1", "0:76 1:0", "A:13622067;C:11406781;G:11303440;T:13715844;N:528", 76, 0, null, null, 13622067, 11406781, 11303440, 13715844, 528, "SRX9521913", "SRS7729120", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.86014, null, 0.09565, null, 0.96252, null, 0.45301, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61889, "SRR13074869", "SRX9521912", "SRS7729119", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 H10", "GSM4911708", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 H10", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911708", "GSM4911708: SDPL.1X 01 H10; Danio rerio; RNA Seq", "GSM4911708", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911708", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31847_Track-65513_R1.fastq.gz", "fastq", 54199552.0, 713152.0, "GSM4911708 r1", "0:76 1:0", "A:14613140;C:12664231;G:12481214;T:14440413;N:554", 76, 0, null, null, 14613140, 12664231, 12481214, 14440413, 554, "SRX9521912", "SRS7729119", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.83847, null, 0.0463, null, 0.95465, null, 0.4661, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61890, "SRR13074868", "SRX9521911", "SRS7729118", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 C11", "GSM4911707", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 C11", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911707", "GSM4911707: SDPL.1X 01 C11; Danio rerio; RNA Seq", "GSM4911707", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911707", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31848_Track-65516_R1.fastq.gz", "fastq", 50085216.0, 659016.0, "GSM4911707 r1", "0:76 1:0", "A:13748335;C:11332042;G:11277617;T:13726702;N:520", 76, 0, null, null, 13748335, 11332042, 11277617, 13726702, 520, "SRX9521911", "SRS7729118", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.85163, null, 0.06643, null, 0.94866, null, 0.41876, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61891, "SRR13074867", "SRX9521910", "SRS7729116", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 F10", "GSM4911706", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 F10", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911706", "GSM4911706: SDPL.1X 01 F10; Danio rerio; RNA Seq", "GSM4911706", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911706", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31845_Track-65521_R1.fastq.gz", "fastq", 62281620.0, 819495.0, "GSM4911706 r1", "0:76 1:0", "A:17609719;C:13581841;G:13554360;T:17535048;N:652", 76, 0, null, null, 17609719, 13581841, 13554360, 17535048, 652, "SRX9521910", "SRS7729116", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.888, null, 0.07076, null, 0.94373, null, 0.40445, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61892, "SRR13074866", "SRX9521909", "SRS7729117", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 D10", "GSM4911705", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 D10", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911705", "GSM4911705: SDPL.1X 01 D10; Danio rerio; RNA Seq", "GSM4911705", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911705", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31843_Track-65494_R1.fastq.gz", "fastq", 50016664.0, 658114.0, "GSM4911705 r1", "0:76 1:0", "A:13556216;C:11587501;G:11405855;T:13466527;N:565", 76, 0, null, null, 13556216, 11587501, 11405855, 13466527, 565, "SRX9521909", "SRS7729117", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.86173, null, 0.07254, null, 0.9585, null, 0.4398, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61893, "SRR13074865", "SRX9521908", "SRS7729115", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 H09", "GSM4911704", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 H09", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911704", "GSM4911704: SDPL.1X 01 H09; Danio rerio; RNA Seq", "GSM4911704", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911704", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31841_Track-65517_R1.fastq.gz", "fastq", 57497800.0, 756550.0, "GSM4911704 r1", "0:76 1:0", "A:15234361;C:13740258;G:13485376;T:15037204;N:601", 76, 0, null, null, 15234361, 13740258, 13485376, 15037204, 601, "SRX9521908", "SRS7729115", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.80337, null, 0.07149, null, 0.96197, null, 0.46562, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61894, "SRR13074864", "SRX9521907", "SRS7729114", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 D09", "GSM4911703", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 D09", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911703", "GSM4911703: SDPL.1X 01 D09; Danio rerio; RNA Seq", "GSM4911703", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911703", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31837_Track-65520_R1.fastq.gz", "fastq", 39290632.0, 516982.0, "GSM4911703 r1", "0:76 1:0", "A:10705956;C:9062965;G:9013523;T:10507818;N:370", 76, 0, null, null, 10705956, 9062965, 9013523, 10507818, 370, "SRX9521907", "SRS7729114", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.84931, null, 0.06191, null, 0.94844, null, 0.43923, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61895, "SRR13074863", "SRX9521906", "SRS7729113", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 E09", "GSM4911702", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 E09", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911702", "GSM4911702: SDPL.1X 01 E09; Danio rerio; RNA Seq", "GSM4911702", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911702", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31838_Track-65491_R1.fastq.gz", "fastq", 61965460.0, 815335.0, "GSM4911702 r1", "0:76 1:0", "A:16477650;C:14685380;G:14442373;T:16359327;N:730", 76, 0, null, null, 16477650, 14685380, 14442373, 16359327, 730, "SRX9521906", "SRS7729113", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.84168, null, 0.07136, null, 0.95994, null, 0.4496, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61896, "SRR13074862", "SRX9521905", "SRS7729112", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 H08", "GSM4911701", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 H08", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911701", "GSM4911701: SDPL.1X 01 H08; Danio rerio; RNA Seq", "GSM4911701", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911701", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31835_Track-65524_R1.fastq.gz", "fastq", 43124528.0, 567428.0, "GSM4911701 r1", "0:76 1:0", "A:12087543;C:9503663;G:9433604;T:12099295;N:423", 76, 0, null, null, 12087543, 9503663, 9433604, 12099295, 423, "SRX9521905", "SRS7729112", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.87346, null, 0.06823, null, 0.91319, null, 0.44132, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61897, "SRR13074861", "SRX9521904", "SRS7729111", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 G08", "GSM4911700", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 G08", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911700", "GSM4911700: SDPL.1X 01 G08; Danio rerio; RNA Seq", "GSM4911700", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911700", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31834_Track-65815_R1.fastq.gz", "fastq", 68812680.0, 905430.0, "GSM4911700 r1", "0:76 1:0", "A:18393172;C:16321163;G:16311394;T:17786188;N:763", 76, 0, null, null, 18393172, 16321163, 16311394, 17786188, 763, "SRX9521904", "SRS7729111", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.77544, null, 0.02505, null, 0.98599, null, 0.37319, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"], [61898, "SRR13074860", "SRX9521903", "SRS7729110", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SDPL.1X 01 F08", "GSM4911699", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "SDPL.1X 01 F08", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl", "GSM4911699", "GSM4911699: SDPL.1X 01 F08; Danio rerio; RNA Seq", "GSM4911699", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911699", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31833_Track-65514_R1.fastq.gz", "fastq", 57341240.0, 754490.0, "GSM4911699 r1", "0:76 1:0", "A:16401241;C:12304778;G:12249825;T:16384848;N:548", 76, 0, null, null, 16401241, 12304778, 12249825, 16384848, 548, "SRX9521903", "SRS7729110", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.83611, null, 0.13643, null, 0.94211, null, 0.45347, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"]], "truncated": false, "filtered_table_rows_count": 688, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"experiment.library_source\" = :p0 and \"experiment.platform\" = :p1 and \"tissue_curation\" = :p2 order by rowid limit 101", "params": {"p0": "TRANSCRIPTOMIC", "p1": "ILLUMINA", "p2": "Spinal Cord"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord", "results": [{"value": "RNA-Seq", "label": "RNA-Seq", "count": 688, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord&experiment.library_strategy=RNA-Seq", "selected": false}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 688, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord", "selected": true}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord", "results": [{"value": "cDNA", "label": "cDNA", "count": 687, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord&experiment.library_selection=cDNA", "selected": false}, {"value": "Oligo-dT", "label": "Oligo-dT", "count": 1, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord&experiment.library_selection=Oligo-dT", "selected": false}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord", "results": [{"value": "SINGLE", "label": "SINGLE", "count": 562, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord&experiment.library_layout=SINGLE", "selected": false}, {"value": "PAIRED", "label": "PAIRED", "count": 126, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord&experiment.library_layout=PAIRED", "selected": false}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord", "results": [{"value": "ILLUMINA", "label": "ILLUMINA", "count": 688, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&tissue_curation=Spinal+Cord", "selected": true}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord", "results": [{"value": "Larval", "label": "Larval", "count": 398, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord&devstage_curation_coarse=Larval", "selected": false}, {"value": "Adult", "label": "Adult", "count": 190, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord&devstage_curation_coarse=Adult", "selected": false}, {"value": "Embryo", "label": "Embryo", "count": 64, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord&devstage_curation_coarse=Embryo", "selected": false}, {"value": "Undetermined", "label": "Undetermined", "count": 25, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord&devstage_curation_coarse=Undetermined", "selected": false}, {"value": "Juvenile", "label": "Juvenile", "count": 11, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord&devstage_curation_coarse=Juvenile", "selected": false}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord", "results": [{"value": "Larval", "label": "Larval", "count": 398, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord&devstage_curation=Larval", "selected": false}, {"value": "Adult", "label": "Adult", "count": 141, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord&devstage_curation=Adult", "selected": false}, {"value": "Undetermined", "label": "Undetermined", "count": 74, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord&devstage_curation=Undetermined", "selected": false}, {"value": "Multi-stage", "label": "Multi-stage", "count": 40, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord&devstage_curation=Multi-stage", "selected": false}, {"value": "Pharyngula", "label": "Pharyngula", "count": 16, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord&devstage_curation=Pharyngula", "selected": false}, {"value": "Juvenile", "label": "Juvenile", "count": 11, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord&devstage_curation=Juvenile", "selected": false}, {"value": "Hatching", "label": "Hatching", "count": 8, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord&devstage_curation=Hatching", "selected": false}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord", "results": [{"value": "Nervous System", "label": "Nervous System", "count": 688, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord&tissue_curation_coarse=Nervous+System", "selected": false}], "truncated": false}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord", "results": [{"value": "Spinal Cord", "label": "Spinal Cord", "count": 688, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA", "selected": true}], "truncated": false}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord", "results": [{"value": "smartseq", "label": "smartseq", "count": 554, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord&technology=smartseq", "selected": false}, {"value": "bulk", "label": "bulk", "count": 60, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord&technology=bulk", "selected": false}, {"value": "unknown", "label": "unknown", "count": 48, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord&technology=unknown", "selected": false}, {"value": "10x", "label": "10x", "count": 26, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord&technology=10x", "selected": false}], "truncated": false}}, "suggested_facets": [], "next": "61898", "next_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord&_next=61898", "private": false, "allow_execute_sql": true, "query_ms": 115.65225300000748}