{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where experiment.library_source = \"TRANSCRIPTOMIC\", experiment.library_strategy = \"RNA-Seq\" and technology = \"iclip\"", "rows": [[41262, "SRR4026154", "SRX2018187", "SRS1614128", "SRP081553", "PRJNA338793", "Characterization of genetic loss of function of Fus in zebrafish", "GSE85554", "Transcriptome Analysis", "The RNA binding protein FUS is implicated in transcription  alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3\u2019UTR usage  which could mask the effects of loss of Fus. Unlike published fus morphants  maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus /  genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus /  and WT labeled with the prefix \"Sample imb ketting 2014 13 \" we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that  we performed RNA sequencing a second time  using the same input RNA  except for the Fus knockout replicate #3  because there was not enough input RNA left. Instead  a different Fus knockout replicate #1 was sequenced. However  we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools  and the samples are highly correlated at least 0.97 and 0.95  Spearman and Pearson correlation respectively. Therefore  we considered first \"Sample imb ketting 2014 13 \" and second sequencing runs as technical replicates.", null, "pubmed:27898262", null, "FUS KO 6", "GSM2277123", null, "source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO", "FUS KO 6", "RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR   runMode alignReads   outBAMsortingThreadN 0   outFilterMultimapNmax 20   alignSJoverhangMin 8   alignSJDBoverhangMin 1   outFilterMismatchNmax 2   alignIntronMin 21   outSAMtype BAM SortedByCoordinate   sjdbOverhang 99   outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were:  Q 1  O  T 4  p  P  s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR   runMode alignReads   outFilterMismatchNmax 2   outFilterMultimapNmax 10   alignIntronMin 21   outStd SAM   outSAMattributes Standard   outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR     runMode genomeGenerate     runThreadN 8     genomeDir sjdbStarIndex     sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb    sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples  and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of   outSAMstrandField intronMotif  which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly  reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next  unidentified nucleotides  Ns  were corrected with GenomeAnalysisTK.jar  T SplitNCigarReads  rf ReassignOneMappingQuality  RMQF 255  RMQT 60  U ALLOW N CIGAR READS  improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar  T BaseRecalibrator  knownSites vcf. Finally  variants were called with GenomeAnalysisTK.jar  T HaplotypeCaller  dontUseSoftClippedBases  stand call conf 20.0  stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar  T VariantFiltration  window 35  cluster 3  filterName FS  filter \"FS > 30.0\"  filterName QD  filter \"QD < 2.0\". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout  we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates  thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble  and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads  log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.", "adult female brain", "The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "Zebrafish were maintained in standard conditions. Unless stated otherwise  in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts  23177 07/A 15 5 001 OES tail fin clips.", "tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO", "GSM2277123", "GSM2277123: FUS KO 6; Danio rerio; RNA Seq", "GSM2277123", null, "1", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "GEO Accession:GSM2277123", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP081553", null, null, "Sample_imb_ketting_2014_13_FUS_KO_6_R1.fastq.gz Sample_imb_ketting_2014_13_FUS_KO_6_R2.fastq.gz", "fastq fastq", 7975498532.0, 39482666.0, "GSM2277123 r1", "0:101 1:101", "A:2277361634;C:1708878425;G:1702517993;T:2283731854;N:3008626", 101, 101, null, null, 2277361634, 1708878425, 1702517993, 2283731854, 3008626, "SRX2018187", "SRS1614128", "SRA451974", "GEO", "Rene Ketting, Institute of Molecular Biology", 2, 0.92046, 0.9235, 0.18223, 0.18163, 0.68866, 0.68927, 0.48519, 0.47059, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "3prime", "poly_a", "trueseq", "bulk", "clip", "iclip", null, "Germany", "2016-08-12", "Adult", "Adult", "Brain", "Nervous System"], [41263, "SRR4026155", "SRX2018187", "SRS1614128", "SRP081553", "PRJNA338793", "Characterization of genetic loss of function of Fus in zebrafish", "GSE85554", "Transcriptome Analysis", "The RNA binding protein FUS is implicated in transcription  alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3\u2019UTR usage  which could mask the effects of loss of Fus. Unlike published fus morphants  maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus /  genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus /  and WT labeled with the prefix \"Sample imb ketting 2014 13 \" we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that  we performed RNA sequencing a second time  using the same input RNA  except for the Fus knockout replicate #3  because there was not enough input RNA left. Instead  a different Fus knockout replicate #1 was sequenced. However  we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools  and the samples are highly correlated at least 0.97 and 0.95  Spearman and Pearson correlation respectively. Therefore  we considered first \"Sample imb ketting 2014 13 \" and second sequencing runs as technical replicates.", null, "pubmed:27898262", null, "FUS KO 6", "GSM2277123", null, "source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO", "FUS KO 6", "RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR   runMode alignReads   outBAMsortingThreadN 0   outFilterMultimapNmax 20   alignSJoverhangMin 8   alignSJDBoverhangMin 1   outFilterMismatchNmax 2   alignIntronMin 21   outSAMtype BAM SortedByCoordinate   sjdbOverhang 99   outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were:  Q 1  O  T 4  p  P  s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR   runMode alignReads   outFilterMismatchNmax 2   outFilterMultimapNmax 10   alignIntronMin 21   outStd SAM   outSAMattributes Standard   outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR     runMode genomeGenerate     runThreadN 8     genomeDir sjdbStarIndex     sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb    sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples  and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of   outSAMstrandField intronMotif  which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly  reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next  unidentified nucleotides  Ns  were corrected with GenomeAnalysisTK.jar  T SplitNCigarReads  rf ReassignOneMappingQuality  RMQF 255  RMQT 60  U ALLOW N CIGAR READS  improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar  T BaseRecalibrator  knownSites vcf. Finally  variants were called with GenomeAnalysisTK.jar  T HaplotypeCaller  dontUseSoftClippedBases  stand call conf 20.0  stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar  T VariantFiltration  window 35  cluster 3  filterName FS  filter \"FS > 30.0\"  filterName QD  filter \"QD < 2.0\". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout  we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates  thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble  and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads  log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.", "adult female brain", "The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "Zebrafish were maintained in standard conditions. Unless stated otherwise  in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts  23177 07/A 15 5 001 OES tail fin clips.", "tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO", "GSM2277123", "GSM2277123: FUS KO 6; Danio rerio; RNA Seq", "GSM2277123", null, "1", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "GEO Accession:GSM2277123", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP081553", null, null, "FUS_KO_6_R1.fastq.gz FUS_KO_6_R2.fastq.gz", "fastq fastq", 7173346028.0, 35511614.0, "GSM2277123 r2", "0:101 1:101", "A:1991537753;C:1595400788;G:1586024536;T:1997441866;N:2941085", 101, 101, null, null, 1991537753, 1595400788, 1586024536, 1997441866, 2941085, "SRX2018187", "SRS1614128", "SRA451974", "GEO", "Rene Ketting, Institute of Molecular Biology", 2, 0.93379, 0.93701, 0.16593, 0.1657, 0.68517, 0.68558, 0.49349, 0.49229, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "3prime", "poly_a", "trueseq", "bulk", "clip", "iclip", null, "Germany", "2016-08-12", "Adult", "Adult", "Brain", "Nervous System"], [41264, "SRR4026152", "SRX2018186", "SRS1614129", "SRP081553", "PRJNA338793", "Characterization of genetic loss of function of Fus in zebrafish", "GSE85554", "Transcriptome Analysis", "The RNA binding protein FUS is implicated in transcription  alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3\u2019UTR usage  which could mask the effects of loss of Fus. Unlike published fus morphants  maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus /  genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus /  and WT labeled with the prefix \"Sample imb ketting 2014 13 \" we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that  we performed RNA sequencing a second time  using the same input RNA  except for the Fus knockout replicate #3  because there was not enough input RNA left. Instead  a different Fus knockout replicate #1 was sequenced. However  we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools  and the samples are highly correlated at least 0.97 and 0.95  Spearman and Pearson correlation respectively. Therefore  we considered first \"Sample imb ketting 2014 13 \" and second sequencing runs as technical replicates.", null, "pubmed:27898262", null, "FUS KO 5", "GSM2277122", null, "source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO", "FUS KO 5", "RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR   runMode alignReads   outBAMsortingThreadN 0   outFilterMultimapNmax 20   alignSJoverhangMin 8   alignSJDBoverhangMin 1   outFilterMismatchNmax 2   alignIntronMin 21   outSAMtype BAM SortedByCoordinate   sjdbOverhang 99   outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were:  Q 1  O  T 4  p  P  s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR   runMode alignReads   outFilterMismatchNmax 2   outFilterMultimapNmax 10   alignIntronMin 21   outStd SAM   outSAMattributes Standard   outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR     runMode genomeGenerate     runThreadN 8     genomeDir sjdbStarIndex     sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb    sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples  and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of   outSAMstrandField intronMotif  which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly  reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next  unidentified nucleotides  Ns  were corrected with GenomeAnalysisTK.jar  T SplitNCigarReads  rf ReassignOneMappingQuality  RMQF 255  RMQT 60  U ALLOW N CIGAR READS  improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar  T BaseRecalibrator  knownSites vcf. Finally  variants were called with GenomeAnalysisTK.jar  T HaplotypeCaller  dontUseSoftClippedBases  stand call conf 20.0  stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar  T VariantFiltration  window 35  cluster 3  filterName FS  filter \"FS > 30.0\"  filterName QD  filter \"QD < 2.0\". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout  we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates  thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble  and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads  log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.", "adult female brain", "The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "Zebrafish were maintained in standard conditions. Unless stated otherwise  in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts  23177 07/A 15 5 001 OES tail fin clips.", "tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO", "GSM2277122", "GSM2277122: FUS KO 5; Danio rerio; RNA Seq", "GSM2277122", null, "1", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "GEO Accession:GSM2277122", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP081553", null, null, "Sample_imb_ketting_2014_13_FUS_KO_5_R1.fastq.gz Sample_imb_ketting_2014_13_FUS_KO_5_R2.fastq.gz", "fastq fastq", 7478598328.0, 37022764.0, "GSM2277122 r1", "0:101 1:101", "A:2133855925;C:1603288158;G:1598612742;T:2140065375;N:2776128", 101, 101, null, null, 2133855925, 1603288158, 1598612742, 2140065375, 2776128, "SRX2018186", "SRS1614129", "SRA451974", "GEO", "Rene Ketting, Institute of Molecular Biology", 2, 0.9197, 0.92307, 0.17221, 0.17171, 0.68578, 0.68586, 0.49581, 0.50519, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "3prime", "poly_a", "trueseq", "bulk", "clip", "iclip", null, "Germany", "2016-08-12", "Adult", "Adult", "Brain", "Nervous System"], [41265, "SRR4026153", "SRX2018186", "SRS1614129", "SRP081553", "PRJNA338793", "Characterization of genetic loss of function of Fus in zebrafish", "GSE85554", "Transcriptome Analysis", "The RNA binding protein FUS is implicated in transcription  alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3\u2019UTR usage  which could mask the effects of loss of Fus. Unlike published fus morphants  maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus /  genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus /  and WT labeled with the prefix \"Sample imb ketting 2014 13 \" we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that  we performed RNA sequencing a second time  using the same input RNA  except for the Fus knockout replicate #3  because there was not enough input RNA left. Instead  a different Fus knockout replicate #1 was sequenced. However  we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools  and the samples are highly correlated at least 0.97 and 0.95  Spearman and Pearson correlation respectively. Therefore  we considered first \"Sample imb ketting 2014 13 \" and second sequencing runs as technical replicates.", null, "pubmed:27898262", null, "FUS KO 5", "GSM2277122", null, "source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO", "FUS KO 5", "RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR   runMode alignReads   outBAMsortingThreadN 0   outFilterMultimapNmax 20   alignSJoverhangMin 8   alignSJDBoverhangMin 1   outFilterMismatchNmax 2   alignIntronMin 21   outSAMtype BAM SortedByCoordinate   sjdbOverhang 99   outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were:  Q 1  O  T 4  p  P  s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR   runMode alignReads   outFilterMismatchNmax 2   outFilterMultimapNmax 10   alignIntronMin 21   outStd SAM   outSAMattributes Standard   outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR     runMode genomeGenerate     runThreadN 8     genomeDir sjdbStarIndex     sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb    sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples  and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of   outSAMstrandField intronMotif  which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly  reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next  unidentified nucleotides  Ns  were corrected with GenomeAnalysisTK.jar  T SplitNCigarReads  rf ReassignOneMappingQuality  RMQF 255  RMQT 60  U ALLOW N CIGAR READS  improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar  T BaseRecalibrator  knownSites vcf. Finally  variants were called with GenomeAnalysisTK.jar  T HaplotypeCaller  dontUseSoftClippedBases  stand call conf 20.0  stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar  T VariantFiltration  window 35  cluster 3  filterName FS  filter \"FS > 30.0\"  filterName QD  filter \"QD < 2.0\". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout  we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates  thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble  and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads  log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.", "adult female brain", "The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "Zebrafish were maintained in standard conditions. Unless stated otherwise  in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts  23177 07/A 15 5 001 OES tail fin clips.", "tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO", "GSM2277122", "GSM2277122: FUS KO 5; Danio rerio; RNA Seq", "GSM2277122", null, "1", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "GEO Accession:GSM2277122", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP081553", null, null, "FUS_KO_5_R1.fastq.gz FUS_KO_5_R2.fastq.gz", "fastq fastq", 6719087822.0, 33262811.0, "GSM2277122 r2", "0:101 1:101", "A:1785013612;C:1574089873;G:1572290158;T:1784978560;N:2715619", 101, 101, null, null, 1785013612, 1574089873, 1572290158, 1784978560, 2715619, "SRX2018186", "SRS1614129", "SRA451974", "GEO", "Rene Ketting, Institute of Molecular Biology", 2, 0.94652, 0.94901, 0.12756, 0.12603, 0.67834, 0.6789, 0.50281, 0.50397, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "3prime", "poly_a", "trueseq", "bulk", "clip", "iclip", null, "Germany", "2016-08-12", "Adult", "Adult", "Brain", "Nervous System"], [41266, "SRR4026151", "SRX2018185", "SRS1614126", "SRP081553", "PRJNA338793", "Characterization of genetic loss of function of Fus in zebrafish", "GSE85554", "Transcriptome Analysis", "The RNA binding protein FUS is implicated in transcription  alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3\u2019UTR usage  which could mask the effects of loss of Fus. Unlike published fus morphants  maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus /  genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus /  and WT labeled with the prefix \"Sample imb ketting 2014 13 \" we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that  we performed RNA sequencing a second time  using the same input RNA  except for the Fus knockout replicate #3  because there was not enough input RNA left. Instead  a different Fus knockout replicate #1 was sequenced. However  we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools  and the samples are highly correlated at least 0.97 and 0.95  Spearman and Pearson correlation respectively. Therefore  we considered first \"Sample imb ketting 2014 13 \" and second sequencing runs as technical replicates.", null, "pubmed:27898262", null, "FUS KO 3", "GSM2277121", null, "source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO", "FUS KO 3", "RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR   runMode alignReads   outBAMsortingThreadN 0   outFilterMultimapNmax 20   alignSJoverhangMin 8   alignSJDBoverhangMin 1   outFilterMismatchNmax 2   alignIntronMin 21   outSAMtype BAM SortedByCoordinate   sjdbOverhang 99   outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were:  Q 1  O  T 4  p  P  s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR   runMode alignReads   outFilterMismatchNmax 2   outFilterMultimapNmax 10   alignIntronMin 21   outStd SAM   outSAMattributes Standard   outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR     runMode genomeGenerate     runThreadN 8     genomeDir sjdbStarIndex     sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb    sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples  and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of   outSAMstrandField intronMotif  which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly  reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next  unidentified nucleotides  Ns  were corrected with GenomeAnalysisTK.jar  T SplitNCigarReads  rf ReassignOneMappingQuality  RMQF 255  RMQT 60  U ALLOW N CIGAR READS  improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar  T BaseRecalibrator  knownSites vcf. Finally  variants were called with GenomeAnalysisTK.jar  T HaplotypeCaller  dontUseSoftClippedBases  stand call conf 20.0  stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar  T VariantFiltration  window 35  cluster 3  filterName FS  filter \"FS > 30.0\"  filterName QD  filter \"QD < 2.0\". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout  we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates  thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble  and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads  log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.", "adult female brain", "The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "Zebrafish were maintained in standard conditions. Unless stated otherwise  in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts  23177 07/A 15 5 001 OES tail fin clips.", "tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO", "GSM2277121", "GSM2277121: FUS KO 3; Danio rerio; RNA Seq", "GSM2277121", null, "1", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "GEO Accession:GSM2277121", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP081553", null, null, "Sample_imb_ketting_2014_13_FUS_KO_3_R1.fastq.gz Sample_imb_ketting_2014_13_FUS_KO_3_R2.fastq.gz", "fastq fastq", 7443582840.0, 36849420.0, "GSM2277121 r1", "0:101 1:101", "A:2135476546;C:1584607182;G:1583492766;T:2137210756;N:2795590", 101, 101, null, null, 2135476546, 1584607182, 1583492766, 2137210756, 2795590, "SRX2018185", "SRS1614126", "SRA451974", "GEO", "Rene Ketting, Institute of Molecular Biology", 2, 0.91865, 0.92202, 0.16917, 0.16765, 0.69402, 0.69424, 0.49158, 0.505, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "3prime", "poly_a", "trueseq", "bulk", "clip", "iclip", null, "Germany", "2016-08-12", "Adult", "Adult", "Brain", "Nervous System"], [41267, "SRR4026149", "SRX2018184", "SRS1614127", "SRP081553", "PRJNA338793", "Characterization of genetic loss of function of Fus in zebrafish", "GSE85554", "Transcriptome Analysis", "The RNA binding protein FUS is implicated in transcription  alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3\u2019UTR usage  which could mask the effects of loss of Fus. Unlike published fus morphants  maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus /  genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus /  and WT labeled with the prefix \"Sample imb ketting 2014 13 \" we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that  we performed RNA sequencing a second time  using the same input RNA  except for the Fus knockout replicate #3  because there was not enough input RNA left. Instead  a different Fus knockout replicate #1 was sequenced. However  we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools  and the samples are highly correlated at least 0.97 and 0.95  Spearman and Pearson correlation respectively. Therefore  we considered first \"Sample imb ketting 2014 13 \" and second sequencing runs as technical replicates.", null, "pubmed:27898262", null, "FUS KO 2", "GSM2277120", null, "source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO", "FUS KO 2", "RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR   runMode alignReads   outBAMsortingThreadN 0   outFilterMultimapNmax 20   alignSJoverhangMin 8   alignSJDBoverhangMin 1   outFilterMismatchNmax 2   alignIntronMin 21   outSAMtype BAM SortedByCoordinate   sjdbOverhang 99   outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were:  Q 1  O  T 4  p  P  s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR   runMode alignReads   outFilterMismatchNmax 2   outFilterMultimapNmax 10   alignIntronMin 21   outStd SAM   outSAMattributes Standard   outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR     runMode genomeGenerate     runThreadN 8     genomeDir sjdbStarIndex     sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb    sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples  and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of   outSAMstrandField intronMotif  which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly  reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next  unidentified nucleotides  Ns  were corrected with GenomeAnalysisTK.jar  T SplitNCigarReads  rf ReassignOneMappingQuality  RMQF 255  RMQT 60  U ALLOW N CIGAR READS  improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar  T BaseRecalibrator  knownSites vcf. Finally  variants were called with GenomeAnalysisTK.jar  T HaplotypeCaller  dontUseSoftClippedBases  stand call conf 20.0  stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar  T VariantFiltration  window 35  cluster 3  filterName FS  filter \"FS > 30.0\"  filterName QD  filter \"QD < 2.0\". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout  we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates  thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble  and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads  log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.", "adult female brain", "The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "Zebrafish were maintained in standard conditions. Unless stated otherwise  in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts  23177 07/A 15 5 001 OES tail fin clips.", "tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO", "GSM2277120", "GSM2277120: FUS KO 2; Danio rerio; RNA Seq", "GSM2277120", null, "1", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "GEO Accession:GSM2277120", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP081553", null, null, "Sample_imb_ketting_2014_13_FUS_KO_2_R1.fastq.gz Sample_imb_ketting_2014_13_FUS_KO_2_R2.fastq.gz", "fastq fastq", 7538568694.0, 37319647.0, "GSM2277120 r1", "0:101 1:101", "A:2147431018;C:1618323797;G:1622221747;T:2147775519;N:2816613", 101, 101, null, null, 2147431018, 1618323797, 1622221747, 2147775519, 2816613, "SRX2018184", "SRS1614127", "SRA451974", "GEO", "Rene Ketting, Institute of Molecular Biology", 2, 0.92241, 0.92545, 0.17277, 0.17289, 0.6882, 0.68878, 0.50153, 0.49587, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "3prime", "poly_a", "trueseq", "bulk", "clip", "iclip", null, "Germany", "2016-08-12", "Adult", "Adult", "Brain", "Nervous System"], [41268, "SRR4026150", "SRX2018184", "SRS1614127", "SRP081553", "PRJNA338793", "Characterization of genetic loss of function of Fus in zebrafish", "GSE85554", "Transcriptome Analysis", "The RNA binding protein FUS is implicated in transcription  alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3\u2019UTR usage  which could mask the effects of loss of Fus. Unlike published fus morphants  maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus /  genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus /  and WT labeled with the prefix \"Sample imb ketting 2014 13 \" we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that  we performed RNA sequencing a second time  using the same input RNA  except for the Fus knockout replicate #3  because there was not enough input RNA left. Instead  a different Fus knockout replicate #1 was sequenced. However  we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools  and the samples are highly correlated at least 0.97 and 0.95  Spearman and Pearson correlation respectively. Therefore  we considered first \"Sample imb ketting 2014 13 \" and second sequencing runs as technical replicates.", null, "pubmed:27898262", null, "FUS KO 2", "GSM2277120", null, "source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO", "FUS KO 2", "RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR   runMode alignReads   outBAMsortingThreadN 0   outFilterMultimapNmax 20   alignSJoverhangMin 8   alignSJDBoverhangMin 1   outFilterMismatchNmax 2   alignIntronMin 21   outSAMtype BAM SortedByCoordinate   sjdbOverhang 99   outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were:  Q 1  O  T 4  p  P  s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR   runMode alignReads   outFilterMismatchNmax 2   outFilterMultimapNmax 10   alignIntronMin 21   outStd SAM   outSAMattributes Standard   outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR     runMode genomeGenerate     runThreadN 8     genomeDir sjdbStarIndex     sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb    sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples  and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of   outSAMstrandField intronMotif  which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly  reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next  unidentified nucleotides  Ns  were corrected with GenomeAnalysisTK.jar  T SplitNCigarReads  rf ReassignOneMappingQuality  RMQF 255  RMQT 60  U ALLOW N CIGAR READS  improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar  T BaseRecalibrator  knownSites vcf. Finally  variants were called with GenomeAnalysisTK.jar  T HaplotypeCaller  dontUseSoftClippedBases  stand call conf 20.0  stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar  T VariantFiltration  window 35  cluster 3  filterName FS  filter \"FS > 30.0\"  filterName QD  filter \"QD < 2.0\". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout  we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates  thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble  and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads  log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.", "adult female brain", "The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "Zebrafish were maintained in standard conditions. Unless stated otherwise  in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts  23177 07/A 15 5 001 OES tail fin clips.", "tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO", "GSM2277120", "GSM2277120: FUS KO 2; Danio rerio; RNA Seq", "GSM2277120", null, "1", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "GEO Accession:GSM2277120", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP081553", null, null, "FUS_KO_2_R1.fastq.gz FUS_KO_2_R2.fastq.gz", "fastq fastq", 6447010386.0, 31915893.0, "GSM2277120 r2", "0:101 1:101", "A:1836751010;C:1386222757;G:1379853653;T:1841581040;N:2601926", 101, 101, null, null, 1836751010, 1386222757, 1379853653, 1841581040, 2601926, "SRX2018184", "SRS1614127", "SRA451974", "GEO", "Rene Ketting, Institute of Molecular Biology", 2, 0.92533, 0.92991, 0.17619, 0.17625, 0.69031, 0.69081, 0.49983, 0.50191, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "3prime", "poly_a", "trueseq", "bulk", "clip", "iclip", null, "Germany", "2016-08-12", "Adult", "Adult", "Brain", "Nervous System"], [41269, "SRR4026148", "SRX2018183", "SRS1614125", "SRP081553", "PRJNA338793", "Characterization of genetic loss of function of Fus in zebrafish", "GSE85554", "Transcriptome Analysis", "The RNA binding protein FUS is implicated in transcription  alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3\u2019UTR usage  which could mask the effects of loss of Fus. Unlike published fus morphants  maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus /  genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus /  and WT labeled with the prefix \"Sample imb ketting 2014 13 \" we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that  we performed RNA sequencing a second time  using the same input RNA  except for the Fus knockout replicate #3  because there was not enough input RNA left. Instead  a different Fus knockout replicate #1 was sequenced. However  we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools  and the samples are highly correlated at least 0.97 and 0.95  Spearman and Pearson correlation respectively. Therefore  we considered first \"Sample imb ketting 2014 13 \" and second sequencing runs as technical replicates.", null, "pubmed:27898262", null, "FUS KO 1", "GSM2277119", null, "source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO", "FUS KO 1", "RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR   runMode alignReads   outBAMsortingThreadN 0   outFilterMultimapNmax 20   alignSJoverhangMin 8   alignSJDBoverhangMin 1   outFilterMismatchNmax 2   alignIntronMin 21   outSAMtype BAM SortedByCoordinate   sjdbOverhang 99   outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were:  Q 1  O  T 4  p  P  s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR   runMode alignReads   outFilterMismatchNmax 2   outFilterMultimapNmax 10   alignIntronMin 21   outStd SAM   outSAMattributes Standard   outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR     runMode genomeGenerate     runThreadN 8     genomeDir sjdbStarIndex     sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb    sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples  and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of   outSAMstrandField intronMotif  which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly  reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next  unidentified nucleotides  Ns  were corrected with GenomeAnalysisTK.jar  T SplitNCigarReads  rf ReassignOneMappingQuality  RMQF 255  RMQT 60  U ALLOW N CIGAR READS  improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar  T BaseRecalibrator  knownSites vcf. Finally  variants were called with GenomeAnalysisTK.jar  T HaplotypeCaller  dontUseSoftClippedBases  stand call conf 20.0  stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar  T VariantFiltration  window 35  cluster 3  filterName FS  filter \"FS > 30.0\"  filterName QD  filter \"QD < 2.0\". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout  we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates  thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble  and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads  log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.", "adult female brain", "The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "Zebrafish were maintained in standard conditions. Unless stated otherwise  in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts  23177 07/A 15 5 001 OES tail fin clips.", "tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO", "GSM2277119", "GSM2277119: FUS KO 1; Danio rerio; RNA Seq", "GSM2277119", null, "1", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "GEO Accession:GSM2277119", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP081553", null, null, "FUS_KO_1_R1.fastq.gz FUS_KO_1_R2.fastq.gz", "fastq fastq", 7395102840.0, 36609420.0, "GSM2277119 r1", "0:101 1:101", "A:2103771703;C:1595017984;G:1583980946;T:2109307704;N:3024503", 101, 101, null, null, 2103771703, 1595017984, 1583980946, 2109307704, 3024503, "SRX2018183", "SRS1614125", "SRA451974", "GEO", "Rene Ketting, Institute of Molecular Biology", 2, 0.9246, 0.92781, 0.17577, 0.17518, 0.69116, 0.69232, 0.50228, 0.49896, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "3prime", "poly_a", "trueseq", "bulk", "clip", "iclip", null, "Germany", "2016-08-12", "Adult", "Adult", "Brain", "Nervous System"], [41270, "SRR4026146", "SRX2018182", "SRS1614123", "SRP081553", "PRJNA338793", "Characterization of genetic loss of function of Fus in zebrafish", "GSE85554", "Transcriptome Analysis", "The RNA binding protein FUS is implicated in transcription  alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3\u2019UTR usage  which could mask the effects of loss of Fus. Unlike published fus morphants  maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus /  genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus /  and WT labeled with the prefix \"Sample imb ketting 2014 13 \" we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that  we performed RNA sequencing a second time  using the same input RNA  except for the Fus knockout replicate #3  because there was not enough input RNA left. Instead  a different Fus knockout replicate #1 was sequenced. However  we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools  and the samples are highly correlated at least 0.97 and 0.95  Spearman and Pearson correlation respectively. Therefore  we considered first \"Sample imb ketting 2014 13 \" and second sequencing runs as technical replicates.", null, "pubmed:27898262", null, "WT 6", "GSM2277118", null, "source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type", "WT 6", "RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR   runMode alignReads   outBAMsortingThreadN 0   outFilterMultimapNmax 20   alignSJoverhangMin 8   alignSJDBoverhangMin 1   outFilterMismatchNmax 2   alignIntronMin 21   outSAMtype BAM SortedByCoordinate   sjdbOverhang 99   outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were:  Q 1  O  T 4  p  P  s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR   runMode alignReads   outFilterMismatchNmax 2   outFilterMultimapNmax 10   alignIntronMin 21   outStd SAM   outSAMattributes Standard   outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR     runMode genomeGenerate     runThreadN 8     genomeDir sjdbStarIndex     sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb    sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples  and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of   outSAMstrandField intronMotif  which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly  reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next  unidentified nucleotides  Ns  were corrected with GenomeAnalysisTK.jar  T SplitNCigarReads  rf ReassignOneMappingQuality  RMQF 255  RMQT 60  U ALLOW N CIGAR READS  improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar  T BaseRecalibrator  knownSites vcf. Finally  variants were called with GenomeAnalysisTK.jar  T HaplotypeCaller  dontUseSoftClippedBases  stand call conf 20.0  stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar  T VariantFiltration  window 35  cluster 3  filterName FS  filter \"FS > 30.0\"  filterName QD  filter \"QD < 2.0\". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout  we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates  thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble  and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads  log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.", "adult female brain", "The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "Zebrafish were maintained in standard conditions. Unless stated otherwise  in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts  23177 07/A 15 5 001 OES tail fin clips.", "tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type", "GSM2277118", "GSM2277118: WT 6; Danio rerio; RNA Seq", "GSM2277118", null, "1", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "GEO Accession:GSM2277118", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP081553", null, null, "Sample_imb_ketting_2014_13_WT_6_R1.fastq.gz Sample_imb_ketting_2014_13_WT_6_R2.fastq.gz", "fastq fastq", 8334635544.0, 41260572.0, "GSM2277118 r1", "0:101 1:101", "A:2382306534;C:1783081151;G:1778919442;T:2387251408;N:3077009", 101, 101, null, null, 2382306534, 1783081151, 1778919442, 2387251408, 3077009, "SRX2018182", "SRS1614123", "SRA451974", "GEO", "Rene Ketting, Institute of Molecular Biology", 2, 0.91647, 0.9192, 0.1793, 0.17873, 0.69215, 0.69262, 0.50463, 0.50038, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "3prime", "poly_a", "trueseq", "bulk", "clip", "iclip", null, "Germany", "2016-08-12", "Adult", "Adult", "Brain", "Nervous System"], [41271, "SRR4026147", "SRX2018182", "SRS1614123", "SRP081553", "PRJNA338793", "Characterization of genetic loss of function of Fus in zebrafish", "GSE85554", "Transcriptome Analysis", "The RNA binding protein FUS is implicated in transcription  alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3\u2019UTR usage  which could mask the effects of loss of Fus. Unlike published fus morphants  maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus /  genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus /  and WT labeled with the prefix \"Sample imb ketting 2014 13 \" we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that  we performed RNA sequencing a second time  using the same input RNA  except for the Fus knockout replicate #3  because there was not enough input RNA left. Instead  a different Fus knockout replicate #1 was sequenced. However  we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools  and the samples are highly correlated at least 0.97 and 0.95  Spearman and Pearson correlation respectively. Therefore  we considered first \"Sample imb ketting 2014 13 \" and second sequencing runs as technical replicates.", null, "pubmed:27898262", null, "WT 6", "GSM2277118", null, "source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type", "WT 6", "RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR   runMode alignReads   outBAMsortingThreadN 0   outFilterMultimapNmax 20   alignSJoverhangMin 8   alignSJDBoverhangMin 1   outFilterMismatchNmax 2   alignIntronMin 21   outSAMtype BAM SortedByCoordinate   sjdbOverhang 99   outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were:  Q 1  O  T 4  p  P  s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR   runMode alignReads   outFilterMismatchNmax 2   outFilterMultimapNmax 10   alignIntronMin 21   outStd SAM   outSAMattributes Standard   outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR     runMode genomeGenerate     runThreadN 8     genomeDir sjdbStarIndex     sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb    sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples  and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of   outSAMstrandField intronMotif  which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly  reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next  unidentified nucleotides  Ns  were corrected with GenomeAnalysisTK.jar  T SplitNCigarReads  rf ReassignOneMappingQuality  RMQF 255  RMQT 60  U ALLOW N CIGAR READS  improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar  T BaseRecalibrator  knownSites vcf. Finally  variants were called with GenomeAnalysisTK.jar  T HaplotypeCaller  dontUseSoftClippedBases  stand call conf 20.0  stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar  T VariantFiltration  window 35  cluster 3  filterName FS  filter \"FS > 30.0\"  filterName QD  filter \"QD < 2.0\". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout  we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates  thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble  and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads  log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.", "adult female brain", "The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "Zebrafish were maintained in standard conditions. Unless stated otherwise  in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts  23177 07/A 15 5 001 OES tail fin clips.", "tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type", "GSM2277118", "GSM2277118: WT 6; Danio rerio; RNA Seq", "GSM2277118", null, "1", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "GEO Accession:GSM2277118", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP081553", null, null, "WT_6_R1.fastq.gz WT_6_R2.fastq.gz", "fastq fastq", 7239861396.0, 35840898.0, "GSM2277118 r2", "0:101 1:101", "A:1993396411;C:1626521001;G:1620190105;T:1996794482;N:2959397", 101, 101, null, null, 1993396411, 1626521001, 1620190105, 1996794482, 2959397, "SRX2018182", "SRS1614123", "SRA451974", "GEO", "Rene Ketting, Institute of Molecular Biology", 2, 0.93444, 0.93758, 0.15305, 0.15223, 0.68781, 0.6885, 0.5083, 0.50745, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "3prime", "poly_a", "trueseq", "bulk", "clip", "iclip", null, "Germany", "2016-08-12", "Adult", "Adult", "Brain", "Nervous System"], [41272, "SRR4026144", "SRX2018181", "SRS1614122", "SRP081553", "PRJNA338793", "Characterization of genetic loss of function of Fus in zebrafish", "GSE85554", "Transcriptome Analysis", "The RNA binding protein FUS is implicated in transcription  alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3\u2019UTR usage  which could mask the effects of loss of Fus. Unlike published fus morphants  maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus /  genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus /  and WT labeled with the prefix \"Sample imb ketting 2014 13 \" we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that  we performed RNA sequencing a second time  using the same input RNA  except for the Fus knockout replicate #3  because there was not enough input RNA left. Instead  a different Fus knockout replicate #1 was sequenced. However  we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools  and the samples are highly correlated at least 0.97 and 0.95  Spearman and Pearson correlation respectively. Therefore  we considered first \"Sample imb ketting 2014 13 \" and second sequencing runs as technical replicates.", null, "pubmed:27898262", null, "WT 4", "GSM2277117", null, "source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type", "WT 4", "RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR   runMode alignReads   outBAMsortingThreadN 0   outFilterMultimapNmax 20   alignSJoverhangMin 8   alignSJDBoverhangMin 1   outFilterMismatchNmax 2   alignIntronMin 21   outSAMtype BAM SortedByCoordinate   sjdbOverhang 99   outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were:  Q 1  O  T 4  p  P  s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR   runMode alignReads   outFilterMismatchNmax 2   outFilterMultimapNmax 10   alignIntronMin 21   outStd SAM   outSAMattributes Standard   outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR     runMode genomeGenerate     runThreadN 8     genomeDir sjdbStarIndex     sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb    sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples  and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of   outSAMstrandField intronMotif  which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly  reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next  unidentified nucleotides  Ns  were corrected with GenomeAnalysisTK.jar  T SplitNCigarReads  rf ReassignOneMappingQuality  RMQF 255  RMQT 60  U ALLOW N CIGAR READS  improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar  T BaseRecalibrator  knownSites vcf. Finally  variants were called with GenomeAnalysisTK.jar  T HaplotypeCaller  dontUseSoftClippedBases  stand call conf 20.0  stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar  T VariantFiltration  window 35  cluster 3  filterName FS  filter \"FS > 30.0\"  filterName QD  filter \"QD < 2.0\". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout  we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates  thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble  and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads  log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.", "adult female brain", "The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "Zebrafish were maintained in standard conditions. Unless stated otherwise  in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts  23177 07/A 15 5 001 OES tail fin clips.", "tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type", "GSM2277117", "GSM2277117: WT 4; Danio rerio; RNA Seq", "GSM2277117", null, "1", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "GEO Accession:GSM2277117", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP081553", null, null, "Sample_imb_ketting_2014_13_WT_4_R1.fastq.gz Sample_imb_ketting_2014_13_WT_4_R2.fastq.gz", "fastq fastq", 7425010556.0, 36757478.0, "GSM2277117 r1", "0:101 1:101", "A:2145596358;C:1565455511;G:1562345442;T:2148814299;N:2798946", 101, 101, null, null, 2145596358, 1565455511, 1562345442, 2148814299, 2798946, "SRX2018181", "SRS1614122", "SRA451974", "GEO", "Rene Ketting, Institute of Molecular Biology", 2, 0.91897, 0.92157, 0.17645, 0.17633, 0.6981, 0.69948, 0.51038, 0.50544, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "3prime", "poly_a", "trueseq", "bulk", "clip", "iclip", null, "Germany", "2016-08-12", "Adult", "Adult", "Brain", "Nervous System"], [41273, "SRR4026145", "SRX2018181", "SRS1614122", "SRP081553", "PRJNA338793", "Characterization of genetic loss of function of Fus in zebrafish", "GSE85554", "Transcriptome Analysis", "The RNA binding protein FUS is implicated in transcription  alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3\u2019UTR usage  which could mask the effects of loss of Fus. Unlike published fus morphants  maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus /  genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus /  and WT labeled with the prefix \"Sample imb ketting 2014 13 \" we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that  we performed RNA sequencing a second time  using the same input RNA  except for the Fus knockout replicate #3  because there was not enough input RNA left. Instead  a different Fus knockout replicate #1 was sequenced. However  we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools  and the samples are highly correlated at least 0.97 and 0.95  Spearman and Pearson correlation respectively. Therefore  we considered first \"Sample imb ketting 2014 13 \" and second sequencing runs as technical replicates.", null, "pubmed:27898262", null, "WT 4", "GSM2277117", null, "source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type", "WT 4", "RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR   runMode alignReads   outBAMsortingThreadN 0   outFilterMultimapNmax 20   alignSJoverhangMin 8   alignSJDBoverhangMin 1   outFilterMismatchNmax 2   alignIntronMin 21   outSAMtype BAM SortedByCoordinate   sjdbOverhang 99   outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were:  Q 1  O  T 4  p  P  s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR   runMode alignReads   outFilterMismatchNmax 2   outFilterMultimapNmax 10   alignIntronMin 21   outStd SAM   outSAMattributes Standard   outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR     runMode genomeGenerate     runThreadN 8     genomeDir sjdbStarIndex     sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb    sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples  and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of   outSAMstrandField intronMotif  which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly  reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next  unidentified nucleotides  Ns  were corrected with GenomeAnalysisTK.jar  T SplitNCigarReads  rf ReassignOneMappingQuality  RMQF 255  RMQT 60  U ALLOW N CIGAR READS  improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar  T BaseRecalibrator  knownSites vcf. Finally  variants were called with GenomeAnalysisTK.jar  T HaplotypeCaller  dontUseSoftClippedBases  stand call conf 20.0  stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar  T VariantFiltration  window 35  cluster 3  filterName FS  filter \"FS > 30.0\"  filterName QD  filter \"QD < 2.0\". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout  we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates  thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble  and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads  log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.", "adult female brain", "The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "Zebrafish were maintained in standard conditions. Unless stated otherwise  in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts  23177 07/A 15 5 001 OES tail fin clips.", "tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type", "GSM2277117", "GSM2277117: WT 4; Danio rerio; RNA Seq", "GSM2277117", null, "1", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "GEO Accession:GSM2277117", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP081553", null, null, "WT_4_R1.fastq.gz WT_4_R2.fastq.gz", "fastq fastq", 6322186910.0, 31297955.0, "GSM2277117 r2", "0:101 1:101", "A:1808695425;C:1352265448;G:1346884156;T:1811742728;N:2599153", 101, 101, null, null, 1808695425, 1352265448, 1346884156, 1811742728, 2599153, "SRX2018181", "SRS1614122", "SRA451974", "GEO", "Rene Ketting, Institute of Molecular Biology", 2, 0.927, 0.92959, 0.17323, 0.17284, 0.69562, 0.69601, 0.50522, 0.50634, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "3prime", "poly_a", "trueseq", "bulk", "clip", "iclip", null, "Germany", "2016-08-12", "Adult", "Adult", "Brain", "Nervous System"], [41274, "SRR4026142", "SRX2018180", "SRS1614124", "SRP081553", "PRJNA338793", "Characterization of genetic loss of function of Fus in zebrafish", "GSE85554", "Transcriptome Analysis", "The RNA binding protein FUS is implicated in transcription  alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3\u2019UTR usage  which could mask the effects of loss of Fus. Unlike published fus morphants  maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus /  genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus /  and WT labeled with the prefix \"Sample imb ketting 2014 13 \" we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that  we performed RNA sequencing a second time  using the same input RNA  except for the Fus knockout replicate #3  because there was not enough input RNA left. Instead  a different Fus knockout replicate #1 was sequenced. However  we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools  and the samples are highly correlated at least 0.97 and 0.95  Spearman and Pearson correlation respectively. Therefore  we considered first \"Sample imb ketting 2014 13 \" and second sequencing runs as technical replicates.", null, "pubmed:27898262", null, "WT 3", "GSM2277116", null, "source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type", "WT 3", "RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR   runMode alignReads   outBAMsortingThreadN 0   outFilterMultimapNmax 20   alignSJoverhangMin 8   alignSJDBoverhangMin 1   outFilterMismatchNmax 2   alignIntronMin 21   outSAMtype BAM SortedByCoordinate   sjdbOverhang 99   outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were:  Q 1  O  T 4  p  P  s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR   runMode alignReads   outFilterMismatchNmax 2   outFilterMultimapNmax 10   alignIntronMin 21   outStd SAM   outSAMattributes Standard   outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR     runMode genomeGenerate     runThreadN 8     genomeDir sjdbStarIndex     sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb    sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples  and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of   outSAMstrandField intronMotif  which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly  reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next  unidentified nucleotides  Ns  were corrected with GenomeAnalysisTK.jar  T SplitNCigarReads  rf ReassignOneMappingQuality  RMQF 255  RMQT 60  U ALLOW N CIGAR READS  improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar  T BaseRecalibrator  knownSites vcf. Finally  variants were called with GenomeAnalysisTK.jar  T HaplotypeCaller  dontUseSoftClippedBases  stand call conf 20.0  stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar  T VariantFiltration  window 35  cluster 3  filterName FS  filter \"FS > 30.0\"  filterName QD  filter \"QD < 2.0\". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout  we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates  thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble  and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads  log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.", "adult female brain", "The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "Zebrafish were maintained in standard conditions. Unless stated otherwise  in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts  23177 07/A 15 5 001 OES tail fin clips.", "tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type", "GSM2277116", "GSM2277116: WT 3; Danio rerio; RNA Seq", "GSM2277116", null, "1", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "GEO Accession:GSM2277116", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP081553", null, null, "Sample_imb_ketting_2014_13_WT_3_R1.fastq.gz Sample_imb_ketting_2014_13_WT_3_R2.fastq.gz", "fastq fastq", 7556697588.0, 37409394.0, "GSM2277116 r1", "0:101 1:101", "A:2168554402;C:1607788560;G:1605790339;T:2171752391;N:2811896", 101, 101, null, null, 2168554402, 1607788560, 1605790339, 2171752391, 2811896, "SRX2018180", "SRS1614124", "SRA451974", "GEO", "Rene Ketting, Institute of Molecular Biology", 2, 0.91892, 0.92233, 0.17858, 0.17763, 0.69589, 0.69674, 0.50649, 0.50869, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "3prime", "poly_a", "trueseq", "bulk", "clip", "iclip", null, "Germany", "2016-08-12", "Adult", "Adult", "Brain", "Nervous System"], [41275, "SRR4026143", "SRX2018180", "SRS1614124", "SRP081553", "PRJNA338793", "Characterization of genetic loss of function of Fus in zebrafish", "GSE85554", "Transcriptome Analysis", "The RNA binding protein FUS is implicated in transcription  alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3\u2019UTR usage  which could mask the effects of loss of Fus. Unlike published fus morphants  maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus /  genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus /  and WT labeled with the prefix \"Sample imb ketting 2014 13 \" we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that  we performed RNA sequencing a second time  using the same input RNA  except for the Fus knockout replicate #3  because there was not enough input RNA left. Instead  a different Fus knockout replicate #1 was sequenced. However  we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools  and the samples are highly correlated at least 0.97 and 0.95  Spearman and Pearson correlation respectively. Therefore  we considered first \"Sample imb ketting 2014 13 \" and second sequencing runs as technical replicates.", null, "pubmed:27898262", null, "WT 3", "GSM2277116", null, "source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type", "WT 3", "RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR   runMode alignReads   outBAMsortingThreadN 0   outFilterMultimapNmax 20   alignSJoverhangMin 8   alignSJDBoverhangMin 1   outFilterMismatchNmax 2   alignIntronMin 21   outSAMtype BAM SortedByCoordinate   sjdbOverhang 99   outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were:  Q 1  O  T 4  p  P  s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR   runMode alignReads   outFilterMismatchNmax 2   outFilterMultimapNmax 10   alignIntronMin 21   outStd SAM   outSAMattributes Standard   outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR     runMode genomeGenerate     runThreadN 8     genomeDir sjdbStarIndex     sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb    sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples  and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of   outSAMstrandField intronMotif  which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly  reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next  unidentified nucleotides  Ns  were corrected with GenomeAnalysisTK.jar  T SplitNCigarReads  rf ReassignOneMappingQuality  RMQF 255  RMQT 60  U ALLOW N CIGAR READS  improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar  T BaseRecalibrator  knownSites vcf. Finally  variants were called with GenomeAnalysisTK.jar  T HaplotypeCaller  dontUseSoftClippedBases  stand call conf 20.0  stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar  T VariantFiltration  window 35  cluster 3  filterName FS  filter \"FS > 30.0\"  filterName QD  filter \"QD < 2.0\". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout  we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates  thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble  and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads  log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.", "adult female brain", "The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "Zebrafish were maintained in standard conditions. Unless stated otherwise  in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts  23177 07/A 15 5 001 OES tail fin clips.", "tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type", "GSM2277116", "GSM2277116: WT 3; Danio rerio; RNA Seq", "GSM2277116", null, "1", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "GEO Accession:GSM2277116", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP081553", null, null, "WT_3_R1.fastq.gz WT_3_R2.fastq.gz", "fastq fastq", 7898912858.0, 39103529.0, "GSM2277116 r2", "0:101 1:101", "A:2243356257;C:1706636846;G:1702064968;T:2243634692;N:3220095", 101, 101, null, null, 2243356257, 1706636846, 1702064968, 2243634692, 3220095, "SRX2018180", "SRS1614124", "SRA451974", "GEO", "Rene Ketting, Institute of Molecular Biology", 2, 0.92701, 0.93109, 0.17113, 0.17214, 0.69591, 0.69716, 0.50649, 0.51272, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "3prime", "poly_a", "trueseq", "bulk", "clip", "iclip", null, "Germany", "2016-08-12", "Adult", "Adult", "Brain", "Nervous System"], [41276, "SRR4026140", "SRX2018179", "SRS1614121", "SRP081553", "PRJNA338793", "Characterization of genetic loss of function of Fus in zebrafish", "GSE85554", "Transcriptome Analysis", "The RNA binding protein FUS is implicated in transcription  alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3\u2019UTR usage  which could mask the effects of loss of Fus. Unlike published fus morphants  maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus /  genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus /  and WT labeled with the prefix \"Sample imb ketting 2014 13 \" we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that  we performed RNA sequencing a second time  using the same input RNA  except for the Fus knockout replicate #3  because there was not enough input RNA left. Instead  a different Fus knockout replicate #1 was sequenced. However  we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools  and the samples are highly correlated at least 0.97 and 0.95  Spearman and Pearson correlation respectively. Therefore  we considered first \"Sample imb ketting 2014 13 \" and second sequencing runs as technical replicates.", null, "pubmed:27898262", null, "WT 1", "GSM2277115", null, "source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type", "WT 1", "RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR   runMode alignReads   outBAMsortingThreadN 0   outFilterMultimapNmax 20   alignSJoverhangMin 8   alignSJDBoverhangMin 1   outFilterMismatchNmax 2   alignIntronMin 21   outSAMtype BAM SortedByCoordinate   sjdbOverhang 99   outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were:  Q 1  O  T 4  p  P  s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR   runMode alignReads   outFilterMismatchNmax 2   outFilterMultimapNmax 10   alignIntronMin 21   outStd SAM   outSAMattributes Standard   outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR     runMode genomeGenerate     runThreadN 8     genomeDir sjdbStarIndex     sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb    sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples  and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of   outSAMstrandField intronMotif  which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly  reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next  unidentified nucleotides  Ns  were corrected with GenomeAnalysisTK.jar  T SplitNCigarReads  rf ReassignOneMappingQuality  RMQF 255  RMQT 60  U ALLOW N CIGAR READS  improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar  T BaseRecalibrator  knownSites vcf. Finally  variants were called with GenomeAnalysisTK.jar  T HaplotypeCaller  dontUseSoftClippedBases  stand call conf 20.0  stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar  T VariantFiltration  window 35  cluster 3  filterName FS  filter \"FS > 30.0\"  filterName QD  filter \"QD < 2.0\". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout  we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates  thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble  and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads  log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.", "adult female brain", "The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "Zebrafish were maintained in standard conditions. Unless stated otherwise  in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts  23177 07/A 15 5 001 OES tail fin clips.", "tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type", "GSM2277115", "GSM2277115: WT 1; Danio rerio; RNA Seq", "GSM2277115", null, "1", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "GEO Accession:GSM2277115", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP081553", null, null, "Sample_imb_ketting_2014_13_WT_1_R1.fastq.gz Sample_imb_ketting_2014_13_WT_1_R2.fastq.gz", "fastq fastq", 7999392910.0, 39600955.0, "GSM2277115 r1", "0:101 1:101", "A:2287512350;C:1711532349;G:1705616114;T:2291731604;N:3000493", 101, 101, null, null, 2287512350, 1711532349, 1705616114, 2291731604, 3000493, "SRX2018179", "SRS1614121", "SRA451974", "GEO", "Rene Ketting, Institute of Molecular Biology", 2, 0.92291, 0.92474, 0.16701, 0.16646, 0.698, 0.69814, 0.51025, 0.51024, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "3prime", "poly_a", "trueseq", "bulk", "clip", "iclip", null, "Germany", "2016-08-12", "Adult", "Adult", "Brain", "Nervous System"], [41277, "SRR4026141", "SRX2018179", "SRS1614121", "SRP081553", "PRJNA338793", "Characterization of genetic loss of function of Fus in zebrafish", "GSE85554", "Transcriptome Analysis", "The RNA binding protein FUS is implicated in transcription  alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3\u2019UTR usage  which could mask the effects of loss of Fus. Unlike published fus morphants  maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus /  genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus /  and WT labeled with the prefix \"Sample imb ketting 2014 13 \" we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that  we performed RNA sequencing a second time  using the same input RNA  except for the Fus knockout replicate #3  because there was not enough input RNA left. Instead  a different Fus knockout replicate #1 was sequenced. However  we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools  and the samples are highly correlated at least 0.97 and 0.95  Spearman and Pearson correlation respectively. Therefore  we considered first \"Sample imb ketting 2014 13 \" and second sequencing runs as technical replicates.", null, "pubmed:27898262", null, "WT 1", "GSM2277115", null, "source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type", "WT 1", "RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR   runMode alignReads   outBAMsortingThreadN 0   outFilterMultimapNmax 20   alignSJoverhangMin 8   alignSJDBoverhangMin 1   outFilterMismatchNmax 2   alignIntronMin 21   outSAMtype BAM SortedByCoordinate   sjdbOverhang 99   outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were:  Q 1  O  T 4  p  P  s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR   runMode alignReads   outFilterMismatchNmax 2   outFilterMultimapNmax 10   alignIntronMin 21   outStd SAM   outSAMattributes Standard   outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR     runMode genomeGenerate     runThreadN 8     genomeDir sjdbStarIndex     sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb    sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples  and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of   outSAMstrandField intronMotif  which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly  reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next  unidentified nucleotides  Ns  were corrected with GenomeAnalysisTK.jar  T SplitNCigarReads  rf ReassignOneMappingQuality  RMQF 255  RMQT 60  U ALLOW N CIGAR READS  improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar  T BaseRecalibrator  knownSites vcf. Finally  variants were called with GenomeAnalysisTK.jar  T HaplotypeCaller  dontUseSoftClippedBases  stand call conf 20.0  stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar  T VariantFiltration  window 35  cluster 3  filterName FS  filter \"FS > 30.0\"  filterName QD  filter \"QD < 2.0\". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout  we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates  thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble  and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads  log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.", "adult female brain", "The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "Zebrafish were maintained in standard conditions. Unless stated otherwise  in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts  23177 07/A 15 5 001 OES tail fin clips.", "tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type", "GSM2277115", "GSM2277115: WT 1; Danio rerio; RNA Seq", "GSM2277115", null, "1", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "GEO Accession:GSM2277115", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP081553", null, null, "WT_1_R1.fastq.gz WT_1_R2.fastq.gz", "fastq fastq", 6187101026.0, 30629213.0, "GSM2277115 r2", "0:101 1:101", "A:1757769151;C:1333826875;G:1336928364;T:1756068161;N:2508475", 101, 101, null, null, 1757769151, 1333826875, 1336928364, 1756068161, 2508475, "SRX2018179", "SRS1614121", "SRA451974", "GEO", "Rene Ketting, Institute of Molecular Biology", 2, 0.9294, 0.9334, 0.16402, 0.16355, 0.69682, 0.69741, 0.49912, 0.50428, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "3prime", "poly_a", "trueseq", "bulk", "clip", "iclip", null, "Germany", "2016-08-12", "Adult", "Adult", "Brain", "Nervous System"], [49577, "SRR7947926", "SRX4781875", "SRS3862067", "SRP163087", "PRJNA494251", "Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis", "GSE120724", "Other", "We resolved the RNA secondary structure during zebrafish early embryogenesis based on  in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages.  Also  we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages  including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2  4  6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.", null, "pubmed:32423473", null, "elavl1a morphant 6h rna seq rep2", "GSM3409399", null, "source name:elavl1a morphant 6h rna seq rep2|strain:AB|tissue:zebrafish embryos|genotype/variation:elavl1a morphants zebrafish embryos cells|age:6hpf", "elavl1a morphant 6h rna seq rep2", "trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window  then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID  second is transcript length  third is RPKM  then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID  second is  transcript length  third is the unique mapped reads count  fourth is the mulitple mapped reads count  fifth is the RPKM.", "elavl1a morphant 6h rna seq rep2", "For Elavl1a morphants generation  morpholino oligonucleotides of elavl1a were injected into one cell stage embryos  then embryos were harvested at desired stages", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen.To enrich polyA RNA  the total RNA was subjected to polyA selection. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before 3\u2019 adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M 5\u2019 adenylated and 3\u2019 blocked linker 3\u2019 bio for unmodified  3\u2019 ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l 5\u2019 Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer\u2019s protocol.", "Zebrafish wild type strain AB was raised in system water at 28.5\u00b0C under standard conditions.", "strain:AB|tissue:zebrafish embryos|genotype/variation:elavl1a morphants zebrafish embryos cells|age:6hpf", "GSM3409399", "GSM3409399: elavl1a morphant 6h rna seq rep2; Danio rerio; RNA Seq", "GSM3409399", null, "1", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before three prime adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M five prime adenylated and three prime blocked linker three prime bio for unmodified  three prime ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.", "GEO Accession:GSM3409399", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP163087", null, null, "elavl1a_morphant_6h_rna-seq_rep2.R1.fastq.gz elavl1a_morphant_6h_rna-seq_rep2.R2.fastq.gz", "fastq fastq", 19875464400.0, 66251548.0, "GSM3409399 r1", "0:150 1:150", "A:5352630990;C:4584661408;G:4726300804;T:5209787586;N:2083612", 150, 150, null, null, 5352630990, 4584661408, 4726300804, 5209787586, 2083612, "SRX4781875", "SRS3862067", "SRA787572", "GEO", "Life Science, Tsinghua University", 2, 0.94901, 0.95039, 0.09074, 0.08943, 0.75866, 0.76418, 0.55609, 0.56574, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "clip", "iclip", null, "China", "2018-10-01", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [49578, "SRR7947925", "SRX4781874", "SRS3862066", "SRP163087", "PRJNA494251", "Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis", "GSE120724", "Other", "We resolved the RNA secondary structure during zebrafish early embryogenesis based on  in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages.  Also  we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages  including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2  4  6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.", null, "pubmed:32423473", null, "elavl1a morphant 6h rna seq rep1", "GSM3409398", null, "source name:elavl1a morphant 6h rna seq rep1|strain:AB|tissue:zebrafish embryos|genotype/variation:elavl1a morphants zebrafish embryos cells|age:6hpf", "elavl1a morphant 6h rna seq rep1", "trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window  then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID  second is transcript length  third is RPKM  then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID  second is  transcript length  third is the unique mapped reads count  fourth is the mulitple mapped reads count  fifth is the RPKM.", "elavl1a morphant 6h rna seq rep1", "For Elavl1a morphants generation  morpholino oligonucleotides of elavl1a were injected into one cell stage embryos  then embryos were harvested at desired stages", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen.To enrich polyA RNA  the total RNA was subjected to polyA selection. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before 3\u2019 adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M 5\u2019 adenylated and 3\u2019 blocked linker 3\u2019 bio for unmodified  3\u2019 ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l 5\u2019 Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer\u2019s protocol.", "Zebrafish wild type strain AB was raised in system water at 28.5\u00b0C under standard conditions.", "strain:AB|tissue:zebrafish embryos|genotype/variation:elavl1a morphants zebrafish embryos cells|age:6hpf", "GSM3409398", "GSM3409398: elavl1a morphant 6h rna seq rep1; Danio rerio; RNA Seq", "GSM3409398", null, "1", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before three prime adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M five prime adenylated and three prime blocked linker three prime bio for unmodified  three prime ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.", "GEO Accession:GSM3409398", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP163087", null, null, "elavl1a_morphant_6h_rna-seq_rep1.R2.fastq.gz elavl1a_morphant_6h_rna-seq_rep1.R1.fastq.gz", "fastq fastq", 20202214200.0, 67340714.0, "GSM3409398 r1", "0:150 1:150", "A:5439747248;C:4667041902;G:4805911969;T:5287977733;N:1535348", 150, 150, null, null, 5439747248, 4667041902, 4805911969, 5287977733, 1535348, "SRX4781874", "SRS3862066", "SRA787572", "GEO", "Life Science, Tsinghua University", 2, 0.94586, 0.94757, 0.09031, 0.09016, 0.76019, 0.76493, 0.55951, 0.56185, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "clip", "iclip", null, "China", "2018-10-01", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [49579, "SRR7947924", "SRX4781873", "SRS3862065", "SRP163087", "PRJNA494251", "Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis", "GSE120724", "Other", "We resolved the RNA secondary structure during zebrafish early embryogenesis based on  in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages.  Also  we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages  including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2  4  6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.", null, "pubmed:32423473", null, "elavl1a morphant 4h rna seq rep2", "GSM3409397", null, "source name:elavl1a morphant 4h rna seq rep2|strain:AB|tissue:zebrafish embryos|genotype/variation:elavl1a morphants zebrafish embryos cells|age:4hpf", "elavl1a morphant 4h rna seq rep2", "trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window  then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID  second is transcript length  third is RPKM  then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID  second is  transcript length  third is the unique mapped reads count  fourth is the mulitple mapped reads count  fifth is the RPKM.", "elavl1a morphant 4h rna seq rep2", "For Elavl1a morphants generation  morpholino oligonucleotides of elavl1a were injected into one cell stage embryos  then embryos were harvested at desired stages", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen.To enrich polyA RNA  the total RNA was subjected to polyA selection. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before 3\u2019 adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M 5\u2019 adenylated and 3\u2019 blocked linker 3\u2019 bio for unmodified  3\u2019 ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l 5\u2019 Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer\u2019s protocol.", "Zebrafish wild type strain AB was raised in system water at 28.5\u00b0C under standard conditions.", "strain:AB|tissue:zebrafish embryos|genotype/variation:elavl1a morphants zebrafish embryos cells|age:4hpf", "GSM3409397", "GSM3409397: elavl1a morphant 4h rna seq rep2; Danio rerio; RNA Seq", "GSM3409397", null, "1", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before three prime adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M five prime adenylated and three prime blocked linker three prime bio for unmodified  three prime ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.", "GEO Accession:GSM3409397", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP163087", null, null, "elavl1a_morphant_4h_rna-seq_rep2.R2.fastq.gz elavl1a_morphant_4h_rna-seq_rep2.R1.fastq.gz", "fastq fastq", 38764196400.0, 129213988.0, "GSM3409397 r1", "0:150 1:150", "A:10980499317;C:8394995318;G:8739322914;T:10645637187;N:3741664", 150, 150, null, null, 10980499317, 8394995318, 8739322914, 10645637187, 3741664, "SRX4781873", "SRS3862065", "SRA787572", "GEO", "Life Science, Tsinghua University", 2, 0.94567, 0.94509, 0.06713, 0.06614, 0.76191, 0.76508, 0.73283, 0.74007, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "clip", "iclip", null, "China", "2018-10-01", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [49580, "SRR7947923", "SRX4781872", "SRS3862064", "SRP163087", "PRJNA494251", "Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis", "GSE120724", "Other", "We resolved the RNA secondary structure during zebrafish early embryogenesis based on  in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages.  Also  we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages  including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2  4  6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.", null, "pubmed:32423473", null, "elavl1a morphant 4h rna seq rep1", "GSM3409396", null, "source name:elavl1a morphant 4h rna seq rep1|strain:AB|tissue:zebrafish embryos|genotype/variation:elavl1a morphants zebrafish embryos cells|age:4hpf", "elavl1a morphant 4h rna seq rep1", "trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window  then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID  second is transcript length  third is RPKM  then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID  second is  transcript length  third is the unique mapped reads count  fourth is the mulitple mapped reads count  fifth is the RPKM.", "elavl1a morphant 4h rna seq rep1", "For Elavl1a morphants generation  morpholino oligonucleotides of elavl1a were injected into one cell stage embryos  then embryos were harvested at desired stages", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen.To enrich polyA RNA  the total RNA was subjected to polyA selection. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before 3\u2019 adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M 5\u2019 adenylated and 3\u2019 blocked linker 3\u2019 bio for unmodified  3\u2019 ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l 5\u2019 Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer\u2019s protocol.", "Zebrafish wild type strain AB was raised in system water at 28.5\u00b0C under standard conditions.", "strain:AB|tissue:zebrafish embryos|genotype/variation:elavl1a morphants zebrafish embryos cells|age:4hpf", "GSM3409396", "GSM3409396: elavl1a morphant 4h rna seq rep1; Danio rerio; RNA Seq", "GSM3409396", null, "1", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before three prime adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M five prime adenylated and three prime blocked linker three prime bio for unmodified  three prime ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.", "GEO Accession:GSM3409396", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP163087", null, null, "elavl1a_morphant_4h_rna-seq_rep1.R1.fastq.gz elavl1a_morphant_4h_rna-seq_rep1.R2.fastq.gz", "fastq fastq", 34417602600.0, 114725342.0, "GSM3409396 r1", "0:150 1:150", "A:9798364920;C:7402367067;G:7677976380;T:9534399996;N:4494237", 150, 150, null, null, 9798364920, 7402367067, 7677976380, 9534399996, 4494237, "SRX4781872", "SRS3862064", "SRA787572", "GEO", "Life Science, Tsinghua University", 2, 0.94663, 0.94701, 0.06442, 0.06367, 0.76264, 0.7655, 0.73483, 0.74221, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "clip", "iclip", null, "China", "2018-10-01", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [49581, "SRR7947922", "SRX4781871", "SRS3862063", "SRP163087", "PRJNA494251", "Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis", "GSE120724", "Other", "We resolved the RNA secondary structure during zebrafish early embryogenesis based on  in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages.  Also  we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages  including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2  4  6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.", null, "pubmed:32423473", null, "control 6h rna seq rep2", "GSM3409395", null, "source name:control 6h rna seq rep2|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:6hpf", "control 6h rna seq rep2", "trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window  then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID  second is transcript length  third is RPKM  then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID  second is  transcript length  third is the unique mapped reads count  fourth is the mulitple mapped reads count  fifth is the RPKM.", "control 6h rna seq rep2", "For Elavl1a morphants generation  morpholino oligonucleotides of elavl1a were injected into one cell stage embryos  then embryos were harvested at desired stages", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen.To enrich polyA RNA  the total RNA was subjected to polyA selection. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before 3\u2019 adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M 5\u2019 adenylated and 3\u2019 blocked linker 3\u2019 bio for unmodified  3\u2019 ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l 5\u2019 Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer\u2019s protocol.", "Zebrafish wild type strain AB was raised in system water at 28.5\u00b0C under standard conditions.", "strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:6hpf", "GSM3409395", "GSM3409395: control 6h rna seq rep2; Danio rerio; RNA Seq", "GSM3409395", null, "1", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before three prime adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M five prime adenylated and three prime blocked linker three prime bio for unmodified  three prime ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.", "GEO Accession:GSM3409395", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP163087", null, null, "control_6h_rna-seq_rep2.R1.fastq.gz control_6h_rna-seq_rep2.R2.fastq.gz", "fastq fastq", 39198242400.0, 130660808.0, "GSM3409395 r1", "0:150 1:150", "A:11268897172;C:8355243125;G:8663182840;T:10907160510;N:3758753", 150, 150, null, null, 11268897172, 8355243125, 8663182840, 10907160510, 3758753, "SRX4781871", "SRS3862063", "SRA787572", "GEO", "Life Science, Tsinghua University", 2, 0.94553, 0.94591, 0.09312, 0.09248, 0.78098, 0.78397, 0.73432, 0.73781, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "clip", "iclip", null, "China", "2018-10-01", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [49582, "SRR7947921", "SRX4781870", "SRS3862062", "SRP163087", "PRJNA494251", "Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis", "GSE120724", "Other", "We resolved the RNA secondary structure during zebrafish early embryogenesis based on  in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages.  Also  we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages  including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2  4  6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.", null, "pubmed:32423473", null, "control 6h rna seq rep1", "GSM3409394", null, "source name:control 6h rna seq rep1|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:6hpf", "control 6h rna seq rep1", "trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window  then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID  second is transcript length  third is RPKM  then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID  second is  transcript length  third is the unique mapped reads count  fourth is the mulitple mapped reads count  fifth is the RPKM.", "control 6h rna seq rep1", "For Elavl1a morphants generation  morpholino oligonucleotides of elavl1a were injected into one cell stage embryos  then embryos were harvested at desired stages", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen.To enrich polyA RNA  the total RNA was subjected to polyA selection. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before 3\u2019 adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M 5\u2019 adenylated and 3\u2019 blocked linker 3\u2019 bio for unmodified  3\u2019 ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l 5\u2019 Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer\u2019s protocol.", "Zebrafish wild type strain AB was raised in system water at 28.5\u00b0C under standard conditions.", "strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:6hpf", "GSM3409394", "GSM3409394: control 6h rna seq rep1; Danio rerio; RNA Seq", "GSM3409394", null, "1", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before three prime adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M five prime adenylated and three prime blocked linker three prime bio for unmodified  three prime ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.", "GEO Accession:GSM3409394", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP163087", null, null, "control_6h_rna-seq_rep1.R1.fastq.gz control_6h_rna-seq_rep1.R2.fastq.gz", "fastq fastq", 49781358600.0, 165937862.0, "GSM3409394 r1", "0:150 1:150", "A:14340306167;C:10572507738;G:11006666686;T:13855405563;N:6472446", 150, 150, null, null, 14340306167, 10572507738, 11006666686, 13855405563, 6472446, "SRX4781870", "SRS3862062", "SRA787572", "GEO", "Life Science, Tsinghua University", 2, 0.94466, 0.94506, 0.09485, 0.09402, 0.77782, 0.78303, 0.72367, 0.72791, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "clip", "iclip", null, "China", "2018-10-01", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [49583, "SRR7947920", "SRX4781869", "SRS3862061", "SRP163087", "PRJNA494251", "Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis", "GSE120724", "Other", "We resolved the RNA secondary structure during zebrafish early embryogenesis based on  in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages.  Also  we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages  including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2  4  6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.", null, "pubmed:32423473", null, "control 4h rna seq rep2", "GSM3409393", null, "source name:control 4h rna seq rep2|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:4hpf", "control 4h rna seq rep2", "trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window  then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID  second is transcript length  third is RPKM  then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID  second is  transcript length  third is the unique mapped reads count  fourth is the mulitple mapped reads count  fifth is the RPKM.", "control 4h rna seq rep2", "For Elavl1a morphants generation  morpholino oligonucleotides of elavl1a were injected into one cell stage embryos  then embryos were harvested at desired stages", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen.To enrich polyA RNA  the total RNA was subjected to polyA selection. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before 3\u2019 adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M 5\u2019 adenylated and 3\u2019 blocked linker 3\u2019 bio for unmodified  3\u2019 ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l 5\u2019 Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer\u2019s protocol.", "Zebrafish wild type strain AB was raised in system water at 28.5\u00b0C under standard conditions.", "strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:4hpf", "GSM3409393", "GSM3409393: control 4h rna seq rep2; Danio rerio; RNA Seq", "GSM3409393", null, "1", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before three prime adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M five prime adenylated and three prime blocked linker three prime bio for unmodified  three prime ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.", "GEO Accession:GSM3409393", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP163087", null, null, "control_4h_rna-seq_rep2.R1.fastq.gz control_4h_rna-seq_rep2.R2.fastq.gz", "fastq fastq", 33462197400.0, 111540658.0, "GSM3409393 r1", "0:150 1:150", "A:9246596683;C:7497270682;G:7798285753;T:8916810951;N:3233331", 150, 150, null, null, 9246596683, 7497270682, 7798285753, 8916810951, 3233331, "SRX4781869", "SRS3862061", "SRA787572", "GEO", "Life Science, Tsinghua University", 2, 0.94792, 0.94861, 0.0862, 0.08529, 0.76084, 0.76309, 0.73536, 0.73703, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "clip", "iclip", null, "China", "2018-10-01", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [49584, "SRR7947919", "SRX4781868", "SRS3862060", "SRP163087", "PRJNA494251", "Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis", "GSE120724", "Other", "We resolved the RNA secondary structure during zebrafish early embryogenesis based on  in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages.  Also  we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages  including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2  4  6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.", null, "pubmed:32423473", null, "control 4h rna seq rep1", "GSM3409392", null, "source name:control 4h rna seq rep1|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:4hpf", "control 4h rna seq rep1", "trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window  then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID  second is transcript length  third is RPKM  then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID  second is  transcript length  third is the unique mapped reads count  fourth is the mulitple mapped reads count  fifth is the RPKM.", "control 4h rna seq rep1", "For Elavl1a morphants generation  morpholino oligonucleotides of elavl1a were injected into one cell stage embryos  then embryos were harvested at desired stages", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen.To enrich polyA RNA  the total RNA was subjected to polyA selection. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before 3\u2019 adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M 5\u2019 adenylated and 3\u2019 blocked linker 3\u2019 bio for unmodified  3\u2019 ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l 5\u2019 Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer\u2019s protocol.", "Zebrafish wild type strain AB was raised in system water at 28.5\u00b0C under standard conditions.", "strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:4hpf", "GSM3409392", "GSM3409392: control 4h rna seq rep1; Danio rerio; RNA Seq", "GSM3409392", null, "1", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before three prime adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M five prime adenylated and three prime blocked linker three prime bio for unmodified  three prime ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.", "GEO Accession:GSM3409392", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP163087", null, null, "control_4h_rna-seq_rep1.R1.fastq.gz control_4h_rna-seq_rep1.R2.fastq.gz", "fastq fastq", 38719753500.0, 129065845.0, "GSM3409392 r1", "0:150 1:150", "A:10763970685;C:8606443742;G:8961006857;T:10383272808;N:5059408", 150, 150, null, null, 10763970685, 8606443742, 8961006857, 10383272808, 5059408, "SRX4781868", "SRS3862060", "SRA787572", "GEO", "Life Science, Tsinghua University", 2, 0.94748, 0.948, 0.08608, 0.08505, 0.76023, 0.76357, 0.72873, 0.73242, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "clip", "iclip", null, "China", "2018-10-01", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [49585, "SRR7947918", "SRX4781867", "SRS3862059", "SRP163087", "PRJNA494251", "Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis", "GSE120724", "Other", "We resolved the RNA secondary structure during zebrafish early embryogenesis based on  in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages.  Also  we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages  including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2  4  6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.", null, "pubmed:32423473", null, "control 2h rna seq rep2", "GSM3409391", null, "source name:control 2h rna seq rep2|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:2hpf", "control 2h rna seq rep2", "trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window  then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID  second is transcript length  third is RPKM  then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID  second is  transcript length  third is the unique mapped reads count  fourth is the mulitple mapped reads count  fifth is the RPKM.", "control 2h rna seq rep2", "For Elavl1a morphants generation  morpholino oligonucleotides of elavl1a were injected into one cell stage embryos  then embryos were harvested at desired stages", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen.To enrich polyA RNA  the total RNA was subjected to polyA selection. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before 3\u2019 adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M 5\u2019 adenylated and 3\u2019 blocked linker 3\u2019 bio for unmodified  3\u2019 ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l 5\u2019 Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer\u2019s protocol.", "Zebrafish wild type strain AB was raised in system water at 28.5\u00b0C under standard conditions.", "strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:2hpf", "GSM3409391", "GSM3409391: control 2h rna seq rep2; Danio rerio; RNA Seq", "GSM3409391", null, "1", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before three prime adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M five prime adenylated and three prime blocked linker three prime bio for unmodified  three prime ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.", "GEO Accession:GSM3409391", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP163087", null, null, "control_2h_rna-seq_rep2.R1.fastq.gz control_2h_rna-seq_rep2.R2.fastq.gz", "fastq fastq", 39017750100.0, 130059167.0, "GSM3409391 r1", "0:150 1:150", "A:10979134932;C:8549683633;G:8854910977;T:10629254366;N:4766192", 150, 150, null, null, 10979134932, 8549683633, 8854910977, 10629254366, 4766192, "SRX4781867", "SRS3862059", "SRA787572", "GEO", "Life Science, Tsinghua University", 2, 0.94685, 0.94869, 0.03416, 0.03311, 0.76536, 0.76731, 0.65079, 0.65387, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "clip", "iclip", null, "China", "2018-10-01", "Cleavage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [49586, "SRR7947917", "SRX4781866", "SRS3862058", "SRP163087", "PRJNA494251", "Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis", "GSE120724", "Other", "We resolved the RNA secondary structure during zebrafish early embryogenesis based on  in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages.  Also  we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages  including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2  4  6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.", null, "pubmed:32423473", null, "control 2h rna seq rep1", "GSM3409390", null, "source name:control 2h rna seq rep1|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:2hpf", "control 2h rna seq rep1", "trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window  then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID  second is transcript length  third is RPKM  then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID  second is  transcript length  third is the unique mapped reads count  fourth is the mulitple mapped reads count  fifth is the RPKM.", "control 2h rna seq rep1", "For Elavl1a morphants generation  morpholino oligonucleotides of elavl1a were injected into one cell stage embryos  then embryos were harvested at desired stages", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen.To enrich polyA RNA  the total RNA was subjected to polyA selection. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before 3\u2019 adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M 5\u2019 adenylated and 3\u2019 blocked linker 3\u2019 bio for unmodified  3\u2019 ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l 5\u2019 Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer\u2019s protocol.", "Zebrafish wild type strain AB was raised in system water at 28.5\u00b0C under standard conditions.", "strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:2hpf", "GSM3409390", "GSM3409390: control 2h rna seq rep1; Danio rerio; RNA Seq", "GSM3409390", null, "1", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before three prime adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M five prime adenylated and three prime blocked linker three prime bio for unmodified  three prime ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.", "GEO Accession:GSM3409390", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP163087", null, null, "control_2h_rna-seq_rep1.R1.fastq.gz control_2h_rna-seq_rep1.R2.fastq.gz", "fastq fastq", 33999089400.0, 113330298.0, "GSM3409390 r1", "0:150 1:150", "A:9602786363;C:7418727808;G:7667052932;T:9305137704;N:5384593", 150, 150, null, null, 9602786363, 7418727808, 7667052932, 9305137704, 5384593, "SRX4781866", "SRS3862058", "SRA787572", "GEO", "Life Science, Tsinghua University", 2, 0.94874, 0.95121, 0.03388, 0.03264, 0.76524, 0.76662, 0.65127, 0.65427, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "clip", "iclip", null, "China", "2018-10-01", "Cleavage", "Embryo", "Embryo Imprecise", "All anatomical structures"]], "truncated": false, "filtered_table_rows_count": 26, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"experiment.library_source\" = :p0 and \"experiment.library_strategy\" = :p1 and \"technology\" = :p2 order by rowid limit 101", "params": {"p0": "TRANSCRIPTOMIC", "p1": "RNA-Seq", "p2": "iclip"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.library_strategy=RNA-Seq&technology=iclip", "results": [{"value": "RNA-Seq", "label": "RNA-Seq", "count": 26, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&technology=iclip", "selected": true}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.library_strategy=RNA-Seq&technology=iclip", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 26, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&technology=iclip", "selected": true}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.library_strategy=RNA-Seq&technology=iclip", "results": [{"value": "cDNA", "label": "cDNA", "count": 26, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.library_strategy=RNA-Seq&technology=iclip&experiment.library_selection=cDNA", "selected": false}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.library_strategy=RNA-Seq&technology=iclip", "results": [{"value": "PAIRED", "label": "PAIRED", "count": 26, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.library_strategy=RNA-Seq&technology=iclip&experiment.library_layout=PAIRED", "selected": false}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.library_strategy=RNA-Seq&technology=iclip", "results": [{"value": "ILLUMINA", "label": "ILLUMINA", "count": 26, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.library_strategy=RNA-Seq&technology=iclip&experiment.platform=ILLUMINA", "selected": false}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.library_strategy=RNA-Seq&technology=iclip", "results": [{"value": "Adult", "label": "Adult", "count": 16, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.library_strategy=RNA-Seq&technology=iclip&devstage_curation_coarse=Adult", "selected": false}, {"value": "Embryo", "label": "Embryo", "count": 10, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.library_strategy=RNA-Seq&technology=iclip&devstage_curation_coarse=Embryo", "selected": false}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.library_strategy=RNA-Seq&technology=iclip", "results": [{"value": "Adult", "label": "Adult", "count": 16, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.library_strategy=RNA-Seq&technology=iclip&devstage_curation=Adult", "selected": false}, {"value": "Blastula", "label": "Blastula", "count": 4, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.library_strategy=RNA-Seq&technology=iclip&devstage_curation=Blastula", "selected": false}, {"value": "Gastrula", "label": "Gastrula", "count": 4, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.library_strategy=RNA-Seq&technology=iclip&devstage_curation=Gastrula", "selected": false}, {"value": "Cleavage", "label": "Cleavage", "count": 2, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.library_strategy=RNA-Seq&technology=iclip&devstage_curation=Cleavage", "selected": false}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.library_strategy=RNA-Seq&technology=iclip", "results": [{"value": "Nervous System", "label": "Nervous System", "count": 16, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.library_strategy=RNA-Seq&technology=iclip&tissue_curation_coarse=Nervous+System", "selected": false}, {"value": "All anatomical structures", "label": "All anatomical structures", "count": 10, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.library_strategy=RNA-Seq&technology=iclip&tissue_curation_coarse=All+anatomical+structures", "selected": false}], "truncated": false}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.library_strategy=RNA-Seq&technology=iclip", "results": [{"value": "Brain", "label": "Brain", "count": 16, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.library_strategy=RNA-Seq&technology=iclip&tissue_curation=Brain", "selected": false}, {"value": "Embryo Imprecise", "label": "Embryo Imprecise", "count": 10, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.library_strategy=RNA-Seq&technology=iclip&tissue_curation=Embryo+Imprecise", "selected": false}], "truncated": false}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.library_strategy=RNA-Seq&technology=iclip", "results": [{"value": "iclip", "label": "iclip", "count": 26, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_source=TRANSCRIPTOMIC&experiment.library_strategy=RNA-Seq", "selected": true}], "truncated": false}}, "suggested_facets": [], "next": null, "next_url": null, "private": false, "allow_execute_sql": true, "query_ms": 97.71127299973159}