{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where experiment.library_selection = \"size fractionation\", experiment.platform = \"ILLUMINA\" and tissue_curation_coarse = \"Reproductive System\"", "rows": [[25293, "SRR25764131", "SRX21486791", "SRS18719090", "SRP457111", "PRJNA1009808", "Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq]", "GSE241754", "Transcriptome Analysis", "Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points  namelyat the 256 cell 2.5 hpf  1000 cell 3 hpf  sphere 4 hpf  shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis  polysome profiling  ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.", "parent bioproject:PRJNA1009800", "pubmed:39402326", null, "WT egg 0 hpf tRNA seq rep2", "GSM7734772", null, "source name:Unfertilized egg|strain:TLAB strain|tissue:Unfertilized egg|developmental stage:unfertilized egg 0 hpf|genotype:WT|geo loc name:missing|collection date:missing", "WT egg 0 hpf tRNA seq rep2", "Read demultiplexing and adapter trimming performed with cutadapt v3.5  where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained  and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5\u2019 RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters   species Drer   cluster id 0.93   min cov 0.001   max mismatches 0.075   control condition Egg   deconv cov ratio 0.4   remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters  and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts", "Unfertilized egg", "unperturbed growth conditions in E3 medium for zebrafish embryos.", "50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4  100 mM LiCl  2 mM EDTA  5 mM DTT  pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021  2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq", "Embryos were grown in standard housing conditions namely28\u00b0C at a 14/10 hour light/dark cycle.", "strain:TLAB strain|tissue:Unfertilized egg|developmental stage:unfertilized egg 0 hpf|genotype:WT", "GSM7734772", "GSM7734772: WT egg 0 hpf tRNA seq rep2; Danio rerio; ncRNA Seq", "GSM7734772 r1", "GSM7734772", "1", "50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4  100 mM LiCl  2 mM EDTA  5 mM DTT  pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021  2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP457111", null, null, "WT_tRNA_egg_2.fastq.gz", "fastq", 206374994.0, 3181706.0, "GSM7734772 r1", "0:64.86", "A:41195250;C:56578032;G:56479855;T:52121365;N:492", 64, null, null, null, 41195250, 56578032, 56479855, 52121365, 492, "SRX21486791", "SRS18719090", "SRA1700461", "Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry", "Max Planck Institute of Biochemistry", 1, 0.28659, null, 0.02017, null, 0.9207, null, 0.48536, null, 78, null, "B", null, "usable mapping rate", "illumina", "nextseq", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2023-08-28", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [25294, "SRR25764132", "SRX21486790", "SRS18719089", "SRP457111", "PRJNA1009808", "Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq]", "GSE241754", "Transcriptome Analysis", "Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points  namelyat the 256 cell 2.5 hpf  1000 cell 3 hpf  sphere 4 hpf  shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis  polysome profiling  ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.", "parent bioproject:PRJNA1009800", "pubmed:39402326", null, "WT egg 0 hpf tRNA seq rep1", "GSM7734771", null, "source name:Unfertilized egg|strain:TLAB strain|tissue:Unfertilized egg|developmental stage:unfertilized egg 0 hpf|genotype:WT|geo loc name:missing|collection date:missing", "WT egg 0 hpf tRNA seq rep1", "Read demultiplexing and adapter trimming performed with cutadapt v3.5  where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained  and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5\u2019 RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters   species Drer   cluster id 0.93   min cov 0.001   max mismatches 0.075   control condition Egg   deconv cov ratio 0.4   remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters  and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts", "Unfertilized egg", "unperturbed growth conditions in E3 medium for zebrafish embryos.", "50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4  100 mM LiCl  2 mM EDTA  5 mM DTT  pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021  2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq", "Embryos were grown in standard housing conditions namely28\u00b0C at a 14/10 hour light/dark cycle.", "strain:TLAB strain|tissue:Unfertilized egg|developmental stage:unfertilized egg 0 hpf|genotype:WT", "GSM7734771", "GSM7734771: WT egg 0 hpf tRNA seq rep1; Danio rerio; ncRNA Seq", "GSM7734771 r1", "GSM7734771", "1", "50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4  100 mM LiCl  2 mM EDTA  5 mM DTT  pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021  2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP457111", null, null, "WT_tRNA_egg_1.fastq.gz", "fastq", 86021968.0, 1304769.0, "GSM7734771 r1", "0:65.93", "A:17511521;C:23474625;G:23300759;T:21734864;N:199", 65, null, null, null, 17511521, 23474625, 23300759, 21734864, 199, "SRX21486790", "SRS18719089", "SRA1700461", "Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry", "Max Planck Institute of Biochemistry", 1, 0.29829, null, 0.02027, null, 0.92245, null, 0.48877, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2023-08-28", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [29746, "SRR27467679", "SRX23139227", "SRS20090270", "SRP482074", "PRJNA1061456", "tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development", "PRJNA1061456", "Other", null, null, null, null, null, "ovary BS R2", null, "strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:adult|collection date:2022|geo loc name:Austria|sex:female|tissue:ovary|treatment:BS|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "tRAM seq of zebrafish: ovary  BS  rep2", "EV02003", "EV02003", "RNA was extracted with Trizol  tRNA isolated by size selection on denaturing polyacrylamide gel  range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment  three prime adapter ligated with T4 RNA ligase 2  reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase  using NEB Next indexed primers.", null, null, "OTHER", "TRANSCRIPTOMIC", "size fractionation", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP482074", null, null, "EV02003.R1.fastq.gz EV02003.R2.fastq.gz", "fastq fastq", 1031891720.0, 3416860.0, "EV02003.R1.fastq.gz", "0:151 1:151", "A:264464363;C:153440613;G:408557241;T:205367487;N:62016", 151, 151, null, null, 264464363, 153440613, 408557241, 205367487, 62016, "SRX23139227", "SRS20090270", "SRA1781872", "Medical University of Vienna|Cell and Developmental Biology", "Medical University of Vienna", 2, 0.0, 0.00019, 0.0, 0.00015, 1.0, 0.99993, null, 1.0, 151, 151, "T", "T", "mates < 9% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2024-01-09", "Adult", "Adult", "Gonad", "Reproductive System"], [29755, "SRR27467688", "SRX23139218", "SRS20090261", "SRP482074", "PRJNA1061456", "tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development", "PRJNA1061456", "Other", null, null, null, null, null, "ovary DM R2", null, "strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:adult|collection date:2022|geo loc name:Austria|sex:female|tissue:ovary|treatment:DM|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "tRAM seq of zebrafish: ovary  DM  rep2", "EV02002", "EV02002", "RNA was extracted with Trizol  tRNA isolated by size selection on denaturing polyacrylamide gel  range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment  three prime adapter ligated with T4 RNA ligase 2  reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase  using NEB Next indexed primers.", null, null, "OTHER", "TRANSCRIPTOMIC", "size fractionation", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP482074", null, null, "EV02002.R1.fastq.gz EV02002.R2.fastq.gz", "fastq fastq", 861320308.0, 2852054.0, "EV02002.R1.fastq.gz", "0:151 1:151", "A:205625519;C:162178974;G:334206312;T:159256900;N:52603", 151, 151, null, null, 205625519, 162178974, 334206312, 159256900, 52603, "SRX23139218", "SRS20090261", "SRA1781872", "Medical University of Vienna|Cell and Developmental Biology", "Medical University of Vienna", 2, 2e-05, 0.00049, 0.0, 0.00027, 1.0, 0.99947, null, 0.44444, 151, 151, "T", "T", "mates < 9% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2024-01-09", "Adult", "Adult", "Gonad", "Reproductive System"], [29756, "SRR27467689", "SRX23139217", "SRS20090260", "SRP482074", "PRJNA1061456", "tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development", "PRJNA1061456", "Other", null, null, null, null, null, "ovary mock R2", null, "strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:adult|collection date:2022|geo loc name:Austria|sex:female|tissue:ovary|treatment:mock|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "tRAM seq of zebrafish: ovary  mock  rep2", "EV02001", "EV02001", "RNA was extracted with Trizol  tRNA isolated by size selection on denaturing polyacrylamide gel  range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment  three prime adapter ligated with T4 RNA ligase 2  reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase  using NEB Next indexed primers.", null, null, "OTHER", "TRANSCRIPTOMIC", "size fractionation", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP482074", null, null, "EV02001.R1.fastq.gz EV02001.R2.fastq.gz", "fastq fastq", 520371066.0, 1723083.0, "EV02001.R1.fastq.gz", "0:151 1:151", "A:116107273;C:90896560;G:218652568;T:94682244;N:32421", 151, 151, null, null, 116107273, 90896560, 218652568, 94682244, 32421, "SRX23139217", "SRS20090260", "SRA1781872", "Medical University of Vienna|Cell and Developmental Biology", "Medical University of Vienna", 2, 2e-05, 0.00086, 0.0, 0.00078, 0.99995, 0.99981, 0.0, 0.61538, 151, 151, "T", "T", "mates < 9% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2024-01-09", "Adult", "Adult", "Gonad", "Reproductive System"], [29765, "SRR27437485", "SRX23109812", "SRS20064566", "SRP482074", "PRJNA1061456", "tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development", "PRJNA1061456", "Other", null, null, null, null, null, "ovary BS R3", null, "strain:TLAB fish|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|dev stage:adult|collection date:2022|geo loc name:Austria|sex:female|tissue:ovary|treatment:BS|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "tRAM seq of zebrafish: ovary  BS  rep3", "EV04017", "EV04017", "RNA was extracted with Trizol  tRNA isolated by size selection on denaturing polyacrylamide gel  range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment  three prime adapter ligated with T4 RNA ligase 2  reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase  using NEB Next indexed primers.", null, null, "OTHER", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP482074", null, null, "EV04017.R1.fastq.gz", "fastq", 576584540.0, 4118461.0, "EV04017.R1.fastq.gz", "0:140", "A:149516980;C:91163801;G:169046762;T:166831111;N:25886", 140, null, null, null, 149516980, 91163801, 169046762, 166831111, 25886, "SRX23109812", "SRS20064566", "SRA1780298", "Medical University of Vienna|Cell and Developmental Biology", "Medical University of Vienna", 1, 0.0, null, 0.0, null, 1.0, null, null, null, 140, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2024-01-06", "Adult", "Adult", "Gonad", "Reproductive System"], [29776, "SRR27437496", "SRX23109801", "SRS20064555", "SRP482074", "PRJNA1061456", "tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development", "PRJNA1061456", "Other", null, null, null, null, null, "ovary DM R3", null, "strain:TLAB fish|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|dev stage:adult|collection date:2022|geo loc name:Austria|sex:female|tissue:ovary|treatment:DM|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "tRAM seq of zebrafish: ovary  DM  rep3", "EV04016", "EV04016", "RNA was extracted with Trizol  tRNA isolated by size selection on denaturing polyacrylamide gel  range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment  three prime adapter ligated with T4 RNA ligase 2  reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase  using NEB Next indexed primers.", null, null, "OTHER", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP482074", null, null, "EV04016.R1.fastq.gz", "fastq", 635752880.0, 4541092.0, "EV04016.R1.fastq.gz", "0:140", "A:160072248;C:143996869;G:189137330;T:142516059;N:30374", 140, null, null, null, 160072248, 143996869, 189137330, 142516059, 30374, "SRX23109801", "SRS20064555", "SRA1780298", "Medical University of Vienna|Cell and Developmental Biology", "Medical University of Vienna", 1, 1e-05, null, 0.0, null, 0.99997, null, 1.0, null, 140, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2024-01-06", "Adult", "Adult", "Gonad", "Reproductive System"], [29777, "SRR27437497", "SRX23109800", "SRS20064554", "SRP482074", "PRJNA1061456", "tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development", "PRJNA1061456", "Other", null, null, null, null, null, "ovary mock R3", null, "strain:TLAB fish|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|dev stage:adult|collection date:2022|geo loc name:Austria|sex:female|tissue:ovary|treatment:mock|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "tRAM seq of zebrafish: ovary  mock  rep3", "EV04015", "EV04015", "RNA was extracted with Trizol  tRNA isolated by size selection on denaturing polyacrylamide gel  range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment  three prime adapter ligated with T4 RNA ligase 2  reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase  using NEB Next indexed primers.", null, null, "OTHER", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP482074", null, null, "EV04015.R1.fastq.gz", "fastq", 489700680.0, 3497862.0, "EV04015.R1.fastq.gz", "0:140", "A:126641754;C:126582886;G:130564204;T:105889815;N:22021", 140, null, null, null, 126641754, 126582886, 130564204, 105889815, 22021, "SRX23109800", "SRS20064554", "SRA1780298", "Medical University of Vienna|Cell and Developmental Biology", "Medical University of Vienna", 1, 6e-05, null, 0.0, null, 0.99983, null, 0.55555, null, 140, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2024-01-06", "Adult", "Adult", "Gonad", "Reproductive System"], [29786, "SRR27435871", "SRX23108225", "SRS20063062", "SRP482074", "PRJNA1061456", "tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development", "PRJNA1061456", "Other", null, null, null, null, null, "ovary BS R4", null, "strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:adult|collection date:2022|geo loc name:Austria|sex:female|tissue:ovary|treatment:BS|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "tRAM seq of zebrafish: ovary  BS  rep4", "EV08003", "EV08003", "RNA was extracted with Trizol  tRNA isolated by size selection on denaturing polyacrylamide gel  range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment  three prime adapter ligated with T4 RNA ligase 2  reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase  using NEB Next indexed primers.", null, null, "OTHER", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP482074", null, null, "EV08003.R1.fastq.gz", "fastq", 571689580.0, 4083497.0, "EV08003.R1.fastq.gz", "0:140", "A:141414131;C:88722455;G:138790445;T:202723075;N:39474", 140, null, null, null, 141414131, 88722455, 138790445, 202723075, 39474, "SRX23108225", "SRS20063062", "SRA1780265", "Medical University of Vienna|Cell and Developmental Biology", "Medical University of Vienna", 1, 3e-05, null, 0.0, null, 0.99991, null, 0.75, null, 140, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2024-01-05", "Adult", "Adult", "Gonad", "Reproductive System"], [29797, "SRR27435882", "SRX23108214", "SRS20063050", "SRP482074", "PRJNA1061456", "tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development", "PRJNA1061456", "Other", null, null, null, null, null, "ovary DM R4", null, "strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:adult|collection date:2022|geo loc name:Austria|sex:female|tissue:ovary|treatment:DM|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "tRAM seq of zebrafish: ovary  DM  rep4", "EV08002", "EV08002", "RNA was extracted with Trizol  tRNA isolated by size selection on denaturing polyacrylamide gel  range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment  three prime adapter ligated with T4 RNA ligase 2  reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase  using NEB Next indexed primers.", null, null, "OTHER", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP482074", null, null, "EV08002.R1.fastq.gz", "fastq", 668593800.0, 4775670.0, "EV08002.R1.fastq.gz", "0:140", "A:164584224;C:175789134;G:175538168;T:152637106;N:45168", 140, null, null, null, 164584224, 175789134, 175538168, 152637106, 45168, "SRX23108214", "SRS20063050", "SRA1780265", "Medical University of Vienna|Cell and Developmental Biology", "Medical University of Vienna", 1, 0.00525, null, 2e-05, null, 0.99192, null, 0.63501, null, 140, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2024-01-05", "Adult", "Adult", "Gonad", "Reproductive System"], [29798, "SRR27435883", "SRX23108213", "SRS20063051", "SRP482074", "PRJNA1061456", "tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development", "PRJNA1061456", "Other", null, null, null, null, null, "ovary mock R4", null, "strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:adult|collection date:2022|geo loc name:Austria|sex:female|tissue:ovary|treatment:mock|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "tRAM seq of zebrafish: ovary  mock  rep4", "EV08001", "EV08001", "RNA was extracted with Trizol  tRNA isolated by size selection on denaturing polyacrylamide gel  range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment  three prime adapter ligated with T4 RNA ligase 2  reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase  using NEB Next indexed primers.", null, null, "OTHER", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP482074", null, null, "EV08001.R1.fastq.gz", "fastq", 753247460.0, 5380339.0, "EV08001.R1.fastq.gz", "0:140", "A:183862675;C:196453674;G:197604061;T:175275086;N:51964", 140, null, null, null, 183862675, 196453674, 197604061, 175275086, 51964, "SRX23108213", "SRS20063051", "SRA1780265", "Medical University of Vienna|Cell and Developmental Biology", "Medical University of Vienna", 1, 0.00754, null, 4e-05, null, 0.98957, null, 0.51048, null, 140, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2024-01-05", "Adult", "Adult", "Gonad", "Reproductive System"], [36273, "SRR298566", "SRX079844", "SRS212650", "SRP007331", "PRJNA141525", "Tdrd1 acts as a molecular scaffold for Piwi proteins and piRNA targets in zebrafish.", "GSE29418", "Transcriptome Analysis", "RNA libraries from immunoprecipitates of Tdrd1  Ziwi and Zili  total testis RNA  total RNA from 3 wpf wild type and tdrd1 mutant gonads. Overall design: Both size selected and non size selected libraries were made. Sequencing was performed using Illumina platform.", null, "pubmed:21743441", null, "WTTESTIS", "GSM727523", null, "tissue:adult testis extract|strain:TL", "WTTESTIS", "three prime adapter sequences were trimmed and inserts longer than 18 nt were mapped to the D. rerio genome Zv9.", "adult testis extract", null, "Tissue was homogenized in trizol and total RNA was isolated. RNAs ranging from 18 35 nucleotides were size selected from gel. For cDNA synthesis  the RNA molecules in the immunoprecipitated fraction were first poly A tailed using polyApolymerase followed by ligation of synthetic RNA adapter to the five prime phosphate. First strand cDNA synthesis was then performed using an oligodT linker primer and M MLVRNase H  reverse transcriptase. cDNA was PCR amplified with adapter specific primers and used in Illumina sequencing.", null, "strain:TL", "GSM727523", "GSM727523: WTTESTIS", "GSM727523: WTTESTIS", "GSM727523: WTTESTIS", "1", null, "GEO Accession:GSM727523", "RNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer II", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP007331", null, "read name barcode proc directive:ignore", "WTTESTIS.fastq", "fastq", 732997980.0, 20361055.0, "GSM727523 1", "0:36", null, 36, null, null, null, null, null, null, null, null, "SRX079844", "SRS212650", "SRA039167", "GEO", "European Research Institute for the Biology of Ageing, University Medical Center Groningen", 1, 0.08155, null, 0.07176, null, 0.97851, null, 0.52359, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2011-05-20", "Adult", "Adult", "Gonad", "Reproductive System"], [36274, "SRR298565", "SRX079843", "SRS212649", "SRP007331", "PRJNA141525", "Tdrd1 acts as a molecular scaffold for Piwi proteins and piRNA targets in zebrafish.", "GSE29418", "Transcriptome Analysis", "RNA libraries from immunoprecipitates of Tdrd1  Ziwi and Zili  total testis RNA  total RNA from 3 wpf wild type and tdrd1 mutant gonads. Overall design: Both size selected and non size selected libraries were made. Sequencing was performed using Illumina platform.", null, "pubmed:21743441", null, "WT3WK", "GSM727522", null, "tissue:3 wpf whole gonads|strain:TL", "WT3WK", "three prime adapter sequences were trimmed and inserts longer than 18 nt were mapped to the D. rerio genome Zv9.", "3 wpf whole gonads", null, "Tissue was homogenized in trizol and total RNA was isolated. RNAs ranging from 18 35 nucleotides were size selected from gel. For cDNA synthesis  the RNA molecules in the immunoprecipitated fraction were first poly A tailed using polyApolymerase followed by ligation of synthetic RNA adapter to the five prime phosphate. First strand cDNA synthesis was then performed using an oligodT linker primer and M MLVRNase H  reverse transcriptase. cDNA was PCR amplified with adapter specific primers and used in Illumina sequencing.", null, "strain:TL", "GSM727522", "GSM727522: WT3WK", "GSM727522: WT3WK", "GSM727522: WT3WK", "1", null, "GEO Accession:GSM727522", "RNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer II", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP007331", null, "read name barcode proc directive:ignore", "WT3WK.fastq", "fastq", 365473116.0, 10152031.0, "GSM727522 1", "0:36", null, 36, null, null, null, null, null, null, null, null, "SRX079843", "SRS212649", "SRA039167", "GEO", "European Research Institute for the Biology of Ageing, University Medical Center Groningen", 1, 0.09055, null, 0.0603, null, 0.97798, null, 0.44571, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2011-05-20", "Larval", "Larval", "Gonad", "Reproductive System"], [36275, "SRR298564", "SRX079842", "SRS212648", "SRP007331", "PRJNA141525", "Tdrd1 acts as a molecular scaffold for Piwi proteins and piRNA targets in zebrafish.", "GSE29418", "Transcriptome Analysis", "RNA libraries from immunoprecipitates of Tdrd1  Ziwi and Zili  total testis RNA  total RNA from 3 wpf wild type and tdrd1 mutant gonads. Overall design: Both size selected and non size selected libraries were made. Sequencing was performed using Illumina platform.", null, "pubmed:21743441", null, "TDRD1WK3", "GSM727521", null, "tissue:3 wpf tdrd1 mutant gonads|strain:TL", "TDRD1WK3", "three prime adapter sequences were trimmed and inserts longer than 18 nt were mapped to the D. rerio genome Zv9.", "3 wpf tdrd1 mutant gonads", null, "Tissue was homogenized in trizol and total RNA was isolated. RNAs ranging from 18 35 nucleotides were size selected from gel. For cDNA synthesis  the RNA molecules in the immunoprecipitated fraction were first poly A tailed using polyApolymerase followed by ligation of synthetic RNA adapter to the five prime phosphate. First strand cDNA synthesis was then performed using an oligodT linker primer and M MLVRNase H  reverse transcriptase. cDNA was PCR amplified with adapter specific primers and used in Illumina sequencing.", null, "strain:TL", "GSM727521", "GSM727521: TDRD1WK3", "GSM727521: TDRD1WK3", "GSM727521: TDRD1WK3", "1", null, "GEO Accession:GSM727521", "RNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer II", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP007331", null, "read name barcode proc directive:ignore", "TDRD1WK3.fastq", "fastq", 369931536.0, 10275876.0, "GSM727521 1", "0:36", null, 36, null, null, null, null, null, null, null, null, "SRX079842", "SRS212648", "SRA039167", "GEO", "European Research Institute for the Biology of Ageing, University Medical Center Groningen", 1, 0.08303, null, 0.04674, null, 0.97938, null, 0.35673, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2011-05-20", "Larval", "Larval", "Gonad", "Reproductive System"], [36514, "SRR578923", "SRX190981", "SRS366702", "SRP015982", "PRJNA176481", "Small RNA analysis of Tu And SJD zebrafish strain and their progeny", "GSE41299", "Transcriptome Analysis", "Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled .", null, "pubmed:23335638", null, "SJD male", "GSM1014087", null, "source name:Testes|sex:male|strain:SJD|development stage:Adult|tissue:Testes", "SJD male", "Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads  except for libraries Tu Male  Tu P0  SJD Male  SJD P0  SJDxTuF1  TuxSJDF1  TuxSJDF2 and SJDxTuF2  which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts", "Testes", null, "Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps.", "Animals were grown under standard conditioni", "gender:male|strain:SJD|developmental stage:Adult|tissue:Testes", "GSM1014087", "GSM1014087: SJD male; Danio rerio; RNA Seq", "GSM1014087 1", null, "1", null, "GEO Accession:GSM1014087", "RNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer IIx", null, "SRP015982", null, null, "SJD_Male.fastq", "fastq", 869956128.0, 24165448.0, "GSM1014087 r1", "0:36", "A:216078167;C:187750746;G:231408128;T:234642875;N:76212", 36, null, null, null, 216078167, 187750746, 231408128, 234642875, 76212, "SRX190981", "SRS366702", "SRA059229", "GEO", "European Research Institute for the Biology of Ageing, University Medical Center Groningen", 1, 0.27444, null, 0.19385, null, 0.92478, null, 0.49214, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2012-10-03", "Adult", "Adult", "Gonad", "Reproductive System"], [36515, "SRR578922", "SRX190980", "SRS366701", "SRP015982", "PRJNA176481", "Small RNA analysis of Tu And SJD zebrafish strain and their progeny", "GSE41299", "Transcriptome Analysis", "Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled .", null, "pubmed:23335638", null, "Tu Male", "GSM1014086", null, "source name:Testes|sex:male|strain:Tu|development stage:Adult|tissue:Testes", "Tu Male", "Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads  except for libraries Tu Male  Tu P0  SJD Male  SJD P0  SJDxTuF1  TuxSJDF1  TuxSJDF2 and SJDxTuF2  which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts", "Testes", null, "Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps.", "Animals were grown under standard conditioni", "gender:male|strain:Tu|developmental stage:Adult|tissue:Testes", "GSM1014086", "GSM1014086: Tu Male; Danio rerio; RNA Seq", "GSM1014086 1", null, "1", null, "GEO Accession:GSM1014086", "RNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer IIx", null, "SRP015982", null, null, null, null, 908421696.0, 25233936.0, "GSM1014086 r1", "0:36", "A:222765185;C:198165182;G:240641436;T:246807325;N:42568", 36, null, null, null, 222765185, 198165182, 240641436, 246807325, 42568, "SRX190980", "SRS366701", "SRA059229", "GEO", "European Research Institute for the Biology of Ageing, University Medical Center Groningen", 1, 0.1451, null, 0.10199, null, 0.95128, null, 0.45517, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2012-10-03", "Adult", "Adult", "Gonad", "Reproductive System"], [36516, "SRR578921", "SRX190979", "SRS366700", "SRP015982", "PRJNA176481", "Small RNA analysis of Tu And SJD zebrafish strain and their progeny", "GSE41299", "Transcriptome Analysis", "Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled .", null, "pubmed:23335638", null, "TuxSJDF2 Individual 2", "GSM1014085", null, "source name:Ovary|sex:female|strain:Hybrid SJD and Tu|development stage:Adult|tissue:Ovary", "TuxSJDF2 Individual 2", "Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads  except for libraries Tu Male  Tu P0  SJD Male  SJD P0  SJDxTuF1  TuxSJDF1  TuxSJDF2 and SJDxTuF2  which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts", "Ovary", null, "Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps.", "Animals were grown under standard conditioni", "gender:female|strain:Hybrid SJD and Tu|developmental stage:Adult|tissue:Ovary", "GSM1014085", "GSM1014085: TuxSJDF2 Individual 2; Danio rerio; RNA Seq", "GSM1014085 1", null, "1", null, "GEO Accession:GSM1014085", "RNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer IIx", null, "SRP015982", null, null, null, null, 383509188.0, 10653033.0, "GSM1014085 r1", "0:36", "A:105355133;C:85084746;G:89408418;T:103592177;N:68714", 36, null, null, null, 105355133, 85084746, 89408418, 103592177, 68714, "SRX190979", "SRS366700", "SRA059229", "GEO", "European Research Institute for the Biology of Ageing, University Medical Center Groningen", 1, 0.14582, null, 0.10997, null, 0.96175, null, 0.35151, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2012-10-03", "Adult", "Adult", "Gonad", "Reproductive System"], [36517, "SRR578920", "SRX190978", "SRS366699", "SRP015982", "PRJNA176481", "Small RNA analysis of Tu And SJD zebrafish strain and their progeny", "GSE41299", "Transcriptome Analysis", "Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled .", null, "pubmed:23335638", null, "TuxSJDF2 Individual 1", "GSM1014084", null, "source name:Ovary|sex:female|strain:Hybrid SJD and Tu|development stage:Adult|tissue:Ovary", "TuxSJDF2 Individual 1", "Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads  except for libraries Tu Male  Tu P0  SJD Male  SJD P0  SJDxTuF1  TuxSJDF1  TuxSJDF2 and SJDxTuF2  which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts", "Ovary", null, "Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps.", "Animals were grown under standard conditioni", "gender:female|strain:Hybrid SJD and Tu|developmental stage:Adult|tissue:Ovary", "GSM1014084", "GSM1014084: TuxSJDF2 Individual 1; Danio rerio; RNA Seq", "GSM1014084 1", null, "1", null, "GEO Accession:GSM1014084", "RNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer IIx", null, "SRP015982", null, null, "TuxSJDF1_Individual_1.fastq", "fastq", 464899752.0, 12913882.0, "GSM1014084 r1", "0:36", "A:140830427;C:93401413;G:113254459;T:117332119;N:81334", 36, null, null, null, 140830427, 93401413, 113254459, 117332119, 81334, "SRX190978", "SRS366699", "SRA059229", "GEO", "European Research Institute for the Biology of Ageing, University Medical Center Groningen", 1, 0.43194, null, 0.32, null, 0.93154, null, 0.3438, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2012-10-03", "Adult", "Adult", "Gonad", "Reproductive System"], [36518, "SRR578919", "SRX190977", "SRS366698", "SRP015982", "PRJNA176481", "Small RNA analysis of Tu And SJD zebrafish strain and their progeny", "GSE41299", "Transcriptome Analysis", "Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled .", null, "pubmed:23335638", null, "TuxSJDF2", "GSM1014083", null, "source name:Ovary|sex:female|strain:Hybrid SJD and Tu|development stage:Adult|tissue:Ovary", "TuxSJDF2", "Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads  except for libraries Tu Male  Tu P0  SJD Male  SJD P0  SJDxTuF1  TuxSJDF1  TuxSJDF2 and SJDxTuF2  which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts", "Ovary", null, "Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps.", "Animals were grown under standard conditioni", "gender:female|strain:Hybrid SJD and Tu|developmental stage:Adult|tissue:Ovary", "GSM1014083", "GSM1014083: TuxSJDF2; Danio rerio; RNA Seq", "GSM1014083 1", null, "1", null, "GEO Accession:GSM1014083", "RNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer IIx", null, "SRP015982", null, null, "TuxSJDF2.fastq", "fastq", 1036162620.0, 28782295.0, "GSM1014083 r1", "0:36", "A:268457303;C:215700792;G:273583173;T:278046713;N:374639", 36, null, null, null, 268457303, 215700792, 273583173, 278046713, 374639, "SRX190977", "SRS366698", "SRA059229", "GEO", "European Research Institute for the Biology of Ageing, University Medical Center Groningen", 1, 0.16399, null, 0.12914, null, 0.9517, null, 0.52232, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2012-10-03", "Adult", "Adult", "Gonad", "Reproductive System"], [36519, "SRR578918", "SRX190976", "SRS366697", "SRP015982", "PRJNA176481", "Small RNA analysis of Tu And SJD zebrafish strain and their progeny", "GSE41299", "Transcriptome Analysis", "Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled .", null, "pubmed:23335638", null, "TuxSJDF1 Individual 2", "GSM1014082", null, "source name:Ovary|sex:female|strain:Hybrid SJD and Tu|development stage:Adult|tissue:Ovary", "TuxSJDF1 Individual 2", "Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads  except for libraries Tu Male  Tu P0  SJD Male  SJD P0  SJDxTuF1  TuxSJDF1  TuxSJDF2 and SJDxTuF2  which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts", "Ovary", null, "Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps.", "Animals were grown under standard conditioni", "gender:female|strain:Hybrid SJD and Tu|developmental stage:Adult|tissue:Ovary", "GSM1014082", "GSM1014082: TuxSJDF1 Individual 2; Danio rerio; RNA Seq", "GSM1014082 1", null, "1", null, "GEO Accession:GSM1014082", "RNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer IIx", null, "SRP015982", null, null, null, null, 344764980.0, 9576805.0, "GSM1014082 r1", "0:36", "A:90252809;C:80943703;G:83338280;T:90171695;N:58493", 36, null, null, null, 90252809, 80943703, 83338280, 90171695, 58493, "SRX190976", "SRS366697", "SRA059229", "GEO", "European Research Institute for the Biology of Ageing, University Medical Center Groningen", 1, 0.18861, null, 0.14536, null, 0.95335, null, 0.54431, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2012-10-03", "Adult", "Adult", "Gonad", "Reproductive System"], [36520, "SRR578917", "SRX190975", "SRS366696", "SRP015982", "PRJNA176481", "Small RNA analysis of Tu And SJD zebrafish strain and their progeny", "GSE41299", "Transcriptome Analysis", "Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled .", null, "pubmed:23335638", null, "TuxSJDF1 Individual 1", "GSM1014081", null, "source name:Ovary|sex:female|strain:Hybrid SJD and Tu|development stage:Adult|tissue:Ovary", "TuxSJDF1 Individual 1", "Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads  except for libraries Tu Male  Tu P0  SJD Male  SJD P0  SJDxTuF1  TuxSJDF1  TuxSJDF2 and SJDxTuF2  which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts", "Ovary", null, "Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps.", "Animals were grown under standard conditioni", "gender:female|strain:Hybrid SJD and Tu|developmental stage:Adult|tissue:Ovary", "GSM1014081", "GSM1014081: TuxSJDF1 Individual 1; Danio rerio; RNA Seq", "GSM1014081 1", null, "1", null, "GEO Accession:GSM1014081", "RNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer IIx", null, "SRP015982", null, null, "TuxSJDF2_Individual_1.fastq", "fastq", 373504320.0, 10375120.0, "GSM1014081 r1", "0:36", "A:96550943;C:89937876;G:87356943;T:99426239;N:232319", 36, null, null, null, 96550943, 89937876, 87356943, 99426239, 232319, "SRX190975", "SRS366696", "SRA059229", "GEO", "European Research Institute for the Biology of Ageing, University Medical Center Groningen", 1, 0.15362, null, 0.12272, null, 0.95943, null, 0.56453, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2012-10-03", "Adult", "Adult", "Gonad", "Reproductive System"], [36521, "SRR578916", "SRX190974", "SRS366695", "SRP015982", "PRJNA176481", "Small RNA analysis of Tu And SJD zebrafish strain and their progeny", "GSE41299", "Transcriptome Analysis", "Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled .", null, "pubmed:23335638", null, "TuxSJDF1", "GSM1014080", null, "source name:Ovary|sex:female|strain:Hybrid SJD and Tu|development stage:Adult|tissue:Ovary", "TuxSJDF1", "Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads  except for libraries Tu Male  Tu P0  SJD Male  SJD P0  SJDxTuF1  TuxSJDF1  TuxSJDF2 and SJDxTuF2  which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts", "Ovary", null, "Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps.", "Animals were grown under standard conditioni", "gender:female|strain:Hybrid SJD and Tu|developmental stage:Adult|tissue:Ovary", "GSM1014080", "GSM1014080: TuxSJDF1; Danio rerio; RNA Seq", "GSM1014080 1", null, "1", null, "GEO Accession:GSM1014080", "RNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer IIx", null, "SRP015982", null, null, "TuxSJDF1.fastq", "fastq", 1031108904.0, 28641914.0, "GSM1014080 r1", "0:36", "A:270773113;C:213123466;G:267237418;T:279702377;N:272530", 36, null, null, null, 270773113, 213123466, 267237418, 279702377, 272530, "SRX190974", "SRS366695", "SRA059229", "GEO", "European Research Institute for the Biology of Ageing, University Medical Center Groningen", 1, 0.15469, null, 0.12537, null, 0.95457, null, 0.48819, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2012-10-03", "Adult", "Adult", "Gonad", "Reproductive System"], [36522, "SRR578915", "SRX190973", "SRS366694", "SRP015982", "PRJNA176481", "Small RNA analysis of Tu And SJD zebrafish strain and their progeny", "GSE41299", "Transcriptome Analysis", "Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled .", null, "pubmed:23335638", null, "Tu P0 Individual 2", "GSM1014079", null, "source name:Ovary|sex:female|strain:Tu|development stage:Adult|tissue:Ovary", "Tu P0 Individual 2", "Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads  except for libraries Tu Male  Tu P0  SJD Male  SJD P0  SJDxTuF1  TuxSJDF1  TuxSJDF2 and SJDxTuF2  which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts", "Ovary", null, "Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps.", "Animals were grown under standard conditioni", "gender:female|strain:Tu|developmental stage:Adult|tissue:Ovary", "GSM1014079", "GSM1014079: Tu P0 Individual 2; Danio rerio; RNA Seq", "GSM1014079 1", null, "1", null, "GEO Accession:GSM1014079", "RNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer IIx", null, "SRP015982", null, null, null, null, 464586408.0, 12905178.0, "GSM1014079 r1", "0:36", "A:150621423;C:99131637;G:92380585;T:122374816;N:77947", 36, null, null, null, 150621423, 99131637, 92380585, 122374816, 77947, "SRX190973", "SRS366694", "SRA059229", "GEO", "European Research Institute for the Biology of Ageing, University Medical Center Groningen", 1, 0.0937, null, 0.05289, null, 0.96546, null, 0.60026, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2012-10-03", "Adult", "Adult", "Gonad", "Reproductive System"], [36523, "SRR578914", "SRX190972", "SRS366693", "SRP015982", "PRJNA176481", "Small RNA analysis of Tu And SJD zebrafish strain and their progeny", "GSE41299", "Transcriptome Analysis", "Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled .", null, "pubmed:23335638", null, "Tu P0 Individual 1", "GSM1014078", null, "source name:Ovary|sex:female|strain:Tu|development stage:Adult|tissue:Ovary", "Tu P0 Individual 1", "Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads  except for libraries Tu Male  Tu P0  SJD Male  SJD P0  SJDxTuF1  TuxSJDF1  TuxSJDF2 and SJDxTuF2  which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts", "Ovary", null, "Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps.", "Animals were grown under standard conditioni", "gender:female|strain:Tu|developmental stage:Adult|tissue:Ovary", "GSM1014078", "GSM1014078: Tu P0 Individual 1; Danio rerio; RNA Seq", "GSM1014078 1", null, "1", null, "GEO Accession:GSM1014078", "RNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer IIx", null, "SRP015982", null, null, null, null, 427172796.0, 11865911.0, "GSM1014078 r1", "0:36", "A:135500495;C:91385480;G:87823245;T:112202150;N:261426", 36, null, null, null, 135500495, 91385480, 87823245, 112202150, 261426, "SRX190972", "SRS366693", "SRA059229", "GEO", "European Research Institute for the Biology of Ageing, University Medical Center Groningen", 1, 0.1368, null, 0.09652, null, 0.95142, null, 0.49555, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2012-10-03", "Adult", "Adult", "Gonad", "Reproductive System"], [36524, "SRR578913", "SRX190971", "SRS366692", "SRP015982", "PRJNA176481", "Small RNA analysis of Tu And SJD zebrafish strain and their progeny", "GSE41299", "Transcriptome Analysis", "Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled .", null, "pubmed:23335638", null, "Tu P0", "GSM1014077", null, "source name:Ovary|sex:female|strain:Tu|development stage:Adult|tissue:Ovary", "Tu P0", "Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads  except for libraries Tu Male  Tu P0  SJD Male  SJD P0  SJDxTuF1  TuxSJDF1  TuxSJDF2 and SJDxTuF2  which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts", "Ovary", null, "Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps.", "Animals were grown under standard conditioni", "gender:female|strain:Tu|developmental stage:Adult|tissue:Ovary", "GSM1014077", "GSM1014077: Tu P0; Danio rerio; RNA Seq", "GSM1014077 1", null, "1", null, "GEO Accession:GSM1014077", "RNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer IIx", null, "SRP015982", null, null, null, null, 967772772.0, 26882577.0, "GSM1014077 r1", "0:36", "A:227085973;C:218180545;G:249458631;T:273002038;N:45585", 36, null, null, null, 227085973, 218180545, 249458631, 273002038, 45585, "SRX190971", "SRS366692", "SRA059229", "GEO", "European Research Institute for the Biology of Ageing, University Medical Center Groningen", 1, 0.14418, null, 0.1135, null, 0.95818, null, 0.51074, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2012-10-03", "Adult", "Adult", "Gonad", "Reproductive System"], [36525, "SRR578912", "SRX190970", "SRS366691", "SRP015982", "PRJNA176481", "Small RNA analysis of Tu And SJD zebrafish strain and their progeny", "GSE41299", "Transcriptome Analysis", "Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled .", null, "pubmed:23335638", null, "SJDxTuF2 Individual 2", "GSM1014076", null, "source name:Ovary|sex:female|strain:Hybrid SJD and Tu|development stage:Adult|tissue:Ovary", "SJDxTuF2 Individual 2", "Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads  except for libraries Tu Male  Tu P0  SJD Male  SJD P0  SJDxTuF1  TuxSJDF1  TuxSJDF2 and SJDxTuF2  which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts", "Ovary", null, "Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps.", "Animals were grown under standard conditioni", "gender:female|strain:Hybrid SJD and Tu|developmental stage:Adult|tissue:Ovary", "GSM1014076", "GSM1014076: SJDxTuF2 Individual 2; Danio rerio; RNA Seq", "GSM1014076 1", null, "1", null, "GEO Accession:GSM1014076", "RNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer IIx", null, "SRP015982", null, null, null, null, 347475024.0, 9652084.0, "GSM1014076 r1", "0:36", "A:91189258;C:81789488;G:84551251;T:89882775;N:62252", 36, null, null, null, 91189258, 81789488, 84551251, 89882775, 62252, "SRX190970", "SRS366691", "SRA059229", "GEO", "European Research Institute for the Biology of Ageing, University Medical Center Groningen", 1, 0.15872, null, 0.12439, null, 0.95848, null, 0.56717, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2012-10-03", "Adult", "Adult", "Gonad", "Reproductive System"], [36526, "SRR578911", "SRX190969", "SRS366690", "SRP015982", "PRJNA176481", "Small RNA analysis of Tu And SJD zebrafish strain and their progeny", "GSE41299", "Transcriptome Analysis", "Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled .", null, "pubmed:23335638", null, "SJDxTuF2 Individual 1", "GSM1014075", null, "source name:Ovary|sex:female|strain:Hybrid SJD and Tu|development stage:Adult|tissue:Ovary", "SJDxTuF2 Individual 1", "Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads  except for libraries Tu Male  Tu P0  SJD Male  SJD P0  SJDxTuF1  TuxSJDF1  TuxSJDF2 and SJDxTuF2  which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts", "Ovary", null, "Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps.", "Animals were grown under standard conditioni", "gender:female|strain:Hybrid SJD and Tu|developmental stage:Adult|tissue:Ovary", "GSM1014075", "GSM1014075: SJDxTuF2 Individual 1; Danio rerio; RNA Seq", "GSM1014075 1", null, "1", null, "GEO Accession:GSM1014075", "RNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer IIx", null, "SRP015982", null, null, null, null, 400137228.0, 11114923.0, "GSM1014075 r1", "0:36", "A:107143937;C:91495000;G:94706504;T:106722021;N:69766", 36, null, null, null, 107143937, 91495000, 94706504, 106722021, 69766, "SRX190969", "SRS366690", "SRA059229", "GEO", "European Research Institute for the Biology of Ageing, University Medical Center Groningen", 1, 0.15753, null, 0.12463, null, 0.95538, null, 0.5649, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2012-10-03", "Adult", "Adult", "Gonad", "Reproductive System"], [36527, "SRR578910", "SRX190968", "SRS366689", "SRP015982", "PRJNA176481", "Small RNA analysis of Tu And SJD zebrafish strain and their progeny", "GSE41299", "Transcriptome Analysis", "Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled .", null, "pubmed:23335638", null, "SJDxTuF2", "GSM1014074", null, "source name:Ovary|sex:female|strain:Hybrid SJD and Tu|development stage:Adult|tissue:Ovary", "SJDxTuF2", "Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads  except for libraries Tu Male  Tu P0  SJD Male  SJD P0  SJDxTuF1  TuxSJDF1  TuxSJDF2 and SJDxTuF2  which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts", "Ovary", null, "Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps.", "Animals were grown under standard conditioni", "gender:female|strain:Hybrid SJD and Tu|developmental stage:Adult|tissue:Ovary", "GSM1014074", "GSM1014074: SJDxTuF2; Danio rerio; RNA Seq", "GSM1014074 1", null, "1", null, "GEO Accession:GSM1014074", "RNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer IIx", null, "SRP015982", null, null, "SJDxTuF2.fastq", "fastq", 958492116.0, 26624781.0, "GSM1014074 r1", "0:36", "A:261275440;C:193944805;G:248348765;T:254793050;N:130056", 36, null, null, null, 261275440, 193944805, 248348765, 254793050, 130056, "SRX190968", "SRS366689", "SRA059229", "GEO", "European Research Institute for the Biology of Ageing, University Medical Center Groningen", 1, 0.20051, null, 0.16387, null, 0.94653, null, 0.53263, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2012-10-03", "Adult", "Adult", "Gonad", "Reproductive System"], [36528, "SRR578909", "SRX190967", "SRS366688", "SRP015982", "PRJNA176481", "Small RNA analysis of Tu And SJD zebrafish strain and their progeny", "GSE41299", "Transcriptome Analysis", "Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled .", null, "pubmed:23335638", null, "SJDxTuF1 Individual 2", "GSM1014073", null, "source name:Ovary|sex:female|strain:Hybrid SJD and Tu|development stage:Adult|tissue:Ovary", "SJDxTuF1 Individual 2", "Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads  except for libraries Tu Male  Tu P0  SJD Male  SJD P0  SJDxTuF1  TuxSJDF1  TuxSJDF2 and SJDxTuF2  which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts", "Ovary", null, "Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps.", "Animals were grown under standard conditioni", "gender:female|strain:Hybrid SJD and Tu|developmental stage:Adult|tissue:Ovary", "GSM1014073", "GSM1014073: SJDxTuF1 Individual 2; Danio rerio; RNA Seq", "GSM1014073 1", null, "1", null, "GEO Accession:GSM1014073", "RNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer IIx", null, "SRP015982", null, null, null, null, 435761532.0, 12104487.0, "GSM1014073 r1", "0:36", "A:120580697;C:105605593;G:91379055;T:117787426;N:408761", 36, null, null, null, 120580697, 105605593, 91379055, 117787426, 408761, "SRX190967", "SRS366688", "SRA059229", "GEO", "European Research Institute for the Biology of Ageing, University Medical Center Groningen", 1, 0.07215, null, 0.05695, null, 0.97557, null, 0.48838, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2012-10-03", "Adult", "Adult", "Gonad", "Reproductive System"], [36529, "SRR578908", "SRX190966", "SRS366687", "SRP015982", "PRJNA176481", "Small RNA analysis of Tu And SJD zebrafish strain and their progeny", "GSE41299", "Transcriptome Analysis", "Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled .", null, "pubmed:23335638", null, "SJDxTuF1 Individual 1", "GSM1014072", null, "source name:Ovary|sex:female|strain:Hybrid SJD and Tu|development stage:Adult|tissue:Ovary", "SJDxTuF1 Individual 1", "Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads  except for libraries Tu Male  Tu P0  SJD Male  SJD P0  SJDxTuF1  TuxSJDF1  TuxSJDF2 and SJDxTuF2  which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts", "Ovary", null, "Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps.", "Animals were grown under standard conditioni", "gender:female|strain:Hybrid SJD and Tu|developmental stage:Adult|tissue:Ovary", "GSM1014072", "GSM1014072: SJDxTuF1 Individual 1; Danio rerio; RNA Seq", "GSM1014072 1", null, "1", null, "GEO Accession:GSM1014072", "RNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer IIx", null, "SRP015982", null, null, null, null, 378296532.0, 10508237.0, "GSM1014072 r1", "0:36", "A:109216358;C:76585213;G:90165899;T:102085771;N:243291", 36, null, null, null, 109216358, 76585213, 90165899, 102085771, 243291, "SRX190966", "SRS366687", "SRA059229", "GEO", "European Research Institute for the Biology of Ageing, University Medical Center Groningen", 1, 0.13684, null, 0.10794, null, 0.96335, null, 0.49651, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2012-10-03", "Adult", "Adult", "Gonad", "Reproductive System"], [36530, "SRR578907", "SRX190965", "SRS366686", "SRP015982", "PRJNA176481", "Small RNA analysis of Tu And SJD zebrafish strain and their progeny", "GSE41299", "Transcriptome Analysis", "Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled .", null, "pubmed:23335638", null, "SJDxTuF1", "GSM1014071", null, "source name:Ovary|sex:female|strain:Hybrid SJD and Tu|development stage:Adult|tissue:Ovary", "SJDxTuF1", "Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads  except for libraries Tu Male  Tu P0  SJD Male  SJD P0  SJDxTuF1  TuxSJDF1  TuxSJDF2 and SJDxTuF2  which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts", "Ovary", null, "Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps.", "Animals were grown under standard conditioni", "gender:female|strain:Hybrid SJD and Tu|developmental stage:Adult|tissue:Ovary", "GSM1014071", "GSM1014071: SJDxTuF1; Danio rerio; RNA Seq", "GSM1014071 1", null, "1", null, "GEO Accession:GSM1014071", "RNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer IIx", null, "SRP015982", null, null, null, null, 1047688380.0, 29102455.0, "GSM1014071 r1", "0:36", "A:277032474;C:213232299;G:269309034;T:288068877;N:45696", 36, null, null, null, 277032474, 213232299, 269309034, 288068877, 45696, "SRX190965", "SRS366686", "SRA059229", "GEO", "European Research Institute for the Biology of Ageing, University Medical Center Groningen", 1, 0.1858, null, 0.15153, null, 0.95006, null, 0.51345, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2012-10-03", "Adult", "Adult", "Gonad", "Reproductive System"], [36531, "SRR578906", "SRX190964", "SRS366685", "SRP015982", "PRJNA176481", "Small RNA analysis of Tu And SJD zebrafish strain and their progeny", "GSE41299", "Transcriptome Analysis", "Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled .", null, "pubmed:23335638", null, "SJD P0 Individual 2", "GSM1014070", null, "source name:Ovary|sex:female|strain:SJD|development stage:Adult|tissue:Ovary", "SJD P0 Individual 2", "Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads  except for libraries Tu Male  Tu P0  SJD Male  SJD P0  SJDxTuF1  TuxSJDF1  TuxSJDF2 and SJDxTuF2  which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts", "Ovary", null, "Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps.", "Animals were grown under standard conditioni", "gender:female|strain:SJD|developmental stage:Adult|tissue:Ovary", "GSM1014070", "GSM1014070: SJD P0 Individual 2; Danio rerio; RNA Seq", "GSM1014070 1", null, "1", null, "GEO Accession:GSM1014070", "RNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer IIx", null, "SRP015982", null, null, "SJD_P0_Individual_2.fastq", "fastq", 392951772.0, 10915327.0, "GSM1014070 r1", "0:36", "A:126709476;C:82393458;G:82997127;T:100597122;N:254589", 36, null, null, null, 126709476, 82393458, 82997127, 100597122, 254589, "SRX190964", "SRS366685", "SRA059229", "GEO", "European Research Institute for the Biology of Ageing, University Medical Center Groningen", 1, 0.12786, null, 0.10199, null, 0.95724, null, 0.52026, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2012-10-03", "Adult", "Adult", "Gonad", "Reproductive System"], [36532, "SRR578905", "SRX190963", "SRS366684", "SRP015982", "PRJNA176481", "Small RNA analysis of Tu And SJD zebrafish strain and their progeny", "GSE41299", "Transcriptome Analysis", "Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled .", null, "pubmed:23335638", null, "SJD P0 Individual 1", "GSM1014069", null, "source name:Ovary|sex:female|strain:SJD|development stage:Adult|tissue:Ovary", "SJD P0 Individual 1", "Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads  except for libraries Tu Male  Tu P0  SJD Male  SJD P0  SJDxTuF1  TuxSJDF1  TuxSJDF2 and SJDxTuF2  which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts", "Ovary", null, "Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps.", "Animals were grown under standard conditioni", "gender:female|strain:SJD|developmental stage:Adult|tissue:Ovary", "GSM1014069", "GSM1014069: SJD P0 Individual 1; Danio rerio; RNA Seq", "GSM1014069 1", null, "1", null, "GEO Accession:GSM1014069", "RNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer IIx", null, "SRP015982", null, null, "SJD_P0_Individual_1.fastq", "fastq", 379882512.0, 10552292.0, "GSM1014069 r1", "0:36", "A:122444116;C:80302064;G:76948943;T:99839311;N:348078", 36, null, null, null, 122444116, 80302064, 76948943, 99839311, 348078, "SRX190963", "SRS366684", "SRA059229", "GEO", "European Research Institute for the Biology of Ageing, University Medical Center Groningen", 1, 0.21364, null, 0.16206, null, 0.94268, null, 0.45306, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2012-10-03", "Adult", "Adult", "Gonad", "Reproductive System"], [36533, "SRR578904", "SRX190962", "SRS366683", "SRP015982", "PRJNA176481", "Small RNA analysis of Tu And SJD zebrafish strain and their progeny", "GSE41299", "Transcriptome Analysis", "Small RNA libraries from total RNA isolated from adult ovaries Overall design: Small RNA libraries were derived from Ovaries of the Founder strain and their offspring and their reciprocal offspring. RNA from 5 individual ovaries was pooled .", null, "pubmed:23335638", null, "SJD P0", "GSM1014068", null, "source name:Ovary|sex:female|strain:SJD|development stage:Adult|tissue:Ovary", "SJD P0", "Barcode splitting and adapter trimming performed using custom scripts. Barcode is the first 4 bases of the reads  except for libraries Tu Male  Tu P0  SJD Male  SJD P0  SJDxTuF1  TuxSJDF1  TuxSJDF2 and SJDxTuF2  which do not have a barcode. three prime adapter seqeunce starts with 'TCGTATG'. Reads were mapped to D.rerio genome assembly using megablast software. Genome build: Zv9 Supplementary files format and content: Text file with read counts", "Ovary", null, "Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. five prime and three prime adaptors were ligated. RNA was not treated with any enzymes before ligation steps.", "Animals were grown under standard conditioni", "gender:female|strain:SJD|developmental stage:Adult|tissue:Ovary", "GSM1014068", "GSM1014068: SJD P0; Danio rerio; RNA Seq", "GSM1014068 1", null, "1", null, "GEO Accession:GSM1014068", "RNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer IIx", null, "SRP015982", null, null, "SJD_P0.fastq", "fastq", 837950832.0, 23276412.0, "GSM1014068 r1", "0:36", "A:217386642;C:179519865;G:217337232;T:223633685;N:73408", 36, null, null, null, 217386642, 179519865, 217337232, 223633685, 73408, "SRX190962", "SRS366683", "SRA059229", "GEO", "European Research Institute for the Biology of Ageing, University Medical Center Groningen", 1, 0.26607, null, 0.21631, null, 0.93789, null, 0.46928, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2012-10-03", "Adult", "Adult", "Gonad", "Reproductive System"], [37997, "SRR1265760", "SRX529154", "SRS598851", "SRP041544", "PRJNA245824", "Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish", "GSE57169", "Transcriptome Analysis", "The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish  substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain  gut  liver  ovary  testis  eye  heart and embryo of zebrafish.  In brain  gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs  with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2  we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0%  with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs  respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further  we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as  a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling  novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.", null, "pubmed:26574018", null, "Testis Replicate 3 sRNAseq", "GSM1376643", null, "source name:Testis|gender:male|tissue:Testis|genetic background:Wild type   Singapore strain", "Testis Replicate 3 sRNAseq", "Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedl\u00e4nder et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database  finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl  p <zebrafish precursor miRNA fasta file>  m <zebrafish mature miRNA fasta file>  r <unique reads fasta file>  t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis.", "Testis", "N/A", "Total RNA were extracted using mirVana\u2122 miRNA Isolation Kit AM1560  Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the  mirVana\u2122 miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using  TruSeq Small RNA Sample Preparation Kit  RS 200 0012  Illumina  Inc.. Libraries were prepared according to manufacturer instructions. Briefly  1\u00b5g of good quality Total RNA per sample was used as starting material. 5\u2019 and 3\u2019 RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.", "Fishes were purchased from a local supplier and acclimatized before tissue extraction.", "gender:Male|tissue:Testis|genetic background:Wild type   Singapore strain", "GSM1376643", "GSM1376643: Testis Replicate 3 sRNAseq; Danio rerio; miRNA Seq", "GSM1376643", null, "1", "Total RNA were extracted using mirVana\u2122 miRNA Isolation Kit AM1560  Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the  mirVana\u2122 miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using  TruSeq Small RNA Sample Preparation Kit  RS 200 0012  Illumina  Inc.. Libraries were prepared according to manufacturer instructions. Briefly  1\u00b5g of good quality Total RNA per sample was used as starting material. 5\u2019 and 3\u2019 RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.", "GEO Accession:GSM1376643", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP041544", null, null, "MZT004_GCCAAT_L004_R1.fastq.gz", "fastq", 1096387628.0, 14426153.0, "GSM1376643 r1", "0:76", "A:268706118;C:286539627;G:262643519;T:278353167;N:145197", 76, null, null, null, 268706118, 286539627, 262643519, 278353167, 145197, "SRX529154", "SRS598851", "SRA160430", "GEO", "Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore", 1, 0.00659, null, 0.00333, null, 0.99845, null, 0.7331, null, 76, null, "T", null, "under 1.2% mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "trueseq", "bulk", "unknown", "unknown", null, "Singapore", "2014-04-29", "Undetermined", "Embryo", "Gonad", "Reproductive System"], [37998, "SRR1265759", "SRX529153", "SRS598850", "SRP041544", "PRJNA245824", "Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish", "GSE57169", "Transcriptome Analysis", "The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish  substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain  gut  liver  ovary  testis  eye  heart and embryo of zebrafish.  In brain  gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs  with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2  we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0%  with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs  respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further  we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as  a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling  novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.", null, "pubmed:26574018", null, "Testis Replicate 2 sRNAseq", "GSM1376642", null, "source name:Testis|gender:male|tissue:Testis|genetic background:Wild type   Singapore strain", "Testis Replicate 2 sRNAseq", "Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedl\u00e4nder et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database  finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl  p <zebrafish precursor miRNA fasta file>  m <zebrafish mature miRNA fasta file>  r <unique reads fasta file>  t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis.", "Testis", "N/A", "Total RNA were extracted using mirVana\u2122 miRNA Isolation Kit AM1560  Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the  mirVana\u2122 miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using  TruSeq Small RNA Sample Preparation Kit  RS 200 0012  Illumina  Inc.. Libraries were prepared according to manufacturer instructions. Briefly  1\u00b5g of good quality Total RNA per sample was used as starting material. 5\u2019 and 3\u2019 RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.", "Fishes were purchased from a local supplier and acclimatized before tissue extraction.", "gender:Male|tissue:Testis|genetic background:Wild type   Singapore strain", "GSM1376642", "GSM1376642: Testis Replicate 2 sRNAseq; Danio rerio; miRNA Seq", "GSM1376642", null, "1", "Total RNA were extracted using mirVana\u2122 miRNA Isolation Kit AM1560  Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the  mirVana\u2122 miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using  TruSeq Small RNA Sample Preparation Kit  RS 200 0012  Illumina  Inc.. Libraries were prepared according to manufacturer instructions. Briefly  1\u00b5g of good quality Total RNA per sample was used as starting material. 5\u2019 and 3\u2019 RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.", "GEO Accession:GSM1376642", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP041544", null, null, "MZT003_ACAGTG_L004_R1.fastq.gz", "fastq", 1562745896.0, 20562446.0, "GSM1376642 r1", "0:76", "A:381752411;C:387452090;G:395892335;T:397438930;N:210130", 76, null, null, null, 381752411, 387452090, 395892335, 397438930, 210130, "SRX529153", "SRS598850", "SRA160430", "GEO", "Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore", 1, 0.01222, null, 0.00651, null, 0.99788, null, 0.69591, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "trueseq", "bulk", "unknown", "unknown", null, "Singapore", "2014-04-29", "Undetermined", "Embryo", "Gonad", "Reproductive System"], [37999, "SRR1265758", "SRX529152", "SRS598849", "SRP041544", "PRJNA245824", "Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish", "GSE57169", "Transcriptome Analysis", "The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish  substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain  gut  liver  ovary  testis  eye  heart and embryo of zebrafish.  In brain  gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs  with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2  we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0%  with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs  respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further  we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as  a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling  novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.", null, "pubmed:26574018", null, "Testis Replicate 1 sRNAseq", "GSM1376641", null, "source name:Testis|gender:male|tissue:Testis|genetic background:Wild type   Singapore strain", "Testis Replicate 1 sRNAseq", "Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedl\u00e4nder et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database  finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl  p <zebrafish precursor miRNA fasta file>  m <zebrafish mature miRNA fasta file>  r <unique reads fasta file>  t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis.", "Testis", "N/A", "Total RNA were extracted using mirVana\u2122 miRNA Isolation Kit AM1560  Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the  mirVana\u2122 miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using  TruSeq Small RNA Sample Preparation Kit  RS 200 0012  Illumina  Inc.. Libraries were prepared according to manufacturer instructions. Briefly  1\u00b5g of good quality Total RNA per sample was used as starting material. 5\u2019 and 3\u2019 RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.", "Fishes were purchased from a local supplier and acclimatized before tissue extraction.", "gender:Male|tissue:Testis|genetic background:Wild type   Singapore strain", "GSM1376641", "GSM1376641: Testis Replicate 1 sRNAseq; Danio rerio; miRNA Seq", "GSM1376641", null, "1", "Total RNA were extracted using mirVana\u2122 miRNA Isolation Kit AM1560  Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the  mirVana\u2122 miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using  TruSeq Small RNA Sample Preparation Kit  RS 200 0012  Illumina  Inc.. Libraries were prepared according to manufacturer instructions. Briefly  1\u00b5g of good quality Total RNA per sample was used as starting material. 5\u2019 and 3\u2019 RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.", "GEO Accession:GSM1376641", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP041544", null, null, "MZT001_TGACCA_L004_R1.fastq.gz", "fastq", 1368892316.0, 18011741.0, "GSM1376641 r1", "0:76", "A:335715713;C:358829703;G:326742789;T:347419137;N:184974", 76, null, null, null, 335715713, 358829703, 326742789, 347419137, 184974, "SRX529152", "SRS598849", "SRA160430", "GEO", "Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore", 1, 0.00032, null, 3e-05, null, 0.99943, null, 0.69387, null, 76, null, "T", null, "under 1.2% mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "trueseq", "bulk", "unknown", "unknown", null, "Singapore", "2014-04-29", "Undetermined", "Embryo", "Gonad", "Reproductive System"], [38000, "SRR1265757", "SRX529151", "SRS598848", "SRP041544", "PRJNA245824", "Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish", "GSE57169", "Transcriptome Analysis", "The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish  substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain  gut  liver  ovary  testis  eye  heart and embryo of zebrafish.  In brain  gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs  with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2  we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0%  with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs  respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further  we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as  a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling  novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.", null, "pubmed:26574018", null, "Ovary Replicate 3 sRNAseq", "GSM1376640", null, "source name:Ovary|gender:female|tissue:Ovary|genetic background:Wild type   Singapore strain", "Ovary Replicate 3 sRNAseq", "Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedl\u00e4nder et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database  finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl  p <zebrafish precursor miRNA fasta file>  m <zebrafish mature miRNA fasta file>  r <unique reads fasta file>  t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis.", "Ovary", "N/A", "Total RNA were extracted using mirVana\u2122 miRNA Isolation Kit AM1560  Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the  mirVana\u2122 miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using  TruSeq Small RNA Sample Preparation Kit  RS 200 0012  Illumina  Inc.. Libraries were prepared according to manufacturer instructions. Briefly  1\u00b5g of good quality Total RNA per sample was used as starting material. 5\u2019 and 3\u2019 RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.", "Fishes were purchased from a local supplier and acclimatized before tissue extraction.", "gender:Female|tissue:Ovary|genetic background:Wild type   Singapore strain", "GSM1376640", "GSM1376640: Ovary Replicate 3 sRNAseq; Danio rerio; miRNA Seq", "GSM1376640", null, "1", "Total RNA were extracted using mirVana\u2122 miRNA Isolation Kit AM1560  Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the  mirVana\u2122 miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using  TruSeq Small RNA Sample Preparation Kit  RS 200 0012  Illumina  Inc.. Libraries were prepared according to manufacturer instructions. Briefly  1\u00b5g of good quality Total RNA per sample was used as starting material. 5\u2019 and 3\u2019 RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.", "GEO Accession:GSM1376640", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP041544", null, null, "MZO006_GATCAG_L008_R1.fastq.gz", "fastq", 1411005984.0, 27666784.0, "GSM1376640 r1", "0:51", "A:326542153;C:314421825;G:411019622;T:358847379;N:175005", 51, null, null, null, 326542153, 314421825, 411019622, 358847379, 175005, "SRX529151", "SRS598848", "SRA160430", "GEO", "Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore", 1, 0.00638, null, 0.00068, null, 0.99513, null, 0.75483, null, 51, null, "T", null, "under 1.2% mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "trueseq", "bulk", "unknown", "unknown", null, "Singapore", "2014-04-29", "Undetermined", "Embryo", "Gonad", "Reproductive System"], [38001, "SRR1265756", "SRX529150", "SRS598847", "SRP041544", "PRJNA245824", "Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish", "GSE57169", "Transcriptome Analysis", "The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish  substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain  gut  liver  ovary  testis  eye  heart and embryo of zebrafish.  In brain  gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs  with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2  we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0%  with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs  respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further  we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as  a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling  novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.", null, "pubmed:26574018", null, "Ovary Replicate 2 sRNAseq", "GSM1376639", null, "source name:Ovary|gender:female|tissue:Ovary|genetic background:Wild type   Singapore strain", "Ovary Replicate 2 sRNAseq", "Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedl\u00e4nder et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database  finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl  p <zebrafish precursor miRNA fasta file>  m <zebrafish mature miRNA fasta file>  r <unique reads fasta file>  t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis.", "Ovary", "N/A", "Total RNA were extracted using mirVana\u2122 miRNA Isolation Kit AM1560  Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the  mirVana\u2122 miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using  TruSeq Small RNA Sample Preparation Kit  RS 200 0012  Illumina  Inc.. Libraries were prepared according to manufacturer instructions. Briefly  1\u00b5g of good quality Total RNA per sample was used as starting material. 5\u2019 and 3\u2019 RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.", "Fishes were purchased from a local supplier and acclimatized before tissue extraction.", "gender:Female|tissue:Ovary|genetic background:Wild type   Singapore strain", "GSM1376639", "GSM1376639: Ovary Replicate 2 sRNAseq; Danio rerio; miRNA Seq", "GSM1376639", null, "1", "Total RNA were extracted using mirVana\u2122 miRNA Isolation Kit AM1560  Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the  mirVana\u2122 miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using  TruSeq Small RNA Sample Preparation Kit  RS 200 0012  Illumina  Inc.. Libraries were prepared according to manufacturer instructions. Briefly  1\u00b5g of good quality Total RNA per sample was used as starting material. 5\u2019 and 3\u2019 RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.", "GEO Accession:GSM1376639", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP041544", null, null, "MZO005_ACTTGA_L008_R1.fastq.gz", "fastq", 765419424.0, 15008224.0, "GSM1376639 r1", "0:51", "A:179455664;C:170237021;G:221342071;T:194287721;N:96947", 51, null, null, null, 179455664, 170237021, 221342071, 194287721, 96947, "SRX529150", "SRS598847", "SRA160430", "GEO", "Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore", 1, 0.02512, null, 0.00355, null, 0.98212, null, 0.67744, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "trueseq", "bulk", "unknown", "unknown", null, "Singapore", "2014-04-29", "Undetermined", "Embryo", "Gonad", "Reproductive System"], [38002, "SRR1265755", "SRX529149", "SRS598846", "SRP041544", "PRJNA245824", "Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish", "GSE57169", "Transcriptome Analysis", "The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish  substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain  gut  liver  ovary  testis  eye  heart and embryo of zebrafish.  In brain  gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs  with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2  we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0%  with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs  respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further  we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as  a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling  novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.", null, "pubmed:26574018", null, "Ovary Replicate 1 sRNAseq", "GSM1376638", null, "source name:Ovary|gender:female|tissue:Ovary|genetic background:Wild type   Singapore strain", "Ovary Replicate 1 sRNAseq", "Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedl\u00e4nder et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database  finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl  p <zebrafish precursor miRNA fasta file>  m <zebrafish mature miRNA fasta file>  r <unique reads fasta file>  t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis.", "Ovary", "N/A", "Total RNA were extracted using mirVana\u2122 miRNA Isolation Kit AM1560  Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the  mirVana\u2122 miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using  TruSeq Small RNA Sample Preparation Kit  RS 200 0012  Illumina  Inc.. Libraries were prepared according to manufacturer instructions. Briefly  1\u00b5g of good quality Total RNA per sample was used as starting material. 5\u2019 and 3\u2019 RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.", "Fishes were purchased from a local supplier and acclimatized before tissue extraction.", "gender:Female|tissue:Ovary|genetic background:Wild type   Singapore strain", "GSM1376638", "GSM1376638: Ovary Replicate 1 sRNAseq; Danio rerio; miRNA Seq", "GSM1376638", null, "1", "Total RNA were extracted using mirVana\u2122 miRNA Isolation Kit AM1560  Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the  mirVana\u2122 miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using  TruSeq Small RNA Sample Preparation Kit  RS 200 0012  Illumina  Inc.. Libraries were prepared according to manufacturer instructions. Briefly  1\u00b5g of good quality Total RNA per sample was used as starting material. 5\u2019 and 3\u2019 RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.", "GEO Accession:GSM1376638", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP041544", null, null, "MZO004_CAGATC_L008_R1.fastq.gz", "fastq", 487558674.0, 9559974.0, "GSM1376638 r1", "0:51", "A:114833813;C:108951811;G:140408702;T:123302557;N:61791", 51, null, null, null, 114833813, 108951811, 140408702, 123302557, 61791, "SRX529149", "SRS598846", "SRA160430", "GEO", "Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore", 1, 0.00298, null, 0.0004, null, 0.99644, null, 0.84584, null, 51, null, "T", null, "under 1.2% mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "trueseq", "bulk", "unknown", "unknown", null, "Singapore", "2014-04-29", "Undetermined", "Embryo", "Gonad", "Reproductive System"], [38256, "SRR1596061", "SRX719267", "SRS715451", "SRP048591", "PRJNA262865", "Identification and Characterization of MicroRNAs in Zebrafish Spermatozoa by Illumina Sequencing", "GSE61984", "Other", "MicroRNAs miRNAs are involved in nearly every biological process examined to date. Mounting evidence show that some spermatozoa specific miRNAs play important roles in the regulation of spermatogenesis and germ cells development  but little is known of the exact identity and function of miRNA in sperm cells or their potential involvement in spermatogenesis and germ cells development. Here  we investigated the spermatozoa miRNA profiles using illumina deep sequencing combined with bioinformatic analysis using zebrafish as a model system. Deep sequencing of small RNAs yielded 12 million raw reads from zebrafish spermatozoa. Analysis showed that the noncoding RNA of the spermatozoa included tRNA  rRNA  snRNA  snoRNA and miRNA. By mapping to the zebrafish genome  we identified 400 novel and 204 conserved miRNAs which could be grouped into 104 families  including zebrafish specific families  such as mir 731  mir 724  mir 725  mir 729 and mir 2185. We report the first characterization of the miRNAs profiling in zebrafish spermatozoa. The obtained spermatozoa miRNAs profiling will serve as valuable resources to systematically study spermatogenesis in fish and vertebrate. Overall design: Examination of small RNA populations in zebrafish spermatozoa", null, "pubmed:26418264", null, "zebrafish sperm", "GSM1517943", null, "tissue:Zebrafish Spermatozoa|cell type:Spermatozoa|strain:AB wild type", "zebrafish sperm", "The sequencing data were analyzed as described previously by Xu et al 2014. The low quality reads were filtered to remove reads without xxx 3\u2019 adaptor  5\u2019 adaptor contaminant reads  reads without xxx insert fragment  reads containing polyA stretches  and reads of less than 18 nt. Next  the remaining sequences clean reads were mapped to the zebrafish genome using SOAP with a tolerance of one mismatch to analyze their distribution The sequences were aligned against known miRNA precursors and mature miRNAs deposited in the miRBase 20.0 to identify conserved miRNAs. The clean reads were compared against the sRNAs rRNAs  tRNAs  snRNAs  snoRNA  miRNA deposited in the GenBank and Rfam http://www.sanger.ac.uk/resources/databases/rfam.html databases to annotate the sRNA sequences. Because some sRNA tags might map to more than one category we used priority rules to ensure that every unique sRNA was mapped to only one annotation as follows: rRNA etc. GenBank >Rfam >known miRNA >repeat >exon >intron. Genome build: miRBase 20.0 Supplementary files format and content: zebrafish miRNA count.txt include RPKM values of each known miRNA in this sample", "Zebrafish Spermatozoa", null, "Total RNA was isolated from sample using Trizol reagent Invitrogen  USA in accordance with the manufacturer\u2019s protocol. RNA integrity was confirmed using the 2100 Bioanalyzer Agilent Technologies. RNA samples that passed the quality check were sent to BGI Shenzhen  China for sRNA library construction and Solexa sequencing using standard protocols on the Illumina Hiseq 2000 platform.", null, "cell type:Spermatozoa|strain:AB wild type", "GSM1517943", "GSM1517943: zebrafish sperm; Danio rerio; miRNA Seq", "GSM1517943", null, "1", "Total RNA was isolated from sample using Trizol reagent Invitrogen  USA in accordance with the manufacturer\u2019s protocol. RNA integrity was confirmed using the 2100 Bioanalyzer Agilent Technologies. RNA samples that passed the quality check were sent to BGI Shenzhen  China for sRNA library construction and Solexa sequencing using standard protocols on the Illumina Hiseq 2000 platform.", "GEO Accession:GSM1517943", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP048591", null, null, "zebrafish-sperm5.fq.bz2", "fastq", 588000000.0, 12000000.0, "GSM1517943 r1", "0:49", "A:122673394;C:136175879;G:140377184;T:188702650;N:70893", 49, null, null, null, 122673394, 136175879, 140377184, 188702650, 70893, "SRX719267", "SRS715451", "SRA188511", "GEO", "SUN YAT-SEN UNIVERSITY", 1, 2e-05, null, 0.0, null, 0.99997, null, 1.0, null, 49, null, "T", null, "under 1.2% mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "China", "2014-10-02", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [41150, "SRR3744678", "SRX1898686", "SRS1541536", "SRP077941", "PRJNA327880", "Analysis of piRNA production in meioc moto mutant zebrafish testis", "GSE84060", "Transcriptome Analysis", "We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus  it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.", null, "pubmed:39605693", null, "moto homozygous 5", "GSM2226636", null, "tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / ", "moto homozygous 5", "Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3\u2019 adapter sequences using Flexbar v.2.4 using parameters:  m 18  ao 10  as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters:  n 0  e 80  l 18  y   best   nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter  minlen 24  maxlen 32. Transposon annotation for zebrafish DNA  LTR  LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables   Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA  LTR  LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options:  M  F SAF  s 1 for sense mapping reads and  M  F SAF  s 2 for antisense mapping reads.  Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense  and antisense mapping read counts summarised per transposon type.", "testis", null, "Testes from moto+/  and moto /  zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad  and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13  with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read  51 cycles  high output mode on 2 lanes of HiSeq 2000 system Illumina.", null, "strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / ", "GSM2226636", "GSM2226636: moto homozygous 5; Danio rerio; ncRNA Seq", "GSM2226636", null, "1", "Testes from moto+/  and moto /  zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad  and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13  with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read  51 cycles  high output mode on 2 lanes of HiSeq 2000 system Illumina.", "GEO Accession:GSM2226636", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP077941", null, null, null, null, 2118467988.0, 41538588.0, "GSM2226636 r1", "0:51", "A:616161510;C:469529175;G:576120961;T:456560109;N:96233", 51, null, null, null, 616161510, 469529175, 576120961, 456560109, 96233, "SRX1898686", "SRS1541536", "SRA438045", "GEO", "Bioinformatics Core Facility, Institute of Molecular Biology", 1, 0.52011, null, 0.38818, null, 0.90193, null, 0.51677, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2016-07-05", "Adult", "Adult", "Gonad", "Reproductive System"], [41151, "SRR3744677", "SRX1898685", "SRS1541535", "SRP077941", "PRJNA327880", "Analysis of piRNA production in meioc moto mutant zebrafish testis", "GSE84060", "Transcriptome Analysis", "We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus  it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.", null, "pubmed:39605693", null, "moto homozygous 4", "GSM2226635", null, "tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / ", "moto homozygous 4", "Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3\u2019 adapter sequences using Flexbar v.2.4 using parameters:  m 18  ao 10  as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters:  n 0  e 80  l 18  y   best   nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter  minlen 24  maxlen 32. Transposon annotation for zebrafish DNA  LTR  LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables   Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA  LTR  LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options:  M  F SAF  s 1 for sense mapping reads and  M  F SAF  s 2 for antisense mapping reads.  Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense  and antisense mapping read counts summarised per transposon type.", "testis", null, "Testes from moto+/  and moto /  zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad  and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13  with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read  51 cycles  high output mode on 2 lanes of HiSeq 2000 system Illumina.", null, "strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / ", "GSM2226635", "GSM2226635: moto homozygous 4; Danio rerio; ncRNA Seq", "GSM2226635", null, "1", "Testes from moto+/  and moto /  zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad  and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13  with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read  51 cycles  high output mode on 2 lanes of HiSeq 2000 system Illumina.", "GEO Accession:GSM2226635", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP077941", null, null, null, null, 1771929771.0, 34743721.0, "GSM2226635 r1", "0:51", "A:524609276;C:393148247;G:436902442;T:417188575;N:81231", 51, null, null, null, 524609276, 393148247, 436902442, 417188575, 81231, "SRX1898685", "SRS1541535", "SRA438045", "GEO", "Bioinformatics Core Facility, Institute of Molecular Biology", 1, 0.62874, null, 0.45148, null, 0.89008, null, 0.52837, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2016-07-05", "Adult", "Adult", "Gonad", "Reproductive System"], [41152, "SRR3744676", "SRX1898684", "SRS1541534", "SRP077941", "PRJNA327880", "Analysis of piRNA production in meioc moto mutant zebrafish testis", "GSE84060", "Transcriptome Analysis", "We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus  it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.", null, "pubmed:39605693", null, "moto homozygous 3", "GSM2226634", null, "tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / ", "moto homozygous 3", "Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3\u2019 adapter sequences using Flexbar v.2.4 using parameters:  m 18  ao 10  as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters:  n 0  e 80  l 18  y   best   nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter  minlen 24  maxlen 32. Transposon annotation for zebrafish DNA  LTR  LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables   Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA  LTR  LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options:  M  F SAF  s 1 for sense mapping reads and  M  F SAF  s 2 for antisense mapping reads.  Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense  and antisense mapping read counts summarised per transposon type.", "testis", null, "Testes from moto+/  and moto /  zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad  and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13  with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read  51 cycles  high output mode on 2 lanes of HiSeq 2000 system Illumina.", null, "strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / ", "GSM2226634", "GSM2226634: moto homozygous 3; Danio rerio; ncRNA Seq", "GSM2226634", null, "1", "Testes from moto+/  and moto /  zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad  and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13  with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read  51 cycles  high output mode on 2 lanes of HiSeq 2000 system Illumina.", "GEO Accession:GSM2226634", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP077941", null, null, null, null, 1849849917.0, 36271567.0, "GSM2226634 r1", "0:51", "A:554317433;C:408404232;G:459010543;T:428033928;N:83781", 51, null, null, null, 554317433, 408404232, 459010543, 428033928, 83781, "SRX1898684", "SRS1541534", "SRA438045", "GEO", "Bioinformatics Core Facility, Institute of Molecular Biology", 1, 0.69752, null, 0.51829, null, 0.89027, null, 0.53775, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2016-07-05", "Adult", "Adult", "Gonad", "Reproductive System"], [41153, "SRR3744675", "SRX1898683", "SRS1541533", "SRP077941", "PRJNA327880", "Analysis of piRNA production in meioc moto mutant zebrafish testis", "GSE84060", "Transcriptome Analysis", "We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus  it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.", null, "pubmed:39605693", null, "moto homozygous 2", "GSM2226633", null, "tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / ", "moto homozygous 2", "Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3\u2019 adapter sequences using Flexbar v.2.4 using parameters:  m 18  ao 10  as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters:  n 0  e 80  l 18  y   best   nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter  minlen 24  maxlen 32. Transposon annotation for zebrafish DNA  LTR  LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables   Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA  LTR  LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options:  M  F SAF  s 1 for sense mapping reads and  M  F SAF  s 2 for antisense mapping reads.  Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense  and antisense mapping read counts summarised per transposon type.", "testis", null, "Testes from moto+/  and moto /  zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad  and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13  with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read  51 cycles  high output mode on 2 lanes of HiSeq 2000 system Illumina.", null, "strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / ", "GSM2226633", "GSM2226633: moto homozygous 2; Danio rerio; ncRNA Seq", "GSM2226633", null, "1", "Testes from moto+/  and moto /  zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad  and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13  with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read  51 cycles  high output mode on 2 lanes of HiSeq 2000 system Illumina.", "GEO Accession:GSM2226633", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP077941", null, null, null, null, 1863615327.0, 36541477.0, "GSM2226633 r1", "0:51", "A:554370010;C:414418365;G:465346091;T:429394630;N:86231", 51, null, null, null, 554370010, 414418365, 465346091, 429394630, 86231, "SRX1898683", "SRS1541533", "SRA438045", "GEO", "Bioinformatics Core Facility, Institute of Molecular Biology", 1, 0.74326, null, 0.52319, null, 0.87361, null, 0.53081, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2016-07-05", "Adult", "Adult", "Gonad", "Reproductive System"], [41154, "SRR3744674", "SRX1898682", "SRS1541532", "SRP077941", "PRJNA327880", "Analysis of piRNA production in meioc moto mutant zebrafish testis", "GSE84060", "Transcriptome Analysis", "We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus  it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.", null, "pubmed:39605693", null, "moto homozygous 1", "GSM2226632", null, "tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / ", "moto homozygous 1", "Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3\u2019 adapter sequences using Flexbar v.2.4 using parameters:  m 18  ao 10  as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters:  n 0  e 80  l 18  y   best   nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter  minlen 24  maxlen 32. Transposon annotation for zebrafish DNA  LTR  LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables   Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA  LTR  LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options:  M  F SAF  s 1 for sense mapping reads and  M  F SAF  s 2 for antisense mapping reads.  Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense  and antisense mapping read counts summarised per transposon type.", "testis", null, "Testes from moto+/  and moto /  zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad  and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13  with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read  51 cycles  high output mode on 2 lanes of HiSeq 2000 system Illumina.", null, "strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / ", "GSM2226632", "GSM2226632: moto homozygous 1; Danio rerio; ncRNA Seq", "GSM2226632", null, "1", "Testes from moto+/  and moto /  zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad  and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13  with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read  51 cycles  high output mode on 2 lanes of HiSeq 2000 system Illumina.", "GEO Accession:GSM2226632", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP077941", null, null, null, null, 1453145193.0, 28493043.0, "GSM2226632 r1", "0:51", "A:435644830;C:320413861;G:361678589;T:335340817;N:67096", 51, null, null, null, 435644830, 320413861, 361678589, 335340817, 67096, "SRX1898682", "SRS1541532", "SRA438045", "GEO", "Bioinformatics Core Facility, Institute of Molecular Biology", 1, 0.66367, null, 0.47841, null, 0.88262, null, 0.50114, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2016-07-05", "Adult", "Adult", "Gonad", "Reproductive System"], [41155, "SRR3744673", "SRX1898681", "SRS1541531", "SRP077941", "PRJNA327880", "Analysis of piRNA production in meioc moto mutant zebrafish testis", "GSE84060", "Transcriptome Analysis", "We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus  it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.", null, "pubmed:39605693", null, "moto heterozygous 6", "GSM2226631", null, "tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ ", "moto heterozygous 6", "Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3\u2019 adapter sequences using Flexbar v.2.4 using parameters:  m 18  ao 10  as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters:  n 0  e 80  l 18  y   best   nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter  minlen 24  maxlen 32. Transposon annotation for zebrafish DNA  LTR  LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables   Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA  LTR  LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options:  M  F SAF  s 1 for sense mapping reads and  M  F SAF  s 2 for antisense mapping reads.  Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense  and antisense mapping read counts summarised per transposon type.", "testis", null, "Testes from moto+/  and moto /  zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad  and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13  with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read  51 cycles  high output mode on 2 lanes of HiSeq 2000 system Illumina.", null, "strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ ", "GSM2226631", "GSM2226631: moto heterozygous 6; Danio rerio; ncRNA Seq", "GSM2226631", null, "1", "Testes from moto+/  and moto /  zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad  and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13  with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read  51 cycles  high output mode on 2 lanes of HiSeq 2000 system Illumina.", "GEO Accession:GSM2226631", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP077941", null, null, null, null, 2009800248.0, 39407848.0, "GSM2226631 r1", "0:51", "A:586066305;C:443066820;G:503291347;T:477284226;N:91550", 51, null, null, null, 586066305, 443066820, 503291347, 477284226, 91550, "SRX1898681", "SRS1541531", "SRA438045", "GEO", "Bioinformatics Core Facility, Institute of Molecular Biology", 1, 0.69598, null, 0.49191, null, 0.8828, null, 0.51759, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2016-07-05", "Adult", "Adult", "Gonad", "Reproductive System"], [41156, "SRR3744672", "SRX1898680", "SRS1541530", "SRP077941", "PRJNA327880", "Analysis of piRNA production in meioc moto mutant zebrafish testis", "GSE84060", "Transcriptome Analysis", "We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus  it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.", null, "pubmed:39605693", null, "moto heterozygous 5", "GSM2226630", null, "tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ ", "moto heterozygous 5", "Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3\u2019 adapter sequences using Flexbar v.2.4 using parameters:  m 18  ao 10  as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters:  n 0  e 80  l 18  y   best   nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter  minlen 24  maxlen 32. Transposon annotation for zebrafish DNA  LTR  LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables   Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA  LTR  LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options:  M  F SAF  s 1 for sense mapping reads and  M  F SAF  s 2 for antisense mapping reads.  Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense  and antisense mapping read counts summarised per transposon type.", "testis", null, "Testes from moto+/  and moto /  zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad  and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13  with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read  51 cycles  high output mode on 2 lanes of HiSeq 2000 system Illumina.", null, "strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ ", "GSM2226630", "GSM2226630: moto heterozygous 5; Danio rerio; ncRNA Seq", "GSM2226630", null, "1", "Testes from moto+/  and moto /  zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad  and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13  with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read  51 cycles  high output mode on 2 lanes of HiSeq 2000 system Illumina.", "GEO Accession:GSM2226630", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP077941", null, null, null, null, 1833618504.0, 35953304.0, "GSM2226630 r1", "0:51", "A:510624241;C:446979639;G:473431335;T:402499572;N:83717", 51, null, null, null, 510624241, 446979639, 473431335, 402499572, 83717, "SRX1898680", "SRS1541530", "SRA438045", "GEO", "Bioinformatics Core Facility, Institute of Molecular Biology", 1, 0.73675, null, 0.50008, null, 0.87957, null, 0.53243, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2016-07-05", "Adult", "Adult", "Gonad", "Reproductive System"], [41157, "SRR3744671", "SRX1898679", "SRS1541529", "SRP077941", "PRJNA327880", "Analysis of piRNA production in meioc moto mutant zebrafish testis", "GSE84060", "Transcriptome Analysis", "We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus  it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.", null, "pubmed:39605693", null, "moto heterozygous 4", "GSM2226629", null, "tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ ", "moto heterozygous 4", "Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3\u2019 adapter sequences using Flexbar v.2.4 using parameters:  m 18  ao 10  as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters:  n 0  e 80  l 18  y   best   nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter  minlen 24  maxlen 32. Transposon annotation for zebrafish DNA  LTR  LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables   Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA  LTR  LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options:  M  F SAF  s 1 for sense mapping reads and  M  F SAF  s 2 for antisense mapping reads.  Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense  and antisense mapping read counts summarised per transposon type.", "testis", null, "Testes from moto+/  and moto /  zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad  and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13  with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read  51 cycles  high output mode on 2 lanes of HiSeq 2000 system Illumina.", null, "strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ ", "GSM2226629", "GSM2226629: moto heterozygous 4; Danio rerio; ncRNA Seq", "GSM2226629", null, "1", "Testes from moto+/  and moto /  zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad  and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13  with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read  51 cycles  high output mode on 2 lanes of HiSeq 2000 system Illumina.", "GEO Accession:GSM2226629", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP077941", null, null, null, null, 2011846776.0, 39447976.0, "GSM2226629 r1", "0:51", "A:566935163;C:480777294;G:518987229;T:445055757;N:91333", 51, null, null, null, 566935163, 480777294, 518987229, 445055757, 91333, "SRX1898679", "SRS1541529", "SRA438045", "GEO", "Bioinformatics Core Facility, Institute of Molecular Biology", 1, 0.7246, null, 0.49021, null, 0.88051, null, 0.5202, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2016-07-05", "Adult", "Adult", "Gonad", "Reproductive System"], [41158, "SRR3744670", "SRX1898678", "SRS1541528", "SRP077941", "PRJNA327880", "Analysis of piRNA production in meioc moto mutant zebrafish testis", "GSE84060", "Transcriptome Analysis", "We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus  it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.", null, "pubmed:39605693", null, "moto heterozygous 3", "GSM2226628", null, "tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ ", "moto heterozygous 3", "Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3\u2019 adapter sequences using Flexbar v.2.4 using parameters:  m 18  ao 10  as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters:  n 0  e 80  l 18  y   best   nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter  minlen 24  maxlen 32. Transposon annotation for zebrafish DNA  LTR  LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables   Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA  LTR  LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options:  M  F SAF  s 1 for sense mapping reads and  M  F SAF  s 2 for antisense mapping reads.  Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense  and antisense mapping read counts summarised per transposon type.", "testis", null, "Testes from moto+/  and moto /  zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad  and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13  with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read  51 cycles  high output mode on 2 lanes of HiSeq 2000 system Illumina.", null, "strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ ", "GSM2226628", "GSM2226628: moto heterozygous 3; Danio rerio; ncRNA Seq", "GSM2226628", null, "1", "Testes from moto+/  and moto /  zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad  and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13  with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read  51 cycles  high output mode on 2 lanes of HiSeq 2000 system Illumina.", "GEO Accession:GSM2226628", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP077941", null, null, null, null, 1618368312.0, 31732712.0, "GSM2226628 r1", "0:51", "A:476792369;C:353703619;G:406141931;T:381656601;N:73792", 51, null, null, null, 476792369, 353703619, 406141931, 381656601, 73792, "SRX1898678", "SRS1541528", "SRA438045", "GEO", "Bioinformatics Core Facility, Institute of Molecular Biology", 1, 0.67806, null, 0.48273, null, 0.88363, null, 0.53518, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2016-07-05", "Adult", "Adult", "Gonad", "Reproductive System"], [41159, "SRR3744669", "SRX1898677", "SRS1541527", "SRP077941", "PRJNA327880", "Analysis of piRNA production in meioc moto mutant zebrafish testis", "GSE84060", "Transcriptome Analysis", "We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus  it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.", null, "pubmed:39605693", null, "moto heterozygous 2", "GSM2226627", null, "tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ ", "moto heterozygous 2", "Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3\u2019 adapter sequences using Flexbar v.2.4 using parameters:  m 18  ao 10  as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters:  n 0  e 80  l 18  y   best   nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter  minlen 24  maxlen 32. Transposon annotation for zebrafish DNA  LTR  LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables   Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA  LTR  LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options:  M  F SAF  s 1 for sense mapping reads and  M  F SAF  s 2 for antisense mapping reads.  Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense  and antisense mapping read counts summarised per transposon type.", "testis", null, "Testes from moto+/  and moto /  zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad  and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13  with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read  51 cycles  high output mode on 2 lanes of HiSeq 2000 system Illumina.", null, "strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ ", "GSM2226627", "GSM2226627: moto heterozygous 2; Danio rerio; ncRNA Seq", "GSM2226627", null, "1", "Testes from moto+/  and moto /  zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad  and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13  with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read  51 cycles  high output mode on 2 lanes of HiSeq 2000 system Illumina.", "GEO Accession:GSM2226627", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP077941", null, null, null, null, 1825076565.0, 35785815.0, "GSM2226627 r1", "0:51", "A:543891854;C:404479103;G:451780092;T:424842227;N:83289", 51, null, null, null, 543891854, 404479103, 451780092, 424842227, 83289, "SRX1898677", "SRS1541527", "SRA438045", "GEO", "Bioinformatics Core Facility, Institute of Molecular Biology", 1, 0.53478, null, 0.39486, null, 0.89899, null, 0.52282, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2016-07-05", "Adult", "Adult", "Gonad", "Reproductive System"], [41160, "SRR3744668", "SRX1898676", "SRS1541526", "SRP077941", "PRJNA327880", "Analysis of piRNA production in meioc moto mutant zebrafish testis", "GSE84060", "Transcriptome Analysis", "We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus  it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.", null, "pubmed:39605693", null, "moto heterozygous 1", "GSM2226626", null, "tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ ", "moto heterozygous 1", "Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3\u2019 adapter sequences using Flexbar v.2.4 using parameters:  m 18  ao 10  as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters:  n 0  e 80  l 18  y   best   nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter  minlen 24  maxlen 32. Transposon annotation for zebrafish DNA  LTR  LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables   Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA  LTR  LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options:  M  F SAF  s 1 for sense mapping reads and  M  F SAF  s 2 for antisense mapping reads.  Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense  and antisense mapping read counts summarised per transposon type.", "testis", null, "Testes from moto+/  and moto /  zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad  and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13  with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read  51 cycles  high output mode on 2 lanes of HiSeq 2000 system Illumina.", null, "strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ ", "GSM2226626", "GSM2226626: moto heterozygous 1; Danio rerio; ncRNA Seq", "GSM2226626", null, "1", "Testes from moto+/  and moto /  zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad  and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13  with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read  51 cycles  high output mode on 2 lanes of HiSeq 2000 system Illumina.", "GEO Accession:GSM2226626", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP077941", null, null, null, null, 1358381226.0, 26634926.0, "GSM2226626 r1", "0:51", "A:402110510;C:300618987;G:340178435;T:315410530;N:62764", 51, null, null, null, 402110510, 300618987, 340178435, 315410530, 62764, "SRX1898676", "SRS1541526", "SRA438045", "GEO", "Bioinformatics Core Facility, Institute of Molecular Biology", 1, 0.68106, null, 0.46812, null, 0.87596, null, 0.53427, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "nebnext", "bulk", "unknown", "unknown", null, "Germany", "2016-07-05", "Adult", "Adult", "Gonad", "Reproductive System"], [41693, "SRR5122167", "SRX2437316", "SRS1872014", "SRP095411", "PRJNA358209", "Identification of a specific 13 miRNA expression signature during follicle activation in Zebrafish", "GSE92639", "Transcriptome Analysis", "Purpose: We aimed to investigate important miRNA events and to define specific miRNA expression signature underlying the follicle activation of zebrafish. Methods: By using small and regular RNA sequencing  we performed transcriptomic analyses of PG primary growth stage I; inactive and PV pre vitellogenic stage II; activated follicles to decipher important miRNA and gene events underlying follicle activation of zebrafish. We identified differentially expressed miRNAs for subsequent qPCR validation and miRNA::target gene prediction. Interaction of candidate miRNA:: target gene pairs were further validated by luciferase reporter assay. Global gene networks involved during PG to PV transition were also assessed by Gene Ontology as well as KEGG pathway analyses. Results and Conclusion: Our expression results indicated that PG follicles can be well differentiated from PV follicles by simply using a specific 13 miRNA expression signature let 7a   7b   7c 5p   7d 5p   7h   7i; miR 21   23a   27c 3p   107a 3p   125b 5p   145 3p   202 5p. Besides  we validated interactions of let 7i::atg4a  miR 202 5p::c23h20orf24 and miR 144::ybx1 by luciferase reporter assay. Purpose: we aimed to investigate important miRNA events and to define specific miRNA expression signature underlying the follicle activation of zebrafish Overall design: To identify differentially expressed miRNAs and its potential downstream targets during follicle activation of zebrafish  we carried out transcriptomic profiling by both small and regular RNA sequencing. By intersecting gene lists of the online predicted targets and RNA seq derived differentially expressed transcripts with a reciprocal expression pattern of miRNAs  we shortlisted 6 pairs of miRNA::target gene for validation using luciferase reporter assay.", null, "pubmed:29228146", null, "PG small RNA seq 2", "GSM2433869", null, "tissue:Ovarian follicle|strain:AB|cell type:Pre vitellogenic follicle|age:from ovary of 3 month zebrafish", "PG small RNA seq 2", "For the RNA seq data  all the pair end reads were mapped to the zebrafish genome  using TopHat version 2.0.11. Genome annotation files with GTF format for known genes were downloaded from Ensembl. FPKM and RPKM values were calculated for each miRNA and gene respectively using Cufflinks software version 2.2.1 with default parameters. Genome build: Zv9 Ensembl release 79 Supplementary files format and content: tab delimited text files include FFKM for each mRNA transcript; tab delimited text files include RFKM for each miRNA.", "Ovarian follicle", "Ovaries from 3 mpf adult zebrafish were dissected in 60% medium of Leibovitz L 15 and follicles PG PV were sorted out according to the size and morphology.", "RNA was extracted with miRNeasy and RNAeasy extraction kits Qiagen RNA Seq libraries were constructed according to Illumima TrueSeq and small RNA seq protocol  and sequenced with the Illumina Hiseq 2000 Single end sequencing and pair end sequencing were used for small RNA seq library and RNA seq library  respectively", "AB fish was housed under a stable flow through condition at 28\u00b0C on a 14L:10D photoperiod with the light on at 0800 and off at 2200. Fish were fed regularly twice a day with live brine shrimp with supplement of commercial tropical fish food at a fixed time basis.", "strain:AB|cell type:Pre vitellogenic follicle|age:from ovary of 3 month zebrafish", "GSM2433869", "GSM2433869: PG small RNA seq 2; Danio rerio; ncRNA Seq", "GSM2433869", null, "1", "RNA was extracted with miRNeasy and RNAeasy extraction kits Qiagen RNA Seq libraries were constructed according to Illumima TrueSeq and small RNA seq protocol  and sequenced with the Illumina Hiseq 2000 Single end sequencing and pair end sequencing were used for small RNA seq library and RNA seq library  respectively", "GEO Accession:GSM2433869", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP095411", null, null, "Ctrl_PV_1.fq.gz", "fastq", 532189753.0, 19043107.0, "GSM2433869 r1", "0:27.95 1:0", "A:138460901;C:107807428;G:115489810;T:170431567;N:47", 27, 0, null, null, 138460901, 107807428, 115489810, 170431567, 47, "SRX2437316", "SRS1872014", "SRA505873", "GEO", "Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institute of Health", 1, 0.86612, null, 0.65562, null, 0.84486, null, 0.53167, null, 26, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2016-12-20", "Adult", "Adult", "Gonad", "Reproductive System"], [41694, "SRR5122166", "SRX2437315", "SRS1872013", "SRP095411", "PRJNA358209", "Identification of a specific 13 miRNA expression signature during follicle activation in Zebrafish", "GSE92639", "Transcriptome Analysis", "Purpose: We aimed to investigate important miRNA events and to define specific miRNA expression signature underlying the follicle activation of zebrafish. Methods: By using small and regular RNA sequencing  we performed transcriptomic analyses of PG primary growth stage I; inactive and PV pre vitellogenic stage II; activated follicles to decipher important miRNA and gene events underlying follicle activation of zebrafish. We identified differentially expressed miRNAs for subsequent qPCR validation and miRNA::target gene prediction. Interaction of candidate miRNA:: target gene pairs were further validated by luciferase reporter assay. Global gene networks involved during PG to PV transition were also assessed by Gene Ontology as well as KEGG pathway analyses. Results and Conclusion: Our expression results indicated that PG follicles can be well differentiated from PV follicles by simply using a specific 13 miRNA expression signature let 7a   7b   7c 5p   7d 5p   7h   7i; miR 21   23a   27c 3p   107a 3p   125b 5p   145 3p   202 5p. Besides  we validated interactions of let 7i::atg4a  miR 202 5p::c23h20orf24 and miR 144::ybx1 by luciferase reporter assay. Purpose: we aimed to investigate important miRNA events and to define specific miRNA expression signature underlying the follicle activation of zebrafish Overall design: To identify differentially expressed miRNAs and its potential downstream targets during follicle activation of zebrafish  we carried out transcriptomic profiling by both small and regular RNA sequencing. By intersecting gene lists of the online predicted targets and RNA seq derived differentially expressed transcripts with a reciprocal expression pattern of miRNAs  we shortlisted 6 pairs of miRNA::target gene for validation using luciferase reporter assay.", null, "pubmed:29228146", null, "PG small RNA seq 1", "GSM2433868", null, "tissue:Ovarian follicle|strain:AB|cell type:Primary growth follicle|age:from ovary of 3 month zebrafish", "PG small RNA seq 1", "For the RNA seq data  all the pair end reads were mapped to the zebrafish genome  using TopHat version 2.0.11. Genome annotation files with GTF format for known genes were downloaded from Ensembl. FPKM and RPKM values were calculated for each miRNA and gene respectively using Cufflinks software version 2.2.1 with default parameters. Genome build: Zv9 Ensembl release 79 Supplementary files format and content: tab delimited text files include FFKM for each mRNA transcript; tab delimited text files include RFKM for each miRNA.", "Ovarian follicle", "Ovaries from 3 mpf adult zebrafish were dissected in 60% medium of Leibovitz L 15 and follicles PG PV were sorted out according to the size and morphology.", "RNA was extracted with miRNeasy and RNAeasy extraction kits Qiagen RNA Seq libraries were constructed according to Illumima TrueSeq and small RNA seq protocol  and sequenced with the Illumina Hiseq 2000 Single end sequencing and pair end sequencing were used for small RNA seq library and RNA seq library  respectively", "AB fish was housed under a stable flow through condition at 28\u00b0C on a 14L:10D photoperiod with the light on at 0800 and off at 2200. Fish were fed regularly twice a day with live brine shrimp with supplement of commercial tropical fish food at a fixed time basis.", "strain:AB|cell type:Primary growth follicle|age:from ovary of 3 month zebrafish", "GSM2433868", "GSM2433868: PG small RNA seq 1; Danio rerio; ncRNA Seq", "GSM2433868", null, "1", "RNA was extracted with miRNeasy and RNAeasy extraction kits Qiagen RNA Seq libraries were constructed according to Illumima TrueSeq and small RNA seq protocol  and sequenced with the Illumina Hiseq 2000 Single end sequencing and pair end sequencing were used for small RNA seq library and RNA seq library  respectively", "GEO Accession:GSM2433868", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP095411", null, null, "Ctrl_PG_1.fq.gz", "fastq", 368945203.0, 13147324.0, "GSM2433868 r1", "0:28.06 1:0", "A:96466912;C:75527992;G:78177838;T:118772423;N:38", 28, 0, null, null, 96466912, 75527992, 78177838, 118772423, 38, "SRX2437315", "SRS1872013", "SRA505873", "GEO", "Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institute of Health", 1, 0.8524, null, 0.67638, null, 0.86074, null, 0.48958, null, 27, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2016-12-20", "Adult", "Adult", "Gonad", "Reproductive System"], [44967, "SRR6345660", "SRX3442976", "SRS2733636", "SRP126106", "PRJNA421016", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]", "GSE107682", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "smRNA seq library of ovary from tdrd6a mut fish", "GSM2875719", null, "source name:Ovary from tdrd6a mut fish|tissue:whole ovary|genotype:tdrd6a mutant", "smRNA seq library of ovary from tdrd6a mut fish", "1. Adapter trimming with cutadapt  O 8  m 26  M 38  a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter   q 20  p 100  Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end  using a custom bash script. 4. UMIs were trimmed with seqtk trimfq  b 4  a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq  L 15\u00a0 6. Mapping was done to Zebrafish  Danio rerio  genome assembly Zv9 with bowtie v0.12.8   tryhard   best   strata   chunkmbs 256  v 1  M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed  bg  split  scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.\u00a0 \u00a0 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE  SINE  LTR and DNA downloaded from the UCSC genome browser repeat masker track  Zv9 using bedtools intersect  a reads  b transposons  wa  wb  bed  f 1.0  nonamecheck to keep both the read and the transposon information. The arguments  s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re  start re  end re  repFamily  repName strand re  and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons  and readlength the length of the read that. Sample is the sample name  and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.\u00a0 Supplementary files format and content: Files ending in .bw are bigwig tracks.", "Ovary from tdrd6a mut fish", null, "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", null, "tissue:whole ovary|genotype:tdrd6a mutant", "GSM2875719", "GSM2875719: smRNA seq library of ovary from tdrd6a mut fish; Danio rerio; ncRNA Seq", "GSM2875719", null, "1", "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", "GEO Accession:GSM2875719", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP126106", null, null, "Tdrd6a-mut-ovary-input-Adult.fastq.gz", "fastq", 817885062.0, 16036962.0, "GSM2875719 r1", "0:51", "A:212456064;C:163491733;G:233627239;T:208262707;N:47319", 51, null, null, null, 212456064, 163491733, 233627239, 208262707, 47319, "SRX3442976", "SRS2733636", "SRA636010", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.46308, null, 0.13668, null, 0.83587, null, 0.79104, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "5prime", "size_fractionation", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2017-12-04", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [44968, "SRR6345659", "SRX3442975", "SRS2733637", "SRP126106", "PRJNA421016", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]", "GSE107682", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "smRNA seq library of ovary from tdrd6a het fish", "GSM2875718", null, "source name:Ovary from tdrd6a het fish|tissue:whole ovary|genotype:tdrd6a heterozygous", "smRNA seq library of ovary from tdrd6a het fish", "1. Adapter trimming with cutadapt  O 8  m 26  M 38  a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter   q 20  p 100  Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end  using a custom bash script. 4. UMIs were trimmed with seqtk trimfq  b 4  a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq  L 15\u00a0 6. Mapping was done to Zebrafish  Danio rerio  genome assembly Zv9 with bowtie v0.12.8   tryhard   best   strata   chunkmbs 256  v 1  M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed  bg  split  scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.\u00a0 \u00a0 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE  SINE  LTR and DNA downloaded from the UCSC genome browser repeat masker track  Zv9 using bedtools intersect  a reads  b transposons  wa  wb  bed  f 1.0  nonamecheck to keep both the read and the transposon information. The arguments  s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re  start re  end re  repFamily  repName strand re  and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons  and readlength the length of the read that. Sample is the sample name  and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.\u00a0 Supplementary files format and content: Files ending in .bw are bigwig tracks.", "Ovary from tdrd6a het fish", null, "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", null, "tissue:whole ovary|genotype:tdrd6a heterozygous", "GSM2875718", "GSM2875718: smRNA seq library of ovary from tdrd6a het fish; Danio rerio; ncRNA Seq", "GSM2875718", null, "1", "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", "GEO Accession:GSM2875718", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP126106", null, null, "Tdrd6a-het-ovary-input-Adult.fastq.gz", "fastq", 1452353571.0, 28477521.0, "GSM2875718 r1", "0:51", "A:397993735;C:284194126;G:396142390;T:373939235;N:84085", 51, null, null, null, 397993735, 284194126, 396142390, 373939235, 84085, "SRX3442975", "SRS2733637", "SRA636010", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.3869, null, 0.1369, null, 0.86397, null, 0.77165, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "5prime", "size_fractionation", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2017-12-04", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [44969, "SRR6345658", "SRX3442974", "SRS2733632", "SRP126106", "PRJNA421016", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]", "GSE107682", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "smRNA seq library of late oocytes from tdrd6a hett fish", "GSM2875717", null, "source name:late oocytes from tdrd6a hett fish|tissue:late oocytes|genotype:tdrd6a heterozygous", "smRNA seq library of late oocytes from tdrd6a hett fish", "1. Adapter trimming with cutadapt  O 8  m 26  M 38  a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter   q 20  p 100  Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end  using a custom bash script. 4. UMIs were trimmed with seqtk trimfq  b 4  a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq  L 15\u00a0 6. Mapping was done to Zebrafish  Danio rerio  genome assembly Zv9 with bowtie v0.12.8   tryhard   best   strata   chunkmbs 256  v 1  M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed  bg  split  scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.\u00a0 \u00a0 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE  SINE  LTR and DNA downloaded from the UCSC genome browser repeat masker track  Zv9 using bedtools intersect  a reads  b transposons  wa  wb  bed  f 1.0  nonamecheck to keep both the read and the transposon information. The arguments  s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re  start re  end re  repFamily  repName strand re  and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons  and readlength the length of the read that. Sample is the sample name  and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.\u00a0 Supplementary files format and content: Files ending in .bw are bigwig tracks.", "late oocytes from tdrd6a hett fish", null, "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", null, "tissue:late oocytes|genotype:tdrd6a heterozygous", "GSM2875717", "GSM2875717: smRNA seq library of late oocytes from tdrd6a hett fish; Danio rerio; ncRNA Seq", "GSM2875717", null, "1", "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", "GEO Accession:GSM2875717", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP126106", null, null, "tdrd6a-het_oocytes-late-input.fastq.gz", "fastq", 1884769630.0, 28130890.0, "GSM2875717 r1", "0:67", "A:519051884;C:437635381;G:510738306;T:417295309;N:48750", 67, null, null, null, 519051884, 437635381, 510738306, 417295309, 48750, "SRX3442974", "SRS2733632", "SRA636010", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.17778, null, 0.06655, null, 0.95931, null, 0.91529, null, 67, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "5prime", "size_fractionation", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2017-12-04", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [44970, "SRR6345657", "SRX3442973", "SRS2733634", "SRP126106", "PRJNA421016", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]", "GSE107682", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "smRNA seq library of early oocytes from tdrd6a mut fish", "GSM2875716", null, "source name:early oocytes from tdrd6a mut fish|tissue:early oocytes|genotype:tdrd6a mutant", "smRNA seq library of early oocytes from tdrd6a mut fish", "1. Adapter trimming with cutadapt  O 8  m 26  M 38  a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter   q 20  p 100  Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end  using a custom bash script. 4. UMIs were trimmed with seqtk trimfq  b 4  a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq  L 15\u00a0 6. Mapping was done to Zebrafish  Danio rerio  genome assembly Zv9 with bowtie v0.12.8   tryhard   best   strata   chunkmbs 256  v 1  M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed  bg  split  scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.\u00a0 \u00a0 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE  SINE  LTR and DNA downloaded from the UCSC genome browser repeat masker track  Zv9 using bedtools intersect  a reads  b transposons  wa  wb  bed  f 1.0  nonamecheck to keep both the read and the transposon information. The arguments  s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re  start re  end re  repFamily  repName strand re  and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons  and readlength the length of the read that. Sample is the sample name  and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.\u00a0 Supplementary files format and content: Files ending in .bw are bigwig tracks.", "early oocytes from tdrd6a mut fish", null, "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", null, "tissue:early oocytes|genotype:tdrd6a mutant", "GSM2875716", "GSM2875716: smRNA seq library of early oocytes from tdrd6a mut fish; Danio rerio; ncRNA Seq", "GSM2875716", null, "1", "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", "GEO Accession:GSM2875716", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP126106", null, null, "tdrd6a-mut_oocytes-early-input.fastq.gz", "fastq", 2102216723.0, 31376369.0, "GSM2875716 r1", "0:67", "A:592618102;C:472348913;G:550028898;T:487165955;N:54855", 67, null, null, null, 592618102, 472348913, 550028898, 487165955, 54855, "SRX3442973", "SRS2733634", "SRA636010", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.08293, null, 0.04595, null, 0.96193, null, 0.77321, null, 67, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "5prime", "size_fractionation", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2017-12-04", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [44971, "SRR6345656", "SRX3442972", "SRS2733635", "SRP126106", "PRJNA421016", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]", "GSE107682", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "smRNA seq library of late oocytes from tdrd6a mut fish", "GSM2875715", null, "source name:late oocytes from tdrd6a mut fish|tissue:late oocytes|genotype:tdrd6a mutant", "smRNA seq library of late oocytes from tdrd6a mut fish", "1. Adapter trimming with cutadapt  O 8  m 26  M 38  a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter   q 20  p 100  Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end  using a custom bash script. 4. UMIs were trimmed with seqtk trimfq  b 4  a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq  L 15\u00a0 6. Mapping was done to Zebrafish  Danio rerio  genome assembly Zv9 with bowtie v0.12.8   tryhard   best   strata   chunkmbs 256  v 1  M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed  bg  split  scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.\u00a0 \u00a0 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE  SINE  LTR and DNA downloaded from the UCSC genome browser repeat masker track  Zv9 using bedtools intersect  a reads  b transposons  wa  wb  bed  f 1.0  nonamecheck to keep both the read and the transposon information. The arguments  s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re  start re  end re  repFamily  repName strand re  and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons  and readlength the length of the read that. Sample is the sample name  and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.\u00a0 Supplementary files format and content: Files ending in .bw are bigwig tracks.", "late oocytes from tdrd6a mut fish", null, "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", null, "tissue:late oocytes|genotype:tdrd6a mutant", "GSM2875715", "GSM2875715: smRNA seq library of late oocytes from tdrd6a mut fish; Danio rerio; ncRNA Seq", "GSM2875715", null, "1", "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", "GEO Accession:GSM2875715", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP126106", null, null, "tdrd6a-mut_oocytes-late-input.fastq.gz", "fastq", 2110760295.0, 31503885.0, "GSM2875715 r1", "0:67", "A:582021495;C:486821539;G:582933348;T:458929133;N:54780", 67, null, null, null, 582021495, 486821539, 582933348, 458929133, 54780, "SRX3442972", "SRS2733635", "SRA636010", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.17064, null, 0.06728, null, 0.96173, null, 0.9114, null, 67, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "5prime", "size_fractionation", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2017-12-04", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [44972, "SRR6345655", "SRX3442971", "SRS2733633", "SRP126106", "PRJNA421016", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]", "GSE107682", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "smRNA seq library of early oocytes from tdrd6a het fish", "GSM2875714", null, "source name:early oocytes from tdrd6a het fish|tissue:Early oocytes|genotype:tdrd6a heterozygous", "smRNA seq library of early oocytes from tdrd6a het fish", "1. Adapter trimming with cutadapt  O 8  m 26  M 38  a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter   q 20  p 100  Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end  using a custom bash script. 4. UMIs were trimmed with seqtk trimfq  b 4  a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq  L 15\u00a0 6. Mapping was done to Zebrafish  Danio rerio  genome assembly Zv9 with bowtie v0.12.8   tryhard   best   strata   chunkmbs 256  v 1  M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed  bg  split  scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.\u00a0 \u00a0 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE  SINE  LTR and DNA downloaded from the UCSC genome browser repeat masker track  Zv9 using bedtools intersect  a reads  b transposons  wa  wb  bed  f 1.0  nonamecheck to keep both the read and the transposon information. The arguments  s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re  start re  end re  repFamily  repName strand re  and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons  and readlength the length of the read that. Sample is the sample name  and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.\u00a0 Supplementary files format and content: Files ending in .bw are bigwig tracks.", "early oocytes from tdrd6a het fish", null, "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", null, "tissue:Early oocytes|genotype:tdrd6a heterozygous", "GSM2875714", "GSM2875714: smRNA seq library of early oocytes from tdrd6a het fish; Danio rerio; ncRNA Seq", "GSM2875714", null, "1", "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", "GEO Accession:GSM2875714", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP126106", null, null, "tdrd6a-het_oocytes-early-input.fastq.gz", "fastq", 2243425655.0, 33483965.0, "GSM2875714 r1", "0:67", "A:633468129;C:503239215;G:592089295;T:514571679;N:57337", 67, null, null, null, 633468129, 503239215, 592089295, 514571679, 57337, "SRX3442971", "SRS2733633", "SRA636010", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.06641, null, 0.04254, null, 0.96806, null, 0.58509, null, 67, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "5prime", "size_fractionation", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2017-12-04", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [52326, "SRR9119512", "SRX5893495", "SRS4815090", "SRP199448", "PRJNA544696", "Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells", "GSE131759", "Transcriptome Analysis", "MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus  pituitary  and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH  which in turn  induces the secretion of maturation inducing hormone MIH from the ovary.  It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid  to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature.  To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles  we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing.  It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore  bioinformatics analysis revealed the presence of 214 known  31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated  and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs  dre miR 22a 3p  dre miR 16a  dre miR 181a 3p  and dre miR 29a  was validated by real time PCR. Finally  gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function  including oocyte maturation. Taken together  this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles.  The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.", null, "pubmed:31417497", null, "IIIb 3", "GSM3816534", null, "source name:stage IIIb follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIb", "IIIb 3", "LC Sciences in house program ACGT101 miR program  was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences  Houston  Texas  USA. Adaptor dimers  junk  low complexity  common RNA families and repeats were removed  and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure  whose genomic coordinates should not overlap with known pre miRNAs included in this analysis  were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample", "stage IIIb follicular cells", null, "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:ovary|cell type:follicular cells|developmental stage:IIIb", "GSM3816534", "GSM3816534: IIIb 3; Danio rerio; miRNA Seq", "GSM3816534", null, "1", "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3816534", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP199448", null, null, "HI.2030.005.RPI10.IIIb_3_R1.fastq.gz", "fastq", 1449340900.0, 28986818.0, "GSM3816534 r1", "0:50 1:0", "A:351029701;C:324452324;G:401722902;T:371889768;N:246205", 50, 0, null, null, 351029701, 324452324, 401722902, 371889768, 246205, "SRX5893495", "SRS4815090", "SRA890399", "GEO", "Biology, YorkU", 1, 0.08662, null, 0.01333, null, 0.96213, null, 0.83838, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-05-24", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [52327, "SRR9119513", "SRX5893495", "SRS4815090", "SRP199448", "PRJNA544696", "Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells", "GSE131759", "Transcriptome Analysis", "MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus  pituitary  and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH  which in turn  induces the secretion of maturation inducing hormone MIH from the ovary.  It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid  to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature.  To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles  we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing.  It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore  bioinformatics analysis revealed the presence of 214 known  31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated  and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs  dre miR 22a 3p  dre miR 16a  dre miR 181a 3p  and dre miR 29a  was validated by real time PCR. Finally  gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function  including oocyte maturation. Taken together  this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles.  The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.", null, "pubmed:31417497", null, "IIIb 3", "GSM3816534", null, "source name:stage IIIb follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIb", "IIIb 3", "LC Sciences in house program ACGT101 miR program  was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences  Houston  Texas  USA. Adaptor dimers  junk  low complexity  common RNA families and repeats were removed  and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure  whose genomic coordinates should not overlap with known pre miRNAs included in this analysis  were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample", "stage IIIb follicular cells", null, "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:ovary|cell type:follicular cells|developmental stage:IIIb", "GSM3816534", "GSM3816534: IIIb 3; Danio rerio; miRNA Seq", "GSM3816534", null, "1", "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3816534", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP199448", null, null, "HI.2030.006.RPI10.IIIb_3_R1.fastq", "fastq", 1447621100.0, 28952422.0, "GSM3816534 r2", "0:50 1:0", "A:350650304;C:324162528;G:401055729;T:371582418;N:170121", 50, 0, null, null, 350650304, 324162528, 401055729, 371582418, 170121, "SRX5893495", "SRS4815090", "SRA890399", "GEO", "Biology, YorkU", 1, 0.08676, null, 0.01312, null, 0.96282, null, 0.84604, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-05-24", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [52328, "SRR9119510", "SRX5893494", "SRS4815089", "SRP199448", "PRJNA544696", "Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells", "GSE131759", "Transcriptome Analysis", "MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus  pituitary  and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH  which in turn  induces the secretion of maturation inducing hormone MIH from the ovary.  It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid  to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature.  To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles  we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing.  It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore  bioinformatics analysis revealed the presence of 214 known  31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated  and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs  dre miR 22a 3p  dre miR 16a  dre miR 181a 3p  and dre miR 29a  was validated by real time PCR. Finally  gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function  including oocyte maturation. Taken together  this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles.  The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.", null, "pubmed:31417497", null, "IIIb 2", "GSM3816533", null, "source name:stage IIIb follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIb", "IIIb 2", "LC Sciences in house program ACGT101 miR program  was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences  Houston  Texas  USA. Adaptor dimers  junk  low complexity  common RNA families and repeats were removed  and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure  whose genomic coordinates should not overlap with known pre miRNAs included in this analysis  were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample", "stage IIIb follicular cells", null, "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:ovary|cell type:follicular cells|developmental stage:IIIb", "GSM3816533", "GSM3816533: IIIb 2; Danio rerio; miRNA Seq", "GSM3816533", null, "1", "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3816533", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP199448", null, null, "HI.2030.005.RPI9.IIIb_2_R1.fastq.gz", "fastq", 1012538750.0, 20250775.0, "GSM3816533 r1", "0:50 1:0", "A:242873339;C:228078637;G:287889366;T:253526026;N:171382", 50, 0, null, null, 242873339, 228078637, 287889366, 253526026, 171382, "SRX5893494", "SRS4815089", "SRA890399", "GEO", "Biology, YorkU", 1, 0.04745, null, 0.00802, null, 0.968, null, 0.75298, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-05-24", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [52329, "SRR9119511", "SRX5893494", "SRS4815089", "SRP199448", "PRJNA544696", "Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells", "GSE131759", "Transcriptome Analysis", "MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus  pituitary  and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH  which in turn  induces the secretion of maturation inducing hormone MIH from the ovary.  It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid  to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature.  To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles  we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing.  It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore  bioinformatics analysis revealed the presence of 214 known  31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated  and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs  dre miR 22a 3p  dre miR 16a  dre miR 181a 3p  and dre miR 29a  was validated by real time PCR. Finally  gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function  including oocyte maturation. Taken together  this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles.  The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.", null, "pubmed:31417497", null, "IIIb 2", "GSM3816533", null, "source name:stage IIIb follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIb", "IIIb 2", "LC Sciences in house program ACGT101 miR program  was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences  Houston  Texas  USA. Adaptor dimers  junk  low complexity  common RNA families and repeats were removed  and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure  whose genomic coordinates should not overlap with known pre miRNAs included in this analysis  were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample", "stage IIIb follicular cells", null, "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:ovary|cell type:follicular cells|developmental stage:IIIb", "GSM3816533", "GSM3816533: IIIb 2; Danio rerio; miRNA Seq", "GSM3816533", null, "1", "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3816533", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP199448", null, null, "HI.2030.006.RPI9.IIIb_2_R1.fastq", "fastq", 1010559400.0, 20211188.0, "GSM3816533 r2", "0:50 1:0", "A:242471282;C:227664296;G:287157957;T:253147388;N:118477", 50, 0, null, null, 242471282, 227664296, 287157957, 253147388, 118477, "SRX5893494", "SRS4815089", "SRA890399", "GEO", "Biology, YorkU", 1, 0.04679, null, 0.008, null, 0.96946, null, 0.71268, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-05-24", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [52330, "SRR9119508", "SRX5893493", "SRS4815088", "SRP199448", "PRJNA544696", "Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells", "GSE131759", "Transcriptome Analysis", "MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus  pituitary  and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH  which in turn  induces the secretion of maturation inducing hormone MIH from the ovary.  It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid  to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature.  To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles  we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing.  It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore  bioinformatics analysis revealed the presence of 214 known  31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated  and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs  dre miR 22a 3p  dre miR 16a  dre miR 181a 3p  and dre miR 29a  was validated by real time PCR. Finally  gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function  including oocyte maturation. Taken together  this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles.  The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.", null, "pubmed:31417497", null, "IIIb 1", "GSM3816532", null, "source name:stage IIIb follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIb", "IIIb 1", "LC Sciences in house program ACGT101 miR program  was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences  Houston  Texas  USA. Adaptor dimers  junk  low complexity  common RNA families and repeats were removed  and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure  whose genomic coordinates should not overlap with known pre miRNAs included in this analysis  were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample", "stage IIIb follicular cells", null, "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:ovary|cell type:follicular cells|developmental stage:IIIb", "GSM3816532", "GSM3816532: IIIb 1; Danio rerio; miRNA Seq", "GSM3816532", null, "1", "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3816532", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP199448", null, null, "HI.2030.005.RPI8.IIIb_1_R1.fastq.gz", "fastq", 1443846950.0, 28876939.0, "GSM3816532 r1", "0:50 1:0", "A:350805103;C:319766230;G:407583206;T:365448522;N:243889", 50, 0, null, null, 350805103, 319766230, 407583206, 365448522, 243889, "SRX5893493", "SRS4815088", "SRA890399", "GEO", "Biology, YorkU", 1, 0.02559, null, 0.00389, null, 0.98407, null, 0.82023, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-05-24", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [52331, "SRR9119509", "SRX5893493", "SRS4815088", "SRP199448", "PRJNA544696", "Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells", "GSE131759", "Transcriptome Analysis", "MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus  pituitary  and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH  which in turn  induces the secretion of maturation inducing hormone MIH from the ovary.  It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid  to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature.  To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles  we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing.  It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore  bioinformatics analysis revealed the presence of 214 known  31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated  and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs  dre miR 22a 3p  dre miR 16a  dre miR 181a 3p  and dre miR 29a  was validated by real time PCR. Finally  gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function  including oocyte maturation. Taken together  this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles.  The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.", null, "pubmed:31417497", null, "IIIb 1", "GSM3816532", null, "source name:stage IIIb follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIb", "IIIb 1", "LC Sciences in house program ACGT101 miR program  was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences  Houston  Texas  USA. Adaptor dimers  junk  low complexity  common RNA families and repeats were removed  and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure  whose genomic coordinates should not overlap with known pre miRNAs included in this analysis  were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample", "stage IIIb follicular cells", null, "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:ovary|cell type:follicular cells|developmental stage:IIIb", "GSM3816532", "GSM3816532: IIIb 1; Danio rerio; miRNA Seq", "GSM3816532", null, "1", "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3816532", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP199448", null, null, "HI.2030.006.RPI8.IIIb_1_R1.fastq", "fastq", 1442694250.0, 28853885.0, "GSM3816532 r2", "0:50 1:0", "A:350607715;C:319569609;G:407049947;T:365297986;N:168993", 50, 0, null, null, 350607715, 319569609, 407049947, 365297986, 168993, "SRX5893493", "SRS4815088", "SRA890399", "GEO", "Biology, YorkU", 1, 0.02565, null, 0.00409, null, 0.98417, null, 0.81633, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-05-24", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [52332, "SRR9119506", "SRX5893492", "SRS4815087", "SRP199448", "PRJNA544696", "Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells", "GSE131759", "Transcriptome Analysis", "MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus  pituitary  and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH  which in turn  induces the secretion of maturation inducing hormone MIH from the ovary.  It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid  to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature.  To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles  we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing.  It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore  bioinformatics analysis revealed the presence of 214 known  31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated  and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs  dre miR 22a 3p  dre miR 16a  dre miR 181a 3p  and dre miR 29a  was validated by real time PCR. Finally  gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function  including oocyte maturation. Taken together  this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles.  The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.", null, "pubmed:31417497", null, "IIIa 3", "GSM3816531", null, "source name:stage IIIa follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIa", "IIIa 3", "LC Sciences in house program ACGT101 miR program  was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences  Houston  Texas  USA. Adaptor dimers  junk  low complexity  common RNA families and repeats were removed  and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure  whose genomic coordinates should not overlap with known pre miRNAs included in this analysis  were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample", "stage IIIa follicular cells", null, "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:ovary|cell type:follicular cells|developmental stage:IIIa", "GSM3816531", "GSM3816531: IIIa 3; Danio rerio; miRNA Seq", "GSM3816531", null, "1", "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3816531", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP199448", null, null, "HI.2030.005.RPI4.IIIa_3_R1.fastq.gz", "fastq", 1324489100.0, 26489782.0, "GSM3816531 r1", "0:50 1:0", "A:333465386;C:289207984;G:364882545;T:336711699;N:221486", 50, 0, null, null, 333465386, 289207984, 364882545, 336711699, 221486, "SRX5893492", "SRS4815087", "SRA890399", "GEO", "Biology, YorkU", 1, 0.02703, null, 0.00432, null, 0.98313, null, 0.75385, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-05-24", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [52333, "SRR9119507", "SRX5893492", "SRS4815087", "SRP199448", "PRJNA544696", "Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells", "GSE131759", "Transcriptome Analysis", "MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus  pituitary  and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH  which in turn  induces the secretion of maturation inducing hormone MIH from the ovary.  It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid  to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature.  To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles  we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing.  It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore  bioinformatics analysis revealed the presence of 214 known  31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated  and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs  dre miR 22a 3p  dre miR 16a  dre miR 181a 3p  and dre miR 29a  was validated by real time PCR. Finally  gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function  including oocyte maturation. Taken together  this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles.  The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.", null, "pubmed:31417497", null, "IIIa 3", "GSM3816531", null, "source name:stage IIIa follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIa", "IIIa 3", "LC Sciences in house program ACGT101 miR program  was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences  Houston  Texas  USA. Adaptor dimers  junk  low complexity  common RNA families and repeats were removed  and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure  whose genomic coordinates should not overlap with known pre miRNAs included in this analysis  were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample", "stage IIIa follicular cells", null, "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:ovary|cell type:follicular cells|developmental stage:IIIa", "GSM3816531", "GSM3816531: IIIa 3; Danio rerio; miRNA Seq", "GSM3816531", null, "1", "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3816531", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP199448", null, null, "HI.2030.006.RPI4.IIIa_3_R1.fastq", "fastq", 1322554650.0, 26451093.0, "GSM3816531 r2", "0:50 1:0", "A:333031673;C:288843797;G:364209143;T:336315522;N:154515", 50, 0, null, null, 333031673, 288843797, 364209143, 336315522, 154515, "SRX5893492", "SRS4815087", "SRA890399", "GEO", "Biology, YorkU", 1, 0.02671, null, 0.00422, null, 0.98283, null, 0.76748, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-05-24", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [52334, "SRR9119504", "SRX5893491", "SRS4815086", "SRP199448", "PRJNA544696", "Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells", "GSE131759", "Transcriptome Analysis", "MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus  pituitary  and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH  which in turn  induces the secretion of maturation inducing hormone MIH from the ovary.  It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid  to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature.  To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles  we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing.  It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore  bioinformatics analysis revealed the presence of 214 known  31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated  and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs  dre miR 22a 3p  dre miR 16a  dre miR 181a 3p  and dre miR 29a  was validated by real time PCR. Finally  gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function  including oocyte maturation. Taken together  this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles.  The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.", null, "pubmed:31417497", null, "IIIa 2", "GSM3816530", null, "source name:stage IIIa follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIa", "IIIa 2", "LC Sciences in house program ACGT101 miR program  was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences  Houston  Texas  USA. Adaptor dimers  junk  low complexity  common RNA families and repeats were removed  and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure  whose genomic coordinates should not overlap with known pre miRNAs included in this analysis  were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample", "stage IIIa follicular cells", null, "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:ovary|cell type:follicular cells|developmental stage:IIIa", "GSM3816530", "GSM3816530: IIIa 2; Danio rerio; miRNA Seq", "GSM3816530", null, "1", "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3816530", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP199448", null, null, "HI.2030.005.RPI3.IIIa_2_R1.fastq.gz", "fastq", 1382308600.0, 27646172.0, "GSM3816530 r1", "0:50 1:0", "A:342206537;C:301597185;G:385756857;T:352517232;N:230789", 50, 0, null, null, 342206537, 301597185, 385756857, 352517232, 230789, "SRX5893491", "SRS4815086", "SRA890399", "GEO", "Biology, YorkU", 1, 0.05315, null, 0.00892, null, 0.9643, null, 0.79967, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-05-24", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [52335, "SRR9119505", "SRX5893491", "SRS4815086", "SRP199448", "PRJNA544696", "Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells", "GSE131759", "Transcriptome Analysis", "MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus  pituitary  and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH  which in turn  induces the secretion of maturation inducing hormone MIH from the ovary.  It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid  to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature.  To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles  we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing.  It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore  bioinformatics analysis revealed the presence of 214 known  31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated  and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs  dre miR 22a 3p  dre miR 16a  dre miR 181a 3p  and dre miR 29a  was validated by real time PCR. Finally  gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function  including oocyte maturation. Taken together  this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles.  The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.", null, "pubmed:31417497", null, "IIIa 2", "GSM3816530", null, "source name:stage IIIa follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIa", "IIIa 2", "LC Sciences in house program ACGT101 miR program  was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences  Houston  Texas  USA. Adaptor dimers  junk  low complexity  common RNA families and repeats were removed  and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure  whose genomic coordinates should not overlap with known pre miRNAs included in this analysis  were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample", "stage IIIa follicular cells", null, "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:ovary|cell type:follicular cells|developmental stage:IIIa", "GSM3816530", "GSM3816530: IIIa 2; Danio rerio; miRNA Seq", "GSM3816530", null, "1", "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3816530", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP199448", null, null, "HI.2030.006.RPI3.IIIa_2_R1.fastq", "fastq", 1383050750.0, 27661015.0, "GSM3816530 r2", "0:50 1:0", "A:342441286;C:301828080;G:385820344;T:352800933;N:160107", 50, 0, null, null, 342441286, 301828080, 385820344, 352800933, 160107, "SRX5893491", "SRS4815086", "SRA890399", "GEO", "Biology, YorkU", 1, 0.0533, null, 0.00892, null, 0.96323, null, 0.81292, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-05-24", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [52336, "SRR9119502", "SRX5893490", "SRS4815085", "SRP199448", "PRJNA544696", "Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells", "GSE131759", "Transcriptome Analysis", "MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus  pituitary  and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH  which in turn  induces the secretion of maturation inducing hormone MIH from the ovary.  It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid  to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature.  To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles  we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing.  It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore  bioinformatics analysis revealed the presence of 214 known  31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated  and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs  dre miR 22a 3p  dre miR 16a  dre miR 181a 3p  and dre miR 29a  was validated by real time PCR. Finally  gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function  including oocyte maturation. Taken together  this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles.  The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.", null, "pubmed:31417497", null, "IIIa 1", "GSM3816529", null, "source name:stage IIIa follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIa", "IIIa 1", "LC Sciences in house program ACGT101 miR program  was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences  Houston  Texas  USA. Adaptor dimers  junk  low complexity  common RNA families and repeats were removed  and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure  whose genomic coordinates should not overlap with known pre miRNAs included in this analysis  were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample", "stage IIIa follicular cells", null, "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:ovary|cell type:follicular cells|developmental stage:IIIa", "GSM3816529", "GSM3816529: IIIa 1; Danio rerio; miRNA Seq", "GSM3816529", null, "1", "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3816529", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP199448", null, null, "HI.2030.005.RPI2.IIIa_1_R1.fastq.gz", "fastq", 1333818450.0, 26676369.0, "GSM3816529 r1", "0:50 1:0", "A:320039883;C:296663387;G:380656068;T:336233800;N:225312", 50, 0, null, null, 320039883, 296663387, 380656068, 336233800, 225312, "SRX5893490", "SRS4815085", "SRA890399", "GEO", "Biology, YorkU", 1, 0.0976, null, 0.019, null, 0.93718, null, 0.75404, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-05-24", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [52337, "SRR9119503", "SRX5893490", "SRS4815085", "SRP199448", "PRJNA544696", "Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells", "GSE131759", "Transcriptome Analysis", "MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus  pituitary  and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH  which in turn  induces the secretion of maturation inducing hormone MIH from the ovary.  It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid  to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature.  To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles  we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing.  It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore  bioinformatics analysis revealed the presence of 214 known  31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated  and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs  dre miR 22a 3p  dre miR 16a  dre miR 181a 3p  and dre miR 29a  was validated by real time PCR. Finally  gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function  including oocyte maturation. Taken together  this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles.  The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.", null, "pubmed:31417497", null, "IIIa 1", "GSM3816529", null, "source name:stage IIIa follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIa", "IIIa 1", "LC Sciences in house program ACGT101 miR program  was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences  Houston  Texas  USA. Adaptor dimers  junk  low complexity  common RNA families and repeats were removed  and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure  whose genomic coordinates should not overlap with known pre miRNAs included in this analysis  were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample", "stage IIIa follicular cells", null, "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:ovary|cell type:follicular cells|developmental stage:IIIa", "GSM3816529", "GSM3816529: IIIa 1; Danio rerio; miRNA Seq", "GSM3816529", null, "1", "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3816529", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP199448", null, null, "HI.2030.006.RPI2.IIIa_1_R1.fastq", "fastq", 1334152750.0, 26683055.0, "GSM3816529 r2", "0:50 1:0", "A:320194547;C:296827909;G:380547854;T:336424243;N:158197", 50, 0, null, null, 320194547, 296827909, 380547854, 336424243, 158197, "SRX5893490", "SRS4815085", "SRA890399", "GEO", "Biology, YorkU", 1, 0.09727, null, 0.01947, null, 0.93866, null, 0.76527, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-05-24", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [58547, "SRR13652350", "SRX10049113", "SRS8212340", "SRP253438", "PRJNA613601", "five prime half of specific tRNAs feeds back to promote corresponding tRNA gene transcription in vertebrate embryos [small RNA Seq  ssDRIP seq]", "GSE147253", "Other", "five primetRFls are small tRNA fragments derived from five prime half of mature tRNAs. However  it is unknown whether five primetRFls could feed back to regulate tRNA biogenesis. Here we show that five primetRFlGly/GCC and five primetRFlGlu/CTC function to promote transcription of corresponding tRNA genes and are essential for vertebrate early embryogenesis. During zebrafish embryogenesis  dynamics of five primetRFlGly/GCC and five primetRFlGlu/CTC levels correlates with that of tRNAGly/GCC and tRNAGlu/CTC levels. Morpholino mediated knockdown of five primetRFlGly/GCC or five primetRFlGlu/CTC down regulates tRNAGly/GCC or tRNAGlu/CTC levels respectively  and causes embryonic lethality that is efficiently rescued by co injection of properly refolded corresponding tRNA. In zebrafish embryos  tRNA:DNA and five primetRFl:DNA hybrids commonly exist on the template strand of tRNA genes. Mechanistically  unstable five primetRFl:DNA hybrid may prevent the formation of transcriptionally inhibitory stable tRNA:DNA hybrids on the same tRNA loci so as to facilitate tRNA genes transcription. The uncovered mechanism may be implicated in other physiological and pathological processes. Overall design: For small RNA sequencing   total RNA were extracted respectively from wildtype zebrafish embryos T\u00fcbingen Strain of 6 chosen stages  and then subjected to small RNA library preparation individually. To investigate the distribution and stability of R loop on genome  we performed ssDRIP seq with S9.6 antibody  which specifically recognize RNA:DNA hybrid.  Two replicates from wildtype embryos of 256c  sphere and shield stage were collected to perform ssDRIPseq. RNaseH pre treated genome DNA was used as negative control  which was also performed the standard ssDRIP seq procedure. Genomic DNA extracted from these samples were fragmentated by restriction enzymes  and then immunoprecipitated by S9.6 antibody.The ssDNA strands in RNA:DNA hybrids were purified and subjected to library preparation.", "parent bioproject:PRJNA753013", "pubmed:34797706", null, "Egg ncRNA seq", "GSM5069280", null, "tissue:mature oocyte|strain:Tubingen|developmental stage:Mature Oocyte|treatement:no", "Egg ncRNA seq", "For data processing  reads were quality checked by FastQCVersion 0.11.8  and adaptors were cut off by Cutadapt Version 1.16  and only reads that lay between 18 40 nt were kept. The reads of each sample were first aligned to different database by using Bowtie2  Version 2.3.4.1  count table was generated by featureCounts. Genome build: GRCz11 genome and cDNA   tRNA database GtRNAdb  GRCz11", "mature oocyte", null, "For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube  and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific  15596018. The lysate was centrifuged at 12 000 rpm for 10 min  and the supernatant was collected and mixed with 200 \u03bcl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4\u2103  the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min  followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at  80\u2103 until all samples were collected. Two pretreatment steps were included: First  purified total RNAs were treated with T4 Polynucleotide Kinase NEB  M0201S with ATP for 30 min at 37\u2103  then purified by phenol: chloroform extraction. The aim of this step is removing the 2 3\u2019 cyclic phosphate group from the 3\u2019end of 5\u2019tRFls  and add phosphate group to the 5\u2019end of 3\u2019tRFs. In the second step  total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing:  Small RNA libraries  using 1 \u03bcg RNA each  were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research  then bands of 135 160 bp  about the length of 15 40 nt RNA ligated with both adaptors  were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc  pH 4.5  followed by precipitation by adding 2.5 volumes of ethanol.", null, "strain:Tubingen|developmental stage:Mature Oocyte|treatement:no", "GSM5069280", "GSM5069280: Egg ncRNA seq; Danio rerio; ncRNA Seq", "GSM5069280", null, "1", "For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube  and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific  15596018. The lysate was centrifuged at 12 000 rpm for 10 min  and the supernatant was collected and mixed with 200 \u03bcl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4\u2103  the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min  followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at  80\u2103 until all samples were collected. Two pretreatment steps were included: First  purified total RNAs were treated with T4 Polynucleotide Kinase NEB  M0201S with ATP for 30 min at 37\u2103  then purified by phenol: chloroform extraction. The aim of this step is removing the 2 three prime cyclic phosphate group from the three primeend of five primetRFls  and add phosphate group to the five primeend of three primetRFs. In the second step  total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing:  Small RNA libraries  using 1 \u03bcg RNA each  were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research  then bands of 135 160 bp  about the length of 15 40 nt RNA ligated with both adaptors  were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc  pH 4.5  followed by precipitation by adding 2.5 volumes of ethanol.", "GEO Accession:GSM5069280", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP253438", null, null, "Egg-RNA_seq.fq.gz", "fastq", 4328292000.0, 28855280.0, "GSM5069280 r1", "0:150 1:0", "A:757944111;C:789419055;G:2112325298;T:668359520;N:244016", 150, 0, null, null, 757944111, 789419055, 2112325298, 668359520, 244016, "SRX10049113", "SRS8212340", "SRA1056877", "GEO", "Anming Meng Lab, School of Life Science, Tsinghua University", 1, 0.74704, null, 0.18839, null, 0.83197, null, 0.55802, null, 150, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "5prime", "size_fractionation", "nebnext", "bulk", "unknown", "unknown", null, "China", "2021-02-08", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [60887, "SRR12628234", "SRX9110497", "SRS7353480", "SRP282187", "PRJNA663091", "Characterization of small RNAs in early zebrafish PGCs", "GSE157865", "Transcriptome Analysis", "Microscale small RNA high throughput sequencing was used to study small RNA distribution in early zebrafish PGCs primordial germ cells. We find that early zebrafish PGCs have large quantities of piRNAs and small quantities of miRNAs. Among the miRNAs detected  miR 430 accounted for the majority which has been proved to play diverse roles in zebrafish development. In addition  miR 92a 3p and miR 26a 5p have high expression and previous studies show that these two miRNAs can influence cell proliferation in cancer cells. More experiments should be performed in the future to explore whether miR 92a 3p and miR 26a 5p can influence the number of zebrafish PGCs. Overall design: Small RNA profiles at 6 hpf  shield stage  11 hpf 3 somite stage and 24 hpf prim 5 stage of zebrafish PGCs", null, "pubmed:33506864", null, "h24 2: PGCs 24hpf repeat2", "GSM4777194", null, "source name:PGCs|cell type:primordial germ cells|strain:AB|tissue:gonad", "h24 2: PGCs 24hpf repeat2", "Raw reads were pre processed by FASTX Toolkit version 0.0.14 1 Reads were mapped to danRer11 using bowtie version 1.0.0 5 miRNAs were quantified based on miRBase version 22.0 piRNAs were quantified using proTRAC version 2.2.0 Genome build: danRer11 Supplementary files format and content: tab delimited text file includes read number and RPM of miRNA expression for each sample \u2026", "PGCs", null, "PGCs were picked out by green fluoresence small RNA seq library was constructed by microscale small RNA high throughput sequencing method.", null, "cell type:primordial germ cells|strain:AB|tissue:gonad", "GSM4777194", "GSM4777194: h24 2: PGCs 24hpf repeat2; Danio rerio; miRNA Seq", "GSM4777194", null, "1", "PGCs were picked out by green fluoresence small RNA seq library was constructed by microscale small RNA high throughput sequencing method.", "GEO Accession:GSM4777194", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "HiSeq X Ten", null, "SRP282187", null, null, "h24_2.fastq", "fastq", 4024398750.0, 26829325.0, "GSM4777194 r1", "0:150 1:0", "A:1030703487;C:1025857271;G:1004392553;T:963376583;N:68856", 150, 0, null, null, 1030703487, 1025857271, 1004392553, 963376583, 68856, "SRX9110497", "SRS7353480", "SRA1124474", "GEO", "Shanghai Institute of Biochemistry and Cell Biology,CAS", 1, 0.00025, null, 0.0, null, 0.99997, null, 1.0, null, 150, null, "T", null, "under 1.2% mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "China", "2020-09-12", "Pharyngula", "Embryo", "Gonad", "Reproductive System"], [60888, "SRR12628233", "SRX9110496", "SRS7353479", "SRP282187", "PRJNA663091", "Characterization of small RNAs in early zebrafish PGCs", "GSE157865", "Transcriptome Analysis", "Microscale small RNA high throughput sequencing was used to study small RNA distribution in early zebrafish PGCs primordial germ cells. We find that early zebrafish PGCs have large quantities of piRNAs and small quantities of miRNAs. Among the miRNAs detected  miR 430 accounted for the majority which has been proved to play diverse roles in zebrafish development. In addition  miR 92a 3p and miR 26a 5p have high expression and previous studies show that these two miRNAs can influence cell proliferation in cancer cells. More experiments should be performed in the future to explore whether miR 92a 3p and miR 26a 5p can influence the number of zebrafish PGCs. Overall design: Small RNA profiles at 6 hpf  shield stage  11 hpf 3 somite stage and 24 hpf prim 5 stage of zebrafish PGCs", null, "pubmed:33506864", null, "h24 1: PGCs 24hpf repeat1", "GSM4777193", null, "source name:PGCs|cell type:primordial germ cells|strain:AB|tissue:gonad", "h24 1: PGCs 24hpf repeat1", "Raw reads were pre processed by FASTX Toolkit version 0.0.14 1 Reads were mapped to danRer11 using bowtie version 1.0.0 5 miRNAs were quantified based on miRBase version 22.0 piRNAs were quantified using proTRAC version 2.2.0 Genome build: danRer11 Supplementary files format and content: tab delimited text file includes read number and RPM of miRNA expression for each sample \u2026", "PGCs", null, "PGCs were picked out by green fluoresence small RNA seq library was constructed by microscale small RNA high throughput sequencing method.", null, "cell type:primordial germ cells|strain:AB|tissue:gonad", "GSM4777193", "GSM4777193: h24 1: PGCs 24hpf repeat1; Danio rerio; miRNA Seq", "GSM4777193", null, "1", "PGCs were picked out by green fluoresence small RNA seq library was constructed by microscale small RNA high throughput sequencing method.", "GEO Accession:GSM4777193", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "HiSeq X Ten", null, "SRP282187", null, null, "h24_1.fastq", "fastq", 2223111450.0, 14820743.0, "GSM4777193 r1", "0:150 1:0", "A:510125618;C:561938103;G:577742482;T:573267493;N:37754", 150, 0, null, null, 510125618, 561938103, 577742482, 573267493, 37754, "SRX9110496", "SRS7353479", "SRA1124474", "GEO", "Shanghai Institute of Biochemistry and Cell Biology,CAS", 1, 0.0004, null, 0.0, null, 0.99993, null, 1.0, null, 150, null, "T", null, "under 1.2% mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "China", "2020-09-12", "Pharyngula", "Embryo", "Gonad", "Reproductive System"], [60889, "SRR12628232", "SRX9110495", "SRS7353478", "SRP282187", "PRJNA663091", "Characterization of small RNAs in early zebrafish PGCs", "GSE157865", "Transcriptome Analysis", "Microscale small RNA high throughput sequencing was used to study small RNA distribution in early zebrafish PGCs primordial germ cells. We find that early zebrafish PGCs have large quantities of piRNAs and small quantities of miRNAs. Among the miRNAs detected  miR 430 accounted for the majority which has been proved to play diverse roles in zebrafish development. In addition  miR 92a 3p and miR 26a 5p have high expression and previous studies show that these two miRNAs can influence cell proliferation in cancer cells. More experiments should be performed in the future to explore whether miR 92a 3p and miR 26a 5p can influence the number of zebrafish PGCs. Overall design: Small RNA profiles at 6 hpf  shield stage  11 hpf 3 somite stage and 24 hpf prim 5 stage of zebrafish PGCs", null, "pubmed:33506864", null, "h11 2: PGCs 11hpf repeat2", "GSM4777192", null, "source name:PGCs|cell type:primordial germ cells|strain:AB|tissue:gonad", "h11 2: PGCs 11hpf repeat2", "Raw reads were pre processed by FASTX Toolkit version 0.0.14 1 Reads were mapped to danRer11 using bowtie version 1.0.0 5 miRNAs were quantified based on miRBase version 22.0 piRNAs were quantified using proTRAC version 2.2.0 Genome build: danRer11 Supplementary files format and content: tab delimited text file includes read number and RPM of miRNA expression for each sample \u2026", "PGCs", null, "PGCs were picked out by green fluoresence small RNA seq library was constructed by microscale small RNA high throughput sequencing method.", null, "cell type:primordial germ cells|strain:AB|tissue:gonad", "GSM4777192", "GSM4777192: h11 2: PGCs 11hpf repeat2; Danio rerio; miRNA Seq", "GSM4777192", null, "1", "PGCs were picked out by green fluoresence small RNA seq library was constructed by microscale small RNA high throughput sequencing method.", "GEO Accession:GSM4777192", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "HiSeq X Ten", null, "SRP282187", null, null, "h11_2.fastq", "fastq", 1725506100.0, 11503374.0, "GSM4777192 r1", "0:150 1:0", "A:419294958;C:415643261;G:432730446;T:457808038;N:29397", 150, 0, null, null, 419294958, 415643261, 432730446, 457808038, 29397, "SRX9110495", "SRS7353478", "SRA1124474", "GEO", "Shanghai Institute of Biochemistry and Cell Biology,CAS", 1, 0.00062, null, 0.0, null, 0.99991, null, 1.0, null, 150, null, "T", null, "under 1.2% mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "China", "2020-09-12", "Segmentation", "Embryo", "Gonad", "Reproductive System"], [60890, "SRR12628231", "SRX9110494", "SRS7353477", "SRP282187", "PRJNA663091", "Characterization of small RNAs in early zebrafish PGCs", "GSE157865", "Transcriptome Analysis", "Microscale small RNA high throughput sequencing was used to study small RNA distribution in early zebrafish PGCs primordial germ cells. We find that early zebrafish PGCs have large quantities of piRNAs and small quantities of miRNAs. Among the miRNAs detected  miR 430 accounted for the majority which has been proved to play diverse roles in zebrafish development. In addition  miR 92a 3p and miR 26a 5p have high expression and previous studies show that these two miRNAs can influence cell proliferation in cancer cells. More experiments should be performed in the future to explore whether miR 92a 3p and miR 26a 5p can influence the number of zebrafish PGCs. Overall design: Small RNA profiles at 6 hpf  shield stage  11 hpf 3 somite stage and 24 hpf prim 5 stage of zebrafish PGCs", null, "pubmed:33506864", null, "h11 1: PGCs 11hpf repeat1", "GSM4777191", null, "source name:PGCs|cell type:primordial germ cells|strain:AB|tissue:gonad", "h11 1: PGCs 11hpf repeat1", "Raw reads were pre processed by FASTX Toolkit version 0.0.14 1 Reads were mapped to danRer11 using bowtie version 1.0.0 5 miRNAs were quantified based on miRBase version 22.0 piRNAs were quantified using proTRAC version 2.2.0 Genome build: danRer11 Supplementary files format and content: tab delimited text file includes read number and RPM of miRNA expression for each sample \u2026", "PGCs", null, "PGCs were picked out by green fluoresence small RNA seq library was constructed by microscale small RNA high throughput sequencing method.", null, "cell type:primordial germ cells|strain:AB|tissue:gonad", "GSM4777191", "GSM4777191: h11 1: PGCs 11hpf repeat1; Danio rerio; miRNA Seq", "GSM4777191", null, "1", "PGCs were picked out by green fluoresence small RNA seq library was constructed by microscale small RNA high throughput sequencing method.", "GEO Accession:GSM4777191", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "HiSeq X Ten", null, "SRP282187", null, null, "h11_1.fastq", "fastq", 2690366550.0, 17935777.0, "GSM4777191 r1", "0:150 1:0", "A:722881530;C:687611993;G:633563837;T:646263376;N:45814", 150, 0, null, null, 722881530, 687611993, 633563837, 646263376, 45814, "SRX9110494", "SRS7353477", "SRA1124474", "GEO", "Shanghai Institute of Biochemistry and Cell Biology,CAS", 1, 0.0006, null, 0.0, null, 0.99991, null, 1.0, null, 150, null, "T", null, "under 1.2% mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "China", "2020-09-12", "Segmentation", "Embryo", "Gonad", "Reproductive System"], [60891, "SRR12628230", "SRX9110493", "SRS7353476", "SRP282187", "PRJNA663091", "Characterization of small RNAs in early zebrafish PGCs", "GSE157865", "Transcriptome Analysis", "Microscale small RNA high throughput sequencing was used to study small RNA distribution in early zebrafish PGCs primordial germ cells. We find that early zebrafish PGCs have large quantities of piRNAs and small quantities of miRNAs. Among the miRNAs detected  miR 430 accounted for the majority which has been proved to play diverse roles in zebrafish development. In addition  miR 92a 3p and miR 26a 5p have high expression and previous studies show that these two miRNAs can influence cell proliferation in cancer cells. More experiments should be performed in the future to explore whether miR 92a 3p and miR 26a 5p can influence the number of zebrafish PGCs. Overall design: Small RNA profiles at 6 hpf  shield stage  11 hpf 3 somite stage and 24 hpf prim 5 stage of zebrafish PGCs", null, "pubmed:33506864", null, "h6 2: PGCs 6hpf repeat2", "GSM4777190", null, "source name:PGCs|cell type:primordial germ cells|strain:AB|tissue:gonad", "h6 2: PGCs 6hpf repeat2", "Raw reads were pre processed by FASTX Toolkit version 0.0.14 1 Reads were mapped to danRer11 using bowtie version 1.0.0 5 miRNAs were quantified based on miRBase version 22.0 piRNAs were quantified using proTRAC version 2.2.0 Genome build: danRer11 Supplementary files format and content: tab delimited text file includes read number and RPM of miRNA expression for each sample \u2026", "PGCs", null, "PGCs were picked out by green fluoresence small RNA seq library was constructed by microscale small RNA high throughput sequencing method.", null, "cell type:primordial germ cells|strain:AB|tissue:gonad", "GSM4777190", "GSM4777190: h6 2: PGCs 6hpf repeat2; Danio rerio; miRNA Seq", "GSM4777190", null, "1", "PGCs were picked out by green fluoresence small RNA seq library was constructed by microscale small RNA high throughput sequencing method.", "GEO Accession:GSM4777190", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "HiSeq X Ten", null, "SRP282187", null, null, "h6_2.fastq", "fastq", 2330922150.0, 15539481.0, "GSM4777190 r1", "0:150 1:0", "A:563758043;C:619336180;G:552040747;T:595747277;N:39903", 150, 0, null, null, 563758043, 619336180, 552040747, 595747277, 39903, "SRX9110493", "SRS7353476", "SRA1124474", "GEO", "Shanghai Institute of Biochemistry and Cell Biology,CAS", 1, 0.00014, null, 0.0, null, 0.99997, null, 1.0, null, 150, null, "T", null, "under 1.2% mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "China", "2020-09-12", "Gastrula", "Embryo", "Gonad", "Reproductive System"], [60892, "SRR12628229", "SRX9110492", "SRS7353475", "SRP282187", "PRJNA663091", "Characterization of small RNAs in early zebrafish PGCs", "GSE157865", "Transcriptome Analysis", "Microscale small RNA high throughput sequencing was used to study small RNA distribution in early zebrafish PGCs primordial germ cells. We find that early zebrafish PGCs have large quantities of piRNAs and small quantities of miRNAs. Among the miRNAs detected  miR 430 accounted for the majority which has been proved to play diverse roles in zebrafish development. In addition  miR 92a 3p and miR 26a 5p have high expression and previous studies show that these two miRNAs can influence cell proliferation in cancer cells. More experiments should be performed in the future to explore whether miR 92a 3p and miR 26a 5p can influence the number of zebrafish PGCs. Overall design: Small RNA profiles at 6 hpf  shield stage  11 hpf 3 somite stage and 24 hpf prim 5 stage of zebrafish PGCs", null, "pubmed:33506864", null, "h6 1: PGCs 6hpf repeat1", "GSM4777189", null, "source name:PGCs|cell type:primordial germ cells|strain:AB|tissue:gonad", "h6 1: PGCs 6hpf repeat1", "Raw reads were pre processed by FASTX Toolkit version 0.0.14 1 Reads were mapped to danRer11 using bowtie version 1.0.0 5 miRNAs were quantified based on miRBase version 22.0 piRNAs were quantified using proTRAC version 2.2.0 Genome build: danRer11 Supplementary files format and content: tab delimited text file includes read number and RPM of miRNA expression for each sample \u2026", "PGCs", null, "PGCs were picked out by green fluoresence small RNA seq library was constructed by microscale small RNA high throughput sequencing method.", null, "cell type:primordial germ cells|strain:AB|tissue:gonad", "GSM4777189", "GSM4777189: h6 1: PGCs 6hpf repeat1; Danio rerio; miRNA Seq", "GSM4777189", null, "1", "PGCs were picked out by green fluoresence small RNA seq library was constructed by microscale small RNA high throughput sequencing method.", "GEO Accession:GSM4777189", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "HiSeq X Ten", null, "SRP282187", null, null, "h6_1.fastq", "fastq", 1979588400.0, 13197256.0, "GSM4777189 r1", "0:150 1:0", "A:453046525;C:471873747;G:495904656;T:558729697;N:33775", 150, 0, null, null, 453046525, 471873747, 495904656, 558729697, 33775, "SRX9110492", "SRS7353475", "SRA1124474", "GEO", "Shanghai Institute of Biochemistry and Cell Biology,CAS", 1, 0.00028, null, 0.0, null, 0.99997, null, 1.0, null, 150, null, "T", null, "under 1.2% mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "China", "2020-09-12", "Gastrula", "Embryo", "Gonad", "Reproductive System"], [69435, "SRR18685198", "SRX14786396", "SRS12545301", "SRP368241", "PRJNA824784", "Divergent composition and transposon silencing activity of small RNAs in mammalian oocytes", "GSE200470", "Other", "We found piRNAs with different lengths represented the predominant small RNA species in oocytes from the 12 explored species  except mouse. We found endo siRNAs resulted from the truncated Dicer isoform were mouse specific  and os piRNAs associating with PIWIL3 in human oocytes are widespread in mammals and are typically with low levels of the 2' three prime O methylation. The sequences of many highly expressed piRNA clusters are fast evolving compared with their syntenic genomic locations  and the TE families distributing in the conserved piRNA clusters are various between species. Overall design: Profiling small RNAs and mRNA in oocytes from 12 animals.", null, "pubmed:38532500", null, "small RNA zebrafish 3", "GSM6034594", null, "source name:oocyte|tissue:oocyte|Sex:female|Stage:MII|genotype:wild type|molecule subtype:small RNA|geo loc name:missing|collection date:missing", "small RNA zebrafish 3", "We used cutadapt to clip adaptor and filter low quality reads. Reads failing to match the adaptor or reads with lengths shorter than 17 nt were discarded. Redundant sequences were collapsed as useful reads and mapped to reference sequences by bowite. The useful reads were assigned to known miRNAs  tsRNA tRNA derived small non coding RNA  rsRNA rRNA derived small non coding RNA  small snoRNAs  lncRNA  and mRNA  successively. The reads that could not be mapped to these known small RNAs were used to predict piRNAs and endo siRNAs successively. Sequences that were not annotated with any of the RNA categories above were classified as others. We used trimmomatic to clip adaptor and filter low quality reads. The high quality reads were mapped to reference genomes by STAR. The expressed levels of genes were caculated in TPM transcripts per kilobase of exon model per million mapped reads by StringTie. Assembly: GRCh38  GRCm38 Supplementary files format and content: tab delimited text files include TPM values or raw counts for each Sample", "oocyte", null, "Total RNA from oocytes of different species were extracted with TRIzol Reagent Ambion  USA  respectively. Small RNA library construction. Briefly  the single oocytes were incubated at 72 \u00b0C for 3 min then cooled in ice. post 3\u2032 adapter ligation  the samples were incubated with 5 U of lambda exonuclease and 25 U of 5\u2032 de adenylates. Small RNAs were reverse transcribed post 5\u2032 adapter ligation. Two rounds of amplification were conducted to get the libraries and the libraries were recovered with 6% polyacrylamide gel. mRNA library construction. In brief  single oocytes were incubated at 72 \u00b0C for 3 min and then cooled on ice. For every single oocyte  1 \u03bcl of a 1/500 000 1/50 000 dilution of the ERCC RNA Spike In Mix Invitrogen  4456740 was added. post reverse transcription and PCR pre amplification  cDNAs were purified and 3 ng of purified cDNA was used for a tagmentation reaction with Tn5 transposase.", null, "tissue:oocyte|Sex:female|Stage:MII|genotype:wild type|molecule subtype:small RNA", "GSM6034594", "GSM6034594: small RNA zebrafish 3; Danio rerio; miRNA Seq", "GSM6034594 r1", "GSM6034594", "1", "Total RNA from oocytes of different species were extracted with TRIzol Reagent Ambion  USA  respectively. Small RNA library construction. Briefly  the single oocytes were incubated at 72 \u00b0C for 3 min then cooled in ice. post 3\u2032 adapter ligation  the samples were incubated with 5 U of lambda exonuclease and 25 U of 5\u2032 de adenylates. Small RNAs were reverse transcribed post 5\u2032 adapter ligation. Two rounds of amplification were conducted to get the libraries and the libraries were recovered with 6% polyacrylamide gel. mRNA library construction. In brief  single oocytes were incubated at 72 \u00b0C for 3 min and then cooled on ice. For every single oocyte  1 \u03bcl of a 1/500 000 1/50 000 dilution of the ERCC RNA Spike In Mix Invitrogen  4456740 was added. post reverse transcription and PCR pre amplification  cDNAs were purified and 3 ng of purified cDNA was used for a tagmentation reaction with Tn5 transposase.", null, "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP368241", null, null, "Zebrafish3_combined_R1.fastq.gz", "fastq", 687816450.0, 4585443.0, "GSM6034594 r1", "0:150 1:0", "A:94948683;C:106096224;G:367933691;T:118821697;N:16155", 150, 0, null, null, 94948683, 106096224, 367933691, 118821697, 16155, "SRX14786396", "SRS12545301", "SRA1400916", "Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences", "Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences", 1, 2e-05, null, 0.0, null, 0.99993, null, 0.66666, null, 150, null, "T", null, "under 1.2% mapping rate", "illumina", "novaseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "China", "2022-04-08", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [69436, "SRR18685199", "SRX14786395", "SRS12545300", "SRP368241", "PRJNA824784", "Divergent composition and transposon silencing activity of small RNAs in mammalian oocytes", "GSE200470", "Other", "We found piRNAs with different lengths represented the predominant small RNA species in oocytes from the 12 explored species  except mouse. We found endo siRNAs resulted from the truncated Dicer isoform were mouse specific  and os piRNAs associating with PIWIL3 in human oocytes are widespread in mammals and are typically with low levels of the 2' three prime O methylation. The sequences of many highly expressed piRNA clusters are fast evolving compared with their syntenic genomic locations  and the TE families distributing in the conserved piRNA clusters are various between species. Overall design: Profiling small RNAs and mRNA in oocytes from 12 animals.", null, "pubmed:38532500", null, "small RNA zebrafish 2", "GSM6034593", null, "source name:oocyte|tissue:oocyte|Sex:female|Stage:MII|genotype:wild type|molecule subtype:small RNA|geo loc name:missing|collection date:missing", "small RNA zebrafish 2", "We used cutadapt to clip adaptor and filter low quality reads. Reads failing to match the adaptor or reads with lengths shorter than 17 nt were discarded. Redundant sequences were collapsed as useful reads and mapped to reference sequences by bowite. The useful reads were assigned to known miRNAs  tsRNA tRNA derived small non coding RNA  rsRNA rRNA derived small non coding RNA  small snoRNAs  lncRNA  and mRNA  successively. The reads that could not be mapped to these known small RNAs were used to predict piRNAs and endo siRNAs successively. Sequences that were not annotated with any of the RNA categories above were classified as others. We used trimmomatic to clip adaptor and filter low quality reads. The high quality reads were mapped to reference genomes by STAR. The expressed levels of genes were caculated in TPM transcripts per kilobase of exon model per million mapped reads by StringTie. Assembly: GRCh38  GRCm38 Supplementary files format and content: tab delimited text files include TPM values or raw counts for each Sample", "oocyte", null, "Total RNA from oocytes of different species were extracted with TRIzol Reagent Ambion  USA  respectively. Small RNA library construction. Briefly  the single oocytes were incubated at 72 \u00b0C for 3 min then cooled in ice. post 3\u2032 adapter ligation  the samples were incubated with 5 U of lambda exonuclease and 25 U of 5\u2032 de adenylates. Small RNAs were reverse transcribed post 5\u2032 adapter ligation. Two rounds of amplification were conducted to get the libraries and the libraries were recovered with 6% polyacrylamide gel. mRNA library construction. In brief  single oocytes were incubated at 72 \u00b0C for 3 min and then cooled on ice. For every single oocyte  1 \u03bcl of a 1/500 000 1/50 000 dilution of the ERCC RNA Spike In Mix Invitrogen  4456740 was added. post reverse transcription and PCR pre amplification  cDNAs were purified and 3 ng of purified cDNA was used for a tagmentation reaction with Tn5 transposase.", null, "tissue:oocyte|Sex:female|Stage:MII|genotype:wild type|molecule subtype:small RNA", "GSM6034593", "GSM6034593: small RNA zebrafish 2; Danio rerio; miRNA Seq", "GSM6034593 r1", "GSM6034593", "1", "Total RNA from oocytes of different species were extracted with TRIzol Reagent Ambion  USA  respectively. Small RNA library construction. Briefly  the single oocytes were incubated at 72 \u00b0C for 3 min then cooled in ice. post 3\u2032 adapter ligation  the samples were incubated with 5 U of lambda exonuclease and 25 U of 5\u2032 de adenylates. Small RNAs were reverse transcribed post 5\u2032 adapter ligation. Two rounds of amplification were conducted to get the libraries and the libraries were recovered with 6% polyacrylamide gel. mRNA library construction. In brief  single oocytes were incubated at 72 \u00b0C for 3 min and then cooled on ice. For every single oocyte  1 \u03bcl of a 1/500 000 1/50 000 dilution of the ERCC RNA Spike In Mix Invitrogen  4456740 was added. post reverse transcription and PCR pre amplification  cDNAs were purified and 3 ng of purified cDNA was used for a tagmentation reaction with Tn5 transposase.", null, "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP368241", null, null, "Zebrafish2_combined_R1.fastq.gz", "fastq", 354830850.0, 2365539.0, "GSM6034593 r1", "0:150 1:0", "A:48935028;C:57418354;G:192263153;T:56206000;N:8315", 150, 0, null, null, 48935028, 57418354, 192263153, 56206000, 8315, "SRX14786395", "SRS12545300", "SRA1400916", "Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences", "Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences", 1, 0.00026, null, 0.0, null, 0.99967, null, 1.0, null, 150, null, "T", null, "under 1.2% mapping rate", "illumina", "novaseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "China", "2022-04-08", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [69437, "SRR18685200", "SRX14786394", "SRS12545299", "SRP368241", "PRJNA824784", "Divergent composition and transposon silencing activity of small RNAs in mammalian oocytes", "GSE200470", "Other", "We found piRNAs with different lengths represented the predominant small RNA species in oocytes from the 12 explored species  except mouse. We found endo siRNAs resulted from the truncated Dicer isoform were mouse specific  and os piRNAs associating with PIWIL3 in human oocytes are widespread in mammals and are typically with low levels of the 2' three prime O methylation. The sequences of many highly expressed piRNA clusters are fast evolving compared with their syntenic genomic locations  and the TE families distributing in the conserved piRNA clusters are various between species. Overall design: Profiling small RNAs and mRNA in oocytes from 12 animals.", null, "pubmed:38532500", null, "small RNA zebrafish 1", "GSM6034592", null, "source name:oocyte|tissue:oocyte|Sex:female|Stage:MII|genotype:wild type|molecule subtype:small RNA|geo loc name:missing|collection date:missing", "small RNA zebrafish 1", "We used cutadapt to clip adaptor and filter low quality reads. Reads failing to match the adaptor or reads with lengths shorter than 17 nt were discarded. Redundant sequences were collapsed as useful reads and mapped to reference sequences by bowite. The useful reads were assigned to known miRNAs  tsRNA tRNA derived small non coding RNA  rsRNA rRNA derived small non coding RNA  small snoRNAs  lncRNA  and mRNA  successively. The reads that could not be mapped to these known small RNAs were used to predict piRNAs and endo siRNAs successively. Sequences that were not annotated with any of the RNA categories above were classified as others. We used trimmomatic to clip adaptor and filter low quality reads. The high quality reads were mapped to reference genomes by STAR. The expressed levels of genes were caculated in TPM transcripts per kilobase of exon model per million mapped reads by StringTie. Assembly: GRCh38  GRCm38 Supplementary files format and content: tab delimited text files include TPM values or raw counts for each Sample", "oocyte", null, "Total RNA from oocytes of different species were extracted with TRIzol Reagent Ambion  USA  respectively. Small RNA library construction. Briefly  the single oocytes were incubated at 72 \u00b0C for 3 min then cooled in ice. post 3\u2032 adapter ligation  the samples were incubated with 5 U of lambda exonuclease and 25 U of 5\u2032 de adenylates. Small RNAs were reverse transcribed post 5\u2032 adapter ligation. Two rounds of amplification were conducted to get the libraries and the libraries were recovered with 6% polyacrylamide gel. mRNA library construction. In brief  single oocytes were incubated at 72 \u00b0C for 3 min and then cooled on ice. For every single oocyte  1 \u03bcl of a 1/500 000 1/50 000 dilution of the ERCC RNA Spike In Mix Invitrogen  4456740 was added. post reverse transcription and PCR pre amplification  cDNAs were purified and 3 ng of purified cDNA was used for a tagmentation reaction with Tn5 transposase.", null, "tissue:oocyte|Sex:female|Stage:MII|genotype:wild type|molecule subtype:small RNA", "GSM6034592", "GSM6034592: small RNA zebrafish 1; Danio rerio; miRNA Seq", "GSM6034592 r1", "GSM6034592", "1", "Total RNA from oocytes of different species were extracted with TRIzol Reagent Ambion  USA  respectively. Small RNA library construction. Briefly  the single oocytes were incubated at 72 \u00b0C for 3 min then cooled in ice. post 3\u2032 adapter ligation  the samples were incubated with 5 U of lambda exonuclease and 25 U of 5\u2032 de adenylates. Small RNAs were reverse transcribed post 5\u2032 adapter ligation. Two rounds of amplification were conducted to get the libraries and the libraries were recovered with 6% polyacrylamide gel. mRNA library construction. In brief  single oocytes were incubated at 72 \u00b0C for 3 min and then cooled on ice. For every single oocyte  1 \u03bcl of a 1/500 000 1/50 000 dilution of the ERCC RNA Spike In Mix Invitrogen  4456740 was added. post reverse transcription and PCR pre amplification  cDNAs were purified and 3 ng of purified cDNA was used for a tagmentation reaction with Tn5 transposase.", null, "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP368241", null, null, "Zebrafish1_combined_R1.fastq.gz", "fastq", 1096131600.0, 7307544.0, "GSM6034592 r1", "0:150 1:0", "A:172547981;C:159060763;G:590708513;T:173788947;N:25396", 150, 0, null, null, 172547981, 159060763, 590708513, 173788947, 25396, "SRX14786394", "SRS12545299", "SRA1400916", "Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences", "Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences", 1, 0.00016, null, 0.0, null, 0.99965, null, 0.96551, null, 150, null, "T", null, "under 1.2% mapping rate", "illumina", "novaseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "China", "2022-04-08", "Zygote", "Embryo", "Oocyte", "Reproductive System"]], "truncated": false, "filtered_table_rows_count": 82, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"experiment.library_selection\" = :p0 and \"experiment.platform\" = :p1 and \"tissue_curation_coarse\" = :p2 order by rowid limit 101", "params": {"p0": "size fractionation", "p1": "ILLUMINA", "p2": "Reproductive System"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System", "results": [{"value": "miRNA-Seq", "label": "miRNA-Seq", "count": 28, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System&experiment.library_strategy=miRNA-Seq", "selected": false}, {"value": "RNA-Seq", "label": "RNA-Seq", "count": 23, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System&experiment.library_strategy=RNA-Seq", "selected": false}, {"value": "ncRNA-Seq", "label": "ncRNA-Seq", "count": 22, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System&experiment.library_strategy=ncRNA-Seq", "selected": false}, {"value": "OTHER", "label": "OTHER", "count": 9, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System&experiment.library_strategy=OTHER", "selected": false}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 82, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System&experiment.library_source=TRANSCRIPTOMIC", "selected": false}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System", "results": [{"value": "size fractionation", "label": "size fractionation", "count": 82, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System", "selected": true}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System", "results": [{"value": "SINGLE", "label": "SINGLE", "count": 79, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System&experiment.library_layout=SINGLE", "selected": false}, {"value": "PAIRED", "label": "PAIRED", "count": 3, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System&experiment.library_layout=PAIRED", "selected": false}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System", "results": [{"value": "ILLUMINA", "label": "ILLUMINA", "count": 82, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=size+fractionation&tissue_curation_coarse=Reproductive+System", "selected": true}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System", "results": [{"value": "Adult", "label": "Adult", "count": 43, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System&devstage_curation_coarse=Adult", "selected": false}, {"value": "Embryo", "label": "Embryo", "count": 23, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System&devstage_curation_coarse=Embryo", "selected": false}, {"value": "Undetermined", "label": "Undetermined", "count": 14, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System&devstage_curation_coarse=Undetermined", "selected": false}, {"value": "Larval", "label": "Larval", "count": 2, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System&devstage_curation_coarse=Larval", "selected": false}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System", "results": [{"value": "Adult", "label": "Adult", "count": 43, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System&devstage_curation=Adult", "selected": false}, {"value": "Undetermined", "label": "Undetermined", "count": 20, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System&devstage_curation=Undetermined", "selected": false}, {"value": "Zygote", "label": "Zygote", "count": 11, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System&devstage_curation=Zygote", "selected": false}, {"value": "Gastrula", "label": "Gastrula", "count": 2, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System&devstage_curation=Gastrula", "selected": false}, {"value": "Larval", "label": "Larval", "count": 2, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System&devstage_curation=Larval", "selected": false}, {"value": "Pharyngula", "label": "Pharyngula", "count": 2, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System&devstage_curation=Pharyngula", "selected": false}, {"value": "Segmentation", "label": "Segmentation", "count": 2, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System&devstage_curation=Segmentation", "selected": false}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System", "results": [{"value": "Reproductive System", "label": "Reproductive System", "count": 82, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA", "selected": true}], "truncated": false}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System", "results": [{"value": "Gonad", "label": "Gonad", "count": 71, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System&tissue_curation=Gonad", "selected": false}, {"value": "Oocyte", "label": "Oocyte", "count": 11, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System&tissue_curation=Oocyte", "selected": false}], "truncated": false}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System", "results": [{"value": "unknown", "label": "unknown", "count": 76, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System&technology=unknown", "selected": false}, {"value": "generic-scrnaseq-only", "label": "generic-scrnaseq-only", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=size+fractionation&experiment.platform=ILLUMINA&tissue_curation_coarse=Reproductive+System&technology=generic-scrnaseq-only", "selected": false}], "truncated": false}}, "suggested_facets": [], "next": null, "next_url": null, "private": false, "allow_execute_sql": true, "query_ms": 85.69339899986517}