{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where experiment.library_selection = \"other\" and tissue_curation = \"Embryo Imprecise\"", "rows": [[25182, "SRR25670729", "SRX21396042", "SRS18636200", "SRP455680", "PRJNA1006406", "Control of polyA tail length and translation in vertebrate oocytes and early embryos", "GSE241107", "Other", "During oocyte maturation and early embryonic development  polyA tail lengths strongly influence mRNA translation. However  how tail lengths are controlled at different developmental stages has been unclear. Here  we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos  and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos  and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs  mice  and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection  implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time  polyA tail lengths of endogenous mRNAs from frog oocytes and embryos  fish embryos  and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6  2024.", null, null, null, "Fish embryo mRNA germ ring PAL seq v4", "GSM7716871", null, "source name:embryo|tissue:embryo|treatment:N1|geo loc name:missing|collection date:missing", "Fish embryo mRNA germ ring PAL seq v4", "For gene specific tail seq of mRNA reporters  data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4  reads were trimmed with cutadapt v3.7 with the parameters \u201c m 15   quality base=64  q 20 20   match read wildcards  e 0.05  a NNNNATCTCGTATGCCGTCTTCTGCTTG  O 7\u201d. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained  the genomic sequences of humans or fish  depending on which spike in RNAs were used  and the sequences of the polyA standards generated previously  with the parameters \u201c  runThreadN 16   runMode alignReads   outFilterMultimapNmax 1   outReadsUnmapped Fastx   outFilterType BySJout   outSAMattributes All   outSAMtype BAM Unsorted SortedByCoordinate\u201d. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4  primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters  tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4\u20137 tail lengths at quantile 10  25  75  and 90. Supplementary files format and content: For PAL seq v3 or v4  tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4", "embryo", null, "Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 \u00b5g/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase\u2022In in a volume of 10 \u00b5l per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4\u00b0C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37\u00b0C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3\u02b9 adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 \u00b5l. The RNA and oligos were annealed by incubation at 70\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 40 \u00b5l MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 \u00b5l 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 \u00b5l 2x SSC. The RNA was eluted from the beads first with 100 \u00b5l 10 mM HEPES pH 7.5 at 65\u00b0C for 3 min and then second with 100 \u00b5l water at 65\u00b0C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 \u00b5l water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3\u02b9 adapter in a 10 \u00b5l reaction containing 5 \u00b5M 3\u02b9 adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/\u00b5l T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23\u00b0C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 \u00b5l water. The ligated RNA was mixed with 0.6 \u00b5l 100 \u00b5M reverse transcription primer KXS037 in a total volume of 12 \u00b5l  incubated at 65\u00b0C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 \u00b5l reaction containing 1x First Strand Buffer  500 \u00b5M dNTPs  5 mM dithiothreitol  1 unit/\u00b5l SUPERase\u2022In  and 200 units SuperScript III Thermo Fisher  18080044 at 50\u00b0C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 \u00b5l 1 M NaOH at 90\u00b0C for 10 min  followed by neutralization with 36.7 \u00b5l 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 \u00b5l PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer\u2019s suggested protocol for 10\u201315 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3\u02b9 adapter KXS013 was used for 3\u02b9 end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 \u00b5l. The cDNAs and the oligo were annealed by incubation at 65\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 100 \u00b5l MyOne Streptavidin C1 beads and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 \u00b5l 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 \u00b5l water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.", null, "tissue:embryo|treatment:N1", "GSM7716871", "GSM7716871: Fish embryo mRNA germ ring PAL seq v4; Danio rerio; OTHER", "GSM7716871 r1", "GSM7716871", "1", "Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 \u00b5g/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase\u2022In in a volume of 10 \u00b5l per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4\u00b0C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37\u00b0C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3\u02b9 adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 \u00b5l. The RNA and oligos were annealed by incubation at 70\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 40 \u00b5l MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 \u00b5l 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 \u00b5l 2x SSC. The RNA was eluted from the beads first with 100 \u00b5l 10 mM HEPES pH 7.5 at 65\u00b0C for 3 min and then second with 100 \u00b5l water at 65\u00b0C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 \u00b5l water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3\u02b9 adapter in a 10 \u00b5l reaction containing 5 \u00b5M 3\u02b9 adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/\u00b5l T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23\u00b0C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 \u00b5l water. The ligated RNA was mixed with 0.6 \u00b5l 100 \u00b5M reverse transcription primer KXS037 in a total volume of 12 \u00b5l  incubated at 65\u00b0C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 \u00b5l reaction containing 1x First Strand Buffer  500 \u00b5M dNTPs  5 mM dithiothreitol  1 unit/\u00b5l SUPERase\u2022In  and 200 units SuperScript III Thermo Fisher  18080044 at 50\u00b0C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 \u00b5l 1 M NaOH at 90\u00b0C for 10 min  followed by neutralization with 36.7 \u00b5l 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 \u00b5l PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer's suggested protocol for 10\u201315 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3\u02b9 adapter KXS013 was used for 3\u02b9 end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 \u00b5l. The cDNAs and the oligo were annealed by incubation at 65\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 100 \u00b5l MyOne Streptavidin C1 beads and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 \u00b5l 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 \u00b5l water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP455680", null, null, "Fish_embryo_mRNA_germ_ring_PAL_seq_v4_rep1_raw_read2.fastq.gz Fish_embryo_mRNA_germ_ring_PAL_seq_v4_rep1_raw_read1.fastq.gz", "fastq fastq", 2834842912.0, 9234016.0, "GSM7716871 r1", "0:52 1:255", "A:725811118;C:702410592;G:747583409;T:651018348;N:8019445", 52, 255, null, null, 725811118, 702410592, 747583409, 651018348, 8019445, "SRX21396042", "SRS18636200", "SRA1694849", "Whitehead Institute", "Whitehead Institute", 2, 0.00023, 0.30494, 8e-05, 0.01793, 0.99967, 0.99971, 0.5, 1.0, 52, 255, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "bulk", "bulk", null, "United States", "2023-08-17", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [25183, "SRR25670730", "SRX21396042", "SRS18636200", "SRP455680", "PRJNA1006406", "Control of polyA tail length and translation in vertebrate oocytes and early embryos", "GSE241107", "Other", "During oocyte maturation and early embryonic development  polyA tail lengths strongly influence mRNA translation. However  how tail lengths are controlled at different developmental stages has been unclear. Here  we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos  and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos  and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs  mice  and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection  implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time  polyA tail lengths of endogenous mRNAs from frog oocytes and embryos  fish embryos  and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6  2024.", null, null, null, "Fish embryo mRNA germ ring PAL seq v4", "GSM7716871", null, "source name:embryo|tissue:embryo|treatment:N1|geo loc name:missing|collection date:missing", "Fish embryo mRNA germ ring PAL seq v4", "For gene specific tail seq of mRNA reporters  data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4  reads were trimmed with cutadapt v3.7 with the parameters \u201c m 15   quality base=64  q 20 20   match read wildcards  e 0.05  a NNNNATCTCGTATGCCGTCTTCTGCTTG  O 7\u201d. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained  the genomic sequences of humans or fish  depending on which spike in RNAs were used  and the sequences of the polyA standards generated previously  with the parameters \u201c  runThreadN 16   runMode alignReads   outFilterMultimapNmax 1   outReadsUnmapped Fastx   outFilterType BySJout   outSAMattributes All   outSAMtype BAM Unsorted SortedByCoordinate\u201d. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4  primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters  tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4\u20137 tail lengths at quantile 10  25  75  and 90. Supplementary files format and content: For PAL seq v3 or v4  tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4", "embryo", null, "Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 \u00b5g/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase\u2022In in a volume of 10 \u00b5l per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4\u00b0C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37\u00b0C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3\u02b9 adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 \u00b5l. The RNA and oligos were annealed by incubation at 70\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 40 \u00b5l MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 \u00b5l 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 \u00b5l 2x SSC. The RNA was eluted from the beads first with 100 \u00b5l 10 mM HEPES pH 7.5 at 65\u00b0C for 3 min and then second with 100 \u00b5l water at 65\u00b0C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 \u00b5l water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3\u02b9 adapter in a 10 \u00b5l reaction containing 5 \u00b5M 3\u02b9 adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/\u00b5l T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23\u00b0C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 \u00b5l water. The ligated RNA was mixed with 0.6 \u00b5l 100 \u00b5M reverse transcription primer KXS037 in a total volume of 12 \u00b5l  incubated at 65\u00b0C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 \u00b5l reaction containing 1x First Strand Buffer  500 \u00b5M dNTPs  5 mM dithiothreitol  1 unit/\u00b5l SUPERase\u2022In  and 200 units SuperScript III Thermo Fisher  18080044 at 50\u00b0C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 \u00b5l 1 M NaOH at 90\u00b0C for 10 min  followed by neutralization with 36.7 \u00b5l 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 \u00b5l PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer\u2019s suggested protocol for 10\u201315 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3\u02b9 adapter KXS013 was used for 3\u02b9 end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 \u00b5l. The cDNAs and the oligo were annealed by incubation at 65\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 100 \u00b5l MyOne Streptavidin C1 beads and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 \u00b5l 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 \u00b5l water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.", null, "tissue:embryo|treatment:N1", "GSM7716871", "GSM7716871: Fish embryo mRNA germ ring PAL seq v4; Danio rerio; OTHER", "GSM7716871 r1", "GSM7716871", "1", "Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 \u00b5g/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase\u2022In in a volume of 10 \u00b5l per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4\u00b0C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37\u00b0C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3\u02b9 adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 \u00b5l. The RNA and oligos were annealed by incubation at 70\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 40 \u00b5l MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 \u00b5l 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 \u00b5l 2x SSC. The RNA was eluted from the beads first with 100 \u00b5l 10 mM HEPES pH 7.5 at 65\u00b0C for 3 min and then second with 100 \u00b5l water at 65\u00b0C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 \u00b5l water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3\u02b9 adapter in a 10 \u00b5l reaction containing 5 \u00b5M 3\u02b9 adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/\u00b5l T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23\u00b0C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 \u00b5l water. The ligated RNA was mixed with 0.6 \u00b5l 100 \u00b5M reverse transcription primer KXS037 in a total volume of 12 \u00b5l  incubated at 65\u00b0C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 \u00b5l reaction containing 1x First Strand Buffer  500 \u00b5M dNTPs  5 mM dithiothreitol  1 unit/\u00b5l SUPERase\u2022In  and 200 units SuperScript III Thermo Fisher  18080044 at 50\u00b0C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 \u00b5l 1 M NaOH at 90\u00b0C for 10 min  followed by neutralization with 36.7 \u00b5l 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 \u00b5l PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer's suggested protocol for 10\u201315 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3\u02b9 adapter KXS013 was used for 3\u02b9 end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 \u00b5l. The cDNAs and the oligo were annealed by incubation at 65\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 100 \u00b5l MyOne Streptavidin C1 beads and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 \u00b5l 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 \u00b5l water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP455680", null, null, "Fish_embryo_mRNA_germ_ring_PAL_seq_v4_rep2_raw_read1.fastq.gz Fish_embryo_mRNA_germ_ring_PAL_seq_v4_rep2_raw_read2.fastq.gz", "fastq fastq", 3473033898.0, 11312814.0, "GSM7716871 r2", "0:52 1:255", "A:853178471;C:899976159;G:962100712;T:750811461;N:6967095", 52, 255, null, null, 853178471, 899976159, 962100712, 750811461, 6967095, "SRX21396042", "SRS18636200", "SRA1694849", "Whitehead Institute", "Whitehead Institute", 2, 0.00049, 0.0, 0.00012, 0.0, 0.99941, 1.0, 0.64864, null, 52, 255, "T", "T", "mates < 9% mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "bulk", "bulk", null, "United States", "2023-08-17", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [25184, "SRR25670731", "SRX21396041", "SRS18636199", "SRP455680", "PRJNA1006406", "Control of polyA tail length and translation in vertebrate oocytes and early embryos", "GSE241107", "Other", "During oocyte maturation and early embryonic development  polyA tail lengths strongly influence mRNA translation. However  how tail lengths are controlled at different developmental stages has been unclear. Here  we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos  and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos  and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs  mice  and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection  implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time  polyA tail lengths of endogenous mRNAs from frog oocytes and embryos  fish embryos  and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6  2024.", null, null, null, "Fish embryo mRNA zfs:0000015 PAL seq v4", "GSM7716870", null, "source name:embryo|tissue:embryo|treatment:N1|geo loc name:missing|collection date:missing", "Fish embryo mRNA zfs:0000015 PAL seq v4", "For gene specific tail seq of mRNA reporters  data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4  reads were trimmed with cutadapt v3.7 with the parameters \u201c m 15   quality base=64  q 20 20   match read wildcards  e 0.05  a NNNNATCTCGTATGCCGTCTTCTGCTTG  O 7\u201d. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained  the genomic sequences of humans or fish  depending on which spike in RNAs were used  and the sequences of the polyA standards generated previously  with the parameters \u201c  runThreadN 16   runMode alignReads   outFilterMultimapNmax 1   outReadsUnmapped Fastx   outFilterType BySJout   outSAMattributes All   outSAMtype BAM Unsorted SortedByCoordinate\u201d. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4  primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters  tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4\u20137 tail lengths at quantile 10  25  75  and 90. Supplementary files format and content: For PAL seq v3 or v4  tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4", "embryo", null, "Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 \u00b5g/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase\u2022In in a volume of 10 \u00b5l per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4\u00b0C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37\u00b0C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3\u02b9 adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 \u00b5l. The RNA and oligos were annealed by incubation at 70\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 40 \u00b5l MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 \u00b5l 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 \u00b5l 2x SSC. The RNA was eluted from the beads first with 100 \u00b5l 10 mM HEPES pH 7.5 at 65\u00b0C for 3 min and then second with 100 \u00b5l water at 65\u00b0C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 \u00b5l water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3\u02b9 adapter in a 10 \u00b5l reaction containing 5 \u00b5M 3\u02b9 adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/\u00b5l T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23\u00b0C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 \u00b5l water. The ligated RNA was mixed with 0.6 \u00b5l 100 \u00b5M reverse transcription primer KXS037 in a total volume of 12 \u00b5l  incubated at 65\u00b0C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 \u00b5l reaction containing 1x First Strand Buffer  500 \u00b5M dNTPs  5 mM dithiothreitol  1 unit/\u00b5l SUPERase\u2022In  and 200 units SuperScript III Thermo Fisher  18080044 at 50\u00b0C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 \u00b5l 1 M NaOH at 90\u00b0C for 10 min  followed by neutralization with 36.7 \u00b5l 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 \u00b5l PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer\u2019s suggested protocol for 10\u201315 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3\u02b9 adapter KXS013 was used for 3\u02b9 end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 \u00b5l. The cDNAs and the oligo were annealed by incubation at 65\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 100 \u00b5l MyOne Streptavidin C1 beads and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 \u00b5l 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 \u00b5l water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.", null, "tissue:embryo|treatment:N1", "GSM7716870", "GSM7716870: Fish embryo mRNA zfs:0000015 PAL seq v4; Danio rerio; OTHER", "GSM7716870 r1", "GSM7716870", "1", "Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 \u00b5g/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase\u2022In in a volume of 10 \u00b5l per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4\u00b0C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37\u00b0C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3\u02b9 adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 \u00b5l. The RNA and oligos were annealed by incubation at 70\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 40 \u00b5l MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 \u00b5l 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 \u00b5l 2x SSC. The RNA was eluted from the beads first with 100 \u00b5l 10 mM HEPES pH 7.5 at 65\u00b0C for 3 min and then second with 100 \u00b5l water at 65\u00b0C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 \u00b5l water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3\u02b9 adapter in a 10 \u00b5l reaction containing 5 \u00b5M 3\u02b9 adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/\u00b5l T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23\u00b0C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 \u00b5l water. The ligated RNA was mixed with 0.6 \u00b5l 100 \u00b5M reverse transcription primer KXS037 in a total volume of 12 \u00b5l  incubated at 65\u00b0C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 \u00b5l reaction containing 1x First Strand Buffer  500 \u00b5M dNTPs  5 mM dithiothreitol  1 unit/\u00b5l SUPERase\u2022In  and 200 units SuperScript III Thermo Fisher  18080044 at 50\u00b0C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 \u00b5l 1 M NaOH at 90\u00b0C for 10 min  followed by neutralization with 36.7 \u00b5l 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 \u00b5l PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer's suggested protocol for 10\u201315 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3\u02b9 adapter KXS013 was used for 3\u02b9 end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 \u00b5l. The cDNAs and the oligo were annealed by incubation at 65\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 100 \u00b5l MyOne Streptavidin C1 beads and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 \u00b5l 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 \u00b5l water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP455680", null, null, "Fish_embryo_mRNA_30percent_epiboly_PAL_seq_v4_rep1_raw_read1.fastq.gz Fish_embryo_mRNA_30percent_epiboly_PAL_seq_v4_rep1_raw_read2.fastq.gz", "fastq fastq", 2695203962.0, 8779166.0, "GSM7716870 r1", "0:52 1:255", "A:684535386;C:669852151;G:719008886;T:614209811;N:7597728", 52, 255, null, null, 684535386, 669852151, 719008886, 614209811, 7597728, "SRX21396041", "SRS18636199", "SRA1694849", "Whitehead Institute", "Whitehead Institute", 2, 0.00117, 0.35837, 0.00017, 0.00682, 0.99859, 0.99963, 0.69473, 1.0, 52, 255, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "bulk", "bulk", null, "United States", "2023-08-17", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [25185, "SRR25670732", "SRX21396041", "SRS18636199", "SRP455680", "PRJNA1006406", "Control of polyA tail length and translation in vertebrate oocytes and early embryos", "GSE241107", "Other", "During oocyte maturation and early embryonic development  polyA tail lengths strongly influence mRNA translation. However  how tail lengths are controlled at different developmental stages has been unclear. Here  we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos  and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos  and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs  mice  and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection  implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time  polyA tail lengths of endogenous mRNAs from frog oocytes and embryos  fish embryos  and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6  2024.", null, null, null, "Fish embryo mRNA zfs:0000015 PAL seq v4", "GSM7716870", null, "source name:embryo|tissue:embryo|treatment:N1|geo loc name:missing|collection date:missing", "Fish embryo mRNA zfs:0000015 PAL seq v4", "For gene specific tail seq of mRNA reporters  data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4  reads were trimmed with cutadapt v3.7 with the parameters \u201c m 15   quality base=64  q 20 20   match read wildcards  e 0.05  a NNNNATCTCGTATGCCGTCTTCTGCTTG  O 7\u201d. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained  the genomic sequences of humans or fish  depending on which spike in RNAs were used  and the sequences of the polyA standards generated previously  with the parameters \u201c  runThreadN 16   runMode alignReads   outFilterMultimapNmax 1   outReadsUnmapped Fastx   outFilterType BySJout   outSAMattributes All   outSAMtype BAM Unsorted SortedByCoordinate\u201d. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4  primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters  tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4\u20137 tail lengths at quantile 10  25  75  and 90. Supplementary files format and content: For PAL seq v3 or v4  tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4", "embryo", null, "Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 \u00b5g/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase\u2022In in a volume of 10 \u00b5l per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4\u00b0C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37\u00b0C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3\u02b9 adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 \u00b5l. The RNA and oligos were annealed by incubation at 70\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 40 \u00b5l MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 \u00b5l 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 \u00b5l 2x SSC. The RNA was eluted from the beads first with 100 \u00b5l 10 mM HEPES pH 7.5 at 65\u00b0C for 3 min and then second with 100 \u00b5l water at 65\u00b0C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 \u00b5l water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3\u02b9 adapter in a 10 \u00b5l reaction containing 5 \u00b5M 3\u02b9 adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/\u00b5l T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23\u00b0C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 \u00b5l water. The ligated RNA was mixed with 0.6 \u00b5l 100 \u00b5M reverse transcription primer KXS037 in a total volume of 12 \u00b5l  incubated at 65\u00b0C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 \u00b5l reaction containing 1x First Strand Buffer  500 \u00b5M dNTPs  5 mM dithiothreitol  1 unit/\u00b5l SUPERase\u2022In  and 200 units SuperScript III Thermo Fisher  18080044 at 50\u00b0C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 \u00b5l 1 M NaOH at 90\u00b0C for 10 min  followed by neutralization with 36.7 \u00b5l 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 \u00b5l PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer\u2019s suggested protocol for 10\u201315 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3\u02b9 adapter KXS013 was used for 3\u02b9 end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 \u00b5l. The cDNAs and the oligo were annealed by incubation at 65\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 100 \u00b5l MyOne Streptavidin C1 beads and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 \u00b5l 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 \u00b5l water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.", null, "tissue:embryo|treatment:N1", "GSM7716870", "GSM7716870: Fish embryo mRNA zfs:0000015 PAL seq v4; Danio rerio; OTHER", "GSM7716870 r1", "GSM7716870", "1", "Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 \u00b5g/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase\u2022In in a volume of 10 \u00b5l per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4\u00b0C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37\u00b0C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3\u02b9 adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 \u00b5l. The RNA and oligos were annealed by incubation at 70\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 40 \u00b5l MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 \u00b5l 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 \u00b5l 2x SSC. The RNA was eluted from the beads first with 100 \u00b5l 10 mM HEPES pH 7.5 at 65\u00b0C for 3 min and then second with 100 \u00b5l water at 65\u00b0C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 \u00b5l water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3\u02b9 adapter in a 10 \u00b5l reaction containing 5 \u00b5M 3\u02b9 adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/\u00b5l T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23\u00b0C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 \u00b5l water. The ligated RNA was mixed with 0.6 \u00b5l 100 \u00b5M reverse transcription primer KXS037 in a total volume of 12 \u00b5l  incubated at 65\u00b0C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 \u00b5l reaction containing 1x First Strand Buffer  500 \u00b5M dNTPs  5 mM dithiothreitol  1 unit/\u00b5l SUPERase\u2022In  and 200 units SuperScript III Thermo Fisher  18080044 at 50\u00b0C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 \u00b5l 1 M NaOH at 90\u00b0C for 10 min  followed by neutralization with 36.7 \u00b5l 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 \u00b5l PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer's suggested protocol for 10\u201315 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3\u02b9 adapter KXS013 was used for 3\u02b9 end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 \u00b5l. The cDNAs and the oligo were annealed by incubation at 65\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 100 \u00b5l MyOne Streptavidin C1 beads and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 \u00b5l 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 \u00b5l water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP455680", null, null, "Fish_embryo_mRNA_30percent_epiboly_PAL_seq_v4_rep2_raw_read2.fastq.gz Fish_embryo_mRNA_30percent_epiboly_PAL_seq_v4_rep2_raw_read1.fastq.gz", "fastq fastq", 3476338446.0, 11323578.0, "GSM7716870 r2", "0:52 1:255", "A:841832234;C:898325199;G:968774318;T:760398070;N:7008625", 52, 255, null, null, 841832234, 898325199, 968774318, 760398070, 7008625, "SRX21396041", "SRS18636199", "SRA1694849", "Whitehead Institute", "Whitehead Institute", 2, 0.00245, 0.0, 0.00047, 0.0, 0.99803, 1.0, 0.58536, null, 52, 255, "T", "T", "mates < 9% mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "bulk", "bulk", null, "United States", "2023-08-17", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [25186, "SRR25670733", "SRX21396040", "SRS18636198", "SRP455680", "PRJNA1006406", "Control of polyA tail length and translation in vertebrate oocytes and early embryos", "GSE241107", "Other", "During oocyte maturation and early embryonic development  polyA tail lengths strongly influence mRNA translation. However  how tail lengths are controlled at different developmental stages has been unclear. Here  we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos  and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos  and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs  mice  and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection  implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time  polyA tail lengths of endogenous mRNAs from frog oocytes and embryos  fish embryos  and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6  2024.", null, null, null, "Fish embryo mRNA sphere PAL seq v4", "GSM7716869", null, "source name:embryo|tissue:embryo|treatment:N1|geo loc name:missing|collection date:missing", "Fish embryo mRNA sphere PAL seq v4", "For gene specific tail seq of mRNA reporters  data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4  reads were trimmed with cutadapt v3.7 with the parameters \u201c m 15   quality base=64  q 20 20   match read wildcards  e 0.05  a NNNNATCTCGTATGCCGTCTTCTGCTTG  O 7\u201d. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained  the genomic sequences of humans or fish  depending on which spike in RNAs were used  and the sequences of the polyA standards generated previously  with the parameters \u201c  runThreadN 16   runMode alignReads   outFilterMultimapNmax 1   outReadsUnmapped Fastx   outFilterType BySJout   outSAMattributes All   outSAMtype BAM Unsorted SortedByCoordinate\u201d. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4  primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters  tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4\u20137 tail lengths at quantile 10  25  75  and 90. Supplementary files format and content: For PAL seq v3 or v4  tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4", "embryo", null, "Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 \u00b5g/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase\u2022In in a volume of 10 \u00b5l per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4\u00b0C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37\u00b0C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3\u02b9 adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 \u00b5l. The RNA and oligos were annealed by incubation at 70\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 40 \u00b5l MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 \u00b5l 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 \u00b5l 2x SSC. The RNA was eluted from the beads first with 100 \u00b5l 10 mM HEPES pH 7.5 at 65\u00b0C for 3 min and then second with 100 \u00b5l water at 65\u00b0C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 \u00b5l water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3\u02b9 adapter in a 10 \u00b5l reaction containing 5 \u00b5M 3\u02b9 adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/\u00b5l T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23\u00b0C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 \u00b5l water. The ligated RNA was mixed with 0.6 \u00b5l 100 \u00b5M reverse transcription primer KXS037 in a total volume of 12 \u00b5l  incubated at 65\u00b0C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 \u00b5l reaction containing 1x First Strand Buffer  500 \u00b5M dNTPs  5 mM dithiothreitol  1 unit/\u00b5l SUPERase\u2022In  and 200 units SuperScript III Thermo Fisher  18080044 at 50\u00b0C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 \u00b5l 1 M NaOH at 90\u00b0C for 10 min  followed by neutralization with 36.7 \u00b5l 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 \u00b5l PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer\u2019s suggested protocol for 10\u201315 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3\u02b9 adapter KXS013 was used for 3\u02b9 end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 \u00b5l. The cDNAs and the oligo were annealed by incubation at 65\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 100 \u00b5l MyOne Streptavidin C1 beads and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 \u00b5l 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 \u00b5l water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.", null, "tissue:embryo|treatment:N1", "GSM7716869", "GSM7716869: Fish embryo mRNA sphere PAL seq v4; Danio rerio; OTHER", "GSM7716869 r1", "GSM7716869", "1", "Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 \u00b5g/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase\u2022In in a volume of 10 \u00b5l per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4\u00b0C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37\u00b0C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3\u02b9 adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 \u00b5l. The RNA and oligos were annealed by incubation at 70\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 40 \u00b5l MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 \u00b5l 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 \u00b5l 2x SSC. The RNA was eluted from the beads first with 100 \u00b5l 10 mM HEPES pH 7.5 at 65\u00b0C for 3 min and then second with 100 \u00b5l water at 65\u00b0C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 \u00b5l water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3\u02b9 adapter in a 10 \u00b5l reaction containing 5 \u00b5M 3\u02b9 adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/\u00b5l T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23\u00b0C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 \u00b5l water. The ligated RNA was mixed with 0.6 \u00b5l 100 \u00b5M reverse transcription primer KXS037 in a total volume of 12 \u00b5l  incubated at 65\u00b0C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 \u00b5l reaction containing 1x First Strand Buffer  500 \u00b5M dNTPs  5 mM dithiothreitol  1 unit/\u00b5l SUPERase\u2022In  and 200 units SuperScript III Thermo Fisher  18080044 at 50\u00b0C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 \u00b5l 1 M NaOH at 90\u00b0C for 10 min  followed by neutralization with 36.7 \u00b5l 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 \u00b5l PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer's suggested protocol for 10\u201315 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3\u02b9 adapter KXS013 was used for 3\u02b9 end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 \u00b5l. The cDNAs and the oligo were annealed by incubation at 65\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 100 \u00b5l MyOne Streptavidin C1 beads and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 \u00b5l 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 \u00b5l water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP455680", null, null, "Fish_embryo_mRNA_sphere_PAL_seq_v4_rep1_raw_read1.fastq.gz Fish_embryo_mRNA_sphere_PAL_seq_v4_rep1_raw_read2.fastq.gz", "fastq fastq", 3211687254.0, 10461522.0, "GSM7716869 r1", "0:52 1:255", "A:813560400;C:775326762;G:854563477;T:759161458;N:9075157", 52, 255, null, null, 813560400, 775326762, 854563477, 759161458, 9075157, "SRX21396040", "SRS18636198", "SRA1694849", "Whitehead Institute", "Whitehead Institute", 2, 0.00088, 0.43191, 0.0004, 0.01556, 0.99916, 0.99961, 0.55769, 1.0, 52, 255, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "bulk", "bulk", null, "United States", "2023-08-17", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [25187, "SRR25670734", "SRX21396040", "SRS18636198", "SRP455680", "PRJNA1006406", "Control of polyA tail length and translation in vertebrate oocytes and early embryos", "GSE241107", "Other", "During oocyte maturation and early embryonic development  polyA tail lengths strongly influence mRNA translation. However  how tail lengths are controlled at different developmental stages has been unclear. Here  we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos  and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos  and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs  mice  and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection  implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time  polyA tail lengths of endogenous mRNAs from frog oocytes and embryos  fish embryos  and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6  2024.", null, null, null, "Fish embryo mRNA sphere PAL seq v4", "GSM7716869", null, "source name:embryo|tissue:embryo|treatment:N1|geo loc name:missing|collection date:missing", "Fish embryo mRNA sphere PAL seq v4", "For gene specific tail seq of mRNA reporters  data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4  reads were trimmed with cutadapt v3.7 with the parameters \u201c m 15   quality base=64  q 20 20   match read wildcards  e 0.05  a NNNNATCTCGTATGCCGTCTTCTGCTTG  O 7\u201d. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained  the genomic sequences of humans or fish  depending on which spike in RNAs were used  and the sequences of the polyA standards generated previously  with the parameters \u201c  runThreadN 16   runMode alignReads   outFilterMultimapNmax 1   outReadsUnmapped Fastx   outFilterType BySJout   outSAMattributes All   outSAMtype BAM Unsorted SortedByCoordinate\u201d. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4  primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters  tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4\u20137 tail lengths at quantile 10  25  75  and 90. Supplementary files format and content: For PAL seq v3 or v4  tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4", "embryo", null, "Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 \u00b5g/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase\u2022In in a volume of 10 \u00b5l per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4\u00b0C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37\u00b0C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3\u02b9 adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 \u00b5l. The RNA and oligos were annealed by incubation at 70\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 40 \u00b5l MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 \u00b5l 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 \u00b5l 2x SSC. The RNA was eluted from the beads first with 100 \u00b5l 10 mM HEPES pH 7.5 at 65\u00b0C for 3 min and then second with 100 \u00b5l water at 65\u00b0C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 \u00b5l water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3\u02b9 adapter in a 10 \u00b5l reaction containing 5 \u00b5M 3\u02b9 adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/\u00b5l T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23\u00b0C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 \u00b5l water. The ligated RNA was mixed with 0.6 \u00b5l 100 \u00b5M reverse transcription primer KXS037 in a total volume of 12 \u00b5l  incubated at 65\u00b0C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 \u00b5l reaction containing 1x First Strand Buffer  500 \u00b5M dNTPs  5 mM dithiothreitol  1 unit/\u00b5l SUPERase\u2022In  and 200 units SuperScript III Thermo Fisher  18080044 at 50\u00b0C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 \u00b5l 1 M NaOH at 90\u00b0C for 10 min  followed by neutralization with 36.7 \u00b5l 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 \u00b5l PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer\u2019s suggested protocol for 10\u201315 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3\u02b9 adapter KXS013 was used for 3\u02b9 end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 \u00b5l. The cDNAs and the oligo were annealed by incubation at 65\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 100 \u00b5l MyOne Streptavidin C1 beads and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 \u00b5l 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 \u00b5l water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.", null, "tissue:embryo|treatment:N1", "GSM7716869", "GSM7716869: Fish embryo mRNA sphere PAL seq v4; Danio rerio; OTHER", "GSM7716869 r1", "GSM7716869", "1", "Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 \u00b5g/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase\u2022In in a volume of 10 \u00b5l per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4\u00b0C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37\u00b0C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3\u02b9 adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 \u00b5l. The RNA and oligos were annealed by incubation at 70\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 40 \u00b5l MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 \u00b5l 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 \u00b5l 2x SSC. The RNA was eluted from the beads first with 100 \u00b5l 10 mM HEPES pH 7.5 at 65\u00b0C for 3 min and then second with 100 \u00b5l water at 65\u00b0C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 \u00b5l water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3\u02b9 adapter in a 10 \u00b5l reaction containing 5 \u00b5M 3\u02b9 adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/\u00b5l T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23\u00b0C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 \u00b5l water. The ligated RNA was mixed with 0.6 \u00b5l 100 \u00b5M reverse transcription primer KXS037 in a total volume of 12 \u00b5l  incubated at 65\u00b0C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 \u00b5l reaction containing 1x First Strand Buffer  500 \u00b5M dNTPs  5 mM dithiothreitol  1 unit/\u00b5l SUPERase\u2022In  and 200 units SuperScript III Thermo Fisher  18080044 at 50\u00b0C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 \u00b5l 1 M NaOH at 90\u00b0C for 10 min  followed by neutralization with 36.7 \u00b5l 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 \u00b5l PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer's suggested protocol for 10\u201315 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3\u02b9 adapter KXS013 was used for 3\u02b9 end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 \u00b5l. The cDNAs and the oligo were annealed by incubation at 65\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 100 \u00b5l MyOne Streptavidin C1 beads and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 \u00b5l 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 \u00b5l water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP455680", null, null, "Fish_embryo_mRNA_sphere_PAL_seq_v4_rep2_raw_read1.fastq.gz Fish_embryo_mRNA_sphere_PAL_seq_v4_rep2_raw_read2.fastq.gz", "fastq fastq", 3179916131.0, 10358033.0, "GSM7716869 r2", "0:52 1:255", "A:771755667;C:804256300;G:883166175;T:714242073;N:6495916", 52, 255, null, null, 771755667, 804256300, 883166175, 714242073, 6495916, "SRX21396040", "SRS18636198", "SRA1694849", "Whitehead Institute", "Whitehead Institute", 2, 0.00186, 0.0, 0.00088, 0.0, 0.99862, 1.0, 0.64705, null, 52, 255, "T", "T", "mates < 9% mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "bulk", "bulk", null, "United States", "2023-08-17", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [25188, "SRR25670735", "SRX21396039", "SRS18636197", "SRP455680", "PRJNA1006406", "Control of polyA tail length and translation in vertebrate oocytes and early embryos", "GSE241107", "Other", "During oocyte maturation and early embryonic development  polyA tail lengths strongly influence mRNA translation. However  how tail lengths are controlled at different developmental stages has been unclear. Here  we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos  and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos  and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs  mice  and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection  implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time  polyA tail lengths of endogenous mRNAs from frog oocytes and embryos  fish embryos  and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6  2024.", null, null, null, "Fish embryo mRNA 1024cell PAL seq v4", "GSM7716868", null, "source name:embryo|tissue:embryo|treatment:N1|geo loc name:missing|collection date:missing", "Fish embryo mRNA 1024cell PAL seq v4", "For gene specific tail seq of mRNA reporters  data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4  reads were trimmed with cutadapt v3.7 with the parameters \u201c m 15   quality base=64  q 20 20   match read wildcards  e 0.05  a NNNNATCTCGTATGCCGTCTTCTGCTTG  O 7\u201d. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained  the genomic sequences of humans or fish  depending on which spike in RNAs were used  and the sequences of the polyA standards generated previously  with the parameters \u201c  runThreadN 16   runMode alignReads   outFilterMultimapNmax 1   outReadsUnmapped Fastx   outFilterType BySJout   outSAMattributes All   outSAMtype BAM Unsorted SortedByCoordinate\u201d. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4  primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters  tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4\u20137 tail lengths at quantile 10  25  75  and 90. Supplementary files format and content: For PAL seq v3 or v4  tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4", "embryo", null, "Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 \u00b5g/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase\u2022In in a volume of 10 \u00b5l per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4\u00b0C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37\u00b0C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3\u02b9 adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 \u00b5l. The RNA and oligos were annealed by incubation at 70\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 40 \u00b5l MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 \u00b5l 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 \u00b5l 2x SSC. The RNA was eluted from the beads first with 100 \u00b5l 10 mM HEPES pH 7.5 at 65\u00b0C for 3 min and then second with 100 \u00b5l water at 65\u00b0C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 \u00b5l water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3\u02b9 adapter in a 10 \u00b5l reaction containing 5 \u00b5M 3\u02b9 adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/\u00b5l T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23\u00b0C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 \u00b5l water. The ligated RNA was mixed with 0.6 \u00b5l 100 \u00b5M reverse transcription primer KXS037 in a total volume of 12 \u00b5l  incubated at 65\u00b0C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 \u00b5l reaction containing 1x First Strand Buffer  500 \u00b5M dNTPs  5 mM dithiothreitol  1 unit/\u00b5l SUPERase\u2022In  and 200 units SuperScript III Thermo Fisher  18080044 at 50\u00b0C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 \u00b5l 1 M NaOH at 90\u00b0C for 10 min  followed by neutralization with 36.7 \u00b5l 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 \u00b5l PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer\u2019s suggested protocol for 10\u201315 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3\u02b9 adapter KXS013 was used for 3\u02b9 end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 \u00b5l. The cDNAs and the oligo were annealed by incubation at 65\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 100 \u00b5l MyOne Streptavidin C1 beads and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 \u00b5l 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 \u00b5l water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.", null, "tissue:embryo|treatment:N1", "GSM7716868", "GSM7716868: Fish embryo mRNA 1024cell PAL seq v4; Danio rerio; OTHER", "GSM7716868 r1", "GSM7716868", "1", "Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 \u00b5g/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase\u2022In in a volume of 10 \u00b5l per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4\u00b0C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37\u00b0C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3\u02b9 adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 \u00b5l. The RNA and oligos were annealed by incubation at 70\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 40 \u00b5l MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 \u00b5l 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 \u00b5l 2x SSC. The RNA was eluted from the beads first with 100 \u00b5l 10 mM HEPES pH 7.5 at 65\u00b0C for 3 min and then second with 100 \u00b5l water at 65\u00b0C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 \u00b5l water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3\u02b9 adapter in a 10 \u00b5l reaction containing 5 \u00b5M 3\u02b9 adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/\u00b5l T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23\u00b0C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 \u00b5l water. The ligated RNA was mixed with 0.6 \u00b5l 100 \u00b5M reverse transcription primer KXS037 in a total volume of 12 \u00b5l  incubated at 65\u00b0C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 \u00b5l reaction containing 1x First Strand Buffer  500 \u00b5M dNTPs  5 mM dithiothreitol  1 unit/\u00b5l SUPERase\u2022In  and 200 units SuperScript III Thermo Fisher  18080044 at 50\u00b0C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 \u00b5l 1 M NaOH at 90\u00b0C for 10 min  followed by neutralization with 36.7 \u00b5l 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 \u00b5l PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer's suggested protocol for 10\u201315 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3\u02b9 adapter KXS013 was used for 3\u02b9 end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 \u00b5l. The cDNAs and the oligo were annealed by incubation at 65\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 100 \u00b5l MyOne Streptavidin C1 beads and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 \u00b5l 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 \u00b5l water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP455680", null, null, "Fish_embryo_mRNA_1024cell_PAL_seq_v4_rep1_raw_read1.fastq.gz Fish_embryo_mRNA_1024cell_PAL_seq_v4_rep1_raw_read2.fastq.gz", "fastq fastq", 2191900794.0, 7139742.0, "GSM7716868 r1", "0:52 1:255", "A:571954354;C:551162617;G:572445400;T:490238669;N:6099754", 52, 255, null, null, 571954354, 551162617, 572445400, 490238669, 6099754, "SRX21396039", "SRS18636197", "SRA1694849", "Whitehead Institute", "Whitehead Institute", 2, 0.0011, 0.43387, 6e-05, 0.01058, 0.99864, 0.99971, 0.74576, 1.0, 52, 255, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "bulk", "bulk", null, "United States", "2023-08-17", "Zygote", "Embryo", "Embryo Imprecise", "All anatomical structures"], [25189, "SRR25670736", "SRX21396039", "SRS18636197", "SRP455680", "PRJNA1006406", "Control of polyA tail length and translation in vertebrate oocytes and early embryos", "GSE241107", "Other", "During oocyte maturation and early embryonic development  polyA tail lengths strongly influence mRNA translation. However  how tail lengths are controlled at different developmental stages has been unclear. Here  we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos  and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos  and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs  mice  and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection  implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time  polyA tail lengths of endogenous mRNAs from frog oocytes and embryos  fish embryos  and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6  2024.", null, null, null, "Fish embryo mRNA 1024cell PAL seq v4", "GSM7716868", null, "source name:embryo|tissue:embryo|treatment:N1|geo loc name:missing|collection date:missing", "Fish embryo mRNA 1024cell PAL seq v4", "For gene specific tail seq of mRNA reporters  data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4  reads were trimmed with cutadapt v3.7 with the parameters \u201c m 15   quality base=64  q 20 20   match read wildcards  e 0.05  a NNNNATCTCGTATGCCGTCTTCTGCTTG  O 7\u201d. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained  the genomic sequences of humans or fish  depending on which spike in RNAs were used  and the sequences of the polyA standards generated previously  with the parameters \u201c  runThreadN 16   runMode alignReads   outFilterMultimapNmax 1   outReadsUnmapped Fastx   outFilterType BySJout   outSAMattributes All   outSAMtype BAM Unsorted SortedByCoordinate\u201d. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4  primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters  tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4\u20137 tail lengths at quantile 10  25  75  and 90. Supplementary files format and content: For PAL seq v3 or v4  tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4", "embryo", null, "Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 \u00b5g/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase\u2022In in a volume of 10 \u00b5l per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4\u00b0C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37\u00b0C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3\u02b9 adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 \u00b5l. The RNA and oligos were annealed by incubation at 70\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 40 \u00b5l MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 \u00b5l 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 \u00b5l 2x SSC. The RNA was eluted from the beads first with 100 \u00b5l 10 mM HEPES pH 7.5 at 65\u00b0C for 3 min and then second with 100 \u00b5l water at 65\u00b0C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 \u00b5l water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3\u02b9 adapter in a 10 \u00b5l reaction containing 5 \u00b5M 3\u02b9 adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/\u00b5l T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23\u00b0C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 \u00b5l water. The ligated RNA was mixed with 0.6 \u00b5l 100 \u00b5M reverse transcription primer KXS037 in a total volume of 12 \u00b5l  incubated at 65\u00b0C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 \u00b5l reaction containing 1x First Strand Buffer  500 \u00b5M dNTPs  5 mM dithiothreitol  1 unit/\u00b5l SUPERase\u2022In  and 200 units SuperScript III Thermo Fisher  18080044 at 50\u00b0C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 \u00b5l 1 M NaOH at 90\u00b0C for 10 min  followed by neutralization with 36.7 \u00b5l 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 \u00b5l PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer\u2019s suggested protocol for 10\u201315 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3\u02b9 adapter KXS013 was used for 3\u02b9 end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 \u00b5l. The cDNAs and the oligo were annealed by incubation at 65\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 100 \u00b5l MyOne Streptavidin C1 beads and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 \u00b5l 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 \u00b5l water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.", null, "tissue:embryo|treatment:N1", "GSM7716868", "GSM7716868: Fish embryo mRNA 1024cell PAL seq v4; Danio rerio; OTHER", "GSM7716868 r1", "GSM7716868", "1", "Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 \u00b5g/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase\u2022In in a volume of 10 \u00b5l per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4\u00b0C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37\u00b0C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3\u02b9 adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 \u00b5l. The RNA and oligos were annealed by incubation at 70\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 40 \u00b5l MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 \u00b5l 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 \u00b5l 2x SSC. The RNA was eluted from the beads first with 100 \u00b5l 10 mM HEPES pH 7.5 at 65\u00b0C for 3 min and then second with 100 \u00b5l water at 65\u00b0C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 \u00b5l water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3\u02b9 adapter in a 10 \u00b5l reaction containing 5 \u00b5M 3\u02b9 adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/\u00b5l T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23\u00b0C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 \u00b5l water. The ligated RNA was mixed with 0.6 \u00b5l 100 \u00b5M reverse transcription primer KXS037 in a total volume of 12 \u00b5l  incubated at 65\u00b0C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 \u00b5l reaction containing 1x First Strand Buffer  500 \u00b5M dNTPs  5 mM dithiothreitol  1 unit/\u00b5l SUPERase\u2022In  and 200 units SuperScript III Thermo Fisher  18080044 at 50\u00b0C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 \u00b5l 1 M NaOH at 90\u00b0C for 10 min  followed by neutralization with 36.7 \u00b5l 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 \u00b5l PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer's suggested protocol for 10\u201315 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3\u02b9 adapter KXS013 was used for 3\u02b9 end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 \u00b5l. The cDNAs and the oligo were annealed by incubation at 65\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 100 \u00b5l MyOne Streptavidin C1 beads and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 \u00b5l 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 \u00b5l water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP455680", null, null, "Fish_embryo_mRNA_1024cell_PAL_seq_v4_rep2_raw_read1.fastq.gz Fish_embryo_mRNA_1024cell_PAL_seq_v4_rep2_raw_read2.fastq.gz", "fastq fastq", 3840723193.0, 12510499.0, "GSM7716868 r2", "0:52 1:255", "A:985340216;C:991311706;G:1034487140;T:821820974;N:7763157", 52, 255, null, null, 985340216, 991311706, 1034487140, 821820974, 7763157, "SRX21396039", "SRS18636197", "SRA1694849", "Whitehead Institute", "Whitehead Institute", 2, 0.0021, 0.0, 0.00026, 0.0, 0.99859, 1.0, 0.71022, null, 52, 255, "T", "T", "mates < 9% mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "bulk", "bulk", null, "United States", "2023-08-17", "Zygote", "Embryo", "Embryo Imprecise", "All anatomical structures"], [25190, "SRR25670737", "SRX21396038", "SRS18636196", "SRP455680", "PRJNA1006406", "Control of polyA tail length and translation in vertebrate oocytes and early embryos", "GSE241107", "Other", "During oocyte maturation and early embryonic development  polyA tail lengths strongly influence mRNA translation. However  how tail lengths are controlled at different developmental stages has been unclear. Here  we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos  and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos  and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs  mice  and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection  implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time  polyA tail lengths of endogenous mRNAs from frog oocytes and embryos  fish embryos  and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6  2024.", null, null, null, "Fish embryo mRNA 128cell PAL seq v4", "GSM7716867", null, "source name:embryo|tissue:embryo|treatment:N1|geo loc name:missing|collection date:missing", "Fish embryo mRNA 128cell PAL seq v4", "For gene specific tail seq of mRNA reporters  data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4  reads were trimmed with cutadapt v3.7 with the parameters \u201c m 15   quality base=64  q 20 20   match read wildcards  e 0.05  a NNNNATCTCGTATGCCGTCTTCTGCTTG  O 7\u201d. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained  the genomic sequences of humans or fish  depending on which spike in RNAs were used  and the sequences of the polyA standards generated previously  with the parameters \u201c  runThreadN 16   runMode alignReads   outFilterMultimapNmax 1   outReadsUnmapped Fastx   outFilterType BySJout   outSAMattributes All   outSAMtype BAM Unsorted SortedByCoordinate\u201d. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4  primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters  tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4\u20137 tail lengths at quantile 10  25  75  and 90. Supplementary files format and content: For PAL seq v3 or v4  tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4", "embryo", null, "Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 \u00b5g/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase\u2022In in a volume of 10 \u00b5l per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4\u00b0C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37\u00b0C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3\u02b9 adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 \u00b5l. The RNA and oligos were annealed by incubation at 70\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 40 \u00b5l MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 \u00b5l 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 \u00b5l 2x SSC. The RNA was eluted from the beads first with 100 \u00b5l 10 mM HEPES pH 7.5 at 65\u00b0C for 3 min and then second with 100 \u00b5l water at 65\u00b0C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 \u00b5l water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3\u02b9 adapter in a 10 \u00b5l reaction containing 5 \u00b5M 3\u02b9 adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/\u00b5l T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23\u00b0C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 \u00b5l water. The ligated RNA was mixed with 0.6 \u00b5l 100 \u00b5M reverse transcription primer KXS037 in a total volume of 12 \u00b5l  incubated at 65\u00b0C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 \u00b5l reaction containing 1x First Strand Buffer  500 \u00b5M dNTPs  5 mM dithiothreitol  1 unit/\u00b5l SUPERase\u2022In  and 200 units SuperScript III Thermo Fisher  18080044 at 50\u00b0C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 \u00b5l 1 M NaOH at 90\u00b0C for 10 min  followed by neutralization with 36.7 \u00b5l 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 \u00b5l PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer\u2019s suggested protocol for 10\u201315 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3\u02b9 adapter KXS013 was used for 3\u02b9 end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 \u00b5l. The cDNAs and the oligo were annealed by incubation at 65\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 100 \u00b5l MyOne Streptavidin C1 beads and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 \u00b5l 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 \u00b5l water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.", null, "tissue:embryo|treatment:N1", "GSM7716867", "GSM7716867: Fish embryo mRNA 128cell PAL seq v4; Danio rerio; OTHER", "GSM7716867 r1", "GSM7716867", "1", "Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 \u00b5g/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase\u2022In in a volume of 10 \u00b5l per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4\u00b0C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37\u00b0C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3\u02b9 adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 \u00b5l. The RNA and oligos were annealed by incubation at 70\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 40 \u00b5l MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 \u00b5l 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 \u00b5l 2x SSC. The RNA was eluted from the beads first with 100 \u00b5l 10 mM HEPES pH 7.5 at 65\u00b0C for 3 min and then second with 100 \u00b5l water at 65\u00b0C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 \u00b5l water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3\u02b9 adapter in a 10 \u00b5l reaction containing 5 \u00b5M 3\u02b9 adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/\u00b5l T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23\u00b0C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 \u00b5l water. The ligated RNA was mixed with 0.6 \u00b5l 100 \u00b5M reverse transcription primer KXS037 in a total volume of 12 \u00b5l  incubated at 65\u00b0C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 \u00b5l reaction containing 1x First Strand Buffer  500 \u00b5M dNTPs  5 mM dithiothreitol  1 unit/\u00b5l SUPERase\u2022In  and 200 units SuperScript III Thermo Fisher  18080044 at 50\u00b0C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 \u00b5l 1 M NaOH at 90\u00b0C for 10 min  followed by neutralization with 36.7 \u00b5l 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 \u00b5l PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer's suggested protocol for 10\u201315 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3\u02b9 adapter KXS013 was used for 3\u02b9 end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 \u00b5l. The cDNAs and the oligo were annealed by incubation at 65\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 100 \u00b5l MyOne Streptavidin C1 beads and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 \u00b5l 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 \u00b5l water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP455680", null, null, "Fish_embryo_mRNA_128cell_PAL_seq_v4_rep1_raw_read1.fastq.gz Fish_embryo_mRNA_128cell_PAL_seq_v4_rep1_raw_read2.fastq.gz", "fastq fastq", 2104868443.0, 6856249.0, "GSM7716867 r1", "0:52 1:255", "A:539122676;C:505234642;G:558793048;T:495876292;N:5841785", 52, 255, null, null, 539122676, 505234642, 558793048, 495876292, 5841785, "SRX21396038", "SRS18636196", "SRA1694849", "Whitehead Institute", "Whitehead Institute", 2, 0.00035, 0.29379, 7e-05, 0.01129, 0.99949, 0.99971, 0.55882, 0.79591, 52, 255, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "bulk", "bulk", null, "United States", "2023-08-17", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [25191, "SRR25670738", "SRX21396038", "SRS18636196", "SRP455680", "PRJNA1006406", "Control of polyA tail length and translation in vertebrate oocytes and early embryos", "GSE241107", "Other", "During oocyte maturation and early embryonic development  polyA tail lengths strongly influence mRNA translation. However  how tail lengths are controlled at different developmental stages has been unclear. Here  we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos  and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos  and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs  mice  and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection  implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time  polyA tail lengths of endogenous mRNAs from frog oocytes and embryos  fish embryos  and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6  2024.", null, null, null, "Fish embryo mRNA 128cell PAL seq v4", "GSM7716867", null, "source name:embryo|tissue:embryo|treatment:N1|geo loc name:missing|collection date:missing", "Fish embryo mRNA 128cell PAL seq v4", "For gene specific tail seq of mRNA reporters  data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4  reads were trimmed with cutadapt v3.7 with the parameters \u201c m 15   quality base=64  q 20 20   match read wildcards  e 0.05  a NNNNATCTCGTATGCCGTCTTCTGCTTG  O 7\u201d. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained  the genomic sequences of humans or fish  depending on which spike in RNAs were used  and the sequences of the polyA standards generated previously  with the parameters \u201c  runThreadN 16   runMode alignReads   outFilterMultimapNmax 1   outReadsUnmapped Fastx   outFilterType BySJout   outSAMattributes All   outSAMtype BAM Unsorted SortedByCoordinate\u201d. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4  primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters  tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4\u20137 tail lengths at quantile 10  25  75  and 90. Supplementary files format and content: For PAL seq v3 or v4  tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4", "embryo", null, "Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 \u00b5g/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase\u2022In in a volume of 10 \u00b5l per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4\u00b0C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37\u00b0C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3\u02b9 adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 \u00b5l. The RNA and oligos were annealed by incubation at 70\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 40 \u00b5l MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 \u00b5l 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 \u00b5l 2x SSC. The RNA was eluted from the beads first with 100 \u00b5l 10 mM HEPES pH 7.5 at 65\u00b0C for 3 min and then second with 100 \u00b5l water at 65\u00b0C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 \u00b5l water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3\u02b9 adapter in a 10 \u00b5l reaction containing 5 \u00b5M 3\u02b9 adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/\u00b5l T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23\u00b0C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 \u00b5l water. The ligated RNA was mixed with 0.6 \u00b5l 100 \u00b5M reverse transcription primer KXS037 in a total volume of 12 \u00b5l  incubated at 65\u00b0C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 \u00b5l reaction containing 1x First Strand Buffer  500 \u00b5M dNTPs  5 mM dithiothreitol  1 unit/\u00b5l SUPERase\u2022In  and 200 units SuperScript III Thermo Fisher  18080044 at 50\u00b0C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 \u00b5l 1 M NaOH at 90\u00b0C for 10 min  followed by neutralization with 36.7 \u00b5l 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 \u00b5l PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer\u2019s suggested protocol for 10\u201315 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3\u02b9 adapter KXS013 was used for 3\u02b9 end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 \u00b5l. The cDNAs and the oligo were annealed by incubation at 65\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 100 \u00b5l MyOne Streptavidin C1 beads and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 \u00b5l 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 \u00b5l water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.", null, "tissue:embryo|treatment:N1", "GSM7716867", "GSM7716867: Fish embryo mRNA 128cell PAL seq v4; Danio rerio; OTHER", "GSM7716867 r1", "GSM7716867", "1", "Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 \u00b5g/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase\u2022In in a volume of 10 \u00b5l per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4\u00b0C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37\u00b0C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3\u02b9 adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 \u00b5l. The RNA and oligos were annealed by incubation at 70\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 40 \u00b5l MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 \u00b5l 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 \u00b5l 2x SSC. The RNA was eluted from the beads first with 100 \u00b5l 10 mM HEPES pH 7.5 at 65\u00b0C for 3 min and then second with 100 \u00b5l water at 65\u00b0C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 \u00b5l water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3\u02b9 adapter in a 10 \u00b5l reaction containing 5 \u00b5M 3\u02b9 adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/\u00b5l T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23\u00b0C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 \u00b5l water. The ligated RNA was mixed with 0.6 \u00b5l 100 \u00b5M reverse transcription primer KXS037 in a total volume of 12 \u00b5l  incubated at 65\u00b0C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 \u00b5l reaction containing 1x First Strand Buffer  500 \u00b5M dNTPs  5 mM dithiothreitol  1 unit/\u00b5l SUPERase\u2022In  and 200 units SuperScript III Thermo Fisher  18080044 at 50\u00b0C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 \u00b5l 1 M NaOH at 90\u00b0C for 10 min  followed by neutralization with 36.7 \u00b5l 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 \u00b5l PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer's suggested protocol for 10\u201315 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3\u02b9 adapter KXS013 was used for 3\u02b9 end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 \u00b5l. The cDNAs and the oligo were annealed by incubation at 65\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 100 \u00b5l MyOne Streptavidin C1 beads and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 \u00b5l 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 \u00b5l water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP455680", null, null, "Fish_embryo_mRNA_128cell_PAL_seq_v4_rep2_raw_read1.fastq.gz Fish_embryo_mRNA_128cell_PAL_seq_v4_rep2_raw_read2.fastq.gz", "fastq fastq", 3135806371.0, 10214353.0, "GSM7716867 r2", "0:52 1:255", "A:776612486;C:774126305;G:853951502;T:724788612;N:6327466", 52, 255, null, null, 776612486, 774126305, 853951502, 724788612, 6327466, "SRX21396038", "SRS18636196", "SRA1694849", "Whitehead Institute", "Whitehead Institute", 2, 0.00066, 0.0, 0.00011, 0.0, 0.99939, 1.0, 0.55737, null, 52, 255, "T", "T", "mates < 9% mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "bulk", "bulk", null, "United States", "2023-08-17", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [25192, "SRR25670739", "SRX21396037", "SRS18636195", "SRP455680", "PRJNA1006406", "Control of polyA tail length and translation in vertebrate oocytes and early embryos", "GSE241107", "Other", "During oocyte maturation and early embryonic development  polyA tail lengths strongly influence mRNA translation. However  how tail lengths are controlled at different developmental stages has been unclear. Here  we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos  and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos  and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs  mice  and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection  implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time  polyA tail lengths of endogenous mRNAs from frog oocytes and embryos  fish embryos  and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6  2024.", null, null, null, "Fish embryo mRNA 8cell PAL seq v4", "GSM7716866", null, "source name:embryo|tissue:embryo|treatment:N1|geo loc name:missing|collection date:missing", "Fish embryo mRNA 8cell PAL seq v4", "For gene specific tail seq of mRNA reporters  data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4  reads were trimmed with cutadapt v3.7 with the parameters \u201c m 15   quality base=64  q 20 20   match read wildcards  e 0.05  a NNNNATCTCGTATGCCGTCTTCTGCTTG  O 7\u201d. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained  the genomic sequences of humans or fish  depending on which spike in RNAs were used  and the sequences of the polyA standards generated previously  with the parameters \u201c  runThreadN 16   runMode alignReads   outFilterMultimapNmax 1   outReadsUnmapped Fastx   outFilterType BySJout   outSAMattributes All   outSAMtype BAM Unsorted SortedByCoordinate\u201d. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4  primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters  tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4\u20137 tail lengths at quantile 10  25  75  and 90. Supplementary files format and content: For PAL seq v3 or v4  tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4", "embryo", null, "Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 \u00b5g/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase\u2022In in a volume of 10 \u00b5l per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4\u00b0C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37\u00b0C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3\u02b9 adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 \u00b5l. The RNA and oligos were annealed by incubation at 70\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 40 \u00b5l MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 \u00b5l 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 \u00b5l 2x SSC. The RNA was eluted from the beads first with 100 \u00b5l 10 mM HEPES pH 7.5 at 65\u00b0C for 3 min and then second with 100 \u00b5l water at 65\u00b0C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 \u00b5l water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3\u02b9 adapter in a 10 \u00b5l reaction containing 5 \u00b5M 3\u02b9 adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/\u00b5l T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23\u00b0C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 \u00b5l water. The ligated RNA was mixed with 0.6 \u00b5l 100 \u00b5M reverse transcription primer KXS037 in a total volume of 12 \u00b5l  incubated at 65\u00b0C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 \u00b5l reaction containing 1x First Strand Buffer  500 \u00b5M dNTPs  5 mM dithiothreitol  1 unit/\u00b5l SUPERase\u2022In  and 200 units SuperScript III Thermo Fisher  18080044 at 50\u00b0C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 \u00b5l 1 M NaOH at 90\u00b0C for 10 min  followed by neutralization with 36.7 \u00b5l 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 \u00b5l PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer\u2019s suggested protocol for 10\u201315 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3\u02b9 adapter KXS013 was used for 3\u02b9 end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 \u00b5l. The cDNAs and the oligo were annealed by incubation at 65\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 100 \u00b5l MyOne Streptavidin C1 beads and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 \u00b5l 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 \u00b5l water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.", null, "tissue:embryo|treatment:N1", "GSM7716866", "GSM7716866: Fish embryo mRNA 8cell PAL seq v4; Danio rerio; OTHER", "GSM7716866 r1", "GSM7716866", "1", "Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 \u00b5g/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase\u2022In in a volume of 10 \u00b5l per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4\u00b0C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37\u00b0C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3\u02b9 adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 \u00b5l. The RNA and oligos were annealed by incubation at 70\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 40 \u00b5l MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 \u00b5l 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 \u00b5l 2x SSC. The RNA was eluted from the beads first with 100 \u00b5l 10 mM HEPES pH 7.5 at 65\u00b0C for 3 min and then second with 100 \u00b5l water at 65\u00b0C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 \u00b5l water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3\u02b9 adapter in a 10 \u00b5l reaction containing 5 \u00b5M 3\u02b9 adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/\u00b5l T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23\u00b0C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 \u00b5l water. The ligated RNA was mixed with 0.6 \u00b5l 100 \u00b5M reverse transcription primer KXS037 in a total volume of 12 \u00b5l  incubated at 65\u00b0C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 \u00b5l reaction containing 1x First Strand Buffer  500 \u00b5M dNTPs  5 mM dithiothreitol  1 unit/\u00b5l SUPERase\u2022In  and 200 units SuperScript III Thermo Fisher  18080044 at 50\u00b0C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 \u00b5l 1 M NaOH at 90\u00b0C for 10 min  followed by neutralization with 36.7 \u00b5l 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 \u00b5l PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer's suggested protocol for 10\u201315 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3\u02b9 adapter KXS013 was used for 3\u02b9 end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 \u00b5l. The cDNAs and the oligo were annealed by incubation at 65\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 100 \u00b5l MyOne Streptavidin C1 beads and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 \u00b5l 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 \u00b5l water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP455680", null, null, "Fish_embryo_mRNA_8cell_PAL_seq_v4_rep1_raw_read1.fastq.gz Fish_embryo_mRNA_8cell_PAL_seq_v4_rep1_raw_read2.fastq.gz", "fastq fastq", 2618998887.0, 8530941.0, "GSM7716866 r1", "0:52 1:255", "A:673066508;C:641446717;G:706546263;T:590452494;N:7486905", 52, 255, null, null, 673066508, 641446717, 706546263, 590452494, 7486905, "SRX21396037", "SRS18636195", "SRA1694849", "Whitehead Institute", "Whitehead Institute", 2, 0.0009, 0.43244, 0.00014, 0.0054, 0.99902, 0.99967, 0.54901, 1.0, 52, 255, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "bulk", "bulk", null, "United States", "2023-08-17", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [25193, "SRR25670740", "SRX21396037", "SRS18636195", "SRP455680", "PRJNA1006406", "Control of polyA tail length and translation in vertebrate oocytes and early embryos", "GSE241107", "Other", "During oocyte maturation and early embryonic development  polyA tail lengths strongly influence mRNA translation. However  how tail lengths are controlled at different developmental stages has been unclear. Here  we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos  and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos  and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs  mice  and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection  implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time  polyA tail lengths of endogenous mRNAs from frog oocytes and embryos  fish embryos  and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6  2024.", null, null, null, "Fish embryo mRNA 8cell PAL seq v4", "GSM7716866", null, "source name:embryo|tissue:embryo|treatment:N1|geo loc name:missing|collection date:missing", "Fish embryo mRNA 8cell PAL seq v4", "For gene specific tail seq of mRNA reporters  data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4  reads were trimmed with cutadapt v3.7 with the parameters \u201c m 15   quality base=64  q 20 20   match read wildcards  e 0.05  a NNNNATCTCGTATGCCGTCTTCTGCTTG  O 7\u201d. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained  the genomic sequences of humans or fish  depending on which spike in RNAs were used  and the sequences of the polyA standards generated previously  with the parameters \u201c  runThreadN 16   runMode alignReads   outFilterMultimapNmax 1   outReadsUnmapped Fastx   outFilterType BySJout   outSAMattributes All   outSAMtype BAM Unsorted SortedByCoordinate\u201d. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4  primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters  tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4\u20137 tail lengths at quantile 10  25  75  and 90. Supplementary files format and content: For PAL seq v3 or v4  tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4", "embryo", null, "Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 \u00b5g/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase\u2022In in a volume of 10 \u00b5l per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4\u00b0C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37\u00b0C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3\u02b9 adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 \u00b5l. The RNA and oligos were annealed by incubation at 70\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 40 \u00b5l MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 \u00b5l 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 \u00b5l 2x SSC. The RNA was eluted from the beads first with 100 \u00b5l 10 mM HEPES pH 7.5 at 65\u00b0C for 3 min and then second with 100 \u00b5l water at 65\u00b0C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 \u00b5l water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3\u02b9 adapter in a 10 \u00b5l reaction containing 5 \u00b5M 3\u02b9 adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/\u00b5l T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23\u00b0C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 \u00b5l water. The ligated RNA was mixed with 0.6 \u00b5l 100 \u00b5M reverse transcription primer KXS037 in a total volume of 12 \u00b5l  incubated at 65\u00b0C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 \u00b5l reaction containing 1x First Strand Buffer  500 \u00b5M dNTPs  5 mM dithiothreitol  1 unit/\u00b5l SUPERase\u2022In  and 200 units SuperScript III Thermo Fisher  18080044 at 50\u00b0C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 \u00b5l 1 M NaOH at 90\u00b0C for 10 min  followed by neutralization with 36.7 \u00b5l 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 \u00b5l PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer\u2019s suggested protocol for 10\u201315 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3\u02b9 adapter KXS013 was used for 3\u02b9 end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 \u00b5l. The cDNAs and the oligo were annealed by incubation at 65\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 100 \u00b5l MyOne Streptavidin C1 beads and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 \u00b5l 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 \u00b5l water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.", null, "tissue:embryo|treatment:N1", "GSM7716866", "GSM7716866: Fish embryo mRNA 8cell PAL seq v4; Danio rerio; OTHER", "GSM7716866 r1", "GSM7716866", "1", "Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 \u00b5g/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase\u2022In in a volume of 10 \u00b5l per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4\u00b0C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37\u00b0C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3\u02b9 adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 \u00b5l. The RNA and oligos were annealed by incubation at 70\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 40 \u00b5l MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 \u00b5l 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 \u00b5l 2x SSC. The RNA was eluted from the beads first with 100 \u00b5l 10 mM HEPES pH 7.5 at 65\u00b0C for 3 min and then second with 100 \u00b5l water at 65\u00b0C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 \u00b5l water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3\u02b9 adapter in a 10 \u00b5l reaction containing 5 \u00b5M 3\u02b9 adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/\u00b5l T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23\u00b0C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 \u00b5l water. The ligated RNA was mixed with 0.6 \u00b5l 100 \u00b5M reverse transcription primer KXS037 in a total volume of 12 \u00b5l  incubated at 65\u00b0C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 \u00b5l reaction containing 1x First Strand Buffer  500 \u00b5M dNTPs  5 mM dithiothreitol  1 unit/\u00b5l SUPERase\u2022In  and 200 units SuperScript III Thermo Fisher  18080044 at 50\u00b0C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 \u00b5l 1 M NaOH at 90\u00b0C for 10 min  followed by neutralization with 36.7 \u00b5l 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 \u00b5l PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer's suggested protocol for 10\u201315 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3\u02b9 adapter KXS013 was used for 3\u02b9 end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 \u00b5l. The cDNAs and the oligo were annealed by incubation at 65\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 100 \u00b5l MyOne Streptavidin C1 beads and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 \u00b5l 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 \u00b5l water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP455680", null, null, "Fish_embryo_mRNA_8cell_PAL_seq_v4_rep2_raw_read1.fastq.gz Fish_embryo_mRNA_8cell_PAL_seq_v4_rep2_raw_read2.fastq.gz", "fastq fastq", 3028839589.0, 9865927.0, "GSM7716866 r2", "0:52 1:255", "A:756368817;C:758868409;G:836949742;T:670545278;N:6107343", 52, 255, null, null, 756368817, 758868409, 836949742, 670545278, 6107343, "SRX21396037", "SRS18636195", "SRA1694849", "Whitehead Institute", "Whitehead Institute", 2, 0.00156, 0.0, 0.00026, 0.0, 0.99835, 1.0, 0.44791, null, 52, 255, "T", "T", "mates < 9% mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "bulk", "bulk", null, "United States", "2023-08-17", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [25194, "SRR25670741", "SRX21396036", "SRS18636194", "SRP455680", "PRJNA1006406", "Control of polyA tail length and translation in vertebrate oocytes and early embryos", "GSE241107", "Other", "During oocyte maturation and early embryonic development  polyA tail lengths strongly influence mRNA translation. However  how tail lengths are controlled at different developmental stages has been unclear. Here  we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos  and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos  and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs  mice  and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection  implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time  polyA tail lengths of endogenous mRNAs from frog oocytes and embryos  fish embryos  and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6  2024.", null, null, null, "Fish embryo mRNA 1cell PAL seq v4", "GSM7716865", null, "source name:embryo|tissue:embryo|treatment:N1|geo loc name:missing|collection date:missing", "Fish embryo mRNA 1cell PAL seq v4", "For gene specific tail seq of mRNA reporters  data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4  reads were trimmed with cutadapt v3.7 with the parameters \u201c m 15   quality base=64  q 20 20   match read wildcards  e 0.05  a NNNNATCTCGTATGCCGTCTTCTGCTTG  O 7\u201d. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained  the genomic sequences of humans or fish  depending on which spike in RNAs were used  and the sequences of the polyA standards generated previously  with the parameters \u201c  runThreadN 16   runMode alignReads   outFilterMultimapNmax 1   outReadsUnmapped Fastx   outFilterType BySJout   outSAMattributes All   outSAMtype BAM Unsorted SortedByCoordinate\u201d. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4  primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters  tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4\u20137 tail lengths at quantile 10  25  75  and 90. Supplementary files format and content: For PAL seq v3 or v4  tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4", "embryo", null, "Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 \u00b5g/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase\u2022In in a volume of 10 \u00b5l per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4\u00b0C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37\u00b0C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3\u02b9 adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 \u00b5l. The RNA and oligos were annealed by incubation at 70\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 40 \u00b5l MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 \u00b5l 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 \u00b5l 2x SSC. The RNA was eluted from the beads first with 100 \u00b5l 10 mM HEPES pH 7.5 at 65\u00b0C for 3 min and then second with 100 \u00b5l water at 65\u00b0C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 \u00b5l water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3\u02b9 adapter in a 10 \u00b5l reaction containing 5 \u00b5M 3\u02b9 adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/\u00b5l T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23\u00b0C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 \u00b5l water. The ligated RNA was mixed with 0.6 \u00b5l 100 \u00b5M reverse transcription primer KXS037 in a total volume of 12 \u00b5l  incubated at 65\u00b0C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 \u00b5l reaction containing 1x First Strand Buffer  500 \u00b5M dNTPs  5 mM dithiothreitol  1 unit/\u00b5l SUPERase\u2022In  and 200 units SuperScript III Thermo Fisher  18080044 at 50\u00b0C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 \u00b5l 1 M NaOH at 90\u00b0C for 10 min  followed by neutralization with 36.7 \u00b5l 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 \u00b5l PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer\u2019s suggested protocol for 10\u201315 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3\u02b9 adapter KXS013 was used for 3\u02b9 end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 \u00b5l. The cDNAs and the oligo were annealed by incubation at 65\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 100 \u00b5l MyOne Streptavidin C1 beads and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 \u00b5l 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 \u00b5l water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.", null, "tissue:embryo|treatment:N1", "GSM7716865", "GSM7716865: Fish embryo mRNA 1cell PAL seq v4; Danio rerio; OTHER", "GSM7716865 r1", "GSM7716865", "1", "Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 \u00b5g/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase\u2022In in a volume of 10 \u00b5l per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4\u00b0C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37\u00b0C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3\u02b9 adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 \u00b5l. The RNA and oligos were annealed by incubation at 70\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 40 \u00b5l MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 \u00b5l 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 \u00b5l 2x SSC. The RNA was eluted from the beads first with 100 \u00b5l 10 mM HEPES pH 7.5 at 65\u00b0C for 3 min and then second with 100 \u00b5l water at 65\u00b0C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 \u00b5l water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3\u02b9 adapter in a 10 \u00b5l reaction containing 5 \u00b5M 3\u02b9 adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/\u00b5l T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23\u00b0C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 \u00b5l water. The ligated RNA was mixed with 0.6 \u00b5l 100 \u00b5M reverse transcription primer KXS037 in a total volume of 12 \u00b5l  incubated at 65\u00b0C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 \u00b5l reaction containing 1x First Strand Buffer  500 \u00b5M dNTPs  5 mM dithiothreitol  1 unit/\u00b5l SUPERase\u2022In  and 200 units SuperScript III Thermo Fisher  18080044 at 50\u00b0C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 \u00b5l 1 M NaOH at 90\u00b0C for 10 min  followed by neutralization with 36.7 \u00b5l 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 \u00b5l PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer's suggested protocol for 10\u201315 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3\u02b9 adapter KXS013 was used for 3\u02b9 end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 \u00b5l. The cDNAs and the oligo were annealed by incubation at 65\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 100 \u00b5l MyOne Streptavidin C1 beads and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 \u00b5l 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 \u00b5l water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP455680", null, null, "Fish_embryo_mRNA_1cell_PAL_seq_v4_rep1_raw_read1.fastq.gz Fish_embryo_mRNA_1cell_PAL_seq_v4_rep1_raw_read2.fastq.gz", "fastq fastq", 2050143851.0, 6677993.0, "GSM7716865 r1", "0:52 1:255", "A:536391564;C:527126186;G:557802929;T:422990166;N:5833006", 52, 255, null, null, 536391564, 527126186, 557802929, 422990166, 5833006, "SRX21396036", "SRS18636194", "SRA1694849", "Whitehead Institute", "Whitehead Institute", 2, 0.00016, 0.46479, 4e-05, 0.01408, 0.99979, 0.99969, 0.54545, 1.0, 52, 255, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "bulk", "bulk", null, "United States", "2023-08-17", "Zygote", "Embryo", "Embryo Imprecise", "All anatomical structures"], [25195, "SRR25670742", "SRX21396036", "SRS18636194", "SRP455680", "PRJNA1006406", "Control of polyA tail length and translation in vertebrate oocytes and early embryos", "GSE241107", "Other", "During oocyte maturation and early embryonic development  polyA tail lengths strongly influence mRNA translation. However  how tail lengths are controlled at different developmental stages has been unclear. Here  we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos  and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos  and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs  mice  and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection  implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time  polyA tail lengths of endogenous mRNAs from frog oocytes and embryos  fish embryos  and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6  2024.", null, null, null, "Fish embryo mRNA 1cell PAL seq v4", "GSM7716865", null, "source name:embryo|tissue:embryo|treatment:N1|geo loc name:missing|collection date:missing", "Fish embryo mRNA 1cell PAL seq v4", "For gene specific tail seq of mRNA reporters  data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4  reads were trimmed with cutadapt v3.7 with the parameters \u201c m 15   quality base=64  q 20 20   match read wildcards  e 0.05  a NNNNATCTCGTATGCCGTCTTCTGCTTG  O 7\u201d. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained  the genomic sequences of humans or fish  depending on which spike in RNAs were used  and the sequences of the polyA standards generated previously  with the parameters \u201c  runThreadN 16   runMode alignReads   outFilterMultimapNmax 1   outReadsUnmapped Fastx   outFilterType BySJout   outSAMattributes All   outSAMtype BAM Unsorted SortedByCoordinate\u201d. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4  primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters  tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4\u20137 tail lengths at quantile 10  25  75  and 90. Supplementary files format and content: For PAL seq v3 or v4  tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4", "embryo", null, "Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 \u00b5g/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase\u2022In in a volume of 10 \u00b5l per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4\u00b0C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37\u00b0C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3\u02b9 adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 \u00b5l. The RNA and oligos were annealed by incubation at 70\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 40 \u00b5l MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 \u00b5l 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 \u00b5l 2x SSC. The RNA was eluted from the beads first with 100 \u00b5l 10 mM HEPES pH 7.5 at 65\u00b0C for 3 min and then second with 100 \u00b5l water at 65\u00b0C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 \u00b5l water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3\u02b9 adapter in a 10 \u00b5l reaction containing 5 \u00b5M 3\u02b9 adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/\u00b5l T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23\u00b0C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 \u00b5l water. The ligated RNA was mixed with 0.6 \u00b5l 100 \u00b5M reverse transcription primer KXS037 in a total volume of 12 \u00b5l  incubated at 65\u00b0C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 \u00b5l reaction containing 1x First Strand Buffer  500 \u00b5M dNTPs  5 mM dithiothreitol  1 unit/\u00b5l SUPERase\u2022In  and 200 units SuperScript III Thermo Fisher  18080044 at 50\u00b0C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 \u00b5l 1 M NaOH at 90\u00b0C for 10 min  followed by neutralization with 36.7 \u00b5l 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 \u00b5l PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer\u2019s suggested protocol for 10\u201315 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3\u02b9 adapter KXS013 was used for 3\u02b9 end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 \u00b5l. The cDNAs and the oligo were annealed by incubation at 65\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 100 \u00b5l MyOne Streptavidin C1 beads and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 \u00b5l 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 \u00b5l water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.", null, "tissue:embryo|treatment:N1", "GSM7716865", "GSM7716865: Fish embryo mRNA 1cell PAL seq v4; Danio rerio; OTHER", "GSM7716865 r1", "GSM7716865", "1", "Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 \u00b5g/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase\u2022In in a volume of 10 \u00b5l per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4\u00b0C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37\u00b0C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3\u02b9 adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 \u00b5l. The RNA and oligos were annealed by incubation at 70\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 40 \u00b5l MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 \u00b5l 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 \u00b5l 2x SSC. The RNA was eluted from the beads first with 100 \u00b5l 10 mM HEPES pH 7.5 at 65\u00b0C for 3 min and then second with 100 \u00b5l water at 65\u00b0C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 \u00b5l water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3\u02b9 adapter in a 10 \u00b5l reaction containing 5 \u00b5M 3\u02b9 adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/\u00b5l T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23\u00b0C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 \u00b5l water. The ligated RNA was mixed with 0.6 \u00b5l 100 \u00b5M reverse transcription primer KXS037 in a total volume of 12 \u00b5l  incubated at 65\u00b0C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 \u00b5l reaction containing 1x First Strand Buffer  500 \u00b5M dNTPs  5 mM dithiothreitol  1 unit/\u00b5l SUPERase\u2022In  and 200 units SuperScript III Thermo Fisher  18080044 at 50\u00b0C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 \u00b5l 1 M NaOH at 90\u00b0C for 10 min  followed by neutralization with 36.7 \u00b5l 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 \u00b5l PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer's suggested protocol for 10\u201315 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3\u02b9 adapter KXS013 was used for 3\u02b9 end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 \u00b5l. The cDNAs and the oligo were annealed by incubation at 65\u00b0C for 5 min and then slowly cooling to 23\u00b0C at 0.1\u00b0C/sec. The annealed mixture was combined with 100 \u00b5l MyOne Streptavidin C1 beads and incubated for 20 min at 23\u00b0C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 \u00b5l 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 \u00b5l water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP455680", null, null, "Fish_embryo_mRNA_1cell_PAL_seq_v4_rep2_raw_read1.fastq.gz Fish_embryo_mRNA_1cell_PAL_seq_v4_rep2_raw_read2.fastq.gz", "fastq fastq", 3406093776.0, 11094768.0, "GSM7716865 r2", "0:52 1:255", "A:868054279;C:890446070;G:945289336;T:695324057;N:6980034", 52, 255, null, null, 868054279, 890446070, 945289336, 695324057, 6980034, "SRX21396036", "SRS18636194", "SRA1694849", "Whitehead Institute", "Whitehead Institute", 2, 0.00049, 0.0, 0.00014, 0.0, 0.99939, 1.0, 0.58974, null, 52, 255, "T", "T", "mates < 9% mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "bulk", "bulk", null, "United States", "2023-08-17", "Zygote", "Embryo", "Embryo Imprecise", "All anatomical structures"], [33990, "SRR31030860", "SRX26416598", "SRS22936450", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "ZF NES GAPDH Rep4 minus", "GSM8578751", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing", "ZF NES GAPDH Rep4 minus", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF", "GSM8578751", "GSM8578751: ZF NES GAPDH Rep4 minus; Danio rerio; OTHER", "GSM8578751 r1", "GSM8578751", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "ZF_NES_GAPDH_Rep4_minus.R1.fq.gz ZF_NES_GAPDH_Rep4_minus.R2.fq.gz", "fastq fastq", 1100578200.0, 3668594.0, "GSM8578751 r1", "0:150 1:150", "A:287878221;C:249390946;G:265835736;T:297454600;N:18697", 150, 150, null, null, 287878221, 249390946, 265835736, 297454600, 18697, "SRX26416598", "SRS22936450", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [33991, "SRR31030861", "SRX26416597", "SRS22936451", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "ZF NES GAPDH Rep3 plus", "GSM8578750", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing", "ZF NES GAPDH Rep3 plus", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF", "GSM8578750", "GSM8578750: ZF NES GAPDH Rep3 plus; Danio rerio; OTHER", "GSM8578750 r1", "GSM8578750", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "ZF_NES_GAPDH_Rep3_plus.R1.fq.gz ZF_NES_GAPDH_Rep3_plus.R2.fq.gz", "fastq fastq", 1231779300.0, 4105931.0, "GSM8578750 r1", "0:150 1:150", "A:322256597;C:278991471;G:297394980;T:333116282;N:19970", 150, 150, null, null, 322256597, 278991471, 297394980, 333116282, 19970, "SRX26416597", "SRS22936451", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [33992, "SRR31030862", "SRX26416596", "SRS22936449", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "ZF NES GAPDH Rep3 minus", "GSM8578749", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing", "ZF NES GAPDH Rep3 minus", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF", "GSM8578749", "GSM8578749: ZF NES GAPDH Rep3 minus; Danio rerio; OTHER", "GSM8578749 r1", "GSM8578749", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "ZF_NES_GAPDH_Rep3_minus.R1.fq.gz ZF_NES_GAPDH_Rep3_minus.R2.fq.gz", "fastq fastq", 1002124500.0, 3340415.0, "GSM8578749 r1", "0:150 1:150", "A:262024969;C:227163761;G:242157218;T:270761424;N:17128", 150, 150, null, null, 262024969, 227163761, 242157218, 270761424, 17128, "SRX26416596", "SRS22936449", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [33993, "SRR31030863", "SRX26416595", "SRS22936448", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "ZF NES GAPDH Rep2 plus", "GSM8578748", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing", "ZF NES GAPDH Rep2 plus", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF", "GSM8578748", "GSM8578748: ZF NES GAPDH Rep2 plus; Danio rerio; OTHER", "GSM8578748 r1", "GSM8578748", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "ZF_NES_GAPDH_Rep2_plus.R1.fq.gz ZF_NES_GAPDH_Rep2_plus.R2.fq.gz", "fastq fastq", 1051565100.0, 3505217.0, "GSM8578748 r1", "0:150 1:150", "A:275784945;C:237523425;G:253300749;T:284937948;N:18033", 150, 150, null, null, 275784945, 237523425, 253300749, 284937948, 18033, "SRX26416595", "SRS22936448", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [33994, "SRR31030864", "SRX26416594", "SRS22936447", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "ZF NES GAPDH Rep2 minus", "GSM8578747", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing", "ZF NES GAPDH Rep2 minus", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF", "GSM8578747", "GSM8578747: ZF NES GAPDH Rep2 minus; Danio rerio; OTHER", "GSM8578747 r1", "GSM8578747", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "ZF_NES_GAPDH_Rep2_minus.R1.fq.gz ZF_NES_GAPDH_Rep2_minus.R2.fq.gz", "fastq fastq", 1021837200.0, 3406124.0, "GSM8578747 r1", "0:150 1:150", "A:268290250;C:230525208;G:245949056;T:277056045;N:16641", 150, 150, null, null, 268290250, 230525208, 245949056, 277056045, 16641, "SRX26416594", "SRS22936447", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [33995, "SRR31030865", "SRX26416593", "SRS22936446", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "ZF NES GAPDH Rep1 plus", "GSM8578746", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing", "ZF NES GAPDH Rep1 plus", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF", "GSM8578746", "GSM8578746: ZF NES GAPDH Rep1 plus; Danio rerio; OTHER", "GSM8578746 r1", "GSM8578746", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "ZF_NES_GAPDH_Rep1_plus.R1.fq.gz ZF_NES_GAPDH_Rep1_plus.R2.fq.gz", "fastq fastq", 1093620300.0, 3645401.0, "GSM8578746 r1", "0:150 1:150", "A:285989719;C:247805250;G:264181043;T:295625946;N:18342", 150, 150, null, null, 285989719, 247805250, 264181043, 295625946, 18342, "SRX26416593", "SRS22936446", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [33996, "SRR31030866", "SRX26416592", "SRS22936445", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "ZF NES GAPDH Rep1 minus", "GSM8578745", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing", "ZF NES GAPDH Rep1 minus", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF", "GSM8578745", "GSM8578745: ZF NES GAPDH Rep1 minus; Danio rerio; OTHER", "GSM8578745 r1", "GSM8578745", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "ZF_NES_GAPDH_Rep1_minus.R1.fq.gz ZF_NES_GAPDH_Rep1_minus.R2.fq.gz", "fastq fastq", 911747100.0, 3039157.0, "GSM8578745 r1", "0:150 1:150", "A:239833349;C:205185786;G:218897710;T:247814511;N:15744", 150, 150, null, null, 239833349, 205185786, 218897710, 247814511, 15744, "SRX26416592", "SRS22936445", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [33997, "SRR31030867", "SRX26416591", "SRS22936444", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "ZF H2B MALAT1 Rep4 plus", "GSM8578744", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF|geo loc name:missing|collection date:missing", "ZF H2B MALAT1 Rep4 plus", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF", "GSM8578744", "GSM8578744: ZF H2B MALAT1 Rep4 plus; Danio rerio; OTHER", "GSM8578744 r1", "GSM8578744", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "ZF_H2B_MALAT1_Rep4_plus.R1.fq.gz ZF_H2B_MALAT1_Rep4_plus.R2.fq.gz", "fastq fastq", 842103300.0, 2807011.0, "GSM8578744 r1", "0:150 1:150", "A:204870477;C:222752099;G:215404135;T:199062275;N:14314", 150, 150, null, null, 204870477, 222752099, 215404135, 199062275, 14314, "SRX26416591", "SRS22936444", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [33998, "SRR31030868", "SRX26416590", "SRS22936442", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "ZF H2B MALAT1 Rep4 minus", "GSM8578743", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF|geo loc name:missing|collection date:missing", "ZF H2B MALAT1 Rep4 minus", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF", "GSM8578743", "GSM8578743: ZF H2B MALAT1 Rep4 minus; Danio rerio; OTHER", "GSM8578743 r1", "GSM8578743", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "ZF_H2B_MALAT1_Rep4_minus.R1.fq.gz ZF_H2B_MALAT1_Rep4_minus.R2.fq.gz", "fastq fastq", 1166375100.0, 3887917.0, "GSM8578743 r1", "0:150 1:150", "A:283781955;C:308660466;G:298298204;T:275614377;N:20098", 150, 150, null, null, 283781955, 308660466, 298298204, 275614377, 20098, "SRX26416590", "SRS22936442", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [33999, "SRR31030869", "SRX26416589", "SRS22936443", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "ZF H2B MALAT1 Rep3 plus", "GSM8578742", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF|geo loc name:missing|collection date:missing", "ZF H2B MALAT1 Rep3 plus", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF", "GSM8578742", "GSM8578742: ZF H2B MALAT1 Rep3 plus; Danio rerio; OTHER", "GSM8578742 r1", "GSM8578742", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "ZF_H2B_MALAT1_Rep3_plus.R1.fq.gz ZF_H2B_MALAT1_Rep3_plus.R2.fq.gz", "fastq fastq", 1159439400.0, 3864798.0, "GSM8578742 r1", "0:150 1:150", "A:282055391;C:306842216;G:296569227;T:273952570;N:19996", 150, 150, null, null, 282055391, 306842216, 296569227, 273952570, 19996, "SRX26416589", "SRS22936443", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [34000, "SRR31030870", "SRX26416588", "SRS22936440", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "ZF H2B MALAT1 Rep3 minus", "GSM8578741", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF|geo loc name:missing|collection date:missing", "ZF H2B MALAT1 Rep3 minus", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF", "GSM8578741", "GSM8578741: ZF H2B MALAT1 Rep3 minus; Danio rerio; OTHER", "GSM8578741 r1", "GSM8578741", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "ZF_H2B_MALAT1_Rep3_minus.R1.fq.gz ZF_H2B_MALAT1_Rep3_minus.R2.fq.gz", "fastq fastq", 1008297600.0, 3360992.0, "GSM8578741 r1", "0:150 1:150", "A:245277585;C:266840408;G:257911846;T:238251305;N:16456", 150, 150, null, null, 245277585, 266840408, 257911846, 238251305, 16456, "SRX26416588", "SRS22936440", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [34001, "SRR31030871", "SRX26416587", "SRS22936441", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "ZF H2B MALAT1 Rep2 plus", "GSM8578740", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF|geo loc name:missing|collection date:missing", "ZF H2B MALAT1 Rep2 plus", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF", "GSM8578740", "GSM8578740: ZF H2B MALAT1 Rep2 plus; Danio rerio; OTHER", "GSM8578740 r1", "GSM8578740", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "ZF_H2B_MALAT1_Rep2_plus.R1.fq.gz ZF_H2B_MALAT1_Rep2_plus.R2.fq.gz", "fastq fastq", 1419263400.0, 4730878.0, "GSM8578740 r1", "0:150 1:150", "A:345302268;C:375591885;G:362956395;T:335387828;N:25024", 150, 150, null, null, 345302268, 375591885, 362956395, 335387828, 25024, "SRX26416587", "SRS22936441", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [34002, "SRR31030872", "SRX26416586", "SRS22936439", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "ZF H2B MALAT1 Rep2 minus", "GSM8578739", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF|geo loc name:missing|collection date:missing", "ZF H2B MALAT1 Rep2 minus", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF", "GSM8578739", "GSM8578739: ZF H2B MALAT1 Rep2 minus; Danio rerio; OTHER", "GSM8578739 r1", "GSM8578739", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "ZF_H2B_MALAT1_Rep2_minus.R1.fq.gz ZF_H2B_MALAT1_Rep2_minus.R2.fq.gz", "fastq fastq", 1249910700.0, 4166369.0, "GSM8578739 r1", "0:150 1:150", "A:304074828;C:330741431;G:319677748;T:295395235;N:21458", 150, 150, null, null, 304074828, 330741431, 319677748, 295395235, 21458, "SRX26416586", "SRS22936439", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [34003, "SRR31030873", "SRX26416585", "SRS22936438", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "ZF H2B MALAT1 Rep1 plus", "GSM8578738", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF|geo loc name:missing|collection date:missing", "ZF H2B MALAT1 Rep1 plus", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF", "GSM8578738", "GSM8578738: ZF H2B MALAT1 Rep1 plus; Danio rerio; OTHER", "GSM8578738 r1", "GSM8578738", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "ZF_H2B_MALAT1_Rep1_plus.R1.fq.gz ZF_H2B_MALAT1_Rep1_plus.R2.fq.gz", "fastq fastq", 1257872700.0, 4192909.0, "GSM8578738 r1", "0:150 1:150", "A:306022947;C:332851039;G:321699513;T:297277788;N:21413", 150, 150, null, null, 306022947, 332851039, 321699513, 297277788, 21413, "SRX26416585", "SRS22936438", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [34004, "SRR31030874", "SRX26416584", "SRS22936437", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "ZF H2B MALAT1 Rep1 minus", "GSM8578737", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF|geo loc name:missing|collection date:missing", "ZF H2B MALAT1 Rep1 minus", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF", "GSM8578737", "GSM8578737: ZF H2B MALAT1 Rep1 minus; Danio rerio; OTHER", "GSM8578737 r1", "GSM8578737", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "ZF_H2B_MALAT1_Rep1_minus.R1.fq.gz ZF_H2B_MALAT1_Rep1_minus.R2.fq.gz", "fastq fastq", 1377040200.0, 4590134.0, "GSM8578737 r1", "0:150 1:150", "A:335021330;C:364359707;G:352178356;T:325457746;N:23061", 150, 150, null, null, 335021330, 364359707, 352178356, 325457746, 23061, "SRX26416584", "SRS22936437", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [34005, "SRR31030875", "SRX26416583", "SRS22936435", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "ZF H2B GAPDH Rep4 plus", "GSM8578736", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF|geo loc name:missing|collection date:missing", "ZF H2B GAPDH Rep4 plus", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF", "GSM8578736", "GSM8578736: ZF H2B GAPDH Rep4 plus; Danio rerio; OTHER", "GSM8578736 r1", "GSM8578736", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "ZF_H2B_GAPDH_Rep4_plus.R1.fq.gz ZF_H2B_GAPDH_Rep4_plus.R2.fq.gz", "fastq fastq", 1051103100.0, 3503677.0, "GSM8578736 r1", "0:150 1:150", "A:274220771;C:238733668;G:254670769;T:283460283;N:17609", 150, 150, null, null, 274220771, 238733668, 254670769, 283460283, 17609, "SRX26416583", "SRS22936435", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "mate1-mate2 similar by mapping diff", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [34006, "SRR31030876", "SRX26416582", "SRS22936436", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "ZF H2B GAPDH Rep4 minus", "GSM8578735", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF|geo loc name:missing|collection date:missing", "ZF H2B GAPDH Rep4 minus", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF", "GSM8578735", "GSM8578735: ZF H2B GAPDH Rep4 minus; Danio rerio; OTHER", "GSM8578735 r1", "GSM8578735", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "ZF_H2B_GAPDH_Rep4_minus.R1.fq.gz ZF_H2B_GAPDH_Rep4_minus.R2.fq.gz", "fastq fastq", 1206485700.0, 4021619.0, "GSM8578735 r1", "0:150 1:150", "A:314740194;C:274101014;G:292357972;T:325267132;N:19388", 150, 150, null, null, 314740194, 274101014, 292357972, 325267132, 19388, "SRX26416582", "SRS22936436", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "mate1-mate2 similar by mapping diff", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [34007, "SRR31030877", "SRX26416581", "SRS22936434", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "ZF H2B GAPDH Rep3 plus", "GSM8578734", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF|geo loc name:missing|collection date:missing", "ZF H2B GAPDH Rep3 plus", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF", "GSM8578734", "GSM8578734: ZF H2B GAPDH Rep3 plus; Danio rerio; OTHER", "GSM8578734 r1", "GSM8578734", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "ZF_H2B_GAPDH_Rep3_plus.R1.fq.gz ZF_H2B_GAPDH_Rep3_plus.R2.fq.gz", "fastq fastq", 1140550200.0, 3801834.0, "GSM8578734 r1", "0:150 1:150", "A:297636297;C:258828826;G:276373993;T:307692213;N:18871", 150, 150, null, null, 297636297, 258828826, 276373993, 307692213, 18871, "SRX26416581", "SRS22936434", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "mate1-mate2 similar by mapping diff", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [34008, "SRR31030878", "SRX26416580", "SRS22936433", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "ZF H2B GAPDH Rep3 minus", "GSM8578733", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF|geo loc name:missing|collection date:missing", "ZF H2B GAPDH Rep3 minus", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF", "GSM8578733", "GSM8578733: ZF H2B GAPDH Rep3 minus; Danio rerio; OTHER", "GSM8578733 r1", "GSM8578733", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "ZF_H2B_GAPDH_Rep3_minus.R1.fq.gz ZF_H2B_GAPDH_Rep3_minus.R2.fq.gz", "fastq fastq", 782406600.0, 2608022.0, "GSM8578733 r1", "0:150 1:150", "A:204132316;C:177696721;G:189675433;T:210888939;N:13191", 150, 150, null, null, 204132316, 177696721, 189675433, 210888939, 13191, "SRX26416580", "SRS22936433", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "mate1-mate2 similar by mapping diff", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [34009, "SRR31030879", "SRX26416579", "SRS22936431", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "ZF H2B GAPDH Rep2 plus", "GSM8578732", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF|geo loc name:missing|collection date:missing", "ZF H2B GAPDH Rep2 plus", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF", "GSM8578732", "GSM8578732: ZF H2B GAPDH Rep2 plus; Danio rerio; OTHER", "GSM8578732 r1", "GSM8578732", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "ZF_H2B_GAPDH_Rep2_plus.R1.fq.gz ZF_H2B_GAPDH_Rep2_plus.R2.fq.gz", "fastq fastq", 958297200.0, 3194324.0, "GSM8578732 r1", "0:150 1:150", "A:250011335;C:217600823;G:232206339;T:258462392;N:16311", 150, 150, null, null, 250011335, 217600823, 232206339, 258462392, 16311, "SRX26416579", "SRS22936431", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "mate1-mate2 similar by mapping diff", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [34010, "SRR31030880", "SRX26416578", "SRS22936432", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "ZF H2B GAPDH Rep2 minus", "GSM8578731", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF|geo loc name:missing|collection date:missing", "ZF H2B GAPDH Rep2 minus", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF", "GSM8578731", "GSM8578731: ZF H2B GAPDH Rep2 minus; Danio rerio; OTHER", "GSM8578731 r1", "GSM8578731", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "ZF_H2B_GAPDH_Rep2_minus.R1.fq.gz ZF_H2B_GAPDH_Rep2_minus.R2.fq.gz", "fastq fastq", 1020926700.0, 3403089.0, "GSM8578731 r1", "0:150 1:150", "A:266429488;C:231749424;G:247353147;T:275377720;N:16921", 150, 150, null, null, 266429488, 231749424, 247353147, 275377720, 16921, "SRX26416578", "SRS22936432", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "mate1-mate2 similar by mapping diff", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [34011, "SRR31030881", "SRX26416577", "SRS22936430", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "ZF H2B GAPDH Rep1 plus", "GSM8578730", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF|geo loc name:missing|collection date:missing", "ZF H2B GAPDH Rep1 plus", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF", "GSM8578730", "GSM8578730: ZF H2B GAPDH Rep1 plus; Danio rerio; OTHER", "GSM8578730 r1", "GSM8578730", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "ZF_H2B_GAPDH_Rep1_plus.R1.fq.gz ZF_H2B_GAPDH_Rep1_plus.R2.fq.gz", "fastq fastq", 1134318600.0, 3781062.0, "GSM8578730 r1", "0:150 1:150", "A:295931335;C:257596481;G:274848790;T:305922827;N:19167", 150, 150, null, null, 295931335, 257596481, 274848790, 305922827, 19167, "SRX26416577", "SRS22936430", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "mate1-mate2 similar by mapping diff", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [34012, "SRR31030882", "SRX26416576", "SRS22936429", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "ZF H2B GAPDH Rep1 minus", "GSM8578729", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF|geo loc name:missing|collection date:missing", "ZF H2B GAPDH Rep1 minus", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF", "GSM8578729", "GSM8578729: ZF H2B GAPDH Rep1 minus; Danio rerio; OTHER", "GSM8578729 r1", "GSM8578729", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "ZF_H2B_GAPDH_Rep1_minus.R1.fq.gz ZF_H2B_GAPDH_Rep1_minus.R2.fq.gz", "fastq fastq", 752638800.0, 2508796.0, "GSM8578729 r1", "0:150 1:150", "A:196331185;C:170899863;G:182460258;T:202935049;N:12445", 150, 150, null, null, 196331185, 170899863, 182460258, 202935049, 12445, "SRX26416576", "SRS22936429", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "mate1-mate2 similar by mapping diff", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [34013, "SRR31031004", "SRX26416454", "SRS22936307", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "Zeb WT pDBF Rep3", "GSM8578770", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:wildtype|treatment:plus DBF|geo loc name:missing|collection date:missing", "Zeb WT pDBF Rep3", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:wildtype|treatment:plus DBF", "GSM8578770", "GSM8578770: Zeb WT pDBF Rep3; Danio rerio; OTHER", "GSM8578770 r1", "GSM8578770", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "Zeb_WT_pDBF_Rep3.R1.fq.gz Zeb_WT_pDBF_Rep3.R2.fq.gz", "fastq fastq", 23216831100.0, 77389437.0, "GSM8578770 r1", "0:150 1:150", "A:7577896837;C:3508911439;G:4823311862;T:7306393244;N:317718", 150, 150, null, null, 7577896837, 3508911439, 4823311862, 7306393244, 317718, "SRX26416454", "SRS22936307", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "mate2-mate1 similar by mapping diff", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [34014, "SRR31031005", "SRX26416453", "SRS22936305", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "Zeb WT pDBF Rep2", "GSM8578769", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:wildtype|treatment:plus DBF|geo loc name:missing|collection date:missing", "Zeb WT pDBF Rep2", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:wildtype|treatment:plus DBF", "GSM8578769", "GSM8578769: Zeb WT pDBF Rep2; Danio rerio; OTHER", "GSM8578769 r1", "GSM8578769", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "Zeb_WT_pDBF_Rep2.R1.fq.gz Zeb_WT_pDBF_Rep2.R2.fq.gz", "fastq fastq", 27237049500.0, 90790165.0, "GSM8578769 r1", "0:150 1:150", "A:8800724632;C:4062692793;G:5651432074;T:8721823175;N:376826", 150, 150, null, null, 8800724632, 4062692793, 5651432074, 8721823175, 376826, "SRX26416453", "SRS22936305", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "mate2-mate1 similar by mapping diff", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [34015, "SRR31031006", "SRX26416452", "SRS22936306", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "Zeb WT pDBF Rep1", "GSM8578768", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:wildtype|treatment:plus DBF|geo loc name:missing|collection date:missing", "Zeb WT pDBF Rep1", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:wildtype|treatment:plus DBF", "GSM8578768", "GSM8578768: Zeb WT pDBF Rep1; Danio rerio; OTHER", "GSM8578768 r1", "GSM8578768", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "Zeb_WT_pDBF_Rep1.R1.fq.gz Zeb_WT_pDBF_Rep1.R2.fq.gz", "fastq fastq", 22364115300.0, 74547051.0, "GSM8578768 r1", "0:150 1:150", "A:7336106577;C:3346831944;G:4451536371;T:7229335436;N:304972", 150, 150, null, null, 7336106577, 3346831944, 4451536371, 7229335436, 304972, "SRX26416452", "SRS22936306", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "mate2-mate1 similar by mapping diff", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [34016, "SRR31031007", "SRX26416451", "SRS22936304", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "Zeb WT mDBF Rep3", "GSM8578767", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:wildtype|treatment:minus DBF|geo loc name:missing|collection date:missing", "Zeb WT mDBF Rep3", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:wildtype|treatment:minus DBF", "GSM8578767", "GSM8578767: Zeb WT mDBF Rep3; Danio rerio; OTHER", "GSM8578767 r1", "GSM8578767", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "Zeb_WT_mDBF_Rep3.R1.fq.gz Zeb_WT_mDBF_Rep3.R2.fq.gz", "fastq fastq", 20112719100.0, 67042397.0, "GSM8578767 r1", "0:150 1:150", "A:6537370232;C:2924919118;G:3973928235;T:6676228153;N:273362", 150, 150, null, null, 6537370232, 2924919118, 3973928235, 6676228153, 273362, "SRX26416451", "SRS22936304", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "mate2-mate1 similar by mapping diff", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [34017, "SRR31031008", "SRX26416450", "SRS22936303", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "Zeb WT mDBF Rep2", "GSM8578766", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:wildtype|treatment:minus DBF|geo loc name:missing|collection date:missing", "Zeb WT mDBF Rep2", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:wildtype|treatment:minus DBF", "GSM8578766", "GSM8578766: Zeb WT mDBF Rep2; Danio rerio; OTHER", "GSM8578766 r1", "GSM8578766", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "Zeb_WT_mDBF_Rep2.R1.fq.gz Zeb_WT_mDBF_Rep2.R2.fq.gz", "fastq fastq", 24839552100.0, 82798507.0, "GSM8578766 r1", "0:150 1:150", "A:8176074473;C:3715794630;G:4984816273;T:7962528150;N:338574", 150, 150, null, null, 8176074473, 3715794630, 4984816273, 7962528150, 338574, "SRX26416450", "SRS22936303", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "mate2-mate1 similar by mapping diff", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [34018, "SRR31031009", "SRX26416449", "SRS22936302", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "Zeb WT mDBF Rep1", "GSM8578765", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:wildtype|treatment:minus DBF|geo loc name:missing|collection date:missing", "Zeb WT mDBF Rep1", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:wildtype|treatment:minus DBF", "GSM8578765", "GSM8578765: Zeb WT mDBF Rep1; Danio rerio; OTHER", "GSM8578765 r1", "GSM8578765", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "Zeb_WT_mDBF_Rep1.R1.fq.gz Zeb_WT_mDBF_Rep1.R2.fq.gz", "fastq fastq", 23029785600.0, 76765952.0, "GSM8578765 r1", "0:150 1:150", "A:7509388471;C:3438475939;G:4820328116;T:7261277960;N:315114", 150, 150, null, null, 7509388471, 3438475939, 4820328116, 7261277960, 315114, "SRX26416449", "SRS22936302", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "mate2-mate1 similar by mapping diff", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [34019, "SRR31031010", "SRX26416448", "SRS22936301", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "Zeb NES pDBF Rep2", "GSM8578764", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing", "Zeb NES pDBF Rep2", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF", "GSM8578764", "GSM8578764: Zeb NES pDBF Rep2; Danio rerio; OTHER", "GSM8578764 r1", "GSM8578764", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "Zeb_NES_pDBF_Rep2.R1.fq.gz Zeb_NES_pDBF_Rep2.R2.fq.gz", "fastq fastq", 25465584900.0, 84885283.0, "GSM8578764 r1", "0:150 1:150", "A:7944190976;C:4330095891;G:5473069331;T:7718120992;N:107710", 150, 150, null, null, 7944190976, 4330095891, 5473069331, 7718120992, 107710, "SRX26416448", "SRS22936301", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "mate2-mate1 similar by mapping diff", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [34020, "SRR31031011", "SRX26416447", "SRS22936300", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "Zeb NES pDBF Rep1", "GSM8578763", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing", "Zeb NES pDBF Rep1", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF", "GSM8578763", "GSM8578763: Zeb NES pDBF Rep1; Danio rerio; OTHER", "GSM8578763 r1", "GSM8578763", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "Zeb_NES_pDBF_Rep1.R1.fq.gz Zeb_NES_pDBF_Rep1.R2.fq.gz", "fastq fastq", 21107351400.0, 70357838.0, "GSM8578763 r1", "0:150 1:150", "A:6528579219;C:3620666961;G:4496642830;T:6461373643;N:88747", 150, 150, null, null, 6528579219, 3620666961, 4496642830, 6461373643, 88747, "SRX26416447", "SRS22936300", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "mate2-mate1 similar by mapping diff", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [34021, "SRR31031012", "SRX26416446", "SRS22936299", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "Zeb NES mDBF Rep2", "GSM8578762", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing", "Zeb NES mDBF Rep2", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF", "GSM8578762", "GSM8578762: Zeb NES mDBF Rep2; Danio rerio; OTHER", "GSM8578762 r1", "GSM8578762", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "Zeb_NES_mDBF_Rep2.R1.fq.gz Zeb_NES_mDBF_Rep2.R2.fq.gz", "fastq fastq", 21542967300.0, 71809891.0, "GSM8578762 r1", "0:150 1:150", "A:6722613760;C:3654507931;G:4628076548;T:6537678084;N:90977", 150, 150, null, null, 6722613760, 3654507931, 4628076548, 6537678084, 90977, "SRX26416446", "SRS22936299", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "mate2-mate1 similar by mapping diff", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [34022, "SRR31031013", "SRX26416445", "SRS22936297", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "Zeb NES mDBF Rep1", "GSM8578761", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing", "Zeb NES mDBF Rep1", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF", "GSM8578761", "GSM8578761: Zeb NES mDBF Rep1; Danio rerio; OTHER", "GSM8578761 r1", "GSM8578761", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "Zeb_NES_mDBF_Rep1.R1.fq.gz Zeb_NES_mDBF_Rep1.R2.fq.gz", "fastq fastq", 23038870800.0, 76796236.0, "GSM8578761 r1", "0:150 1:150", "A:7216059153;C:3815899397;G:4909028200;T:7097787584;N:96466", 150, 150, null, null, 7216059153, 3815899397, 4909028200, 7097787584, 96466, "SRX26416445", "SRS22936297", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "mate2-mate1 similar by mapping diff", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [34023, "SRR31031014", "SRX26416444", "SRS22936298", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "ZF NES MALAT1 Rep4 plus", "GSM8578760", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing", "ZF NES MALAT1 Rep4 plus", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF", "GSM8578760", "GSM8578760: ZF NES MALAT1 Rep4 plus; Danio rerio; OTHER", "GSM8578760 r1", "GSM8578760", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "ZF_NES_MALAT1_Rep4_plus.R1.fq.gz ZF_NES_MALAT1_Rep4_plus.R2.fq.gz", "fastq fastq", 1091293200.0, 3637644.0, "GSM8578760 r1", "0:150 1:150", "A:265519561;C:288647650;G:279105515;T:258001510;N:18964", 150, 150, null, null, 265519561, 288647650, 279105515, 258001510, 18964, "SRX26416444", "SRS22936298", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [34024, "SRR31031015", "SRX26416443", "SRS22936296", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "ZF NES MALAT1 Rep4 minus", "GSM8578759", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing", "ZF NES MALAT1 Rep4 minus", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF", "GSM8578759", "GSM8578759: ZF NES MALAT1 Rep4 minus; Danio rerio; OTHER", "GSM8578759 r1", "GSM8578759", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "ZF_NES_MALAT1_Rep4_minus.R1.fq.gz ZF_NES_MALAT1_Rep4_minus.R2.fq.gz", "fastq fastq", 1395963600.0, 4653212.0, "GSM8578759 r1", "0:150 1:150", "A:339654289;C:369433701;G:356957685;T:329893853;N:24072", 150, 150, null, null, 339654289, 369433701, 356957685, 329893853, 24072, "SRX26416443", "SRS22936296", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [34025, "SRR31031016", "SRX26416442", "SRS22936295", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "ZF NES MALAT1 Rep3 plus", "GSM8578758", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing", "ZF NES MALAT1 Rep3 plus", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF", "GSM8578758", "GSM8578758: ZF NES MALAT1 Rep3 plus; Danio rerio; OTHER", "GSM8578758 r1", "GSM8578758", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "ZF_NES_MALAT1_Rep3_plus.R1.fq.gz ZF_NES_MALAT1_Rep3_plus.R2.fq.gz", "fastq fastq", 1556195100.0, 5187317.0, "GSM8578758 r1", "0:150 1:150", "A:378553535;C:411730281;G:398086882;T:367797563;N:26839", 150, 150, null, null, 378553535, 411730281, 398086882, 367797563, 26839, "SRX26416442", "SRS22936295", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [34026, "SRR31031017", "SRX26416441", "SRS22936294", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "ZF NES MALAT1 Rep3 minus", "GSM8578757", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing", "ZF NES MALAT1 Rep3 minus", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF", "GSM8578757", "GSM8578757: ZF NES MALAT1 Rep3 minus; Danio rerio; OTHER", "GSM8578757 r1", "GSM8578757", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "ZF_NES_MALAT1_Rep3_minus.R1.fq.gz ZF_NES_MALAT1_Rep3_minus.R2.fq.gz", "fastq fastq", 1511328900.0, 5037763.0, "GSM8578757 r1", "0:150 1:150", "A:367639521;C:400036694;G:386523395;T:357103340;N:25950", 150, 150, null, null, 367639521, 400036694, 386523395, 357103340, 25950, "SRX26416441", "SRS22936294", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [34027, "SRR31031018", "SRX26416440", "SRS22936293", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "ZF NES MALAT1 Rep2 plus", "GSM8578756", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing", "ZF NES MALAT1 Rep2 plus", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF", "GSM8578756", "GSM8578756: ZF NES MALAT1 Rep2 plus; Danio rerio; OTHER", "GSM8578756 r1", "GSM8578756", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "ZF_NES_MALAT1_Rep2_plus.R1.fq.gz ZF_NES_MALAT1_Rep2_plus.R2.fq.gz", "fastq fastq", 1451137800.0, 4837126.0, "GSM8578756 r1", "0:150 1:150", "A:353052445;C:383981771;G:371154128;T:342925275;N:24181", 150, 150, null, null, 353052445, 383981771, 371154128, 342925275, 24181, "SRX26416440", "SRS22936293", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [34028, "SRR31031019", "SRX26416439", "SRS22936292", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "ZF NES MALAT1 Rep2 minus", "GSM8578755", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing", "ZF NES MALAT1 Rep2 minus", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF", "GSM8578755", "GSM8578755: ZF NES MALAT1 Rep2 minus; Danio rerio; OTHER", "GSM8578755 r1", "GSM8578755", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "ZF_NES_MALAT1_Rep2_minus.R1.fq.gz ZF_NES_MALAT1_Rep2_minus.R2.fq.gz", "fastq fastq", 1286489400.0, 4288298.0, "GSM8578755 r1", "0:150 1:150", "A:312986127;C:340482608;G:329001591;T:303997982;N:21092", 150, 150, null, null, 312986127, 340482608, 329001591, 303997982, 21092, "SRX26416439", "SRS22936292", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [34029, "SRR31031020", "SRX26416438", "SRS22936291", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "ZF NES MALAT1 Rep1 plus", "GSM8578754", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing", "ZF NES MALAT1 Rep1 plus", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF", "GSM8578754", "GSM8578754: ZF NES MALAT1 Rep1 plus; Danio rerio; OTHER", "GSM8578754 r1", "GSM8578754", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "ZF_NES_MALAT1_Rep1_plus.R1.fq.gz ZF_NES_MALAT1_Rep1_plus.R2.fq.gz", "fastq fastq", 1146380100.0, 3821267.0, "GSM8578754 r1", "0:150 1:150", "A:278826422;C:303464534;G:293239572;T:270830265;N:19307", 150, 150, null, null, 278826422, 303464534, 293239572, 270830265, 19307, "SRX26416438", "SRS22936291", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [34030, "SRR31031021", "SRX26416437", "SRS22936289", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "ZF NES MALAT1 Rep1 minus", "GSM8578753", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing", "ZF NES MALAT1 Rep1 minus", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF", "GSM8578753", "GSM8578753: ZF NES MALAT1 Rep1 minus; Danio rerio; OTHER", "GSM8578753 r1", "GSM8578753", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "ZF_NES_MALAT1_Rep1_minus.R1.fq.gz ZF_NES_MALAT1_Rep1_minus.R2.fq.gz", "fastq fastq", 1149087000.0, 3830290.0, "GSM8578753 r1", "0:150 1:150", "A:279487473;C:304130198;G:293947979;T:271501018;N:20332", 150, 150, null, null, 279487473, 304130198, 293947979, 271501018, 20332, "SRX26416437", "SRS22936289", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [34031, "SRR31031022", "SRX26416436", "SRS22936290", "SRP539182", "PRJNA1174121", "Quantification of subcellular RNA localization through direct detection of RNA oxidation", "GSE279714", "Other", "Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.", null, "pubmed:39605352;pubmed:40037712", null, "ZF NES GAPDH Rep4 plus", "GSM8578752", null, "source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing", "ZF NES GAPDH Rep4 plus", "OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.", "2 dpf embryos", null, "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", "HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.", "tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF", "GSM8578752", "GSM8578752: ZF NES GAPDH Rep4 plus; Danio rerio; OTHER", "GSM8578752 r1", "GSM8578752", "1", "RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.", null, "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP539182", null, null, "ZF_NES_GAPDH_Rep4_plus.R1.fq.gz ZF_NES_GAPDH_Rep4_plus.R2.fq.gz", "fastq fastq", 1010253300.0, 3367511.0, "GSM8578752 r1", "0:150 1:150", "A:264284161;C:228880831;G:244038984;T:273032130;N:17194", 150, 150, null, null, 264284161, 228880831, 244038984, 273032130, 17194, "SRX26416436", "SRS22936290", "SRA1993027", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", "Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "full_length", "random_priming", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2024-10-17", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [36265, "SRR058073", "SRX022206", "SRS084221", "SRP002640", "PRJNA128943", "Expanding the MicroRNA Targeting Code:  A Novel Type of Site with Centered Pairing", "GSE22068", "Other", "We present \u201ccentered sites \u201d a class of microRNA target sites that lacks both perfect seed pairing and three prime compensatory pairing and instead has 11\u201312 contiguous Watson\u2013Crick pairs to the center of the microRNA.  In elevated Mg2+  centered sites impart mRNA cleavage  but in cells  centered sites repress protein output without xxx Agronaute catalyzed cleavage.  Our study also identified novel extensively paired sites that are cleavage substrates in cultured cells and human brain.  This expanded repertoire of cleavage targets and the identification of the centered site type help explain why central regions of many microRNAs are evolutionarily conserved. Overall design: To study centered sites and identify miRNA cleavage targets  mRNA degradomes were sequenced from human brain and HeLa cells  and smallRNAs were sequenced from human brain and zebrafish embryo at 24 hpf. Replicates were combined before the analysis. Fastq files are not available for GSM548638 and GSM548639.", null, "pubmed:20620952", null, "Zebrafish Embryo small RNAs", "GSM548640", null, "source name:Embryo Cells|data type:small RNAs|tissue:embryo", "Zebrafish Embryo small RNAs", "Small RNA sequences from same total RNA samples were mapped to the human genome hg18  requiring a perfect match  and reads co localizing to annotated miRNA loci miRBase  version 11.0 were counted. sequence reads are summarized as frequency counts", "Embryo Cells", null, "The small RNA cDNA libraries were made as described Grimson et al. 2008  except for the three prime adaptor ligation  which was five prime adenylated pTCGTATGCCGTCTTCTGCTTGidT. For a detailed protocol  see http://web.wi.mit.edu/bartel/pub/protocols.html.", null, "data type:small RNAs|tissue:embryo", "GSM548640", "GSM548640: Zebrafish Embryo small RNAs", "GSM548640: Zebrafish Embryo small RNAs", "GSM548640: Zebrafish Embryo small RNAs", "1", null, "GEO Accession:GSM548640", "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP002640", null, "quality book char:@|quality scoring system:log odds", "Zebrafish_embryo_24h.fastq", "fastq", 62213148.0, 1728143.0, "GSM548640 1", "0:36", "A:13550515;C:14269249;G:15670049;T:18673533;N:49802", 36, null, null, null, 13550515, 14269249, 15670049, 18673533, 49802, "SRX022206", "SRS084221", "SRA020539", "GEO", "Bartel lab, Whitehead Institute", 1, 0.02298, null, 0.02186, null, 0.9988, null, 0.3246, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United States", "2010-06-01", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [40214, "SRR2982513", "SRX1471725", "SRS1197481", "SRP067139", "PRJNA305418", "RiboZero mRNA seq across zebrafish development  for study of uORFs", "PRJNA305418", "Other", "Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs  the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing  we find that i uORFs are pervasive within vertebrate transcriptomes  ii the majority show signatures of active translation  and iii uORFs act as potent regulators of translation and RNA levels  with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally  we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values.", null, null, null, "48hpf", "AG00751 mrna r0 48h", null, "strain:TUAB|age:48hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "AG00751 mrna r0 48h", "48h mRNA R0", "1", "Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al  2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific  single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ  single end  75nt reads", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP067139", null, null, "AG00751_SEQ0112_R1.fastq.gz", "fastq", 1859082512.0, 24461612.0, "48h mRNA R0 run1", "0:76", "A:488142494;C:422062452;G:411293722;T:537489879;N:93965", 76, null, null, null, 488142494, 422062452, 411293722, 537489879, 93965, "SRX1471725", "SRS1197481", "SRA314809", "Yale University|Giraldez Lab", "Yale University", 1, 0.8583, null, 0.37297, null, 0.6956, null, 0.46541, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "rrna_depletion", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2015-12-08", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [40215, "SRR2982514", "SRX1471724", "SRS1197482", "SRP067139", "PRJNA305418", "RiboZero mRNA seq across zebrafish development  for study of uORFs", "PRJNA305418", "Other", "Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs  the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing  we find that i uORFs are pervasive within vertebrate transcriptomes  ii the majority show signatures of active translation  and iii uORFs act as potent regulators of translation and RNA levels  with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally  we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values.", null, null, null, "24hpf", "AG00750 mrna r0 24h", null, "strain:TUAB|age:24hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "AG00750 mrna r0 24h", "24h mRNA R0", "1", "Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al  2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific  single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ  single end  75nt reads", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP067139", null, null, "AG00750_SEQ0114_R1.fastq.gz", "fastq", 2124277824.0, 27951024.0, "24h mRNA R0 run1", "0:76", "A:537946274;C:496576029;G:477023623;T:612576823;N:155075", 76, null, null, null, 537946274, 496576029, 477023623, 612576823, 155075, "SRX1471724", "SRS1197482", "SRA314809", "Yale University|Giraldez Lab", "Yale University", 1, 0.86054, null, 0.27207, null, 0.69877, null, 0.47063, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "rrna_depletion", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2015-12-08", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [40216, "SRR2982511", "SRX1471723", "SRS1197479", "SRP067139", "PRJNA305418", "RiboZero mRNA seq across zebrafish development  for study of uORFs", "PRJNA305418", "Other", "Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs  the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing  we find that i uORFs are pervasive within vertebrate transcriptomes  ii the majority show signatures of active translation  and iii uORFs act as potent regulators of translation and RNA levels  with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally  we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values.", null, null, null, "12hpf", "AG00434 mrna r0 12h", null, "strain:TUAB|age:12hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "AG00434 mrna r0 12h", "12h mRNA R0", "1", "Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al  2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific  single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ  single end  75nt reads", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP067139", null, null, "AG00434_SEQ0071_R1.fastq.gz", "fastq", 1990422368.0, 26189768.0, "12h mRNA R0 run1", "0:76", "A:512242204;C:469314942;G:452176134;T:556618667;N:70421", 76, null, null, null, 512242204, 469314942, 452176134, 556618667, 70421, "SRX1471723", "SRS1197479", "SRA314809", "Yale University|Giraldez Lab", "Yale University", 1, 0.88085, null, 0.297, null, 0.71711, null, 0.46053, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "rrna_depletion", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2015-12-08", "Segmentation", "Embryo", "Embryo Imprecise", "All anatomical structures"], [40217, "SRR2982512", "SRX1471722", "SRS1197480", "SRP067139", "PRJNA305418", "RiboZero mRNA seq across zebrafish development  for study of uORFs", "PRJNA305418", "Other", "Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs  the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing  we find that i uORFs are pervasive within vertebrate transcriptomes  ii the majority show signatures of active translation  and iii uORFs act as potent regulators of translation and RNA levels  with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally  we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values.", null, null, null, "5hpf", "AG00749 mrna r0 5h", null, "strain:TUAB|age:5hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "AG00749 mrna r0 5h", "5h mRNA R0", "1", "Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al  2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific  single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ  single end  75nt reads", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP067139", null, null, "AG00749_SEQ0114_R1.fastq.gz", "fastq", 3163721996.0, 41627921.0, "5h mRNA R0 run1", "0:76", "A:724093110;C:806620205;G:798759186;T:834042462;N:207033", 76, null, null, null, 724093110, 806620205, 798759186, 834042462, 207033, "SRX1471722", "SRS1197480", "SRA314809", "Yale University|Giraldez Lab", "Yale University", 1, 0.75274, null, 0.23572, null, 0.75448, null, 0.47885, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "rrna_depletion", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2015-12-08", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [40218, "SRR2982510", "SRX1471511", "SRS1197399", "SRP067139", "PRJNA305418", "RiboZero mRNA seq across zebrafish development  for study of uORFs", "PRJNA305418", "Other", "Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs  the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing  we find that i uORFs are pervasive within vertebrate transcriptomes  ii the majority show signatures of active translation  and iii uORFs act as potent regulators of translation and RNA levels  with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally  we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values.", null, null, null, "2hpf", "AG00244 mrna r0 2h", null, "strain:TUAB|age:2hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "AG00244 mrna r0 2h", "2h mRNA R0", "1", "Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al  2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific  single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ  single end  75nt reads", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP067139", null, null, "AG00244_SEQ0039_R1.fastq.gz", "fastq", 1010085524.0, 13290599.0, "2h mRNA R0 run1", "0:76", "A:196715560;C:309406513;G:286228000;T:217670217;N:65234", 76, null, null, null, 196715560, 309406513, 286228000, 217670217, 65234, "SRX1471511", "SRS1197399", "SRA314809", "Yale University|Giraldez Lab", "Yale University", 1, 0.89974, null, 0.14215, null, 0.79488, null, 0.72171, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "rrna_depletion", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2015-12-08", "Cleavage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [40249, "SRR3038049", "SRX1494244", "SRS1217111", "SRP067641", "PRJNA306648", "Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition", "GSE76212", "Other", "We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation  respectively  post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined", null, "pubmed:28381614", null, "IgG iCLIP zf ZGA rep3", "GSM1976593", null, "tissue:zebrafish embryo|developmental stage:ZGA 1K cell stage|antibody:anti IgG|barcode sequence:NNNTGGCNN", "IgG iCLIP zf ZGA rep3", "Basecalls performed using CASAVA version 1.4 For detail on data processing see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.", "zebrafish embryo", "Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.", "Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation  three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently  RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959", "Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.", "developmental stage:ZGA 1K cell stage|antibody:anti IgG|barcode sequence:NNNTGGCNN", "GSM1976593", "GSM1976593: IgG iCLIP zf ZGA rep3; Danio rerio; OTHER", "GSM1976593", null, "1", "Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation  three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently  RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959", "GEO Accession:GSM1976593", "OTHER", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP067641", null, null, "iCLIP_IgG_zebrafishembryo_wt_1K_IgGcontrol_Dr_NNNTGGCNN_20140613_L4333_4.fq.gz", "fastq", 82722124.0, 1088449.0, "GSM1976593 r1", "0:76", "A:21959870;C:19048567;G:22289272;T:19403630;N:20785", 76, null, null, null, 21959870, 19048567, 22289272, 19403630, 20785, "SRX1494244", "SRS1217111", "SRA320959", "GEO", "Molecular Biophysics and Biochemistry, Yale University", 1, 0.08124, null, 0.02181, null, 0.98591, null, 0.59183, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "3prime", "other", "unknown", "bulk", "clip", "iclip", null, "United States", "2015-12-21", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [40250, "SRR3038048", "SRX1494243", "SRS1217112", "SRP067641", "PRJNA306648", "Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition", "GSE76212", "Other", "We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation  respectively  post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined", null, "pubmed:28381614", null, "IgG iCLIP zf ZGA rep2", "GSM1976592", null, "tissue:zebrafish embryo|developmental stage:ZGA 1K cell stage|antibody:anti IgG|barcode sequence:NNNCCACNN", "IgG iCLIP zf ZGA rep2", "Basecalls performed using CASAVA version 1.4 For detail on data processing see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.", "zebrafish embryo", "Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.", "Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation  three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently  RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959", "Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.", "developmental stage:ZGA 1K cell stage|antibody:anti IgG|barcode sequence:NNNCCACNN", "GSM1976592", "GSM1976592: IgG iCLIP zf ZGA rep2; Danio rerio; OTHER", "GSM1976592", null, "1", "Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation  three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently  RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959", "GEO Accession:GSM1976592", "OTHER", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP067641", null, null, "iCLIP_IgG_zebrafishembryo_wt_1K_IgGcontrol_Dr_NNNCCACNN_20140613_L4333_2.fq.gz", "fastq", 50195036.0, 660461.0, "GSM1976592 r1", "0:76", "A:14249581;C:12927029;G:12969451;T:10036400;N:12575", 76, null, null, null, 14249581, 12927029, 12969451, 10036400, 12575, "SRX1494243", "SRS1217112", "SRA320959", "GEO", "Molecular Biophysics and Biochemistry, Yale University", 1, 0.25447, null, 0.03871, null, 0.94556, null, 0.7523, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "3prime", "other", "unknown", "bulk", "clip", "iclip", null, "United States", "2015-12-21", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [40251, "SRR3038047", "SRX1494242", "SRS1217113", "SRP067641", "PRJNA306648", "Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition", "GSE76212", "Other", "We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation  respectively  post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined", null, "pubmed:28381614", null, "IgG iCLIP zf ZGA rep1", "GSM1976591", null, "tissue:zebrafish embryo|developmental stage:ZGA 1K cell stage|antibody:anti IgG|barcode sequence:NNNGGCGNN", "IgG iCLIP zf ZGA rep1", "Basecalls performed using CASAVA version 1.4 For detail on data processing see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.", "zebrafish embryo", "Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.", "Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation  three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently  RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959", "Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.", "developmental stage:ZGA 1K cell stage|antibody:anti IgG|barcode sequence:NNNGGCGNN", "GSM1976591", "GSM1976591: IgG iCLIP zf ZGA rep1; Danio rerio; OTHER", "GSM1976591", null, "1", "Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation  three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently  RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959", "GEO Accession:GSM1976591", "OTHER", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP067641", null, null, "iCLIP_IgG_zebrafishembryo_wt_1K_IgGcontrol_Dr_NNNGGCGNN_20140613_L4333_5.fq.gz", "fastq", 453449136.0, 5966436.0, "GSM1976591 r1", "0:76", "A:124726528;C:101139098;G:135573575;T:91900507;N:109428", 76, null, null, null, 124726528, 101139098, 135573575, 91900507, 109428, "SRX1494242", "SRS1217113", "SRA320959", "GEO", "Molecular Biophysics and Biochemistry, Yale University", 1, 0.51353, null, 0.10729, null, 0.88069, null, 0.7159, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "3prime", "other", "unknown", "bulk", "clip", "iclip", null, "United States", "2015-12-21", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [40252, "SRR3038046", "SRX1494241", "SRS1217114", "SRP067641", "PRJNA306648", "Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition", "GSE76212", "Other", "We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation  respectively  post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined", null, "pubmed:28381614", null, "IgG iCLIP zf preZGA rep3", "GSM1976590", null, "tissue:zebrafish embryo|developmental stage:preZGA 32 cell stage|antibody:anti IgG|barcode sequence:NNNTGGCNN", "IgG iCLIP zf preZGA rep3", "Basecalls performed using CASAVA version 1.4 For detail on data processing see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.", "zebrafish embryo", "Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.", "Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation  three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently  RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959", "Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.", "developmental stage:preZGA 32 cell stage|antibody:anti IgG|barcode sequence:NNNTGGCNN", "GSM1976590", "GSM1976590: IgG iCLIP zf preZGA rep3; Danio rerio; OTHER", "GSM1976590", null, "1", "Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation  three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently  RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959", "GEO Accession:GSM1976590", "OTHER", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP067641", null, null, "iCLIP_IgG_Drembryo_wt_IgGcontrol_Dr_NNNTGGCNN_20130812_hnRNPA1_4.fq.gz", "fastq", 600183932.0, 7897157.0, "GSM1976590 r1", "0:76", "A:173843237;C:131372689;G:170729621;T:124187689;N:50696", 76, null, null, null, 173843237, 131372689, 170729621, 124187689, 50696, "SRX1494241", "SRS1217114", "SRA320959", "GEO", "Molecular Biophysics and Biochemistry, Yale University", 1, 0.14511, null, 0.03659, null, 0.9332, null, 0.651, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "3prime", "other", "unknown", "bulk", "clip", "iclip", null, "United States", "2015-12-21", "Cleavage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [40253, "SRR3038045", "SRX1494240", "SRS1217115", "SRP067641", "PRJNA306648", "Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition", "GSE76212", "Other", "We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation  respectively  post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined", null, "pubmed:28381614", null, "IgG iCLIP zf preZGA rep2", "GSM1976589", null, "tissue:zebrafish embryo|developmental stage:preZGA 32 cell stage|antibody:anti IgG|barcode sequence:NNNCCGGNN", "IgG iCLIP zf preZGA rep2", "Basecalls performed using CASAVA version 1.4 For detail on data processing see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.", "zebrafish embryo", "Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.", "Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation  three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently  RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959", "Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.", "developmental stage:preZGA 32 cell stage|antibody:anti IgG|barcode sequence:NNNCCGGNN", "GSM1976589", "GSM1976589: IgG iCLIP zf preZGA rep2; Danio rerio; OTHER", "GSM1976589", null, "1", "Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation  three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently  RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959", "GEO Accession:GSM1976589", "OTHER", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP067641", null, null, "iCLIP_IgG_Drembryo_wt_IgGcontrol_Dr_NNNCCGGNN_20130812_hnRNPA1_5.fq.gz", "fastq", 612280168.0, 8056318.0, "GSM1976589 r1", "0:76", "A:175101988;C:144456623;G:172272609;T:120400014;N:48934", 76, null, null, null, 175101988, 144456623, 172272609, 120400014, 48934, "SRX1494240", "SRS1217115", "SRA320959", "GEO", "Molecular Biophysics and Biochemistry, Yale University", 1, 0.05322, null, 0.01649, null, 0.97656, null, 0.67242, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "3prime", "other", "unknown", "bulk", "clip", "iclip", null, "United States", "2015-12-21", "Cleavage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [40254, "SRR3038044", "SRX1494239", "SRS1217116", "SRP067641", "PRJNA306648", "Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition", "GSE76212", "Other", "We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation  respectively  post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined", null, "pubmed:28381614", null, "IgG iCLIP zf preZGA rep1", "GSM1976588", null, "tissue:zebrafish embryo|developmental stage:preZGA 32 cell stage|antibody:anti IgG|barcode sequence:NNNGGCGNN", "IgG iCLIP zf preZGA rep1", "Basecalls performed using CASAVA version 1.4 For detail on data processing see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.", "zebrafish embryo", "Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.", "Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation  three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently  RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959", "Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.", "developmental stage:preZGA 32 cell stage|antibody:anti IgG|barcode sequence:NNNGGCGNN", "GSM1976588", "GSM1976588: IgG iCLIP zf preZGA rep1; Danio rerio; OTHER", "GSM1976588", null, "1", "Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation  three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently  RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959", "GEO Accession:GSM1976588", "OTHER", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP067641", null, null, "iCLIP_IgG_Drembryo_wt_IgGcontrol_Dr_NNNGGCGNN_20130812_hnRNPA1_1.fq-3.gz", "fastq", 12806760.0, 168510.0, "GSM1976588 r1", "0:76", "A:3652525;C:2758781;G:3842061;T:2552042;N:1351", 76, null, null, null, 3652525, 2758781, 3842061, 2552042, 1351, "SRX1494239", "SRS1217116", "SRA320959", "GEO", "Molecular Biophysics and Biochemistry, Yale University", 1, 0.02784, null, 0.01181, null, 0.99813, null, 0.68217, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "3prime", "other", "unknown", "bulk", "clip", "iclip", null, "United States", "2015-12-21", "Cleavage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [40255, "SRR3038043", "SRX1494238", "SRS1217117", "SRP067641", "PRJNA306648", "Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition", "GSE76212", "Other", "We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation  respectively  post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined", null, "pubmed:28381614", null, "hnRNP A1 iCLIP zf ZGA rep4", "GSM1976587", null, "tissue:zebrafish embryo|developmental stage:ZGA 1K cell stage|antibody:anti hnRNP A1|barcode sequence:NNNGGTCNN", "hnRNP A1 iCLIP zf ZGA rep4", "Basecalls performed using CASAVA version 1.4 For detail on data processing see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.", "zebrafish embryo", "Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.", "Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation  three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently  RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959", "Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.", "developmental stage:ZGA 1K cell stage|antibody:anti hnRNP A1|barcode sequence:NNNGGTCNN", "GSM1976587", "GSM1976587: hnRNP A1 iCLIP zf ZGA rep4; Danio rerio; OTHER", "GSM1976587", null, "1", "Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation  three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently  RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959", "GEO Accession:GSM1976587", "OTHER", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP067641", null, null, "iCLIP_hnRNPA1_zebrafishembryo_wt_1K_hnRNPA1_Dr_NNNGGTCNN_20140613_L4333_6.fq.gz", "fastq", 2884007568.0, 37947468.0, "GSM1976587 r1", "0:76", "A:936463452;C:557587142;G:746595510;T:642623181;N:738283", 76, null, null, null, 936463452, 557587142, 746595510, 642623181, 738283, "SRX1494238", "SRS1217117", "SRA320959", "GEO", "Molecular Biophysics and Biochemistry, Yale University", 1, 0.38306, null, 0.08291, null, 0.80568, null, 0.62132, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "3prime", "other", "unknown", "bulk", "clip", "iclip", null, "United States", "2015-12-21", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [40256, "SRR3038042", "SRX1494237", "SRS1217118", "SRP067641", "PRJNA306648", "Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition", "GSE76212", "Other", "We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation  respectively  post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined", null, "pubmed:28381614", null, "hnRNP A1 iCLIP zf ZGA rep3", "GSM1976586", null, "tissue:zebrafish embryo|developmental stage:ZGA 1K cell stage|antibody:anti hnRNP A1|barcode sequence:NNNCAATNN", "hnRNP A1 iCLIP zf ZGA rep3", "Basecalls performed using CASAVA version 1.4 For detail on data processing see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.", "zebrafish embryo", "Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.", "Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation  three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently  RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959", "Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.", "developmental stage:ZGA 1K cell stage|antibody:anti hnRNP A1|barcode sequence:NNNCAATNN", "GSM1976586", "GSM1976586: hnRNP A1 iCLIP zf ZGA rep3; Danio rerio; OTHER", "GSM1976586", null, "1", "Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation  three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently  RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959", "GEO Accession:GSM1976586", "OTHER", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP067641", null, null, "iCLIP_hnRNPA1_zebrafishembryo_wt_1K_hnRNPA1_Dr_NNNCAATNN_20140613_L4333_3.fq.gz", "fastq", 3875071508.0, 50987783.0, "GSM1976586 r1", "0:76", "A:1328984506;C:775814536;G:956147632;T:813109146;N:1015688", 76, null, null, null, 1328984506, 775814536, 956147632, 813109146, 1015688, "SRX1494237", "SRS1217118", "SRA320959", "GEO", "Molecular Biophysics and Biochemistry, Yale University", 1, 0.35787, null, 0.0904, null, 0.81874, null, 0.64706, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "3prime", "other", "unknown", "bulk", "clip", "iclip", null, "United States", "2015-12-21", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [40257, "SRR3038041", "SRX1494236", "SRS1217119", "SRP067641", "PRJNA306648", "Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition", "GSE76212", "Other", "We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation  respectively  post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined", null, "pubmed:28381614", null, "hnRNP A1 iCLIP zf ZGA rep2", "GSM1976585", null, "tissue:zebrafish embryo|developmental stage:ZGA 1K cell stage|antibody:anti hnRNP A1|barcode sequence:NNNTTGTNN", "hnRNP A1 iCLIP zf ZGA rep2", "Basecalls performed using CASAVA version 1.4 For detail on data processing see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.", "zebrafish embryo", "Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.", "Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation  three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently  RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959", "Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.", "developmental stage:ZGA 1K cell stage|antibody:anti hnRNP A1|barcode sequence:NNNTTGTNN", "GSM1976585", "GSM1976585: hnRNP A1 iCLIP zf ZGA rep2; Danio rerio; OTHER", "GSM1976585", null, "1", "Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation  three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently  RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959", "GEO Accession:GSM1976585", "OTHER", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP067641", null, null, "iCLIP_hnRNPA1_zebrafishembryo_wt_1K_hnRNPA1_Dr_NNNTTGTNN_20140613_L4333_1.fq.gz", "fastq", 3482039180.0, 45816305.0, "GSM1976585 r1", "0:76", "A:1093877493;C:647486562;G:914636686;T:825135975;N:902464", 76, null, null, null, 1093877493, 647486562, 914636686, 825135975, 902464, "SRX1494236", "SRS1217119", "SRA320959", "GEO", "Molecular Biophysics and Biochemistry, Yale University", 1, 0.29908, null, 0.07356, null, 0.83459, null, 0.62976, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "3prime", "other", "unknown", "bulk", "clip", "iclip", null, "United States", "2015-12-21", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [40258, "SRR3038040", "SRX1494235", "SRS1217120", "SRP067641", "PRJNA306648", "Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition", "GSE76212", "Other", "We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation  respectively  post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined", null, "pubmed:28381614", null, "hnRNP A1 iCLIP zf ZGA rep1", "GSM1976584", null, "tissue:zebrafish embryo|developmental stage:ZGA 1K cell stage|antibody:anti hnRNP A1|barcode sequence:NNNGGTTNN", "hnRNP A1 iCLIP zf ZGA rep1", "Basecalls performed using CASAVA version 1.4 For detail on data processing see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.", "zebrafish embryo", "Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.", "Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation  three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently  RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959", "Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.", "developmental stage:ZGA 1K cell stage|antibody:anti hnRNP A1|barcode sequence:NNNGGTTNN", "GSM1976584", "GSM1976584: hnRNP A1 iCLIP zf ZGA rep1; Danio rerio; OTHER", "GSM1976584", null, "1", "Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation  three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently  RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959", "GEO Accession:GSM1976584", "OTHER", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP067641", null, null, "iCLIP_hnRNPA1_zebrafishembryo_wt_1K_hnRNPA1_Dr_NNNGGTTNN_20140613_L4333_7.fq.gz", "fastq", 3547711920.0, 46680420.0, "GSM1976584 r1", "0:76", "A:1105542969;C:658172853;G:958654426;T:824422930;N:918742", 76, null, null, null, 1105542969, 658172853, 958654426, 824422930, 918742, "SRX1494235", "SRS1217120", "SRA320959", "GEO", "Molecular Biophysics and Biochemistry, Yale University", 1, 0.34257, null, 0.08694, null, 0.83055, null, 0.64965, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "3prime", "other", "unknown", "bulk", "clip", "iclip", null, "United States", "2015-12-21", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [40259, "SRR3038039", "SRX1494234", "SRS1217121", "SRP067641", "PRJNA306648", "Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition", "GSE76212", "Other", "We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation  respectively  post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined", null, "pubmed:28381614", null, "hnRNP A1 iCLIP zf preZGA rep3", "GSM1976583", null, "tissue:zebrafish embryo|developmental stage:preZGA 32 cell stage|antibody:anti hnRNP A1|barcode sequence:NNNCAATNN", "hnRNP A1 iCLIP zf preZGA rep3", "Basecalls performed using CASAVA version 1.4 For detail on data processing see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.", "zebrafish embryo", "Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.", "Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation  three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently  RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959", "Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.", "developmental stage:preZGA 32 cell stage|antibody:anti hnRNP A1|barcode sequence:NNNCAATNN", "GSM1976583", "GSM1976583: hnRNP A1 iCLIP zf preZGA rep3; Danio rerio; OTHER", "GSM1976583", null, "1", "Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation  three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently  RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959", "GEO Accession:GSM1976583", "OTHER", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP067641", null, null, "iCLIP_hnRNPA1_Drembryo_wt_hnRNPA1_Dr_NNNCAATNN_20130812_hnRNPA1_3.fq.gz", "fastq", 1944912200.0, 25590950.0, "GSM1976583 r1", "0:76", "A:611172831;C:390755201;G:517844203;T:424973726;N:166239", 76, null, null, null, 611172831, 390755201, 517844203, 424973726, 166239, "SRX1494234", "SRS1217121", "SRA320959", "GEO", "Molecular Biophysics and Biochemistry, Yale University", 1, 0.23819, null, 0.06019, null, 0.85318, null, 0.72811, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "3prime", "other", "unknown", "bulk", "clip", "iclip", null, "United States", "2015-12-21", "Cleavage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [40260, "SRR3038038", "SRX1494233", "SRS1217122", "SRP067641", "PRJNA306648", "Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition", "GSE76212", "Other", "We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation  respectively  post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined", null, "pubmed:28381614", null, "hnRNP A1 iCLIP zf preZGA rep2", "GSM1976582", null, "tissue:zebrafish embryo|developmental stage:preZGA 32 cell stage|antibody:anti hnRNP A1|barcode sequence:NNNTTGTNN", "hnRNP A1 iCLIP zf preZGA rep2", "Basecalls performed using CASAVA version 1.4 For detail on data processing see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.", "zebrafish embryo", "Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.", "Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation  three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently  RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959", "Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.", "developmental stage:preZGA 32 cell stage|antibody:anti hnRNP A1|barcode sequence:NNNTTGTNN", "GSM1976582", "GSM1976582: hnRNP A1 iCLIP zf preZGA rep2; Danio rerio; OTHER", "GSM1976582", null, "1", "Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation  three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently  RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959", "GEO Accession:GSM1976582", "OTHER", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP067641", null, null, "iCLIP_hnRNPA1_Drembryo_wt_hnRNPA1_Dr_NNNTTGTNN_20130812_hnRNPA1_6.fq.gz", "fastq", 1804236124.0, 23739949.0, "GSM1976582 r1", "0:76", "A:520750722;C:337743522;G:499109535;T:446481275;N:151070", 76, null, null, null, 520750722, 337743522, 499109535, 446481275, 151070, "SRX1494233", "SRS1217122", "SRA320959", "GEO", "Molecular Biophysics and Biochemistry, Yale University", 1, 0.25184, null, 0.06217, null, 0.85687, null, 0.67912, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "3prime", "other", "unknown", "bulk", "clip", "iclip", null, "United States", "2015-12-21", "Cleavage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [40261, "SRR3038037", "SRX1494232", "SRS1217123", "SRP067641", "PRJNA306648", "Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition", "GSE76212", "Other", "We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation  respectively  post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined", null, "pubmed:28381614", null, "hnRNP A1 iCLIP zf preZGA rep1", "GSM1976581", null, "tissue:zebrafish embryo|developmental stage:preZGA 32 cell stage|antibody:anti hnRNP A1|barcode sequence:NNNGGTTNN", "hnRNP A1 iCLIP zf preZGA rep1", "Basecalls performed using CASAVA version 1.4 For detail on data processing see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.", "zebrafish embryo", "Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.", "Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation  three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently  RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959", "Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.", "developmental stage:preZGA 32 cell stage|antibody:anti hnRNP A1|barcode sequence:NNNGGTTNN", "GSM1976581", "GSM1976581: hnRNP A1 iCLIP zf preZGA rep1; Danio rerio; OTHER", "GSM1976581", null, "1", "Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation  three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently  RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: K\u00f6nig et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959", "GEO Accession:GSM1976581", "OTHER", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP067641", null, null, "iCLIP_hnRNPA1_Drembryo_wt_hnRNPA1_Dr_NNNGGTTNN_20130812_hnRNPA1_2.fq.gz", "fastq", 2155200476.0, 28357901.0, "GSM1976581 r1", "0:76", "A:646739355;C:394864638;G:606938658;T:506474548;N:183277", 76, null, null, null, 646739355, 394864638, 606938658, 506474548, 183277, "SRX1494232", "SRS1217123", "SRA320959", "GEO", "Molecular Biophysics and Biochemistry, Yale University", 1, 0.24207, null, 0.05859, null, 0.84747, null, 0.70564, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "3prime", "other", "unknown", "bulk", "clip", "iclip", null, "United States", "2015-12-21", "Cleavage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41548, "SRR5017075", "SRX2345570", "SRS1796136", "SRP093295", "PRJNA353372", "N6 methyladenosine dynamics during early vertebrate embryogenesis", "GSE89815", "Other", "Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability  translation efficiency and effect on miR 430 degradation kinetics. Notably  we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms  for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages", null, null, null, "input shield rep2", "GSM2390028", null, "tissue:Embryos|developmental stage:Shield stage embryos|strain:AB wild type", "input shield rep2", "Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5\u2019end  and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al.  2013 with options   seedSearchStartLmax 15   clip3pNbases 10   clip5pNbases 10   outFilterMultimapNmax 20   outFilterMismatchNoverLmax 0.05   outFilterMatchNminOverLread 0.0   outFilterMatchNmin 15   outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al.  2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage  and txt file with raw and normalized read counts for each gene using the input samples", "Embryos", null, "We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization  2   4  and 6 hpf in batches of 200 embryos using TRIzol Invitrogen  cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific  cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads\u00ae mRNA Purification Kit Ambion  #61006. The m6A RIP experiment was carried out as previously described Ke et al.  2015 and the protocol can be found in supplementary file 1. Briefly  polyA+ enriched RNA was partially fragmented by alkaline hydrolysis  ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies  # 10008D conjugated anti m6A antibody Synaptic systems  # 202003. post stringent washing  the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich  # M2780  ethanol precipitated  and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3\u2019pre adenylated DNA liker ligation with T4 RNA ligase2  truncated KQ NEB  #M0373L  at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014  with improved RT primers indicated in Ke et al. 2015.", "Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28\u00b11\u00b0C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water  deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500\u00b5S/cm  general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean  Blacksburg  USA  53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting  Stavanger  Norway dry feed twice a day and live artemia Scanbur  Karlslunde  Denmark once a day. Health monitoring was by daily inspection  use of sentinel fish sent for pathology ZIRC  Eugene  Oregon and water microbiology analysis NMBU Vetbio  Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats  Apopka  FL. Harvested embryos were kept in autoclaved SW at 28 \u00b0C  harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009  the EU Directive 2010/63.", "developmental stage:Shield stage embryos|strain:AB wild type", "GSM2390028", "GSM2390028: input shield rep2; Danio rerio; RIP Seq", "GSM2390028", null, "1", "We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization  2   4  and 6 hpf in batches of 200 embryos using TRIzol Invitrogen  cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific  cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads\u00ae mRNA Purification Kit Ambion  #61006. The m6A RIP experiment was carried out as previously described Ke et al.  2015 and the protocol can be found in supplementary file 1. Briefly  polyA+ enriched RNA was partially fragmented by alkaline hydrolysis  ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies  # 10008D conjugated anti m6A antibody Synaptic systems  # 202003. post stringent washing  the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich  # M2780  ethanol precipitated  and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3\u2019pre adenylated DNA liker ligation with T4 RNA ligase2  truncated KQ NEB  #M0373L  at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014  with improved RT primers indicated in Ke et al. 2015.", "GEO Accession:GSM2390028", "RIP-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP093295", null, null, "input_shield_rep2.fastq.gz", "fastq", 6559838034.0, 69785511.0, "GSM2390028 r1", "0:94", "A:1785772532;C:1552902091;G:1571407685;T:1649464013;N:291713", 94, null, null, null, 1785772532, 1552902091, 1571407685, 1649464013, 291713, "SRX2345570", "SRS1796136", "SRA492943", "GEO", "Klungland Lab, Dept of microbiology, Oslo University Hospital", 1, 0.03627, null, 0.01, null, 0.96676, null, 0.66777, null, 94, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Norway", "2016-11-14", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41549, "SRR5017074", "SRX2345569", "SRS1796134", "SRP093295", "PRJNA353372", "N6 methyladenosine dynamics during early vertebrate embryogenesis", "GSE89815", "Other", "Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability  translation efficiency and effect on miR 430 degradation kinetics. Notably  we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms  for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages", null, null, null, "input shield rep1", "GSM2390027", null, "tissue:Embryos|developmental stage:Shield stage embryos|strain:AB wild type", "input shield rep1", "Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5\u2019end  and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al.  2013 with options   seedSearchStartLmax 15   clip3pNbases 10   clip5pNbases 10   outFilterMultimapNmax 20   outFilterMismatchNoverLmax 0.05   outFilterMatchNminOverLread 0.0   outFilterMatchNmin 15   outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al.  2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage  and txt file with raw and normalized read counts for each gene using the input samples", "Embryos", null, "We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization  2   4  and 6 hpf in batches of 200 embryos using TRIzol Invitrogen  cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific  cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads\u00ae mRNA Purification Kit Ambion  #61006. The m6A RIP experiment was carried out as previously described Ke et al.  2015 and the protocol can be found in supplementary file 1. Briefly  polyA+ enriched RNA was partially fragmented by alkaline hydrolysis  ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies  # 10008D conjugated anti m6A antibody Synaptic systems  # 202003. post stringent washing  the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich  # M2780  ethanol precipitated  and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3\u2019pre adenylated DNA liker ligation with T4 RNA ligase2  truncated KQ NEB  #M0373L  at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014  with improved RT primers indicated in Ke et al. 2015.", "Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28\u00b11\u00b0C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water  deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500\u00b5S/cm  general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean  Blacksburg  USA  53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting  Stavanger  Norway dry feed twice a day and live artemia Scanbur  Karlslunde  Denmark once a day. Health monitoring was by daily inspection  use of sentinel fish sent for pathology ZIRC  Eugene  Oregon and water microbiology analysis NMBU Vetbio  Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats  Apopka  FL. Harvested embryos were kept in autoclaved SW at 28 \u00b0C  harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009  the EU Directive 2010/63.", "developmental stage:Shield stage embryos|strain:AB wild type", "GSM2390027", "GSM2390027: input shield rep1; Danio rerio; RIP Seq", "GSM2390027", null, "1", "We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization  2   4  and 6 hpf in batches of 200 embryos using TRIzol Invitrogen  cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific  cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads\u00ae mRNA Purification Kit Ambion  #61006. The m6A RIP experiment was carried out as previously described Ke et al.  2015 and the protocol can be found in supplementary file 1. Briefly  polyA+ enriched RNA was partially fragmented by alkaline hydrolysis  ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies  # 10008D conjugated anti m6A antibody Synaptic systems  # 202003. post stringent washing  the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich  # M2780  ethanol precipitated  and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3\u2019pre adenylated DNA liker ligation with T4 RNA ligase2  truncated KQ NEB  #M0373L  at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014  with improved RT primers indicated in Ke et al. 2015.", "GEO Accession:GSM2390027", "RIP-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP093295", null, null, "input_shield_rep1.fastq.gz", "fastq", 3765873214.0, 40062481.0, "GSM2390027 r1", "0:94", "A:1002751444;C:902509483;G:908627718;T:951814220;N:170349", 94, null, null, null, 1002751444, 902509483, 908627718, 951814220, 170349, "SRX2345569", "SRS1796134", "SRA492943", "GEO", "Klungland Lab, Dept of microbiology, Oslo University Hospital", 1, 0.03936, null, 0.01095, null, 0.96518, null, 0.68725, null, 94, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Norway", "2016-11-14", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41550, "SRR5017073", "SRX2345568", "SRS1796132", "SRP093295", "PRJNA353372", "N6 methyladenosine dynamics during early vertebrate embryogenesis", "GSE89815", "Other", "Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability  translation efficiency and effect on miR 430 degradation kinetics. Notably  we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms  for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages", null, null, null, "ip shield rep2", "GSM2390026", null, "tissue:Embryos|developmental stage:Shield stage embryos|strain:AB wild type", "ip shield rep2", "Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5\u2019end  and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al.  2013 with options   seedSearchStartLmax 15   clip3pNbases 10   clip5pNbases 10   outFilterMultimapNmax 20   outFilterMismatchNoverLmax 0.05   outFilterMatchNminOverLread 0.0   outFilterMatchNmin 15   outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al.  2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage  and txt file with raw and normalized read counts for each gene using the input samples", "Embryos", null, "We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization  2   4  and 6 hpf in batches of 200 embryos using TRIzol Invitrogen  cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific  cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads\u00ae mRNA Purification Kit Ambion  #61006. The m6A RIP experiment was carried out as previously described Ke et al.  2015 and the protocol can be found in supplementary file 1. Briefly  polyA+ enriched RNA was partially fragmented by alkaline hydrolysis  ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies  # 10008D conjugated anti m6A antibody Synaptic systems  # 202003. post stringent washing  the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich  # M2780  ethanol precipitated  and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3\u2019pre adenylated DNA liker ligation with T4 RNA ligase2  truncated KQ NEB  #M0373L  at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014  with improved RT primers indicated in Ke et al. 2015.", "Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28\u00b11\u00b0C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water  deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500\u00b5S/cm  general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean  Blacksburg  USA  53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting  Stavanger  Norway dry feed twice a day and live artemia Scanbur  Karlslunde  Denmark once a day. Health monitoring was by daily inspection  use of sentinel fish sent for pathology ZIRC  Eugene  Oregon and water microbiology analysis NMBU Vetbio  Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats  Apopka  FL. Harvested embryos were kept in autoclaved SW at 28 \u00b0C  harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009  the EU Directive 2010/63.", "developmental stage:Shield stage embryos|strain:AB wild type", "GSM2390026", "GSM2390026: ip shield rep2; Danio rerio; RIP Seq", "GSM2390026", null, "1", "We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization  2   4  and 6 hpf in batches of 200 embryos using TRIzol Invitrogen  cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific  cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads\u00ae mRNA Purification Kit Ambion  #61006. The m6A RIP experiment was carried out as previously described Ke et al.  2015 and the protocol can be found in supplementary file 1. Briefly  polyA+ enriched RNA was partially fragmented by alkaline hydrolysis  ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies  # 10008D conjugated anti m6A antibody Synaptic systems  # 202003. post stringent washing  the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich  # M2780  ethanol precipitated  and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3\u2019pre adenylated DNA liker ligation with T4 RNA ligase2  truncated KQ NEB  #M0373L  at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014  with improved RT primers indicated in Ke et al. 2015.", "GEO Accession:GSM2390026", "RIP-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP093295", null, null, "ip_shield_rep2.fastq", "fastq", 3855863926.0, 41019829.0, "GSM2390026 r1", "0:94", "A:1044010018;C:931492803;G:952890289;T:926349254;N:1121562", 94, null, null, null, 1044010018, 931492803, 952890289, 926349254, 1121562, "SRX2345568", "SRS1796132", "SRA492943", "GEO", "Klungland Lab, Dept of microbiology, Oslo University Hospital", 1, 0.03311, null, 0.00481, null, 0.96337, null, 0.68612, null, 94, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Norway", "2016-11-14", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41551, "SRR5017072", "SRX2345567", "SRS1796131", "SRP093295", "PRJNA353372", "N6 methyladenosine dynamics during early vertebrate embryogenesis", "GSE89815", "Other", "Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability  translation efficiency and effect on miR 430 degradation kinetics. Notably  we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms  for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages", null, null, null, "ip shield rep1", "GSM2390025", null, "tissue:Embryos|developmental stage:Shield stage embryos|strain:AB wild type", "ip shield rep1", "Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5\u2019end  and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al.  2013 with options   seedSearchStartLmax 15   clip3pNbases 10   clip5pNbases 10   outFilterMultimapNmax 20   outFilterMismatchNoverLmax 0.05   outFilterMatchNminOverLread 0.0   outFilterMatchNmin 15   outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al.  2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage  and txt file with raw and normalized read counts for each gene using the input samples", "Embryos", null, "We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization  2   4  and 6 hpf in batches of 200 embryos using TRIzol Invitrogen  cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific  cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads\u00ae mRNA Purification Kit Ambion  #61006. The m6A RIP experiment was carried out as previously described Ke et al.  2015 and the protocol can be found in supplementary file 1. Briefly  polyA+ enriched RNA was partially fragmented by alkaline hydrolysis  ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies  # 10008D conjugated anti m6A antibody Synaptic systems  # 202003. post stringent washing  the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich  # M2780  ethanol precipitated  and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3\u2019pre adenylated DNA liker ligation with T4 RNA ligase2  truncated KQ NEB  #M0373L  at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014  with improved RT primers indicated in Ke et al. 2015.", "Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28\u00b11\u00b0C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water  deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500\u00b5S/cm  general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean  Blacksburg  USA  53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting  Stavanger  Norway dry feed twice a day and live artemia Scanbur  Karlslunde  Denmark once a day. Health monitoring was by daily inspection  use of sentinel fish sent for pathology ZIRC  Eugene  Oregon and water microbiology analysis NMBU Vetbio  Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats  Apopka  FL. Harvested embryos were kept in autoclaved SW at 28 \u00b0C  harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009  the EU Directive 2010/63.", "developmental stage:Shield stage embryos|strain:AB wild type", "GSM2390025", "GSM2390025: ip shield rep1; Danio rerio; RIP Seq", "GSM2390025", null, "1", "We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization  2   4  and 6 hpf in batches of 200 embryos using TRIzol Invitrogen  cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific  cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads\u00ae mRNA Purification Kit Ambion  #61006. The m6A RIP experiment was carried out as previously described Ke et al.  2015 and the protocol can be found in supplementary file 1. Briefly  polyA+ enriched RNA was partially fragmented by alkaline hydrolysis  ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies  # 10008D conjugated anti m6A antibody Synaptic systems  # 202003. post stringent washing  the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich  # M2780  ethanol precipitated  and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3\u2019pre adenylated DNA liker ligation with T4 RNA ligase2  truncated KQ NEB  #M0373L  at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014  with improved RT primers indicated in Ke et al. 2015.", "GEO Accession:GSM2390025", "RIP-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP093295", null, null, "ip_shield_rep1.fastq.gz", "fastq", 4107624502.0, 43698133.0, "GSM2390025 r1", "0:94", "A:1087077899;C:996101257;G:1020588721;T:1002667943;N:1188682", 94, null, null, null, 1087077899, 996101257, 1020588721, 1002667943, 1188682, "SRX2345567", "SRS1796131", "SRA492943", "GEO", "Klungland Lab, Dept of microbiology, Oslo University Hospital", 1, 0.01898, null, 0.00264, null, 0.97238, null, 0.59809, null, 94, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Norway", "2016-11-14", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41552, "SRR5017071", "SRX2345566", "SRS1796152", "SRP093295", "PRJNA353372", "N6 methyladenosine dynamics during early vertebrate embryogenesis", "GSE89815", "Other", "Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability  translation efficiency and effect on miR 430 degradation kinetics. Notably  we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms  for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages", null, null, null, "input sphere rep2", "GSM2390024", null, "tissue:Embryos|developmental stage:sphere stage embryos|strain:AB wild type", "input sphere rep2", "Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5\u2019end  and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al.  2013 with options   seedSearchStartLmax 15   clip3pNbases 10   clip5pNbases 10   outFilterMultimapNmax 20   outFilterMismatchNoverLmax 0.05   outFilterMatchNminOverLread 0.0   outFilterMatchNmin 15   outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al.  2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage  and txt file with raw and normalized read counts for each gene using the input samples", "Embryos", null, "We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization  2   4  and 6 hpf in batches of 200 embryos using TRIzol Invitrogen  cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific  cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads\u00ae mRNA Purification Kit Ambion  #61006. The m6A RIP experiment was carried out as previously described Ke et al.  2015 and the protocol can be found in supplementary file 1. Briefly  polyA+ enriched RNA was partially fragmented by alkaline hydrolysis  ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies  # 10008D conjugated anti m6A antibody Synaptic systems  # 202003. post stringent washing  the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich  # M2780  ethanol precipitated  and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3\u2019pre adenylated DNA liker ligation with T4 RNA ligase2  truncated KQ NEB  #M0373L  at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014  with improved RT primers indicated in Ke et al. 2015.", "Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28\u00b11\u00b0C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water  deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500\u00b5S/cm  general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean  Blacksburg  USA  53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting  Stavanger  Norway dry feed twice a day and live artemia Scanbur  Karlslunde  Denmark once a day. Health monitoring was by daily inspection  use of sentinel fish sent for pathology ZIRC  Eugene  Oregon and water microbiology analysis NMBU Vetbio  Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats  Apopka  FL. Harvested embryos were kept in autoclaved SW at 28 \u00b0C  harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009  the EU Directive 2010/63.", "developmental stage:sphere stage embryos|strain:AB wild type", "GSM2390024", "GSM2390024: input sphere rep2; Danio rerio; RIP Seq", "GSM2390024", null, "1", "We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization  2   4  and 6 hpf in batches of 200 embryos using TRIzol Invitrogen  cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific  cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads\u00ae mRNA Purification Kit Ambion  #61006. The m6A RIP experiment was carried out as previously described Ke et al.  2015 and the protocol can be found in supplementary file 1. Briefly  polyA+ enriched RNA was partially fragmented by alkaline hydrolysis  ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies  # 10008D conjugated anti m6A antibody Synaptic systems  # 202003. post stringent washing  the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich  # M2780  ethanol precipitated  and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3\u2019pre adenylated DNA liker ligation with T4 RNA ligase2  truncated KQ NEB  #M0373L  at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014  with improved RT primers indicated in Ke et al. 2015.", "GEO Accession:GSM2390024", "RIP-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP093295", null, null, "input_sphere_rep2.fastq.gz", "fastq", 3684856024.0, 39200596.0, "GSM2390024 r1", "0:94", "A:991404019;C:883789087;G:892976599;T:916520929;N:165390", 94, null, null, null, 991404019, 883789087, 892976599, 916520929, 165390, "SRX2345566", "SRS1796152", "SRA492943", "GEO", "Klungland Lab, Dept of microbiology, Oslo University Hospital", 1, 0.03619, null, 0.00867, null, 0.96051, null, 0.63934, null, 94, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Norway", "2016-11-14", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41553, "SRR5017070", "SRX2345565", "SRS1796139", "SRP093295", "PRJNA353372", "N6 methyladenosine dynamics during early vertebrate embryogenesis", "GSE89815", "Other", "Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability  translation efficiency and effect on miR 430 degradation kinetics. Notably  we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms  for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages", null, null, null, "input sphere rep1", "GSM2390023", null, "tissue:Embryos|developmental stage:sphere stage embryos|strain:AB wild type", "input sphere rep1", "Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5\u2019end  and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al.  2013 with options   seedSearchStartLmax 15   clip3pNbases 10   clip5pNbases 10   outFilterMultimapNmax 20   outFilterMismatchNoverLmax 0.05   outFilterMatchNminOverLread 0.0   outFilterMatchNmin 15   outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al.  2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage  and txt file with raw and normalized read counts for each gene using the input samples", "Embryos", null, "We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization  2   4  and 6 hpf in batches of 200 embryos using TRIzol Invitrogen  cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific  cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads\u00ae mRNA Purification Kit Ambion  #61006. The m6A RIP experiment was carried out as previously described Ke et al.  2015 and the protocol can be found in supplementary file 1. Briefly  polyA+ enriched RNA was partially fragmented by alkaline hydrolysis  ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies  # 10008D conjugated anti m6A antibody Synaptic systems  # 202003. post stringent washing  the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich  # M2780  ethanol precipitated  and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3\u2019pre adenylated DNA liker ligation with T4 RNA ligase2  truncated KQ NEB  #M0373L  at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014  with improved RT primers indicated in Ke et al. 2015.", "Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28\u00b11\u00b0C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water  deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500\u00b5S/cm  general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean  Blacksburg  USA  53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting  Stavanger  Norway dry feed twice a day and live artemia Scanbur  Karlslunde  Denmark once a day. Health monitoring was by daily inspection  use of sentinel fish sent for pathology ZIRC  Eugene  Oregon and water microbiology analysis NMBU Vetbio  Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats  Apopka  FL. Harvested embryos were kept in autoclaved SW at 28 \u00b0C  harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009  the EU Directive 2010/63.", "developmental stage:sphere stage embryos|strain:AB wild type", "GSM2390023", "GSM2390023: input sphere rep1; Danio rerio; RIP Seq", "GSM2390023", null, "1", "We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization  2   4  and 6 hpf in batches of 200 embryos using TRIzol Invitrogen  cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific  cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads\u00ae mRNA Purification Kit Ambion  #61006. The m6A RIP experiment was carried out as previously described Ke et al.  2015 and the protocol can be found in supplementary file 1. Briefly  polyA+ enriched RNA was partially fragmented by alkaline hydrolysis  ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies  # 10008D conjugated anti m6A antibody Synaptic systems  # 202003. post stringent washing  the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich  # M2780  ethanol precipitated  and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3\u2019pre adenylated DNA liker ligation with T4 RNA ligase2  truncated KQ NEB  #M0373L  at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014  with improved RT primers indicated in Ke et al. 2015.", "GEO Accession:GSM2390023", "RIP-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP093295", null, null, "input_sphere_rep1.fastq.gz", "fastq", 3774515574.0, 40154421.0, "GSM2390023 r1", "0:94", "A:1014569244;C:912257296;G:925742711;T:921776107;N:170216", 94, null, null, null, 1014569244, 912257296, 925742711, 921776107, 170216, "SRX2345565", "SRS1796139", "SRA492943", "GEO", "Klungland Lab, Dept of microbiology, Oslo University Hospital", 1, 0.04287, null, 0.00892, null, 0.95085, null, 0.50435, null, 94, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Norway", "2016-11-14", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41554, "SRR5017069", "SRX2345564", "SRS1796133", "SRP093295", "PRJNA353372", "N6 methyladenosine dynamics during early vertebrate embryogenesis", "GSE89815", "Other", "Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability  translation efficiency and effect on miR 430 degradation kinetics. Notably  we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms  for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages", null, null, null, "ip sphere rep2", "GSM2390022", null, "tissue:Embryos|developmental stage:sphere stage embryos|strain:AB wild type", "ip sphere rep2", "Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5\u2019end  and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al.  2013 with options   seedSearchStartLmax 15   clip3pNbases 10   clip5pNbases 10   outFilterMultimapNmax 20   outFilterMismatchNoverLmax 0.05   outFilterMatchNminOverLread 0.0   outFilterMatchNmin 15   outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al.  2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage  and txt file with raw and normalized read counts for each gene using the input samples", "Embryos", null, "We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization  2   4  and 6 hpf in batches of 200 embryos using TRIzol Invitrogen  cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific  cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads\u00ae mRNA Purification Kit Ambion  #61006. The m6A RIP experiment was carried out as previously described Ke et al.  2015 and the protocol can be found in supplementary file 1. Briefly  polyA+ enriched RNA was partially fragmented by alkaline hydrolysis  ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies  # 10008D conjugated anti m6A antibody Synaptic systems  # 202003. post stringent washing  the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich  # M2780  ethanol precipitated  and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3\u2019pre adenylated DNA liker ligation with T4 RNA ligase2  truncated KQ NEB  #M0373L  at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014  with improved RT primers indicated in Ke et al. 2015.", "Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28\u00b11\u00b0C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water  deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500\u00b5S/cm  general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean  Blacksburg  USA  53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting  Stavanger  Norway dry feed twice a day and live artemia Scanbur  Karlslunde  Denmark once a day. Health monitoring was by daily inspection  use of sentinel fish sent for pathology ZIRC  Eugene  Oregon and water microbiology analysis NMBU Vetbio  Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats  Apopka  FL. Harvested embryos were kept in autoclaved SW at 28 \u00b0C  harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009  the EU Directive 2010/63.", "developmental stage:sphere stage embryos|strain:AB wild type", "GSM2390022", "GSM2390022: ip sphere rep2; Danio rerio; RIP Seq", "GSM2390022", null, "1", "We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization  2   4  and 6 hpf in batches of 200 embryos using TRIzol Invitrogen  cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific  cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads\u00ae mRNA Purification Kit Ambion  #61006. The m6A RIP experiment was carried out as previously described Ke et al.  2015 and the protocol can be found in supplementary file 1. Briefly  polyA+ enriched RNA was partially fragmented by alkaline hydrolysis  ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies  # 10008D conjugated anti m6A antibody Synaptic systems  # 202003. post stringent washing  the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich  # M2780  ethanol precipitated  and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3\u2019pre adenylated DNA liker ligation with T4 RNA ligase2  truncated KQ NEB  #M0373L  at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014  with improved RT primers indicated in Ke et al. 2015.", "GEO Accession:GSM2390022", "RIP-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP093295", null, null, "ip_sphere_rep2.fastq.gz", "fastq", 3926426624.0, 41770496.0, "GSM2390022 r1", "0:94", "A:1037910962;C:957162730;G:963824694;T:966381238;N:1147000", 94, null, null, null, 1037910962, 957162730, 963824694, 966381238, 1147000, "SRX2345564", "SRS1796133", "SRA492943", "GEO", "Klungland Lab, Dept of microbiology, Oslo University Hospital", 1, 0.03492, null, 0.00427, null, 0.95026, null, 0.60529, null, 94, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Norway", "2016-11-14", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41555, "SRR5017068", "SRX2345563", "SRS1796143", "SRP093295", "PRJNA353372", "N6 methyladenosine dynamics during early vertebrate embryogenesis", "GSE89815", "Other", "Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability  translation efficiency and effect on miR 430 degradation kinetics. Notably  we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms  for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages", null, null, null, "ip sphere rep1", "GSM2390021", null, "tissue:Embryos|developmental stage:sphere stage embryos|strain:AB wild type", "ip sphere rep1", "Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5\u2019end  and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al.  2013 with options   seedSearchStartLmax 15   clip3pNbases 10   clip5pNbases 10   outFilterMultimapNmax 20   outFilterMismatchNoverLmax 0.05   outFilterMatchNminOverLread 0.0   outFilterMatchNmin 15   outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al.  2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage  and txt file with raw and normalized read counts for each gene using the input samples", "Embryos", null, "We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization  2   4  and 6 hpf in batches of 200 embryos using TRIzol Invitrogen  cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific  cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads\u00ae mRNA Purification Kit Ambion  #61006. The m6A RIP experiment was carried out as previously described Ke et al.  2015 and the protocol can be found in supplementary file 1. Briefly  polyA+ enriched RNA was partially fragmented by alkaline hydrolysis  ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies  # 10008D conjugated anti m6A antibody Synaptic systems  # 202003. post stringent washing  the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich  # M2780  ethanol precipitated  and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3\u2019pre adenylated DNA liker ligation with T4 RNA ligase2  truncated KQ NEB  #M0373L  at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014  with improved RT primers indicated in Ke et al. 2015.", "Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28\u00b11\u00b0C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water  deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500\u00b5S/cm  general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean  Blacksburg  USA  53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting  Stavanger  Norway dry feed twice a day and live artemia Scanbur  Karlslunde  Denmark once a day. Health monitoring was by daily inspection  use of sentinel fish sent for pathology ZIRC  Eugene  Oregon and water microbiology analysis NMBU Vetbio  Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats  Apopka  FL. Harvested embryos were kept in autoclaved SW at 28 \u00b0C  harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009  the EU Directive 2010/63.", "developmental stage:sphere stage embryos|strain:AB wild type", "GSM2390021", "GSM2390021: ip sphere rep1; Danio rerio; RIP Seq", "GSM2390021", null, "1", "We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization  2   4  and 6 hpf in batches of 200 embryos using TRIzol Invitrogen  cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific  cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads\u00ae mRNA Purification Kit Ambion  #61006. The m6A RIP experiment was carried out as previously described Ke et al.  2015 and the protocol can be found in supplementary file 1. Briefly  polyA+ enriched RNA was partially fragmented by alkaline hydrolysis  ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies  # 10008D conjugated anti m6A antibody Synaptic systems  # 202003. post stringent washing  the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich  # M2780  ethanol precipitated  and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3\u2019pre adenylated DNA liker ligation with T4 RNA ligase2  truncated KQ NEB  #M0373L  at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014  with improved RT primers indicated in Ke et al. 2015.", "GEO Accession:GSM2390021", "RIP-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP093295", null, null, "ip_sphere_rep1.fastq.gz", "fastq", 4185867000.0, 44530500.0, "GSM2390021 r1", "0:94", "A:1114959829;C:1018236207;G:1019156922;T:1032304051;N:1209991", 94, null, null, null, 1114959829, 1018236207, 1019156922, 1032304051, 1209991, "SRX2345563", "SRS1796143", "SRA492943", "GEO", "Klungland Lab, Dept of microbiology, Oslo University Hospital", 1, 0.03035, null, 0.00288, null, 0.94757, null, 0.5787, null, 94, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Norway", "2016-11-14", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41556, "SRR5017067", "SRX2345562", "SRS1796129", "SRP093295", "PRJNA353372", "N6 methyladenosine dynamics during early vertebrate embryogenesis", "GSE89815", "Other", "Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability  translation efficiency and effect on miR 430 degradation kinetics. Notably  we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms  for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages", null, null, null, "input 64cell rep2", "GSM2390020", null, "tissue:Embryos|developmental stage:64 cell embryos|strain:AB wild type", "input 64cell rep2", "Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5\u2019end  and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al.  2013 with options   seedSearchStartLmax 15   clip3pNbases 10   clip5pNbases 10   outFilterMultimapNmax 20   outFilterMismatchNoverLmax 0.05   outFilterMatchNminOverLread 0.0   outFilterMatchNmin 15   outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al.  2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage  and txt file with raw and normalized read counts for each gene using the input samples", "Embryos", null, "We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization  2   4  and 6 hpf in batches of 200 embryos using TRIzol Invitrogen  cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific  cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads\u00ae mRNA Purification Kit Ambion  #61006. The m6A RIP experiment was carried out as previously described Ke et al.  2015 and the protocol can be found in supplementary file 1. Briefly  polyA+ enriched RNA was partially fragmented by alkaline hydrolysis  ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies  # 10008D conjugated anti m6A antibody Synaptic systems  # 202003. post stringent washing  the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich  # M2780  ethanol precipitated  and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3\u2019pre adenylated DNA liker ligation with T4 RNA ligase2  truncated KQ NEB  #M0373L  at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014  with improved RT primers indicated in Ke et al. 2015.", "Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28\u00b11\u00b0C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water  deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500\u00b5S/cm  general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean  Blacksburg  USA  53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting  Stavanger  Norway dry feed twice a day and live artemia Scanbur  Karlslunde  Denmark once a day. Health monitoring was by daily inspection  use of sentinel fish sent for pathology ZIRC  Eugene  Oregon and water microbiology analysis NMBU Vetbio  Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats  Apopka  FL. Harvested embryos were kept in autoclaved SW at 28 \u00b0C  harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009  the EU Directive 2010/63.", "developmental stage:64 cell embryos|strain:AB wild type", "GSM2390020", "GSM2390020: input 64cell rep2; Danio rerio; RIP Seq", "GSM2390020", null, "1", "We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization  2   4  and 6 hpf in batches of 200 embryos using TRIzol Invitrogen  cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific  cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads\u00ae mRNA Purification Kit Ambion  #61006. The m6A RIP experiment was carried out as previously described Ke et al.  2015 and the protocol can be found in supplementary file 1. Briefly  polyA+ enriched RNA was partially fragmented by alkaline hydrolysis  ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies  # 10008D conjugated anti m6A antibody Synaptic systems  # 202003. post stringent washing  the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich  # M2780  ethanol precipitated  and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3\u2019pre adenylated DNA liker ligation with T4 RNA ligase2  truncated KQ NEB  #M0373L  at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014  with improved RT primers indicated in Ke et al. 2015.", "GEO Accession:GSM2390020", "RIP-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP093295", null, null, "input_64cell_rep2.fastq.gz", "fastq", 3598782386.0, 38284919.0, "GSM2390020 r1", "0:94", "A:953869445;C:864903757;G:875832539;T:903947732;N:228913", 94, null, null, null, 953869445, 864903757, 875832539, 903947732, 228913, "SRX2345562", "SRS1796129", "SRA492943", "GEO", "Klungland Lab, Dept of microbiology, Oslo University Hospital", 1, 0.04289, null, 0.00757, null, 0.9418, null, 0.6078, null, 94, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Norway", "2016-11-14", "Cleavage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41557, "SRR5017066", "SRX2345561", "SRS1796141", "SRP093295", "PRJNA353372", "N6 methyladenosine dynamics during early vertebrate embryogenesis", "GSE89815", "Other", "Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability  translation efficiency and effect on miR 430 degradation kinetics. Notably  we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms  for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages", null, null, null, "input 64cell rep1", "GSM2390019", null, "tissue:Embryos|developmental stage:64 cell embryos|strain:AB wild type", "input 64cell rep1", "Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5\u2019end  and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al.  2013 with options   seedSearchStartLmax 15   clip3pNbases 10   clip5pNbases 10   outFilterMultimapNmax 20   outFilterMismatchNoverLmax 0.05   outFilterMatchNminOverLread 0.0   outFilterMatchNmin 15   outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al.  2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage  and txt file with raw and normalized read counts for each gene using the input samples", "Embryos", null, "We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization  2   4  and 6 hpf in batches of 200 embryos using TRIzol Invitrogen  cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific  cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads\u00ae mRNA Purification Kit Ambion  #61006. The m6A RIP experiment was carried out as previously described Ke et al.  2015 and the protocol can be found in supplementary file 1. Briefly  polyA+ enriched RNA was partially fragmented by alkaline hydrolysis  ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies  # 10008D conjugated anti m6A antibody Synaptic systems  # 202003. post stringent washing  the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich  # M2780  ethanol precipitated  and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3\u2019pre adenylated DNA liker ligation with T4 RNA ligase2  truncated KQ NEB  #M0373L  at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014  with improved RT primers indicated in Ke et al. 2015.", "Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28\u00b11\u00b0C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water  deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500\u00b5S/cm  general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean  Blacksburg  USA  53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting  Stavanger  Norway dry feed twice a day and live artemia Scanbur  Karlslunde  Denmark once a day. Health monitoring was by daily inspection  use of sentinel fish sent for pathology ZIRC  Eugene  Oregon and water microbiology analysis NMBU Vetbio  Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats  Apopka  FL. Harvested embryos were kept in autoclaved SW at 28 \u00b0C  harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009  the EU Directive 2010/63.", "developmental stage:64 cell embryos|strain:AB wild type", "GSM2390019", "GSM2390019: input 64cell rep1; Danio rerio; RIP Seq", "GSM2390019", null, "1", "We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization  2   4  and 6 hpf in batches of 200 embryos using TRIzol Invitrogen  cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific  cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads\u00ae mRNA Purification Kit Ambion  #61006. The m6A RIP experiment was carried out as previously described Ke et al.  2015 and the protocol can be found in supplementary file 1. Briefly  polyA+ enriched RNA was partially fragmented by alkaline hydrolysis  ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies  # 10008D conjugated anti m6A antibody Synaptic systems  # 202003. post stringent washing  the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich  # M2780  ethanol precipitated  and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3\u2019pre adenylated DNA liker ligation with T4 RNA ligase2  truncated KQ NEB  #M0373L  at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014  with improved RT primers indicated in Ke et al. 2015.", "GEO Accession:GSM2390019", "RIP-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP093295", null, null, "input_64cell_rep1.fastq.gz", "fastq", 3538898746.0, 37647859.0, "GSM2390019 r1", "0:94", "A:916878511;C:870431252;G:873611680;T:877750503;N:226800", 94, null, null, null, 916878511, 870431252, 873611680, 877750503, 226800, "SRX2345561", "SRS1796141", "SRA492943", "GEO", "Klungland Lab, Dept of microbiology, Oslo University Hospital", 1, 0.03397, null, 0.00616, null, 0.95268, null, 0.62545, null, 94, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Norway", "2016-11-14", "Cleavage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41558, "SRR5017065", "SRX2345560", "SRS1796153", "SRP093295", "PRJNA353372", "N6 methyladenosine dynamics during early vertebrate embryogenesis", "GSE89815", "Other", "Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability  translation efficiency and effect on miR 430 degradation kinetics. Notably  we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms  for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages", null, null, null, "ip 64cell rep2", "GSM2390018", null, "tissue:Embryos|developmental stage:64 cell embryos|strain:AB wild type", "ip 64cell rep2", "Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5\u2019end  and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al.  2013 with options   seedSearchStartLmax 15   clip3pNbases 10   clip5pNbases 10   outFilterMultimapNmax 20   outFilterMismatchNoverLmax 0.05   outFilterMatchNminOverLread 0.0   outFilterMatchNmin 15   outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al.  2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage  and txt file with raw and normalized read counts for each gene using the input samples", "Embryos", null, "We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization  2   4  and 6 hpf in batches of 200 embryos using TRIzol Invitrogen  cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific  cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads\u00ae mRNA Purification Kit Ambion  #61006. The m6A RIP experiment was carried out as previously described Ke et al.  2015 and the protocol can be found in supplementary file 1. Briefly  polyA+ enriched RNA was partially fragmented by alkaline hydrolysis  ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies  # 10008D conjugated anti m6A antibody Synaptic systems  # 202003. post stringent washing  the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich  # M2780  ethanol precipitated  and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3\u2019pre adenylated DNA liker ligation with T4 RNA ligase2  truncated KQ NEB  #M0373L  at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014  with improved RT primers indicated in Ke et al. 2015.", "Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28\u00b11\u00b0C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water  deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500\u00b5S/cm  general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean  Blacksburg  USA  53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting  Stavanger  Norway dry feed twice a day and live artemia Scanbur  Karlslunde  Denmark once a day. Health monitoring was by daily inspection  use of sentinel fish sent for pathology ZIRC  Eugene  Oregon and water microbiology analysis NMBU Vetbio  Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats  Apopka  FL. Harvested embryos were kept in autoclaved SW at 28 \u00b0C  harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009  the EU Directive 2010/63.", "developmental stage:64 cell embryos|strain:AB wild type", "GSM2390018", "GSM2390018: ip 64cell rep2; Danio rerio; RIP Seq", "GSM2390018", null, "1", "We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization  2   4  and 6 hpf in batches of 200 embryos using TRIzol Invitrogen  cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific  cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads\u00ae mRNA Purification Kit Ambion  #61006. The m6A RIP experiment was carried out as previously described Ke et al.  2015 and the protocol can be found in supplementary file 1. Briefly  polyA+ enriched RNA was partially fragmented by alkaline hydrolysis  ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies  # 10008D conjugated anti m6A antibody Synaptic systems  # 202003. post stringent washing  the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich  # M2780  ethanol precipitated  and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3\u2019pre adenylated DNA liker ligation with T4 RNA ligase2  truncated KQ NEB  #M0373L  at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014  with improved RT primers indicated in Ke et al. 2015.", "GEO Accession:GSM2390018", "RIP-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP093295", null, null, "ip_64cell_rep2.fastq.gz", "fastq", 3530677976.0, 37560404.0, "GSM2390018 r1", "0:94", "A:966880666;C:841411144;G:858285224;T:862983808;N:1117134", 94, null, null, null, 966880666, 841411144, 858285224, 862983808, 1117134, "SRX2345560", "SRS1796153", "SRA492943", "GEO", "Klungland Lab, Dept of microbiology, Oslo University Hospital", 1, 0.04775, null, 0.00421, null, 0.92845, null, 0.5748, null, 94, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Norway", "2016-11-14", "Cleavage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41559, "SRR5017064", "SRX2345559", "SRS1796135", "SRP093295", "PRJNA353372", "N6 methyladenosine dynamics during early vertebrate embryogenesis", "GSE89815", "Other", "Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability  translation efficiency and effect on miR 430 degradation kinetics. Notably  we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms  for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages", null, null, null, "ip 64cell rep1", "GSM2390017", null, "tissue:Embryos|developmental stage:64 cell embryos|strain:AB wild type", "ip 64cell rep1", "Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5\u2019end  and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al.  2013 with options   seedSearchStartLmax 15   clip3pNbases 10   clip5pNbases 10   outFilterMultimapNmax 20   outFilterMismatchNoverLmax 0.05   outFilterMatchNminOverLread 0.0   outFilterMatchNmin 15   outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al.  2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage  and txt file with raw and normalized read counts for each gene using the input samples", "Embryos", null, "We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization  2   4  and 6 hpf in batches of 200 embryos using TRIzol Invitrogen  cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific  cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads\u00ae mRNA Purification Kit Ambion  #61006. The m6A RIP experiment was carried out as previously described Ke et al.  2015 and the protocol can be found in supplementary file 1. Briefly  polyA+ enriched RNA was partially fragmented by alkaline hydrolysis  ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies  # 10008D conjugated anti m6A antibody Synaptic systems  # 202003. post stringent washing  the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich  # M2780  ethanol precipitated  and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3\u2019pre adenylated DNA liker ligation with T4 RNA ligase2  truncated KQ NEB  #M0373L  at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014  with improved RT primers indicated in Ke et al. 2015.", "Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28\u00b11\u00b0C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water  deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500\u00b5S/cm  general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean  Blacksburg  USA  53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting  Stavanger  Norway dry feed twice a day and live artemia Scanbur  Karlslunde  Denmark once a day. Health monitoring was by daily inspection  use of sentinel fish sent for pathology ZIRC  Eugene  Oregon and water microbiology analysis NMBU Vetbio  Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats  Apopka  FL. Harvested embryos were kept in autoclaved SW at 28 \u00b0C  harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009  the EU Directive 2010/63.", "developmental stage:64 cell embryos|strain:AB wild type", "GSM2390017", "GSM2390017: ip 64cell rep1; Danio rerio; RIP Seq", "GSM2390017", null, "1", "We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization  2   4  and 6 hpf in batches of 200 embryos using TRIzol Invitrogen  cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific  cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads\u00ae mRNA Purification Kit Ambion  #61006. The m6A RIP experiment was carried out as previously described Ke et al.  2015 and the protocol can be found in supplementary file 1. Briefly  polyA+ enriched RNA was partially fragmented by alkaline hydrolysis  ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies  # 10008D conjugated anti m6A antibody Synaptic systems  # 202003. post stringent washing  the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich  # M2780  ethanol precipitated  and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3\u2019pre adenylated DNA liker ligation with T4 RNA ligase2  truncated KQ NEB  #M0373L  at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014  with improved RT primers indicated in Ke et al. 2015.", "GEO Accession:GSM2390017", "RIP-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP093295", null, null, "ip_64cell_rep1.fastq.gz", "fastq", 3912003734.0, 41617061.0, "GSM2390017 r1", "0:94", "A:1040276279;C:945311584;G:953598043;T:971589029;N:1228799", 94, null, null, null, 1040276279, 945311584, 953598043, 971589029, 1228799, "SRX2345559", "SRS1796135", "SRA492943", "GEO", "Klungland Lab, Dept of microbiology, Oslo University Hospital", 1, 0.03544, null, 0.00268, null, 0.93914, null, 0.53712, null, 94, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Norway", "2016-11-14", "Cleavage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41560, "SRR5017063", "SRX2345558", "SRS1796155", "SRP093295", "PRJNA353372", "N6 methyladenosine dynamics during early vertebrate embryogenesis", "GSE89815", "Other", "Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability  translation efficiency and effect on miR 430 degradation kinetics. Notably  we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms  for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages", null, null, null, "input 1cell rep2", "GSM2390016", null, "tissue:Embryos|developmental stage:1cell embryos|strain:AB wild type", "input 1cell rep2", "Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5\u2019end  and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al.  2013 with options   seedSearchStartLmax 15   clip3pNbases 10   clip5pNbases 10   outFilterMultimapNmax 20   outFilterMismatchNoverLmax 0.05   outFilterMatchNminOverLread 0.0   outFilterMatchNmin 15   outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al.  2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage  and txt file with raw and normalized read counts for each gene using the input samples", "Embryos", null, "We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization  2   4  and 6 hpf in batches of 200 embryos using TRIzol Invitrogen  cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific  cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads\u00ae mRNA Purification Kit Ambion  #61006. The m6A RIP experiment was carried out as previously described Ke et al.  2015 and the protocol can be found in supplementary file 1. Briefly  polyA+ enriched RNA was partially fragmented by alkaline hydrolysis  ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies  # 10008D conjugated anti m6A antibody Synaptic systems  # 202003. post stringent washing  the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich  # M2780  ethanol precipitated  and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3\u2019pre adenylated DNA liker ligation with T4 RNA ligase2  truncated KQ NEB  #M0373L  at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014  with improved RT primers indicated in Ke et al. 2015.", "Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28\u00b11\u00b0C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water  deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500\u00b5S/cm  general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean  Blacksburg  USA  53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting  Stavanger  Norway dry feed twice a day and live artemia Scanbur  Karlslunde  Denmark once a day. Health monitoring was by daily inspection  use of sentinel fish sent for pathology ZIRC  Eugene  Oregon and water microbiology analysis NMBU Vetbio  Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats  Apopka  FL. Harvested embryos were kept in autoclaved SW at 28 \u00b0C  harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009  the EU Directive 2010/63.", "developmental stage:1cell embryos|strain:AB wild type", "GSM2390016", "GSM2390016: input 1cell rep2; Danio rerio; RIP Seq", "GSM2390016", null, "1", "We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization  2   4  and 6 hpf in batches of 200 embryos using TRIzol Invitrogen  cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific  cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads\u00ae mRNA Purification Kit Ambion  #61006. The m6A RIP experiment was carried out as previously described Ke et al.  2015 and the protocol can be found in supplementary file 1. Briefly  polyA+ enriched RNA was partially fragmented by alkaline hydrolysis  ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies  # 10008D conjugated anti m6A antibody Synaptic systems  # 202003. post stringent washing  the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich  # M2780  ethanol precipitated  and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3\u2019pre adenylated DNA liker ligation with T4 RNA ligase2  truncated KQ NEB  #M0373L  at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014  with improved RT primers indicated in Ke et al. 2015.", "GEO Accession:GSM2390016", "RIP-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP093295", null, null, "input_1cell_rep2.fastq.gz", "fastq", 3379762010.0, 35954915.0, "GSM2390016 r1", "0:94", "A:898920912;C:816234808;G:823428476;T:840956466;N:221348", 94, null, null, null, 898920912, 816234808, 823428476, 840956466, 221348, "SRX2345558", "SRS1796155", "SRA492943", "GEO", "Klungland Lab, Dept of microbiology, Oslo University Hospital", 1, 0.04513, null, 0.00864, null, 0.95085, null, 0.51692, null, 94, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Norway", "2016-11-14", "Zygote", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41561, "SRR5017062", "SRX2345557", "SRS1796128", "SRP093295", "PRJNA353372", "N6 methyladenosine dynamics during early vertebrate embryogenesis", "GSE89815", "Other", "Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability  translation efficiency and effect on miR 430 degradation kinetics. Notably  we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms  for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages", null, null, null, "input 1cell rep1", "GSM2390015", null, "tissue:Embryos|developmental stage:1cell embryos|strain:AB wild type", "input 1cell rep1", "Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5\u2019end  and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al.  2013 with options   seedSearchStartLmax 15   clip3pNbases 10   clip5pNbases 10   outFilterMultimapNmax 20   outFilterMismatchNoverLmax 0.05   outFilterMatchNminOverLread 0.0   outFilterMatchNmin 15   outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al.  2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage  and txt file with raw and normalized read counts for each gene using the input samples", "Embryos", null, "We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization  2   4  and 6 hpf in batches of 200 embryos using TRIzol Invitrogen  cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific  cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads\u00ae mRNA Purification Kit Ambion  #61006. The m6A RIP experiment was carried out as previously described Ke et al.  2015 and the protocol can be found in supplementary file 1. Briefly  polyA+ enriched RNA was partially fragmented by alkaline hydrolysis  ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies  # 10008D conjugated anti m6A antibody Synaptic systems  # 202003. post stringent washing  the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich  # M2780  ethanol precipitated  and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3\u2019pre adenylated DNA liker ligation with T4 RNA ligase2  truncated KQ NEB  #M0373L  at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014  with improved RT primers indicated in Ke et al. 2015.", "Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28\u00b11\u00b0C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water  deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500\u00b5S/cm  general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean  Blacksburg  USA  53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting  Stavanger  Norway dry feed twice a day and live artemia Scanbur  Karlslunde  Denmark once a day. Health monitoring was by daily inspection  use of sentinel fish sent for pathology ZIRC  Eugene  Oregon and water microbiology analysis NMBU Vetbio  Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats  Apopka  FL. Harvested embryos were kept in autoclaved SW at 28 \u00b0C  harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009  the EU Directive 2010/63.", "developmental stage:1cell embryos|strain:AB wild type", "GSM2390015", "GSM2390015: input 1cell rep1; Danio rerio; RIP Seq", "GSM2390015", null, "1", "We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization  2   4  and 6 hpf in batches of 200 embryos using TRIzol Invitrogen  cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific  cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads\u00ae mRNA Purification Kit Ambion  #61006. The m6A RIP experiment was carried out as previously described Ke et al.  2015 and the protocol can be found in supplementary file 1. Briefly  polyA+ enriched RNA was partially fragmented by alkaline hydrolysis  ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies  # 10008D conjugated anti m6A antibody Synaptic systems  # 202003. post stringent washing  the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich  # M2780  ethanol precipitated  and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3\u2019pre adenylated DNA liker ligation with T4 RNA ligase2  truncated KQ NEB  #M0373L  at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014  with improved RT primers indicated in Ke et al. 2015.", "GEO Accession:GSM2390015", "RIP-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP093295", null, null, "input_1cell_rep1.fastq.gz", "fastq", 3650321646.0, 38833209.0, "GSM2390015 r1", "0:94", "A:951411355;C:878458528;G:890250453;T:929968044;N:233266", 94, null, null, null, 951411355, 878458528, 890250453, 929968044, 233266, "SRX2345557", "SRS1796128", "SRA492943", "GEO", "Klungland Lab, Dept of microbiology, Oslo University Hospital", 1, 0.03728, null, 0.00668, null, 0.94901, null, 0.60038, null, 94, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Norway", "2016-11-14", "Zygote", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41562, "SRR5017061", "SRX2345556", "SRS1796127", "SRP093295", "PRJNA353372", "N6 methyladenosine dynamics during early vertebrate embryogenesis", "GSE89815", "Other", "Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability  translation efficiency and effect on miR 430 degradation kinetics. Notably  we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms  for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages", null, null, null, "ip 1cell rep2", "GSM2390014", null, "tissue:Embryos|developmental stage:1cell embryos|strain:AB wild type", "ip 1cell rep2", "Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5\u2019end  and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al.  2013 with options   seedSearchStartLmax 15   clip3pNbases 10   clip5pNbases 10   outFilterMultimapNmax 20   outFilterMismatchNoverLmax 0.05   outFilterMatchNminOverLread 0.0   outFilterMatchNmin 15   outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al.  2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage  and txt file with raw and normalized read counts for each gene using the input samples", "Embryos", null, "We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization  2   4  and 6 hpf in batches of 200 embryos using TRIzol Invitrogen  cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific  cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads\u00ae mRNA Purification Kit Ambion  #61006. The m6A RIP experiment was carried out as previously described Ke et al.  2015 and the protocol can be found in supplementary file 1. Briefly  polyA+ enriched RNA was partially fragmented by alkaline hydrolysis  ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies  # 10008D conjugated anti m6A antibody Synaptic systems  # 202003. post stringent washing  the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich  # M2780  ethanol precipitated  and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3\u2019pre adenylated DNA liker ligation with T4 RNA ligase2  truncated KQ NEB  #M0373L  at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014  with improved RT primers indicated in Ke et al. 2015.", "Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28\u00b11\u00b0C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water  deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500\u00b5S/cm  general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean  Blacksburg  USA  53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting  Stavanger  Norway dry feed twice a day and live artemia Scanbur  Karlslunde  Denmark once a day. Health monitoring was by daily inspection  use of sentinel fish sent for pathology ZIRC  Eugene  Oregon and water microbiology analysis NMBU Vetbio  Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats  Apopka  FL. Harvested embryos were kept in autoclaved SW at 28 \u00b0C  harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009  the EU Directive 2010/63.", "developmental stage:1cell embryos|strain:AB wild type", "GSM2390014", "GSM2390014: ip 1cell rep2; Danio rerio; RIP Seq", "GSM2390014", null, "1", "We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization  2   4  and 6 hpf in batches of 200 embryos using TRIzol Invitrogen  cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific  cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads\u00ae mRNA Purification Kit Ambion  #61006. The m6A RIP experiment was carried out as previously described Ke et al.  2015 and the protocol can be found in supplementary file 1. Briefly  polyA+ enriched RNA was partially fragmented by alkaline hydrolysis  ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies  # 10008D conjugated anti m6A antibody Synaptic systems  # 202003. post stringent washing  the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich  # M2780  ethanol precipitated  and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3\u2019pre adenylated DNA liker ligation with T4 RNA ligase2  truncated KQ NEB  #M0373L  at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014  with improved RT primers indicated in Ke et al. 2015.", "GEO Accession:GSM2390014", "RIP-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP093295", null, null, "ip_1cell_rep2.fastq.gz", "fastq", 3485432580.0, 37079070.0, "GSM2390014 r1", "0:94", "A:953699047;C:835179152;G:846963064;T:848487912;N:1103405", 94, null, null, null, 953699047, 835179152, 846963064, 848487912, 1103405, "SRX2345556", "SRS1796127", "SRA492943", "GEO", "Klungland Lab, Dept of microbiology, Oslo University Hospital", 1, 0.02534, null, 0.00219, null, 0.95891, null, 0.5975, null, 94, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Norway", "2016-11-14", "Zygote", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41563, "SRR5017060", "SRX2345555", "SRS1796130", "SRP093295", "PRJNA353372", "N6 methyladenosine dynamics during early vertebrate embryogenesis", "GSE89815", "Other", "Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability  translation efficiency and effect on miR 430 degradation kinetics. Notably  we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms  for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages", null, null, null, "ip 1cell rep1", "GSM2390013", null, "tissue:Embryos|developmental stage:1cell embryos|strain:AB wild type", "ip 1cell rep1", "Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5\u2019end  and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al.  2013 with options   seedSearchStartLmax 15   clip3pNbases 10   clip5pNbases 10   outFilterMultimapNmax 20   outFilterMismatchNoverLmax 0.05   outFilterMatchNminOverLread 0.0   outFilterMatchNmin 15   outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al.  2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage  and txt file with raw and normalized read counts for each gene using the input samples", "Embryos", null, "We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization  2   4  and 6 hpf in batches of 200 embryos using TRIzol Invitrogen  cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific  cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads\u00ae mRNA Purification Kit Ambion  #61006. The m6A RIP experiment was carried out as previously described Ke et al.  2015 and the protocol can be found in supplementary file 1. Briefly  polyA+ enriched RNA was partially fragmented by alkaline hydrolysis  ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies  # 10008D conjugated anti m6A antibody Synaptic systems  # 202003. post stringent washing  the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich  # M2780  ethanol precipitated  and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3\u2019pre adenylated DNA liker ligation with T4 RNA ligase2  truncated KQ NEB  #M0373L  at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014  with improved RT primers indicated in Ke et al. 2015.", "Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28\u00b11\u00b0C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water  deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500\u00b5S/cm  general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean  Blacksburg  USA  53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting  Stavanger  Norway dry feed twice a day and live artemia Scanbur  Karlslunde  Denmark once a day. Health monitoring was by daily inspection  use of sentinel fish sent for pathology ZIRC  Eugene  Oregon and water microbiology analysis NMBU Vetbio  Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats  Apopka  FL. Harvested embryos were kept in autoclaved SW at 28 \u00b0C  harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009  the EU Directive 2010/63.", "developmental stage:1cell embryos|strain:AB wild type", "GSM2390013", "GSM2390013: ip 1cell rep1; Danio rerio; RIP Seq", "GSM2390013", null, "1", "We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization  2   4  and 6 hpf in batches of 200 embryos using TRIzol Invitrogen  cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific  cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads\u00ae mRNA Purification Kit Ambion  #61006. The m6A RIP experiment was carried out as previously described Ke et al.  2015 and the protocol can be found in supplementary file 1. Briefly  polyA+ enriched RNA was partially fragmented by alkaline hydrolysis  ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies  # 10008D conjugated anti m6A antibody Synaptic systems  # 202003. post stringent washing  the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich  # M2780  ethanol precipitated  and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3\u2019pre adenylated DNA liker ligation with T4 RNA ligase2  truncated KQ NEB  #M0373L  at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014  with improved RT primers indicated in Ke et al. 2015.", "GEO Accession:GSM2390013", "RIP-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP093295", null, null, "ip_1cell_rep1.fastq.gz", "fastq", 3610167102.0, 38406033.0, "GSM2390013 r1", "0:94", "A:961438376;C:875781200;G:891055201;T:880749228;N:1143097", 94, null, null, null, 961438376, 875781200, 891055201, 880749228, 1143097, "SRX2345555", "SRS1796130", "SRA492943", "GEO", "Klungland Lab, Dept of microbiology, Oslo University Hospital", 1, 0.01939, null, 0.00159, null, 0.96457, null, 0.53652, null, 94, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Norway", "2016-11-14", "Zygote", "Embryo", "Embryo Imprecise", "All anatomical structures"], [42000, "SRR5379364", "SRX2674572", "SRS2073700", "SRP102513", "PRJNA380609", "Transcriptome analysis on wild type and ddx39a mutant zebrafish embryos by Next Generation Sequencing", "GSE97067", "Other", "DEAD box RNA helicase DDX39A has been shown to regulate RNA metabolism; however its role in vertebrate development has not previously been examined. To determine the impact of loss of ddx39a on transcriptome during vertebrate early development  we pursued transcriptome analysis RNA Seq on wild type and ddx39a mutant zebrafish embryos at 24 hpf And by using RIP seq to identify targeted RNA which were DDX39A binded. Overall design: Using RNA seq to identify the changes in the transcriptomic landscape in ddx39a mutants. Using RIP seq to identify DDX39A binding RNAs.", null, "pubmed:29636379", null, "ddx39a 24hpf RIPseq", "GSM2550918", null, "source name:embryos|genotype:ddx39a mutant|tissue:embryo|developmental stage:24hpf", "ddx39a 24hpf RIPseq", "Illumina bcl2fastq2 v 2.16.0.10 software was used for base calling. Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.5. High quality reads were alligned to GRCz10 whole genome using tophat V2.2.1 and bowtie2 v2.2.3 with parameters  q  p 8   no novel juncs  G  o. Raw counts of sequencing reads were generated by using HTSeq v 0.6.1p1. Genome build: GRCz10 Supplementary files format and content: tab delimited text files include raw counts for each Sample", "embryos", null, "Microinjection ddx39a Flag mRNA in ddx39a mutant embryos at one cell stage. Lysates were clarified from 24hpf embryos were isolated with anti Flag beads. RNA was harvested using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit was used with 1 ug of total RNA for the construction of sequencing libraries. Magnetic beads with oligodT were used to enrich the mRNAs  and then Frag/Prime buffer was added to fragment the mRNAs. The short mRNA fragments were used as templates and random hexamers were used to synthesize first strand cDNA. Then double stranded cDNA was synthesized by adding buffer solution  dNTPs and DNA polymerase\u0399. The double stranded cDNAs were purified by DNA clean beads according to the manufacturer\u2019s instructions  then repaired at the tail ends  polyA added and enriched by PCR amplification. Finally  we tested the inserts sizes in the cDNA libraries on an Agilent 2100 Bioanalyzer.", null, "genotype:ddx39a mutant|tissue:embryo|developmental stage:24hpf", "GSM2550918", "GSM2550918: ddx39a 24hpf RIPseq; Danio rerio; RIP Seq", "GSM2550918", null, "1", "Microinjection ddx39a Flag mRNA in ddx39a mutant embryos at one cell stage. Lysates were clarified from 24hpf embryos were isolated with anti Flag beads. RNA was harvested using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit was used with 1 ug of total RNA for the construction of sequencing libraries. Magnetic beads with oligodT were used to enrich the mRNAs  and then Frag/Prime buffer was added to fragment the mRNAs. The short mRNA fragments were used as templates and random hexamers were used to synthesize first strand cDNA. Then double stranded cDNA was synthesized by adding buffer solution  dNTPs and DNA polymerase\u0399. The double stranded cDNAs were purified by DNA clean beads according to the manufacturer\u2019s instructions  then repaired at the tail ends  polyA added and enriched by PCR amplification. Finally  we tested the inserts sizes in the cDNA libraries on an Agilent 2100 Bioanalyzer.", "GEO Accession:GSM2550918", "RIP-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP102513", null, null, "RDWHDANwwwCAABRAAPEI-206_1.fq.gz RDWHDANwwwCAABRAAPEI-206_2.fq.gz", "fastq fastq", 3819239400.0, 19096197.0, "GSM2550918 r1", "0:100 1:100", "A:751858949;C:1169790479;G:1139713624;T:756987876;N:888472", 100, 100, null, null, 751858949, 1169790479, 1139713624, 756987876, 888472, "SRX2674572", "SRS2073700", "SRA549449", "GEO", "Xin Lou Lab, Medical School, Nanjing University", 2, 0.98659, 0.98572, 0.28836, 0.28975, 0.89422, 0.89558, 0.75396, 0.78553, 100, 100, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "trueseq", "bulk", "unknown", "unknown", null, "China", "2017-03-27", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [42001, "SRR5379363", "SRX2674571", "SRS2073697", "SRP102513", "PRJNA380609", "Transcriptome analysis on wild type and ddx39a mutant zebrafish embryos by Next Generation Sequencing", "GSE97067", "Other", "DEAD box RNA helicase DDX39A has been shown to regulate RNA metabolism; however its role in vertebrate development has not previously been examined. To determine the impact of loss of ddx39a on transcriptome during vertebrate early development  we pursued transcriptome analysis RNA Seq on wild type and ddx39a mutant zebrafish embryos at 24 hpf And by using RIP seq to identify targeted RNA which were DDX39A binded. Overall design: Using RNA seq to identify the changes in the transcriptomic landscape in ddx39a mutants. Using RIP seq to identify DDX39A binding RNAs.", null, "pubmed:29636379", null, "WT 24hpf RIPseq", "GSM2550917", null, "source name:embryos|genotype:wild type|tissue:embryo|developmental stage:24hpf", "WT 24hpf RIPseq", "Illumina bcl2fastq2 v 2.16.0.10 software was used for base calling. Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.5. High quality reads were alligned to GRCz10 whole genome using tophat V2.2.1 and bowtie2 v2.2.3 with parameters  q  p 8   no novel juncs  G  o. Raw counts of sequencing reads were generated by using HTSeq v 0.6.1p1. Genome build: GRCz10 Supplementary files format and content: tab delimited text files include raw counts for each Sample", "embryos", null, "Microinjection ddx39a Flag mRNA in ddx39a mutant embryos at one cell stage. Lysates were clarified from 24hpf embryos were isolated with anti Flag beads. RNA was harvested using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit was used with 1 ug of total RNA for the construction of sequencing libraries. Magnetic beads with oligodT were used to enrich the mRNAs  and then Frag/Prime buffer was added to fragment the mRNAs. The short mRNA fragments were used as templates and random hexamers were used to synthesize first strand cDNA. Then double stranded cDNA was synthesized by adding buffer solution  dNTPs and DNA polymerase\u0399. The double stranded cDNAs were purified by DNA clean beads according to the manufacturer\u2019s instructions  then repaired at the tail ends  polyA added and enriched by PCR amplification. Finally  we tested the inserts sizes in the cDNA libraries on an Agilent 2100 Bioanalyzer.", null, "genotype:wild type|tissue:embryo|developmental stage:24hpf", "GSM2550917", "GSM2550917: WT 24hpf RIPseq; Danio rerio; RIP Seq", "GSM2550917", null, "1", "Microinjection ddx39a Flag mRNA in ddx39a mutant embryos at one cell stage. Lysates were clarified from 24hpf embryos were isolated with anti Flag beads. RNA was harvested using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit was used with 1 ug of total RNA for the construction of sequencing libraries. Magnetic beads with oligodT were used to enrich the mRNAs  and then Frag/Prime buffer was added to fragment the mRNAs. The short mRNA fragments were used as templates and random hexamers were used to synthesize first strand cDNA. Then double stranded cDNA was synthesized by adding buffer solution  dNTPs and DNA polymerase\u0399. The double stranded cDNAs were purified by DNA clean beads according to the manufacturer\u2019s instructions  then repaired at the tail ends  polyA added and enriched by PCR amplification. Finally  we tested the inserts sizes in the cDNA libraries on an Agilent 2100 Bioanalyzer.", "GEO Accession:GSM2550917", "RIP-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP102513", null, null, "RDWHDANwwwCAAARAAPEI-205_2.fq.gz RDWHDANwwwCAAARAAPEI-205_1.fq.gz", "fastq fastq", 3802882200.0, 19014411.0, "GSM2550917 r1", "0:100 1:100", "A:733911232;C:1178365174;G:1154031422;T:735690235;N:884137", 100, 100, null, null, 733911232, 1178365174, 1154031422, 735690235, 884137, "SRX2674571", "SRS2073697", "SRA549449", "GEO", "Xin Lou Lab, Medical School, Nanjing University", 2, 0.9866, 0.98469, 0.30567, 0.30486, 0.90796, 0.90928, 0.82926, 0.83029, 100, 100, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "trueseq", "bulk", "unknown", "unknown", null, "China", "2017-03-27", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43402, "SRR5931544", "SRX3091819", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "with difenoconazole", "397969", "397969", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4755826950.0, 31705513.0, "D 500 1 2.fq.gz", "0:0 1:150", "A:1274207449;C:1094727902;G:1122524378;T:1264331427;N:35794", 0, 150, null, null, 1274207449, 1094727902, 1122524378, 1264331427, 35794, "SRX3091819", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.91191, null, 0.10926, null, 0.68341, null, 0.47196, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43403, "SRR5931545", "SRX3091818", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "with difenoconazole", "397968", "397968", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4755826950.0, 31705513.0, "D 500 1 1.fq.gz", "0:150 1:0", "A:1276129214;C:1100761964;G:1115345594;T:1263574047;N:16131", 150, 0, null, null, 1276129214, 1100761964, 1115345594, 1263574047, 16131, "SRX3091818", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.91044, null, 0.10895, null, 0.67659, null, 0.46952, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43404, "SRR5931546", "SRX3091817", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "with difenoconazole", "397967", "397967", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4584658950.0, 30564393.0, "D 50 3 2.fq.gz", "0:0 1:150", "A:1214232270;C:1065003267;G:1091428812;T:1213867330;N:127271", 0, 150, null, null, 1214232270, 1065003267, 1091428812, 1213867330, 127271, "SRX3091817", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.92229, null, 0.10554, null, 0.68667, null, 0.4535, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43405, "SRR5931547", "SRX3091816", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "with difenoconazole", "397966", "397966", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4584658950.0, 30564393.0, "D 50 3 1.fq.gz", "0:150 1:0", "A:1219702088;C:1067643780;G:1085480895;T:1211806100;N:26087", 150, 0, null, null, 1219702088, 1067643780, 1085480895, 1211806100, 26087, "SRX3091816", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.92126, null, 0.10598, null, 0.68398, null, 0.44901, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43406, "SRR5931548", "SRX3091815", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "with difenoconazole", "397973", "397973", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4705867200.0, 31372448.0, "D 500 3 2.fq.gz", "0:0 1:150", "A:1240294141;C:1111008282;G:1125861755;T:1228667971;N:35051", 0, 150, null, null, 1240294141, 1111008282, 1125861755, 1228667971, 35051, "SRX3091815", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.92297, null, 0.09739, null, 0.6856, null, 0.47451, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43407, "SRR5931549", "SRX3091814", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "with difenoconazole", "397972", "397972", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4705867200.0, 31372448.0, "D 500 3 1.fq.gz", "0:150 1:0", "A:1241514886;C:1108723884;G:1123339576;T:1232273510;N:15344", 150, 0, null, null, 1241514886, 1108723884, 1123339576, 1232273510, 15344, "SRX3091814", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.92062, null, 0.09796, null, 0.67856, null, 0.47388, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43408, "SRR5931550", "SRX3091813", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "with difenoconazole", "397971", "397971", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4750951350.0, 31673009.0, "D 500 2 2.fq.gz", "0:0 1:150", "A:1286144024;C:1079544004;G:1112952985;T:1272274928;N:35409", 0, 150, null, null, 1286144024, 1079544004, 1112952985, 1272274928, 35409, "SRX3091813", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.90446, null, 0.13747, null, 0.68639, null, 0.46726, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"]], "truncated": false, "filtered_table_rows_count": 289, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"experiment.library_selection\" = :p0 and \"tissue_curation\" = :p1 order by rowid limit 101", "params": {"p0": "other", "p1": "Embryo Imprecise"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise", "results": [{"value": "OTHER", "label": "OTHER", "count": 198, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise&experiment.library_strategy=OTHER", "selected": false}, {"value": "RIP-Seq", "label": "RIP-Seq", "count": 50, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise&experiment.library_strategy=RIP-Seq", "selected": false}, {"value": "RNA-Seq", "label": "RNA-Seq", "count": 39, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise&experiment.library_strategy=RNA-Seq", "selected": false}, {"value": "ATAC-seq", "label": "ATAC-seq", "count": 2, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise&experiment.library_strategy=ATAC-seq", "selected": false}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 288, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise&experiment.library_source=TRANSCRIPTOMIC", "selected": false}, {"value": "TRANSCRIPTOMIC SINGLE CELL", "label": "TRANSCRIPTOMIC SINGLE CELL", "count": 1, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise&experiment.library_source=TRANSCRIPTOMIC+SINGLE+CELL", "selected": false}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise", "results": [{"value": "other", "label": "other", "count": 289, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?tissue_curation=Embryo+Imprecise", "selected": true}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise", "results": [{"value": "SINGLE", "label": "SINGLE", "count": 165, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise&experiment.library_layout=SINGLE", "selected": false}, {"value": "PAIRED", "label": "PAIRED", "count": 124, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise&experiment.library_layout=PAIRED", "selected": false}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise", "results": [{"value": "ILLUMINA", "label": "ILLUMINA", "count": 289, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise&experiment.platform=ILLUMINA", "selected": false}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise", "results": [{"value": "Embryo", "label": "Embryo", "count": 264, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise&devstage_curation_coarse=Embryo", "selected": false}, {"value": "Larval", "label": "Larval", "count": 25, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise&devstage_curation_coarse=Larval", "selected": false}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise", "results": [{"value": "Blastula", "label": "Blastula", "count": 54, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise&devstage_curation=Blastula", "selected": false}, {"value": "Gastrula", "label": "Gastrula", "count": 48, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise&devstage_curation=Gastrula", "selected": false}, {"value": "Hatching", "label": "Hatching", "count": 45, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise&devstage_curation=Hatching", "selected": false}, {"value": "Cleavage", "label": "Cleavage", "count": 42, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise&devstage_curation=Cleavage", "selected": false}, {"value": "Undetermined", "label": "Undetermined", "count": 33, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise&devstage_curation=Undetermined", "selected": false}, {"value": "Larval", "label": "Larval", "count": 25, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise&devstage_curation=Larval", "selected": false}, {"value": "Zygote", "label": "Zygote", "count": 22, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise&devstage_curation=Zygote", "selected": false}, {"value": "Multi-stage", "label": "Multi-stage", "count": 10, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise&devstage_curation=Multi-stage", "selected": false}, {"value": "Pharyngula", "label": "Pharyngula", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise&devstage_curation=Pharyngula", "selected": false}, {"value": "Segmentation", "label": "Segmentation", "count": 4, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise&devstage_curation=Segmentation", "selected": false}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise", "results": [{"value": "All anatomical structures", "label": "All anatomical structures", "count": 289, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise&tissue_curation_coarse=All+anatomical+structures", "selected": false}], "truncated": false}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise", "results": [{"value": "Embryo Imprecise", "label": "Embryo Imprecise", "count": 289, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other", "selected": true}], "truncated": false}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise", "results": [{"value": "unknown", "label": "unknown", "count": 216, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise&technology=unknown", "selected": false}, {"value": "iclip", "label": "iclip", "count": 49, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise&technology=iclip", "selected": false}, {"value": "bulk", "label": "bulk", "count": 20, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise&technology=bulk", "selected": false}, {"value": "10x", "label": "10x", "count": 4, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise&technology=10x", "selected": false}], "truncated": false}}, "suggested_facets": [], "next": "43408", "next_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise&_next=43408", "private": false, "allow_execute_sql": true, "query_ms": 136.140404996695}