{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where experiment.library_selection = \"other\", experiment.library_strategy = \"RNA-Seq\" and tissue_curation_coarse = \"All anatomical structures\"", "rows": [[60, "DRR032764", "DRX029570", "DRS049969", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 100 individuals", "Dr shield 2", "SAMD00028161", null, "sample name:Dr shield 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:shield|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028161", "DRX029570", "Dr shield 2", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028161", null, null, null, 3644397900.0, 36443979.0, "DRR032764", "0:100 1:0", "A:986071173;C:842367218;G:837686080;T:978236607;N:36822", 100, 0, null, null, 986071173, 842367218, 837686080, 978236607, 36822, "DRX029570", "DRS049969", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.92419, null, 0.08269, null, 0.75558, null, 0.47863, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Gastrula", "Embryo", "Whole Organism", "All anatomical structures"], [61, "DRR032763", "DRX029569", "DRS049968", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 100 individuals", "Dr shield 1", "SAMD00028160", null, "sample name:Dr shield 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:shield|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028160", "DRX029569", "Dr shield 1", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028160", null, null, null, 3834622000.0, 38346220.0, "DRR032763", "0:100 1:0", "A:1043352851;C:880011834;G:876775415;T:1034444253;N:37647", 100, 0, null, null, 1043352851, 880011834, 876775415, 1034444253, 37647, "DRX029569", "DRS049968", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.92305, null, 0.09126, null, 0.75481, null, 0.47587, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Gastrula", "Embryo", "Whole Organism", "All anatomical structures"], [62, "DRR032762", "DRX029568", "DRS049967", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 50 individuals", "Dr prime5 6 3", "SAMD00028159", null, "sample name:Dr prime5 6 3|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:prime5 6|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028159", "DRX029568", "Dr prime5 6 3", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028159", null, null, null, 3903332800.0, 39033328.0, "DRR032762", "0:100 1:0", "A:1050045822;C:908538410;G:900588661;T:1044116537;N:43370", 100, 0, null, null, 1050045822, 908538410, 900588661, 1044116537, 43370, "DRX029568", "DRS049967", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.92761, null, 0.07976, null, 0.69126, null, 0.46568, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Undetermined", "Embryo", "Whole Organism", "All anatomical structures"], [63, "DRR032761", "DRX029567", "DRS049966", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 50 individuals", "Dr prime5 6 2", "SAMD00028158", null, "sample name:Dr prime5 6 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:prime5 6|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028158", "DRX029567", "Dr prime5 6 2", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028158", null, null, null, 3678549700.0, 36785497.0, "DRR032761", "0:100 1:0", "A:986526644;C:857762765;G:853417738;T:980801764;N:40789", 100, 0, null, null, 986526644, 857762765, 853417738, 980801764, 40789, "DRX029567", "DRS049966", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.92689, null, 0.07872, null, 0.6928, null, 0.46577, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Undetermined", "Embryo", "Whole Organism", "All anatomical structures"], [64, "DRR032760", "DRX029566", "DRS049965", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 50 individuals", "Dr prime5 6 1", "SAMD00028157", null, "sample name:Dr prime5 6 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:prime5 6|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028157", "DRX029566", "Dr prime5 6 1", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028157", null, null, null, 3863129500.0, 38631295.0, "DRR032760", "0:100 1:0", "A:1035240477;C:901625010;G:895370149;T:1030851937;N:41927", 100, 0, null, null, 1035240477, 901625010, 895370149, 1030851937, 41927, "DRX029566", "DRS049965", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.92337, null, 0.07522, null, 0.69315, null, 0.46516, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Undetermined", "Embryo", "Whole Organism", "All anatomical structures"], [65, "DRR032759", "DRX029565", "DRS049964", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 50 individuals", "Dr prime25 2", "SAMD00028156", null, "sample name:Dr prime25 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:prime25|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028156", "DRX029565", "Dr prime25 2", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028156", null, null, null, 3750136100.0, 37501361.0, "DRR032759", "0:100 1:0", "A:1013528040;C:866734984;G:862431819;T:1007403208;N:38049", 100, 0, null, null, 1013528040, 866734984, 862431819, 1007403208, 38049, "DRX029565", "DRS049964", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.92019, null, 0.09079, null, 0.68304, null, 0.47083, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Undetermined", "Embryo", "Whole Organism", "All anatomical structures"], [66, "DRR032758", "DRX029564", "DRS049963", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 50 individuals", "Dr prime25 1", "SAMD00028155", null, "sample name:Dr prime25 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:prime25|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028155", "DRX029564", "Dr prime25 1", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028155", null, null, null, 3544862700.0, 35448627.0, "DRR032758", "0:100 1:0", "A:952135895;C:825841753;G:821757889;T:945087927;N:39236", 100, 0, null, null, 952135895, 825841753, 821757889, 945087927, 39236, "DRX029564", "DRS049963", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.92229, null, 0.08344, null, 0.68525, null, 0.466, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Undetermined", "Embryo", "Whole Organism", "All anatomical structures"], [67, "DRR032757", "DRX029563", "DRS049962", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 97 individuals", "Dr bud 2", "SAMD00028154", null, "sample name:Dr bud 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:bud|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028154", "DRX029563", "Dr bud 2", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028154", null, null, null, 4104778200.0, 41047782.0, "DRR032757", "0:100 1:0", "A:1116316188;C:944738800;G:936257056;T:1107423486;N:42670", 100, 0, null, null, 1116316188, 944738800, 936257056, 1107423486, 42670, "DRX029563", "DRS049962", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.92945, null, 0.10493, null, 0.73407, null, 0.47824, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Undetermined", "Embryo", "Whole Organism", "All anatomical structures"], [68, "DRR032756", "DRX029562", "DRS049961", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 100 individuals", "Dr bud 1", "SAMD00028153", null, "sample name:Dr bud 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:bud|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028153", "DRX029562", "Dr bud 1", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028153", null, null, null, 4540291000.0, 45402910.0, "DRR032756", "0:100 1:0", "A:1237914068;C:1042346110;G:1033172731;T:1226799791;N:58300", 100, 0, null, null, 1237914068, 1042346110, 1033172731, 1226799791, 58300, "DRX029562", "DRS049961", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.92628, null, 0.10478, null, 0.7391, null, 0.46461, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Undetermined", "Embryo", "Whole Organism", "All anatomical structures"], [69, "DRR032755", "DRX029561", "DRS049960", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 100 individuals", "Dr 90epiboly 2", "SAMD00028152", null, "sample name:Dr 90epiboly 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:90epiboly|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028152", "DRX029561", "Dr 90epiboly 2", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028152", null, null, null, 3572358600.0, 35723586.0, "DRR032755", "0:100 1:0", "A:971653450;C:821326559;G:816855636;T:962477457;N:45498", 100, 0, null, null, 971653450, 821326559, 816855636, 962477457, 45498, "DRX029561", "DRS049960", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.92485, null, 0.10642, null, 0.74213, null, 0.47012, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Gastrula", "Embryo", "Whole Organism", "All anatomical structures"], [70, "DRR032754", "DRX029560", "DRS049959", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 100 individuals", "Dr 90epiboly 1", "SAMD00028151", null, "sample name:Dr 90epiboly 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:90epiboly|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028151", "DRX029560", "Dr 90epiboly 1", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028151", null, null, null, 3423980500.0, 34239805.0, "DRR032754", "0:100 1:0", "A:933088185;C:785251613;G:780911148;T:924686406;N:43148", 100, 0, null, null, 933088185, 785251613, 780911148, 924686406, 43148, "DRX029560", "DRS049959", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.92436, null, 0.10881, null, 0.74255, null, 0.47068, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Gastrula", "Embryo", "Whole Organism", "All anatomical structures"], [71, "DRR032753", "DRX029559", "DRS049958", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 114 individuals", "Dr 8cell 2", "SAMD00028150", null, "sample name:Dr 8cell 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:8cell|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028150", "DRX029559", "Dr 8cell 2", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028150", null, null, null, 3708921900.0, 37089219.0, "DRR032753", "0:100 1:0", "A:985502141;C:874161613;G:869551685;T:979663686;N:42775", 100, 0, null, null, 985502141, 874161613, 869551685, 979663686, 42775, "DRX029559", "DRS049958", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.93329, null, 0.02366, null, 0.78896, null, 0.47447, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Cleavage", "Embryo", "Whole Organism", "All anatomical structures"], [72, "DRR032752", "DRX029558", "DRS049957", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 96 individuals", "Dr 8cell 1", "SAMD00028149", null, "sample name:Dr 8cell 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:8cell|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028149", "DRX029558", "Dr 8cell 1", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028149", null, null, null, 3666991200.0, 36669912.0, "DRR032752", "0:100 1:0", "A:976118513;C:862559696;G:858017821;T:970254302;N:40868", 100, 0, null, null, 976118513, 862559696, 858017821, 970254302, 40868, "DRX029558", "DRS049957", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.934, null, 0.02403, null, 0.78877, null, 0.46902, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Cleavage", "Embryo", "Whole Organism", "All anatomical structures"], [73, "DRR032751", "DRX029557", "DRS049956", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 100 individuals", "Dr 75epiboly 2", "SAMD00028148", null, "sample name:Dr 75epiboly 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:75epiboly|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028148", "DRX029557", "Dr 75epiboly 2", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028148", null, null, null, 3252021500.0, 32520215.0, "DRR032751", "0:100 1:0", "A:885527595;C:746750899;G:742907892;T:876794123;N:40991", 100, 0, null, null, 885527595, 746750899, 742907892, 876794123, 40991, "DRX029557", "DRS049956", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.92594, null, 0.10181, null, 0.74862, null, 0.47789, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Gastrula", "Embryo", "Whole Organism", "All anatomical structures"], [74, "DRR032750", "DRX029556", "DRS049955", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 100 individuals", "Dr 75epiboly 1", "SAMD00028147", null, "sample name:Dr 75epiboly 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:75epiboly|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028147", "DRX029556", "Dr 75epiboly 1", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028147", null, null, null, 3785053700.0, 37850537.0, "DRR032750", "0:100 1:0", "A:1029014798;C:870946157;G:867537069;T:1017508684;N:46992", 100, 0, null, null, 1029014798, 870946157, 867537069, 1017508684, 46992, "DRX029556", "DRS049955", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.92346, null, 0.10046, null, 0.74921, null, 0.47295, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Gastrula", "Embryo", "Whole Organism", "All anatomical structures"], [75, "DRR032749", "DRX029555", "DRS049954", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 50 individuals", "Dr 72h 2", "SAMD00028146", null, "sample name:Dr 72h 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:72h Protruding mouth|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028146", "DRX029555", "Dr 72h 2", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028146", null, null, null, 3429795800.0, 34297958.0, "DRR032749", "0:100 1:0", "A:928062015;C:792470305;G:786930881;T:922296289;N:36310", 100, 0, null, null, 928062015, 792470305, 786930881, 922296289, 36310, "DRX029555", "DRS049954", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.91821, null, 0.09774, null, 0.65437, null, 0.46443, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [76, "DRR032748", "DRX029554", "DRS049953", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 50 individuals", "Dr 72h 1", "SAMD00028145", null, "sample name:Dr 72h 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:72h Protruding mouth|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028145", "DRX029554", "Dr 72h 1", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028145", null, null, null, 3897194500.0, 38971945.0, "DRR032748", "0:100 1:0", "A:1050989414;C:903225496;G:895783177;T:1047153493;N:42920", 100, 0, null, null, 1050989414, 903225496, 895783177, 1047153493, 42920, "DRX029554", "DRS049953", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.92211, null, 0.09393, null, 0.65486, null, 0.45971, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [77, "DRR032747", "DRX029553", "DRS049952", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 50 individuals", "Dr 6somite 2", "SAMD00028144", null, "sample name:Dr 6somite 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:6somite|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028144", "DRX029553", "Dr 6somite 2", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028144", null, null, null, 3704431000.0, 37044310.0, "DRR032747", "0:100 1:0", "A:1001844161;C:856702913;G:850695568;T:995148798;N:39560", 100, 0, null, null, 1001844161, 856702913, 850695568, 995148798, 39560, "DRX029553", "DRS049952", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.92633, null, 0.09211, null, 0.72107, null, 0.47195, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Segmentation", "Embryo", "Whole Organism", "All anatomical structures"], [78, "DRR032746", "DRX029552", "DRS049951", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 50 individuals", "Dr 6somite 1", "SAMD00028143", null, "sample name:Dr 6somite 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:6somite|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028143", "DRX029552", "Dr 6somite 1", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028143", null, null, null, 3529311900.0, 35293119.0, "DRR032746", "0:100 1:0", "A:953957996;C:816824469;G:811403696;T:947089530;N:36209", 100, 0, null, null, 953957996, 816824469, 811403696, 947089530, 36209, "DRX029552", "DRS049951", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.92437, null, 0.09257, null, 0.72113, null, 0.47004, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Segmentation", "Embryo", "Whole Organism", "All anatomical structures"], [79, "DRR032745", "DRX029551", "DRS049950", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 50 individuals", "Dr 60h 2", "SAMD00028142", null, "sample name:Dr 60h 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:60h Pec fin|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028142", "DRX029551", "Dr 60h 2", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028142", null, null, null, 3875337000.0, 38753370.0, "DRR032745", "0:100 1:0", "A:1042558903;C:899892111;G:896867583;T:1035981420;N:36983", 100, 0, null, null, 1042558903, 899892111, 896867583, 1035981420, 36983, "DRX029551", "DRS049950", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.91891, null, 0.09445, null, 0.66156, null, 0.45564, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Hatching", "Embryo", "Whole Organism", "All anatomical structures"], [80, "DRR032744", "DRX029550", "DRS049949", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 50 individuals", "Dr 60h 1", "SAMD00028141", null, "sample name:Dr 60h 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:60h Pec fin|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028141", "DRX029550", "Dr 60h 1", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028141", null, null, null, 3538468200.0, 35384682.0, "DRR032744", "0:100 1:0", "A:960664313;C:812459988;G:809014008;T:956295205;N:34686", 100, 0, null, null, 960664313, 812459988, 809014008, 956295205, 34686, "DRX029550", "DRS049949", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.91388, null, 0.10346, null, 0.66076, null, 0.45203, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Hatching", "Embryo", "Whole Organism", "All anatomical structures"], [81, "DRR032743", "DRX029549", "DRS049948", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 50 individuals", "Dr 5day 3", "SAMD00028140", null, "sample name:Dr 5day 3|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:5day|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028140", "DRX029549", "Dr 5day 3", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028140", null, null, null, 3884716000.0, 38847160.0, "DRR032743", "0:100 1:0", "A:1040550584;C:905663425;G:904247323;T:1034215019;N:39649", 100, 0, null, null, 1040550584, 905663425, 904247323, 1034215019, 39649, "DRX029549", "DRS049948", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.92219, null, 0.08287, null, 0.65863, null, 0.47377, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [82, "DRR032742", "DRX029548", "DRS049947", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 50 individuals", "Dr 5day 2", "SAMD00028139", null, "sample name:Dr 5day 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:5day|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028139", "DRX029548", "Dr 5day 2", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028139", null, null, null, 3893708700.0, 38937087.0, "DRR032742", "0:100 1:0", "A:1050850168;C:899863467;G:897224776;T:1045729184;N:41105", 100, 0, null, null, 1050850168, 899863467, 897224776, 1045729184, 41105, "DRX029548", "DRS049947", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.91671, null, 0.0991, null, 0.65161, null, 0.47454, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [83, "DRR032741", "DRX029547", "DRS049946", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 50 individuals", "Dr 5day 1", "SAMD00028138", null, "sample name:Dr 5day 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:5day|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028138", "DRX029547", "Dr 5day 1", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028138", null, null, null, 3807570600.0, 38075706.0, "DRR032741", "0:100 1:0", "A:1022590228;C:884655401;G:882546091;T:1017737883;N:40997", 100, 0, null, null, 1022590228, 884655401, 882546091, 1017737883, 40997, "DRX029547", "DRS049946", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.9182, null, 0.09442, null, 0.65525, null, 0.46661, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [84, "DRR032740", "DRX029546", "DRS049945", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 50 individuals", "Dr 48h 2", "SAMD00028137", null, "sample name:Dr 48h 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:48h Long pec|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028137", "DRX029546", "Dr 48h 2", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028137", null, null, null, 3702804700.0, 37028047.0, "DRR032740", "0:100 1:0", "A:993931475;C:862403562;G:857808891;T:988623734;N:37038", 100, 0, null, null, 993931475, 862403562, 857808891, 988623734, 37038, "DRX029546", "DRS049945", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.92508, null, 0.08526, null, 0.68349, null, 0.45769, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Hatching", "Embryo", "Whole Organism", "All anatomical structures"], [85, "DRR032739", "DRX029545", "DRS049944", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 50 individuals", "Dr 48h 1", "SAMD00028136", null, "sample name:Dr 48h 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:48h Long pec|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028136", "DRX029545", "Dr 48h 1", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028136", null, null, null, 3980240400.0, 39802404.0, "DRR032739", "0:100 1:0", "A:1070497788;C:925240883;G:920038728;T:1064422474;N:40527", 100, 0, null, null, 1070497788, 925240883, 920038728, 1064422474, 40527, "DRX029545", "DRS049944", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.92349, null, 0.08681, null, 0.67874, null, 0.46565, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Hatching", "Embryo", "Whole Organism", "All anatomical structures"], [86, "DRR032738", "DRX029544", "DRS049943", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 100 individuals", "Dr 32cell 2", "SAMD00028135", null, "sample name:Dr 32cell 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:32cell|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028135", "DRX029544", "Dr 32cell 2", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028135", null, null, null, 3678713000.0, 36787130.0, "DRR032738", "0:100 1:0", "A:981005900;C:863203049;G:859660640;T:974807835;N:35576", 100, 0, null, null, 981005900, 863203049, 859660640, 974807835, 35576, "DRX029544", "DRS049943", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.93302, null, 0.02468, null, 0.77441, null, 0.47485, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Cleavage", "Embryo", "Whole Organism", "All anatomical structures"], [87, "DRR032737", "DRX029543", "DRS049942", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 95 individuals", "Dr 32cell 1", "SAMD00028134", null, "sample name:Dr 32cell 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:32cell|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028134", "DRX029543", "Dr 32cell 1", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028134", null, null, null, 3870906500.0, 38709065.0, "DRR032737", "0:100 1:0", "A:1030407751;C:909948718;G:905608620;T:1024897443;N:43968", 100, 0, null, null, 1030407751, 909948718, 905608620, 1024897443, 43968, "DRX029543", "DRS049942", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.93364, null, 0.02484, null, 0.77307, null, 0.47588, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Cleavage", "Embryo", "Whole Organism", "All anatomical structures"], [88, "DRR032736", "DRX029542", "DRS049941", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 100 individuals", "Dr zfs:0000015 2", "SAMD00028133", null, "sample name:Dr zfs:0000015 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:zfs:0000015|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028133", "DRX029542", "Dr zfs:0000015 2", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028133", null, null, null, 3129028500.0, 31290285.0, "DRR032736", "0:100 1:0", "A:849515903;C:721550282;G:717777586;T:840154982;N:29747", 100, 0, null, null, 849515903, 721550282, 717777586, 840154982, 29747, "DRX029542", "DRS049941", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.92724, null, 0.07971, null, 0.74657, null, 0.47796, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Blastula", "Embryo", "Whole Organism", "All anatomical structures"], [89, "DRR032735", "DRX029541", "DRS049940", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 100 individuals", "Dr zfs:0000015 1", "SAMD00028132", null, "sample name:Dr zfs:0000015 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:zfs:0000015|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028132", "DRX029541", "Dr zfs:0000015 1", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028132", null, null, null, 4310219700.0, 43102197.0, "DRR032735", "0:100 1:0", "A:1169701983;C:993241399;G:986263558;T:1160969083;N:43677", 100, 0, null, null, 1169701983, 993241399, 986263558, 1160969083, 43677, "DRX029541", "DRS049940", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.92609, null, 0.07773, null, 0.74349, null, 0.47849, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Blastula", "Embryo", "Whole Organism", "All anatomical structures"], [90, "DRR032734", "DRX029540", "DRS049939", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 107 individuals", "Dr 2cell 2", "SAMD00028131", null, "sample name:Dr 2cell 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:2cell|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028131", "DRX029540", "Dr 2cell 2", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028131", null, null, null, 3687517000.0, 36875170.0, "DRR032734", "0:100 1:0", "A:975272080;C:873518282;G:869743434;T:968941851;N:41353", 100, 0, null, null, 975272080, 873518282, 869743434, 968941851, 41353, "DRX029540", "DRS049939", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.93204, null, 0.02088, null, 0.81639, null, 0.47553, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Cleavage", "Embryo", "Whole Organism", "All anatomical structures"], [91, "DRR032733", "DRX029539", "DRS049938", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 108 individuals", "Dr 2cell 1", "SAMD00028130", null, "sample name:Dr 2cell 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:2cell|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028130", "DRX029539", "Dr 2cell 1", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028130", null, null, null, 4156651100.0, 41566511.0, "DRR032733", "0:100 1:0", "A:1099943617;C:985498415;G:978884426;T:1092278665;N:45977", 100, 0, null, null, 1099943617, 985498415, 978884426, 1092278665, 45977, "DRX029539", "DRS049938", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.93452, null, 0.02198, null, 0.81197, null, 0.47342, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Cleavage", "Embryo", "Whole Organism", "All anatomical structures"], [92, "DRR032732", "DRX029538", "DRS049937", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 80 individuals", "Dr 14somite 3", "SAMD00028129", null, "sample name:Dr 14somite 3|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:14somite|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028129", "DRX029538", "Dr 14somite 3", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028129", null, null, null, 3734610500.0, 37346105.0, "DRR032732", "0:100 1:0", "A:1009418541;C:863710067;G:858061383;T:1003378800;N:41709", 100, 0, null, null, 1009418541, 863710067, 858061383, 1003378800, 41709, "DRX029538", "DRS049937", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.92401, null, 0.08815, null, 0.70816, null, 0.46602, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Segmentation", "Embryo", "Whole Organism", "All anatomical structures"], [93, "DRR032731", "DRX029537", "DRS049936", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 80 individuals", "Dr 14somite 2", "SAMD00028128", null, "sample name:Dr 14somite 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:14somite|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028128", "DRX029537", "Dr 14somite 2", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028128", null, null, null, 3715174200.0, 37151742.0, "DRR032731", "0:100 1:0", "A:1000703508;C:862290629;G:858173468;T:993968396;N:38199", 100, 0, null, null, 1000703508, 862290629, 858173468, 993968396, 38199, "DRX029537", "DRS049936", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.92491, null, 0.0819, null, 0.71068, null, 0.46957, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Segmentation", "Embryo", "Whole Organism", "All anatomical structures"], [94, "DRR032730", "DRX029536", "DRS049935", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 80 individuals", "Dr 14somite 1", "SAMD00028127", null, "sample name:Dr 14somite 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:14somite|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028127", "DRX029536", "Dr 14somite 1", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028127", null, null, null, 3744386000.0, 37443860.0, "DRR032730", "0:100 1:0", "A:1014537326;C:864070910;G:859190201;T:1006549502;N:38061", 100, 0, null, null, 1014537326, 864070910, 859190201, 1006549502, 38061, "DRX029536", "DRS049935", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.92378, null, 0.08957, null, 0.7068, null, 0.47493, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Segmentation", "Embryo", "Whole Organism", "All anatomical structures"], [7946, "ERR015563", "ERX005934", "ERS012707", "ERP000263", "PRJEB2208", "Zebrafish gene three prime end pull down for genome annotation", "E-MTAB-308", "Transcriptome Analysis", null, null, null, null, "E MTAB 308:Zebrafish embryo 2 dpf 2", "SAMEA898403", "Wellcome Sanger Institute", "Age:2 days|Alias:E MTAB 308:Zebrafish embryo 2 dpf 2|Broker name:ArrayExpress|Description:Protocols: Zebrafish embyos or tissues were collected from a Tuebingen strain incross and grown at 28 C. Collected samples were snap frozen on dry ice and stored at  70 C Total RNA was extracted using Trizol Reagent Invitrogen following the manufacturer's instructions. Pellets were resuspended RNase free 10 mM Tris pH 7.5 and the RNA was quantified using a NanoDrop ND 1000 Spectrophotometer Axon Instruments.|DevelopmentalStage:embryo|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2010 08 19T15:57:35Z|INSDC last update:2018 03 08T15:25:04Z|INSDC status:public|InitialTimePoint:fertilization|OrganismPart:whole organism|SRA accession:ERS012707|Sample Name:ERS012707|Sex:unknown sex|StrainOrLine:Tuebingen|Title:Danio rerio", null, null, null, null, null, null, null, null, "Illumina Genome Analyzer II paired end sequencing; Zebrafish gene 3 prime end pull down for genome annotation", "E MTAB 308:Illumina Genome Analyzer II sequencing of Zebrafish embryo 2 dpf three prime pull down paired end 250 to 300 bp insert", "Zebrafish embro 2 dpf mRNA three prime end", "Zebrafish gene three prime end pull down for genome annotation", "20 ug of total RNA was fragmented using RNA Fragmentation Reagent Ambion for 5 minutes at 70 C and ethanol precipitated with glycogen and LiCl.   RNA was annealed to the oligo stBPM1polyT22 biotin GGCCAGTCCTGGAGTTTTTTTTTTTTTTTTTTTTTTVN and bound to streptavidin  magnetic beads.   post washing by pull down on a magnet  the bound RNA was reverse transcribed with SuperScript II Invitrogen and a second strand synthesised with DNA polymerase I Promega and RNase H NEB.   post further washing  the double strand cDNA was released from the beads with BpmI NEB.   The cDNA was recovered with the QIAgen PCR Purification Kit and made into a standard Illumina library following the manufacturer's protocol with a fragment size of 250 to 300 bp.", "Experimental Factor: AGE:2 d|Experimental Factor: DEVELOPMENTAL STAGE:embryo|Experimental Factor: ORGANISM PART:whole organism|Experimental Factor: SEX:unknown sex", "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina Genome Analyzer II", null, "ERP000263", "Illumina Genome Analyzer II paired end sequencing; Zebrafish gene three prime end pull down for genome annotation", "ENA FIRST PUBLIC:2010 08 19|ENA LAST UPDATE:2018 11 16", "3444_2.srf", "srf", 990308120.0, 6515185.0, "E MTAB 308:Illumina Genome Analyzer II sequencing of Zebrafish embryo 2 dpf three prime pull down paired end 250 to 300 bp insert", "0:76 1:76", "A:279665076;C:200433201;G:189692111;T:304366697;N:16151035", 76, 76, null, null, 279665076, 200433201, 189692111, 304366697, 16151035, "ERX005934", "ERS012707", "ERA010603", "SC|Wellcome Trust Sanger Institute", "SC|Wellcome Trust Sanger Institute", 2, 0.93964, 0.94008, 0.40095, 0.39969, 0.74424, 0.74915, 0.49535, 0.49761, 76, 76, "B", "B", "biological fallback assumption", "illumina", "early_illumina", "3prime", "other", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2010-08-19", "Hatching", "Embryo", "Whole Organism", "All anatomical structures"], [7947, "ERR015564", "ERX005933", "ERS012706", "ERP000263", "PRJEB2208", "Zebrafish gene three prime end pull down for genome annotation", "E-MTAB-308", "Transcriptome Analysis", null, null, null, null, "E MTAB 308:Zebrafish embryo 3 dpf 2", "SAMEA898404", "Wellcome Sanger Institute", "Age:3 days|Alias:E MTAB 308:Zebrafish embryo 3 dpf 2|Broker name:ArrayExpress|Description:Protocols: Zebrafish embyos or tissues were collected from a Tuebingen strain incross and grown at 28 C. Collected samples were snap frozen on dry ice and stored at  70 C Total RNA was extracted using Trizol Reagent Invitrogen following the manufacturer's instructions. Pellets were resuspended RNase free 10 mM Tris pH 7.5 and the RNA was quantified using a NanoDrop ND 1000 Spectrophotometer Axon Instruments.|DevelopmentalStage:embryo|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2010 08 19T15:57:35Z|INSDC last update:2018 03 08T15:25:04Z|INSDC status:public|InitialTimePoint:fertilization|OrganismPart:whole organism|SRA accession:ERS012706|Sample Name:ERS012706|Sex:unknown sex|StrainOrLine:Tuebingen|Title:Danio rerio", null, null, null, null, null, null, null, null, "Illumina Genome Analyzer II paired end sequencing; Zebrafish gene 3 prime end pull down for genome annotation", "E MTAB 308:Illumina Genome Analyzer II sequencing of Zebrafish embryo 3 dpf three prime pull down paired end 250 to 300 bp insert", "Zebrafish embro 3 dpf mRNA three prime end", "Zebrafish gene three prime end pull down for genome annotation", "20 ug of total RNA was fragmented using RNA Fragmentation Reagent Ambion for 5 minutes at 70 C and ethanol precipitated with glycogen and LiCl.   RNA was annealed to the oligo stBPM1polyT22 biotin GGCCAGTCCTGGAGTTTTTTTTTTTTTTTTTTTTTTVN and bound to streptavidin  magnetic beads.   post washing by pull down on a magnet  the bound RNA was reverse transcribed with SuperScript II Invitrogen and a second strand synthesised with DNA polymerase I Promega and RNase H NEB.   post further washing  the double strand cDNA was released from the beads with BpmI NEB.   The cDNA was recovered with the QIAgen PCR Purification Kit and made into a standard Illumina library following the manufacturer's protocol with a fragment size of 250 to 300 bp.", "Experimental Factor: AGE:3 d|Experimental Factor: DEVELOPMENTAL STAGE:embryo|Experimental Factor: ORGANISM PART:whole organism|Experimental Factor: SEX:unknown sex", "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina Genome Analyzer II", null, "ERP000263", "Illumina Genome Analyzer II paired end sequencing; Zebrafish gene three prime end pull down for genome annotation", "ENA FIRST PUBLIC:2010 08 19|ENA LAST UPDATE:2018 11 16", "3444_3.srf", "srf", 1572215648.0, 10343524.0, "E MTAB 308:Illumina Genome Analyzer II sequencing of Zebrafish embryo 3 dpf three prime pull down paired end 250 to 300 bp insert", "0:76 1:76", "A:395189954;C:374281517;G:356666372;T:420372888;N:25704917", 76, 76, null, null, 395189954, 374281517, 356666372, 420372888, 25704917, "ERX005933", "ERS012706", "ERA010603", "SC|Wellcome Trust Sanger Institute", "SC|Wellcome Trust Sanger Institute", 2, 0.96337, 0.96626, 0.12558, 0.12974, 0.7824, 0.79086, 0.40731, 0.41802, 76, 76, "B", "B", "biological fallback assumption", "illumina", "early_illumina", "3prime", "other", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2010-08-19", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [7948, "ERR015562", "ERX005932", "ERS012705", "ERP000263", "PRJEB2208", "Zebrafish gene three prime end pull down for genome annotation", "E-MTAB-308", "Transcriptome Analysis", null, null, null, null, "E MTAB 308:Zebrafish embryo 1 dpf 2", "SAMEA898401", "Wellcome Sanger Institute", "Age:1 days|Alias:E MTAB 308:Zebrafish embryo 1 dpf 2|Broker name:ArrayExpress|Description:Protocols: Zebrafish embyos or tissues were collected from a Tuebingen strain incross and grown at 28 C. Collected samples were snap frozen on dry ice and stored at  70 C Total RNA was extracted using Trizol Reagent Invitrogen following the manufacturer's instructions. Pellets were resuspended RNase free 10 mM Tris pH 7.5 and the RNA was quantified using a NanoDrop ND 1000 Spectrophotometer Axon Instruments.|DevelopmentalStage:embryo|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2010 08 19T15:57:35Z|INSDC last update:2018 03 08T15:25:04Z|INSDC status:public|InitialTimePoint:fertilization|OrganismPart:whole organism|SRA accession:ERS012705|Sample Name:ERS012705|Sex:unknown sex|StrainOrLine:Tuebingen|Title:Danio rerio", null, null, null, null, null, null, null, null, "Illumina Genome Analyzer II paired end sequencing; Zebrafish gene 3 prime end pull down for genome annotation", "E MTAB 308:Illumina Genome Analyzer II sequencing of Zebrafish embryo 1 dpf three prime pull down paired end 250 to 300 bp insert", "Zebrafish embro 1 dpf mRNA three prime end", "Zebrafish gene three prime end pull down for genome annotation", "20 ug of total RNA was fragmented using RNA Fragmentation Reagent Ambion for 5 minutes at 70 C and ethanol precipitated with glycogen and LiCl.   RNA was annealed to the oligo stBPM1polyT22 biotin GGCCAGTCCTGGAGTTTTTTTTTTTTTTTTTTTTTTVN and bound to streptavidin  magnetic beads.   post washing by pull down on a magnet  the bound RNA was reverse transcribed with SuperScript II Invitrogen and a second strand synthesised with DNA polymerase I Promega and RNase H NEB.   post further washing  the double strand cDNA was released from the beads with BpmI NEB.   The cDNA was recovered with the QIAgen PCR Purification Kit and made into a standard Illumina library following the manufacturer's protocol with a fragment size of 250 to 300 bp.", "Experimental Factor: AGE:1 d|Experimental Factor: DEVELOPMENTAL STAGE:embryo|Experimental Factor: ORGANISM PART:whole organism|Experimental Factor: SEX:unknown sex", "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina Genome Analyzer II", null, "ERP000263", "Illumina Genome Analyzer II paired end sequencing; Zebrafish gene three prime end pull down for genome annotation", "ENA FIRST PUBLIC:2010 08 19|ENA LAST UPDATE:2018 11 16", "3444_1.srf", "srf", 1358041568.0, 8934484.0, "E MTAB 308:Illumina Genome Analyzer II sequencing of Zebrafish embryo 1 dpf three prime pull down paired end 250 to 300 bp insert", "0:76 1:76", "A:376045982;C:281568469;G:271365867;T:407279179;N:21782071", 76, 76, null, null, 376045982, 281568469, 271365867, 407279179, 21782071, "ERX005932", "ERS012705", "ERA010603", "SC|Wellcome Trust Sanger Institute", "SC|Wellcome Trust Sanger Institute", 2, 0.94607, 0.94542, 0.3002, 0.30139, 0.73584, 0.74038, 0.51058, 0.51233, 76, 76, "B", "B", "biological fallback assumption", "illumina", "early_illumina", "3prime", "other", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2010-08-19", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [7951, "ERR015565", "ERX005929", "ERS012704", "ERP000263", "PRJEB2208", "Zebrafish gene three prime end pull down for genome annotation", "E-MTAB-308", "Transcriptome Analysis", null, null, null, null, "E MTAB 308:Zebrafish embryo 5 dpf 2", "SAMEA980815", "SC", "Age:5 days|Alias:E MTAB 308:Zebrafish embryo 5 dpf 2|Broker name:ArrayExpress|Description:Protocols: Zebrafish embyos or tissues were collected from a Tuebingen strain incross and grown at 28 C. Collected samples were snap frozen on dry ice and stored at  70 C Total RNA was extracted using Trizol Reagent Invitrogen following the manufacturer's instructions. Pellets were resuspended RNase free 10 mM Tris pH 7.5 and the RNA was quantified using a NanoDrop ND 1000 Spectrophotometer Axon Instruments.|DevelopmentalStage:embryo|INSDC center name:SC|INSDC first public:2010 08 19T15:57:35Z|INSDC last update:2018 03 08T15:25:04Z|INSDC status:public|InitialTimePoint:fertilization|OrganismPart:whole organism|SRA accession:ERS012704|Sample Name:ERS012704|Sex:unknown sex|StrainOrLine:Tuebingen|Title:Danio rerio", null, null, null, null, null, null, null, null, "Illumina Genome Analyzer II paired end sequencing; Zebrafish gene 3 prime end pull down for genome annotation", "E MTAB 308:Illumina Genome Analyzer II sequencing of Zebrafish embryo 5 dpf three prime pull down paired end 250 to 300 bp insert", "Zebrafish embro 5 dpf mRNA three prime end", "Zebrafish gene three prime end pull down for genome annotation", "20 ug of total RNA was fragmented using RNA Fragmentation Reagent Ambion for 5 minutes at 70 C and ethanol precipitated with glycogen and LiCl.   RNA was annealed to the oligo stBPM1polyT22 biotin GGCCAGTCCTGGAGTTTTTTTTTTTTTTTTTTTTTTVN and bound to streptavidin  magnetic beads.   post washing by pull down on a magnet  the bound RNA was reverse transcribed with SuperScript II Invitrogen and a second strand synthesised with DNA polymerase I Promega and RNase H NEB.   post further washing  the double strand cDNA was released from the beads with BpmI NEB.   The cDNA was recovered with the QIAgen PCR Purification Kit and made into a standard Illumina library following the manufacturer's protocol with a fragment size of 250 to 300 bp.", "Experimental Factor: AGE:5 d|Experimental Factor: DEVELOPMENTAL STAGE:embryo|Experimental Factor: ORGANISM PART:whole organism|Experimental Factor: SEX:unknown sex", "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina Genome Analyzer II", null, "ERP000263", "Illumina Genome Analyzer II paired end sequencing; Zebrafish gene three prime end pull down for genome annotation", "ENA FIRST PUBLIC:2010 08 19|ENA LAST UPDATE:2018 11 16", "3444_5.srf", "srf", 1399629832.0, 9208091.0, "E MTAB 308:Illumina Genome Analyzer II sequencing of Zebrafish embryo 5 dpf three prime pull down paired end 250 to 300 bp insert", "0:76 1:76", "A:389123080;C:293319124;G:279736391;T:414876632;N:22574605", 76, 76, null, null, 389123080, 293319124, 279736391, 414876632, 22574605, "ERX005929", "ERS012704", "ERA010603", "SC|Wellcome Trust Sanger Institute", "SC|Wellcome Trust Sanger Institute", 2, 0.92999, 0.9332, 0.45309, 0.46162, 0.72419, 0.73919, 0.49892, 0.50512, 76, 76, "B", "B", "biological fallback assumption", "illumina", "early_illumina", "3prime", "other", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2010-08-19", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [7952, "ERR015568", "ERX005928", "ERS000087", "ERP000263", "PRJEB2208", "Zebrafish gene three prime end pull down for genome annotation", "E-MTAB-308", "Transcriptome Analysis", null, null, null, null, "ZF male sample1", "SAMEA708829", "Wellcome Sanger Institute", "Alias:ZF male sample1|Description:RNA extracted from whole male adult zebrafish without xxx|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2010 02 26T10:44:13Z|INSDC last update:2018 03 08T15:24:37Z|INSDC status:public|SRA accession:ERS000087|Sample Name:ERS000087|Sex:male|Strain:Tuebingen|Title:Danio rerio", null, null, null, null, null, null, null, null, "Illumina Genome Analyzer II paired end sequencing; Zebrafish gene 3 prime end pull down for genome annotation", "E MTAB 308:Illumina Genome Analyzer II sequencing of adult Zebrafish male body dpf three prime pull down paired end 250 to 300 bp insert", "Zebrafish adult male body mRNA three prime end", "Zebrafish gene three prime end pull down for genome annotation", "20 ug of total RNA was fragmented using RNA Fragmentation Reagent Ambion for 5 minutes at 70 C and ethanol precipitated with glycogen and LiCl.   RNA was annealed to the oligo stBPM1polyT22 biotin GGCCAGTCCTGGAGTTTTTTTTTTTTTTTTTTTTTTVN and bound to streptavidin  magnetic beads.   post washing by pull down on a magnet  the bound RNA was reverse transcribed with SuperScript II Invitrogen and a second strand synthesised with DNA polymerase I Promega and RNase H NEB.   post further washing  the double strand cDNA was released from the beads with BpmI NEB.   The cDNA was recovered with the QIAgen PCR Purification Kit and made into a standard Illumina library following the manufacturer's protocol with a fragment size of 250 to 300 bp.", "Experimental Factor: DEVELOPMENTAL STAGE:adult|Experimental Factor: ORGANISM PART:whole fish without xxx|Experimental Factor: SEX:male", "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina Genome Analyzer II", null, "ERP000263", "Illumina Genome Analyzer II paired end sequencing; Zebrafish gene three prime end pull down for genome annotation", "ENA FIRST PUBLIC:2010 08 19|ENA LAST UPDATE:2018 11 16", "3444_8.srf", "srf", 1012667320.0, 6662285.0, "E MTAB 308:Illumina Genome Analyzer II sequencing of adult Zebrafish male body dpf three prime pull down paired end 250 to 300 bp insert", "0:76 1:76", "A:262408681;C:234183204;G:228254982;T:271015871;N:16804582", 76, 76, null, null, 262408681, 234183204, 228254982, 271015871, 16804582, "ERX005928", "ERS000087", "ERA010603", "SC|Wellcome Trust Sanger Institute", "SC|Wellcome Trust Sanger Institute", 2, 0.95123, 0.96116, 0.23163, 0.22276, 0.77847, 0.78648, 0.42301, 0.43528, 76, 76, "B", "B", "biological fallback assumption", "illumina", "early_illumina", "3prime", "other", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2010-02-26", "Adult", "Adult", "Whole Organism", "All anatomical structures"], [36265, "SRR058073", "SRX022206", "SRS084221", "SRP002640", "PRJNA128943", "Expanding the MicroRNA Targeting Code:  A Novel Type of Site with Centered Pairing", "GSE22068", "Other", "We present \u201ccentered sites \u201d a class of microRNA target sites that lacks both perfect seed pairing and three prime compensatory pairing and instead has 11\u201312 contiguous Watson\u2013Crick pairs to the center of the microRNA.  In elevated Mg2+  centered sites impart mRNA cleavage  but in cells  centered sites repress protein output without xxx Agronaute catalyzed cleavage.  Our study also identified novel extensively paired sites that are cleavage substrates in cultured cells and human brain.  This expanded repertoire of cleavage targets and the identification of the centered site type help explain why central regions of many microRNAs are evolutionarily conserved. Overall design: To study centered sites and identify miRNA cleavage targets  mRNA degradomes were sequenced from human brain and HeLa cells  and smallRNAs were sequenced from human brain and zebrafish embryo at 24 hpf. Replicates were combined before the analysis. Fastq files are not available for GSM548638 and GSM548639.", null, "pubmed:20620952", null, "Zebrafish Embryo small RNAs", "GSM548640", null, "source name:Embryo Cells|data type:small RNAs|tissue:embryo", "Zebrafish Embryo small RNAs", "Small RNA sequences from same total RNA samples were mapped to the human genome hg18  requiring a perfect match  and reads co localizing to annotated miRNA loci miRBase  version 11.0 were counted. sequence reads are summarized as frequency counts", "Embryo Cells", null, "The small RNA cDNA libraries were made as described Grimson et al. 2008  except for the three prime adaptor ligation  which was five prime adenylated pTCGTATGCCGTCTTCTGCTTGidT. For a detailed protocol  see http://web.wi.mit.edu/bartel/pub/protocols.html.", null, "data type:small RNAs|tissue:embryo", "GSM548640", "GSM548640: Zebrafish Embryo small RNAs", "GSM548640: Zebrafish Embryo small RNAs", "GSM548640: Zebrafish Embryo small RNAs", "1", null, "GEO Accession:GSM548640", "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP002640", null, "quality book char:@|quality scoring system:log odds", "Zebrafish_embryo_24h.fastq", "fastq", 62213148.0, 1728143.0, "GSM548640 1", "0:36", "A:13550515;C:14269249;G:15670049;T:18673533;N:49802", 36, null, null, null, 13550515, 14269249, 15670049, 18673533, 49802, "SRX022206", "SRS084221", "SRA020539", "GEO", "Bartel lab, Whitehead Institute", 1, 0.02298, null, 0.02186, null, 0.9988, null, 0.3246, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United States", "2010-06-01", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [40214, "SRR2982513", "SRX1471725", "SRS1197481", "SRP067139", "PRJNA305418", "RiboZero mRNA seq across zebrafish development  for study of uORFs", "PRJNA305418", "Other", "Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs  the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing  we find that i uORFs are pervasive within vertebrate transcriptomes  ii the majority show signatures of active translation  and iii uORFs act as potent regulators of translation and RNA levels  with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally  we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values.", null, null, null, "48hpf", "AG00751 mrna r0 48h", null, "strain:TUAB|age:48hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "AG00751 mrna r0 48h", "48h mRNA R0", "1", "Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al  2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific  single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ  single end  75nt reads", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP067139", null, null, "AG00751_SEQ0112_R1.fastq.gz", "fastq", 1859082512.0, 24461612.0, "48h mRNA R0 run1", "0:76", "A:488142494;C:422062452;G:411293722;T:537489879;N:93965", 76, null, null, null, 488142494, 422062452, 411293722, 537489879, 93965, "SRX1471725", "SRS1197481", "SRA314809", "Yale University|Giraldez Lab", "Yale University", 1, 0.8583, null, 0.37297, null, 0.6956, null, 0.46541, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "rrna_depletion", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2015-12-08", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [40215, "SRR2982514", "SRX1471724", "SRS1197482", "SRP067139", "PRJNA305418", "RiboZero mRNA seq across zebrafish development  for study of uORFs", "PRJNA305418", "Other", "Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs  the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing  we find that i uORFs are pervasive within vertebrate transcriptomes  ii the majority show signatures of active translation  and iii uORFs act as potent regulators of translation and RNA levels  with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally  we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values.", null, null, null, "24hpf", "AG00750 mrna r0 24h", null, "strain:TUAB|age:24hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "AG00750 mrna r0 24h", "24h mRNA R0", "1", "Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al  2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific  single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ  single end  75nt reads", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP067139", null, null, "AG00750_SEQ0114_R1.fastq.gz", "fastq", 2124277824.0, 27951024.0, "24h mRNA R0 run1", "0:76", "A:537946274;C:496576029;G:477023623;T:612576823;N:155075", 76, null, null, null, 537946274, 496576029, 477023623, 612576823, 155075, "SRX1471724", "SRS1197482", "SRA314809", "Yale University|Giraldez Lab", "Yale University", 1, 0.86054, null, 0.27207, null, 0.69877, null, 0.47063, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "rrna_depletion", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2015-12-08", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [40216, "SRR2982511", "SRX1471723", "SRS1197479", "SRP067139", "PRJNA305418", "RiboZero mRNA seq across zebrafish development  for study of uORFs", "PRJNA305418", "Other", "Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs  the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing  we find that i uORFs are pervasive within vertebrate transcriptomes  ii the majority show signatures of active translation  and iii uORFs act as potent regulators of translation and RNA levels  with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally  we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values.", null, null, null, "12hpf", "AG00434 mrna r0 12h", null, "strain:TUAB|age:12hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "AG00434 mrna r0 12h", "12h mRNA R0", "1", "Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al  2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific  single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ  single end  75nt reads", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP067139", null, null, "AG00434_SEQ0071_R1.fastq.gz", "fastq", 1990422368.0, 26189768.0, "12h mRNA R0 run1", "0:76", "A:512242204;C:469314942;G:452176134;T:556618667;N:70421", 76, null, null, null, 512242204, 469314942, 452176134, 556618667, 70421, "SRX1471723", "SRS1197479", "SRA314809", "Yale University|Giraldez Lab", "Yale University", 1, 0.88085, null, 0.297, null, 0.71711, null, 0.46053, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "rrna_depletion", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2015-12-08", "Segmentation", "Embryo", "Embryo Imprecise", "All anatomical structures"], [40217, "SRR2982512", "SRX1471722", "SRS1197480", "SRP067139", "PRJNA305418", "RiboZero mRNA seq across zebrafish development  for study of uORFs", "PRJNA305418", "Other", "Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs  the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing  we find that i uORFs are pervasive within vertebrate transcriptomes  ii the majority show signatures of active translation  and iii uORFs act as potent regulators of translation and RNA levels  with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally  we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values.", null, null, null, "5hpf", "AG00749 mrna r0 5h", null, "strain:TUAB|age:5hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "AG00749 mrna r0 5h", "5h mRNA R0", "1", "Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al  2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific  single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ  single end  75nt reads", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP067139", null, null, "AG00749_SEQ0114_R1.fastq.gz", "fastq", 3163721996.0, 41627921.0, "5h mRNA R0 run1", "0:76", "A:724093110;C:806620205;G:798759186;T:834042462;N:207033", 76, null, null, null, 724093110, 806620205, 798759186, 834042462, 207033, "SRX1471722", "SRS1197480", "SRA314809", "Yale University|Giraldez Lab", "Yale University", 1, 0.75274, null, 0.23572, null, 0.75448, null, 0.47885, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "rrna_depletion", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2015-12-08", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [40218, "SRR2982510", "SRX1471511", "SRS1197399", "SRP067139", "PRJNA305418", "RiboZero mRNA seq across zebrafish development  for study of uORFs", "PRJNA305418", "Other", "Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs  the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing  we find that i uORFs are pervasive within vertebrate transcriptomes  ii the majority show signatures of active translation  and iii uORFs act as potent regulators of translation and RNA levels  with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally  we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values.", null, null, null, "2hpf", "AG00244 mrna r0 2h", null, "strain:TUAB|age:2hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "AG00244 mrna r0 2h", "2h mRNA R0", "1", "Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al  2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific  single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ  single end  75nt reads", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP067139", null, null, "AG00244_SEQ0039_R1.fastq.gz", "fastq", 1010085524.0, 13290599.0, "2h mRNA R0 run1", "0:76", "A:196715560;C:309406513;G:286228000;T:217670217;N:65234", 76, null, null, null, 196715560, 309406513, 286228000, 217670217, 65234, "SRX1471511", "SRS1197399", "SRA314809", "Yale University|Giraldez Lab", "Yale University", 1, 0.89974, null, 0.14215, null, 0.79488, null, 0.72171, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "rrna_depletion", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2015-12-08", "Cleavage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43402, "SRR5931544", "SRX3091819", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "with difenoconazole", "397969", "397969", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4755826950.0, 31705513.0, "D 500 1 2.fq.gz", "0:0 1:150", "A:1274207449;C:1094727902;G:1122524378;T:1264331427;N:35794", 0, 150, null, null, 1274207449, 1094727902, 1122524378, 1264331427, 35794, "SRX3091819", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.91191, null, 0.10926, null, 0.68341, null, 0.47196, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43403, "SRR5931545", "SRX3091818", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "with difenoconazole", "397968", "397968", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4755826950.0, 31705513.0, "D 500 1 1.fq.gz", "0:150 1:0", "A:1276129214;C:1100761964;G:1115345594;T:1263574047;N:16131", 150, 0, null, null, 1276129214, 1100761964, 1115345594, 1263574047, 16131, "SRX3091818", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.91044, null, 0.10895, null, 0.67659, null, 0.46952, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43404, "SRR5931546", "SRX3091817", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "with difenoconazole", "397967", "397967", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4584658950.0, 30564393.0, "D 50 3 2.fq.gz", "0:0 1:150", "A:1214232270;C:1065003267;G:1091428812;T:1213867330;N:127271", 0, 150, null, null, 1214232270, 1065003267, 1091428812, 1213867330, 127271, "SRX3091817", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.92229, null, 0.10554, null, 0.68667, null, 0.4535, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43405, "SRR5931547", "SRX3091816", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "with difenoconazole", "397966", "397966", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4584658950.0, 30564393.0, "D 50 3 1.fq.gz", "0:150 1:0", "A:1219702088;C:1067643780;G:1085480895;T:1211806100;N:26087", 150, 0, null, null, 1219702088, 1067643780, 1085480895, 1211806100, 26087, "SRX3091816", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.92126, null, 0.10598, null, 0.68398, null, 0.44901, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43406, "SRR5931548", "SRX3091815", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "with difenoconazole", "397973", "397973", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4705867200.0, 31372448.0, "D 500 3 2.fq.gz", "0:0 1:150", "A:1240294141;C:1111008282;G:1125861755;T:1228667971;N:35051", 0, 150, null, null, 1240294141, 1111008282, 1125861755, 1228667971, 35051, "SRX3091815", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.92297, null, 0.09739, null, 0.6856, null, 0.47451, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43407, "SRR5931549", "SRX3091814", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "with difenoconazole", "397972", "397972", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4705867200.0, 31372448.0, "D 500 3 1.fq.gz", "0:150 1:0", "A:1241514886;C:1108723884;G:1123339576;T:1232273510;N:15344", 150, 0, null, null, 1241514886, 1108723884, 1123339576, 1232273510, 15344, "SRX3091814", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.92062, null, 0.09796, null, 0.67856, null, 0.47388, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43408, "SRR5931550", "SRX3091813", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "with difenoconazole", "397971", "397971", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4750951350.0, 31673009.0, "D 500 2 2.fq.gz", "0:0 1:150", "A:1286144024;C:1079544004;G:1112952985;T:1272274928;N:35409", 0, 150, null, null, 1286144024, 1079544004, 1112952985, 1272274928, 35409, "SRX3091813", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.90446, null, 0.13747, null, 0.68639, null, 0.46726, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43409, "SRR5931551", "SRX3091812", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "with difenoconazole", "397970", "397970", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4750951350.0, 31673009.0, "D 500 2 1.fq.gz", "0:150 1:0", "A:1287515334;C:1090783234;G:1101469034;T:1271168008;N:15740", 150, 0, null, null, 1287515334, 1090783234, 1101469034, 1271168008, 15740, "SRX3091812", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.90214, null, 0.13756, null, 0.68158, null, 0.46719, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43410, "SRR5931552", "SRX3091811", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "without xxx", "397957", "397957", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4071934650.0, 27146231.0, "CK 1 2.fq.gz", "0:0 1:150", "A:1052229682;C:975525985;G:991345538;T:1052207035;N:626410", 0, 150, null, null, 1052229682, 975525985, 991345538, 1052207035, 626410, "SRX3091811", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.93603, null, 0.0589, null, 0.71492, null, 0.48298, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43411, "SRR5931553", "SRX3091810", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "without xxx", "397956", "397956", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4071934650.0, 27146231.0, "CK 1 1.fq.gz", "0:150 1:0", "A:1057694098;C:975549420;G:988477956;T:1049766896;N:446280", 150, 0, null, null, 1057694098, 975549420, 988477956, 1049766896, 446280, "SRX3091810", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.93688, null, 0.05854, null, 0.7091, null, 0.48309, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43412, "SRR5931554", "SRX3091809", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "without xxx", "397959", "397959", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4343291550.0, 28955277.0, "CK 2 2.fq.gz", "0:0 1:150", "A:1153253014;C:1007267471;G:1028912357;T:1153739160;N:119548", 0, 150, null, null, 1153253014, 1007267471, 1028912357, 1153739160, 119548, "SRX3091809", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.9209, null, 0.11211, null, 0.68649, null, 0.45293, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43413, "SRR5931555", "SRX3091808", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "without xxx", "397958", "397958", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4343291550.0, 28955277.0, "CK 2 1.fq.gz", "0:150 1:0", "A:1157702407;C:1008975846;G:1024287434;T:1151988746;N:337117", 150, 0, null, null, 1157702407, 1008975846, 1024287434, 1151988746, 337117, "SRX3091808", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.91946, null, 0.11191, null, 0.6828, null, 0.45241, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43414, "SRR5931556", "SRX3091807", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "without xxx", "397961", "397961", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4518061050.0, 30120407.0, "CK 3 2.fq.gz", "0:0 1:150", "A:1188586431;C:1058258572;G:1080153332;T:1190907666;N:155049", 0, 150, null, null, 1188586431, 1058258572, 1080153332, 1190907666, 155049, "SRX3091807", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.92512, null, 0.09744, null, 0.69085, null, 0.45772, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43415, "SRR5931557", "SRX3091806", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "without xxx", "397960", "397960", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4518061050.0, 30120407.0, "CK 3 1.fq.gz", "0:150 1:0", "A:1195164171;C:1059996453;G:1074722334;T:1188143044;N:35048", 150, 0, null, null, 1195164171, 1059996453, 1074722334, 1188143044, 35048, "SRX3091806", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.9249, null, 0.09772, null, 0.68562, null, 0.45606, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43416, "SRR5931558", "SRX3091805", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "with difenoconazole", "397963", "397963", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4572900600.0, 30486004.0, "D 50 1 2.fq.gz", "0:0 1:150", "A:1218364634;C:1054987971;G:1079106780;T:1220261884;N:179331", 0, 150, null, null, 1218364634, 1054987971, 1079106780, 1220261884, 179331, "SRX3091805", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.91953, null, 0.11512, null, 0.68722, null, 0.45056, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43417, "SRR5931559", "SRX3091804", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "with difenoconazole", "397962", "397962", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4572900600.0, 30486004.0, "D 50 1 1.fq.gz", "0:150 1:0", "A:1223844243;C:1057030107;G:1074694968;T:1217286959;N:44323", 150, 0, null, null, 1223844243, 1057030107, 1074694968, 1217286959, 44323, "SRX3091804", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.91779, null, 0.1149, null, 0.68258, null, 0.46006, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43418, "SRR5931560", "SRX3091803", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "with difenoconazole", "397965", "397965", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4595232150.0, 30634881.0, "D 50 2 2.fq.gz", "0:0 1:150", "A:1225033548;C:1062169088;G:1082021478;T:1225833369;N:174667", 0, 150, null, null, 1225033548, 1062169088, 1082021478, 1225833369, 174667, "SRX3091803", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.91827, null, 0.11697, null, 0.68511, null, 0.44407, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43419, "SRR5931561", "SRX3091802", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "with difenoconazole", "397964", "397964", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4595232150.0, 30634881.0, "D 50 2 1.fq.gz", "0:150 1:0", "A:1231719851;C:1064618233;G:1076698645;T:1222155912;N:39509", 150, 0, null, null, 1231719851, 1064618233, 1076698645, 1222155912, 39509, "SRX3091802", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [47735, "SRR6846413", "SRX3801804", "SRS3053760", "SRP135842", "PRJNA438572", "RNA seq of embryo stimulated by interferons in Danio rerio", "PRJNA438572", "Other", "RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.", null, null, null, null, "IFNY", null, "strain:missing|isolate:missing|breed:missing|cultivar:missing|ecotype:missing|age:missing|dev stage:stimulated by interferons|sex:missing|tissue:embryo|collection date:2017 03 12|geo loc name:China:Wuhan|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA seq of embryo stimulated by interferons in Danio rerio", "IFNY", "IFNY", "RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP135842", null, null, "IFNY_S13_L004_R2_001.fastq.gz IFNY_S13_L004_R1_001.fastq.gz", "fastq fastq", 8611053142.0, 28513421.0, "IFNY S13 L004 R1 001.fastq.gz", "0:151 1:151", "A:2172756042;C:2133682578;G:2133331951;T:2170977207;N:305364", 151, 151, null, null, 2172756042, 2133682578, 2133331951, 2170977207, 305364, "SRX3801804", "SRS3053760", "SRA666995", "Chinese Academy of Sciences|Institute of Hydrobiology", "Chinese Academy of Sciences", 2, 0.955, 0.95804, 0.04308, 0.04392, 0.70218, 0.71033, 0.46525, 0.462, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2018-03-16", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [47736, "SRR6846414", "SRX3801803", "SRS3053759", "SRP135842", "PRJNA438572", "RNA seq of embryo stimulated by interferons in Danio rerio", "PRJNA438572", "Other", "RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.", null, null, null, null, "vector", null, "strain:missing|isolate:missing|breed:missing|cultivar:missing|ecotype:missing|age:missing|dev stage:stimulated by interferons|sex:missing|tissue:embryo|collection date:2017 03 11|geo loc name:China:Wuhan|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA seq of embryo stimulated by interferons in Danio rerio", "vector", "vector", "RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP135842", null, null, "vector_S12_L004_R1_001.fastq.gz vector_S12_L004_R2_001.fastq.gz", "fastq fastq", 10279577472.0, 34038336.0, "vector S12 L004 R1 001.fastq.gz", "0:151 1:151", "A:2615896150;C:2524788585;G:2528030423;T:2610500306;N:362008", 151, 151, null, null, 2615896150, 2524788585, 2528030423, 2610500306, 362008, "SRX3801803", "SRS3053759", "SRA666995", "Chinese Academy of Sciences|Institute of Hydrobiology", "Chinese Academy of Sciences", 2, 0.9555, 0.9579, 0.04617, 0.04728, 0.70337, 0.71072, 0.46191, 0.46954, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2018-03-16", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [47737, "SRR6846415", "SRX3801802", "SRS3053756", "SRP135842", "PRJNA438572", "RNA seq of embryo stimulated by interferons in Danio rerio", "PRJNA438572", "Other", "RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.", null, null, null, null, "IFNG", null, "strain:missing|isolate:missing|breed:missing|cultivar:missing|ecotype:missing|age:missing|dev stage:stimulated by interferons|sex:missing|tissue:embryo|collection date:2017 03 14|geo loc name:China:Wuhan|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA seq of embryo stimulated by interferons in Danio rerio", "IFNG", "IFNG", "RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP135842", null, null, "IFNG_S15_L004_R1_001.fastq.gz IFNG_S15_L004_R2_001.fastq.gz", "fastq fastq", 9082411722.0, 30074211.0, "IFNG S15 L004 R2 001.fastq.gz", "0:151 1:151", "A:2283553036;C:2258886090;G:2257807913;T:2281843116;N:321567", 151, 151, null, null, 2283553036, 2258886090, 2257807913, 2281843116, 321567, "SRX3801802", "SRS3053756", "SRA666995", "Chinese Academy of Sciences|Institute of Hydrobiology", "Chinese Academy of Sciences", 2, 0.95442, 0.95794, 0.03954, 0.04042, 0.70694, 0.71674, 0.45987, 0.45045, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2021-01-01", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [47738, "SRR6846416", "SRX3801801", "SRS3053758", "SRP135842", "PRJNA438572", "RNA seq of embryo stimulated by interferons in Danio rerio", "PRJNA438572", "Other", "RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.", null, null, null, null, "IFN1", null, "strain:missing|isolate:missing|breed:missing|cultivar:missing|ecotype:missing|age:missing|dev stage:stimulated by interferons|sex:missing|tissue:embryo|collection date:2017 03 13|geo loc name:China:Wuhan|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA seq of embryo stimulated by interferons in Danio rerio", "IFN1", "IFN1", "RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP135842", null, null, "IFN1_S14_L004_R1_001.fastq.gz IFN1_S14_L004_R2_001.fastq.gz", "fastq fastq", 9801986820.0, 32456910.0, "IFN1 S14 L004 R2 001.fastq.gz", "0:151 1:151", "A:2476732153;C:2426531434;G:2425138255;T:2473239913;N:345065", 151, 151, null, null, 2476732153, 2426531434, 2425138255, 2473239913, 345065, "SRX3801801", "SRS3053758", "SRA666995", "Chinese Academy of Sciences|Institute of Hydrobiology", "Chinese Academy of Sciences", 2, 0.95422, 0.9559, 0.0427, 0.04366, 0.7068, 0.71467, 0.45683, 0.46354, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2021-01-01", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [47739, "SRR6846417", "SRX3801800", "SRS3053757", "SRP135842", "PRJNA438572", "RNA seq of embryo stimulated by interferons in Danio rerio", "PRJNA438572", "Other", "RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.", null, null, null, null, "IFN3", null, "strain:missing|isolate:missing|breed:missing|cultivar:missing|ecotype:missing|age:missing|dev stage:stimulated by interferons|sex:missing|tissue:embryo|collection date:2017 03 15|geo loc name:China:Wuhan|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA seq of embryo stimulated by interferons in Danio rerio", "IFN3", "IFN3", "RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP135842", null, null, "IFN3_S16_L004_R2_001.fastq.gz IFN3_S16_L004_R1_001.fastq.gz", "fastq fastq", 8628116746.0, 28569923.0, "IFN3 S16 L004 R2 001.fastq.gz", "0:151 1:151", "A:2178313667;C:2137778611;G:2137088678;T:2174631627;N:304163", 151, 151, null, null, 2178313667, 2137778611, 2137088678, 2174631627, 304163, "SRX3801800", "SRS3053757", "SRA666995", "Chinese Academy of Sciences|Institute of Hydrobiology", "Chinese Academy of Sciences", 2, 0.95589, 0.95838, 0.04186, 0.04249, 0.70587, 0.71376, 0.44245, 0.46157, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2021-01-01", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [52870, "SRR9325684", "SRX6092609", "SRS4993655", "SRP201813", "PRJNA549547", "Transcriptome analysis of innate immune response activated by Vibrio parahaemolyticus", "PRJNA549547", "Other", "In this study  we analyzed the transcriptome data between control and infection groups. GO terms and KEGG pathways were found which related to innate immune response activated by Vibrio parahaemolyticus.", null, null, null, "control 2", "C2", null, "strain:AB line|age:3dpf|sex:not determined|tissue:whole larvae|sample type:replicate2|treatment:control|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "control", "C2", "C2", "3dpf whole larvae control", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP201813", null, null, "C5R1 C5R2", "fastq fastq", 7612414642.0, 25206671.0, "C5R1.gz", "0:151 1:151", "A:1998275456;C:1804223564;G:1889177721;T:1919304283;N:1433618", 151, 151, null, null, 1998275456, 1804223564, 1889177721, 1919304283, 1433618, "SRX6092609", "SRS4993655", "SRA900855", "Shanghai Ocean University|College of Fisheries and Life Science", "Shanghai Ocean University", 2, 0.94324, 0.94566, 0.05207, 0.05226, 0.7064, 0.71476, 0.4395, 0.46981, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2019-06-19", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [52871, "SRR9325685", "SRX6092608", "SRS4993654", "SRP201813", "PRJNA549547", "Transcriptome analysis of innate immune response activated by Vibrio parahaemolyticus", "PRJNA549547", "Other", "In this study  we analyzed the transcriptome data between control and infection groups. GO terms and KEGG pathways were found which related to innate immune response activated by Vibrio parahaemolyticus.", null, null, null, "control 1", "C1", null, "strain:AB line|age:3dpf|sex:not determined|tissue:whole larvae|sample type:replicate1|treatment:control|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "control", "C1", "C1", "3dpf whole larvae control", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP201813", null, null, "C4R1 C4R2", "fastq fastq", 6295697964.0, 20846682.0, "C4R1.gz", "0:151 1:151", "A:1647036246;C:1503776742;G:1574879558;T:1568823261;N:1182157", 151, 151, null, null, 1647036246, 1503776742, 1574879558, 1568823261, 1182157, "SRX6092608", "SRS4993654", "SRA900855", "Shanghai Ocean University|College of Fisheries and Life Science", "Shanghai Ocean University", 2, 0.9445, 0.94654, 0.04771, 0.04787, 0.70017, 0.71023, 0.4562, 0.46962, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2019-06-19", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [52872, "SRR9325686", "SRX6092607", "SRS4993653", "SRP201813", "PRJNA549547", "Transcriptome analysis of innate immune response activated by Vibrio parahaemolyticus", "PRJNA549547", "Other", "In this study  we analyzed the transcriptome data between control and infection groups. GO terms and KEGG pathways were found which related to innate immune response activated by Vibrio parahaemolyticus.", null, null, null, "infection 1", "I1", null, "strain:AB line|age:3dpf|sex:not determined|tissue:whole larvae|sample type:replicate1|treatment:infection|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "infection", "I1", "I1", "3dpf whole larvae control", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP201813", null, null, "I4R1 I4R2", "fastq fastq", 5593088924.0, 18520162.0, "I4R1.gz", "0:151 1:151", "A:1483645360;C:1316989046;G:1368211525;T:1423148010;N:1094983", 151, 151, null, null, 1483645360, 1316989046, 1368211525, 1423148010, 1094983, "SRX6092607", "SRS4993653", "SRA900855", "Shanghai Ocean University|College of Fisheries and Life Science", "Shanghai Ocean University", 2, 0.94041, 0.9415, 0.05919, 0.05967, 0.69083, 0.70088, 0.46898, 0.48002, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2019-06-19", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [52873, "SRR9325687", "SRX6092606", "SRS4993652", "SRP201813", "PRJNA549547", "Transcriptome analysis of innate immune response activated by Vibrio parahaemolyticus", "PRJNA549547", "Other", "In this study  we analyzed the transcriptome data between control and infection groups. GO terms and KEGG pathways were found which related to innate immune response activated by Vibrio parahaemolyticus.", null, null, null, "control 3", "C3", null, "strain:AB line|age:3dpf|sex:not determined|tissue:whole larvae|sample type:replicate3|treatment:control|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "control", "C3", "C3", "3dpf whole larvae control", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP201813", null, null, "C6R1 C6R2", "fastq fastq", 6268873418.0, 20757859.0, "C6R1.gz", "0:151 1:151", "A:1661497500;C:1472659955;G:1548227326;T:1585302735;N:1185902", 151, 151, null, null, 1661497500, 1472659955, 1548227326, 1585302735, 1185902, "SRX6092606", "SRS4993652", "SRA900855", "Shanghai Ocean University|College of Fisheries and Life Science", "Shanghai Ocean University", 2, 0.94166, 0.94403, 0.05926, 0.05945, 0.70074, 0.71332, 0.47103, 0.47639, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2019-06-19", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [52874, "SRR9325688", "SRX6092605", "SRS4993651", "SRP201813", "PRJNA549547", "Transcriptome analysis of innate immune response activated by Vibrio parahaemolyticus", "PRJNA549547", "Other", "In this study  we analyzed the transcriptome data between control and infection groups. GO terms and KEGG pathways were found which related to innate immune response activated by Vibrio parahaemolyticus.", null, null, null, "infection 3", "I3", null, "strain:AB line|age:3dpf|sex:not determined|tissue:whole larvae|sample type:replicate3|treatment:infection|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "infection", "I3", "I3", "3dpf whole larvae control", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP201813", null, null, "I6R1 I6R2", "fastq fastq", 5131234586.0, 16990843.0, "I6R1.gz", "0:151 1:151", "A:1358543385;C:1210921479;G:1270192482;T:1290573589;N:1003651", 151, 151, null, null, 1358543385, 1210921479, 1270192482, 1290573589, 1003651, "SRX6092605", "SRS4993651", "SRA900855", "Shanghai Ocean University|College of Fisheries and Life Science", "Shanghai Ocean University", 2, 0.94644, 0.94835, 0.04436, 0.04422, 0.71845, 0.72835, 0.46647, 0.46929, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2019-06-19", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [52875, "SRR9325689", "SRX6092604", "SRS4993650", "SRP201813", "PRJNA549547", "Transcriptome analysis of innate immune response activated by Vibrio parahaemolyticus", "PRJNA549547", "Other", "In this study  we analyzed the transcriptome data between control and infection groups. GO terms and KEGG pathways were found which related to innate immune response activated by Vibrio parahaemolyticus.", null, null, null, "infection 2", "I2", null, "strain:AB line|age:3dpf|sex:not determined|tissue:whole larvae|sample type:replicate2|treatment:infection|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "infection", "I2", "I2", "3dpf whole larvae control", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP201813", null, null, "I5R1 I5R2", "fastq fastq", 6752493500.0, 22359250.0, "I5R1.gz", "0:151 1:151", "A:1779816156;C:1595083778;G:1667677153;T:1708582786;N:1333627", 151, 151, null, null, 1779816156, 1595083778, 1667677153, 1708582786, 1333627, "SRX6092604", "SRS4993650", "SRA900855", "Shanghai Ocean University|College of Fisheries and Life Science", "Shanghai Ocean University", 2, 0.94352, 0.947, 0.05492, 0.05567, 0.70019, 0.70881, 0.47963, 0.47637, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2019-06-19", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [52888, "SRR9333941", "SRX6100410", "SRS5000910", "SRP202062", "PRJNA550012", "Transcriptome analysis of innate immune response in notch1a mutant and wide type zebrafish activated by microinjection Vibrio parahaemolyticus", "PRJNA550012", "Other", "we generated notch1a mutant zebrafish line  and then we infected notch1a mutant and wide type zebrafish by microinjection. The role of notch1a in innnate immune response was analyzed.", null, null, null, "control 1", "WTPBS1", null, "strain:AB line|age:3dpf|sex:not determined|tissue:whole larvae|sample type:replicate1|treatment:control|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "control", "WTPBS1", "WTPBS1", "3dpf whole larvae control", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP202062", null, null, "WT PBS 1 R1 WT PBS 1 R2", "fastq fastq", 8866677000.0, 29555590.0, "WT PBS 1 R1.gz", "0:150 1:150", "A:2183986294;C:2242368970;G:2246335396;T:2193811531;N:174809", 150, 150, null, null, 2183986294, 2242368970, 2246335396, 2193811531, 174809, "SRX6100410", "SRS5000910", "SRA901699", "Shanghai Ocean University|College of Fisheries and Life Science", "Shanghai Ocean University", 2, 0.94766, 0.9446, 0.01552, 0.01523, 0.78013, 0.78914, 0.4609, 0.4456, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2019-06-21", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [52889, "SRR9333942", "SRX6100409", "SRS5000909", "SRP202062", "PRJNA550012", "Transcriptome analysis of innate immune response in notch1a mutant and wide type zebrafish activated by microinjection Vibrio parahaemolyticus", "PRJNA550012", "Other", "we generated notch1a mutant zebrafish line  and then we infected notch1a mutant and wide type zebrafish by microinjection. The role of notch1a in innnate immune response was analyzed.", null, null, null, "control 2", "WTPBS2", null, "strain:AB line|age:3dpf|sex:not determined|tissue:whole larvae|sample type:replicate2|treatment:control|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "control", "WTPBS2", "WTPBS2", "3dpf whole larvae control", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP202062", null, null, "WT PBS 2 R1 WT PBS 2 R2", "fastq fastq", 10082208300.0, 33607361.0, "WT PBS 2 R1.gz", "0:150 1:150", "A:2477937957;C:2557169626;G:2554846201;T:2492055059;N:199457", 150, 150, null, null, 2477937957, 2557169626, 2554846201, 2492055059, 199457, "SRX6100409", "SRS5000909", "SRA901699", "Shanghai Ocean University|College of Fisheries and Life Science", "Shanghai Ocean University", 2, 0.95393, 0.95031, 0.01683, 0.01604, 0.77624, 0.78386, 0.46508, 0.45604, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2019-06-21", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [52890, "SRR9333943", "SRX6100408", "SRS5000905", "SRP202062", "PRJNA550012", "Transcriptome analysis of innate immune response in notch1a mutant and wide type zebrafish activated by microinjection Vibrio parahaemolyticus", "PRJNA550012", "Other", "we generated notch1a mutant zebrafish line  and then we infected notch1a mutant and wide type zebrafish by microinjection. The role of notch1a in innnate immune response was analyzed.", null, null, null, "control 3", "WTPBS3", null, "strain:AB line|age:3dpf|sex:not determined|tissue:whole larvae|sample type:replicate3|treatment:control|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "control", "WTPBS3", "WTPBS3", "3dpf whole larvae control", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP202062", null, null, "WT PBS 3 R2 WT PBS 3 R1", "fastq fastq", 7842530700.0, 26141769.0, "WT PBS 3 R1.gz", "0:150 1:150", "A:1912472880;C:2005415056;G:1999159107;T:1925331911;N:151746", 150, 150, null, null, 1912472880, 2005415056, 1999159107, 1925331911, 151746, "SRX6100408", "SRS5000905", "SRA901699", "Shanghai Ocean University|College of Fisheries and Life Science", "Shanghai Ocean University", 2, 0.95536, 0.9545, 0.01399, 0.01388, 0.78228, 0.79285, 0.4524, 0.45849, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2019-06-21", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [52891, "SRR9333944", "SRX6100407", "SRS5000907", "SRP202062", "PRJNA550012", "Transcriptome analysis of innate immune response in notch1a mutant and wide type zebrafish activated by microinjection Vibrio parahaemolyticus", "PRJNA550012", "Other", "we generated notch1a mutant zebrafish line  and then we infected notch1a mutant and wide type zebrafish by microinjection. The role of notch1a in innnate immune response was analyzed.", null, null, null, "infection 1", "WTVp1", null, "strain:AB line|age:3dpf|sex:not determined|tissue:whole larvae|sample type:replicate1|treatment:infection|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "infection", "WTVp1", "WTVp1", "3dpf whole larvae control", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP202062", null, null, "WT VP 1 R2 WT VP 1 R1", "fastq fastq", 7675960200.0, 25586534.0, "WT VP 1 R1.gz", "0:150 1:150", "A:1889233691;C:1944561523;G:1939597307;T:1902416855;N:150824", 150, 150, null, null, 1889233691, 1944561523, 1939597307, 1902416855, 150824, "SRX6100407", "SRS5000907", "SRA901699", "Shanghai Ocean University|College of Fisheries and Life Science", "Shanghai Ocean University", 2, 0.9543, 0.95081, 0.01719, 0.01715, 0.77417, 0.78307, 0.46427, 0.45935, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2019-06-21", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [52892, "SRR9333945", "SRX6100406", "SRS5000906", "SRP202062", "PRJNA550012", "Transcriptome analysis of innate immune response in notch1a mutant and wide type zebrafish activated by microinjection Vibrio parahaemolyticus", "PRJNA550012", "Other", "we generated notch1a mutant zebrafish line  and then we infected notch1a mutant and wide type zebrafish by microinjection. The role of notch1a in innnate immune response was analyzed.", null, null, null, "infection 2", "WTVp2", null, "strain:AB line|age:3dpf|sex:not determined|tissue:whole larvae|sample type:replicate2|treatment:infection|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "infection", "WTVp2", "WTVp2", "3dpf whole larvae control", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP202062", null, null, "WT VP 2 R1 WT VP 2 R2", "fastq fastq", 9591245700.0, 31970819.0, "WT VP 2 R1.gz", "0:150 1:150", "A:2359635948;C:2430096225;G:2426833110;T:2374492666;N:187751", 150, 150, null, null, 2359635948, 2430096225, 2426833110, 2374492666, 187751, "SRX6100406", "SRS5000906", "SRA901699", "Shanghai Ocean University|College of Fisheries and Life Science", "Shanghai Ocean University", 2, 0.95526, 0.95076, 0.01638, 0.01625, 0.77589, 0.78595, 0.45512, 0.45781, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2019-06-21", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [52893, "SRR9333946", "SRX6100405", "SRS5000908", "SRP202062", "PRJNA550012", "Transcriptome analysis of innate immune response in notch1a mutant and wide type zebrafish activated by microinjection Vibrio parahaemolyticus", "PRJNA550012", "Other", "we generated notch1a mutant zebrafish line  and then we infected notch1a mutant and wide type zebrafish by microinjection. The role of notch1a in innnate immune response was analyzed.", null, null, null, "infection 3", "WTVp3", null, "strain:AB line|age:3dpf|sex:not determined|tissue:whole larvae|sample type:replicate3|treatment:infection|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "infection", "WTVp3", "WTVp3", "3dpf whole larvae control", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP202062", null, null, "WT VP 3 R1 WT VP 3 R2", "fastq fastq", 8828767500.0, 29429225.0, "WT VP 3 R1.gz", "0:150 1:150", "A:2169141529;C:2239438424;G:2237766047;T:2182246217;N:175283", 150, 150, null, null, 2169141529, 2239438424, 2237766047, 2182246217, 175283, "SRX6100405", "SRS5000908", "SRA901699", "Shanghai Ocean University|College of Fisheries and Life Science", "Shanghai Ocean University", 2, 0.95661, 0.95303, 0.01647, 0.01662, 0.77305, 0.78159, 0.46349, 0.46225, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2019-06-21", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [55268, "SRR10215484", "SRX6935171", "SRS5465204", "SRP223930", "PRJNA575342", "CAGE /CappedRNA sequencig", "PRJNA575342", "Other", "CAGE and full length capped RNA sequencing for identification of transcription start TSS utilisation during Zebrafish Danio rerio embryonic development", null, null, null, null, "S06 Prim5", null, "strain:AB|dev stage:Prim 5|sex:N/A|tissue:whole embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "TeloPrime RNA seq Danio rerio  whole embryo  Prim 5  stage", "Prim5 TeloPrime", "Prim5 TeloPrime", "TeloPrime Full Length cDNA amplification", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP223930", null, null, "S06_Prim5_TeloPrime_1.fastq.gz S06_Prim5_TeloPrime_2.fastq.gz", "fastq fastq", 24558505000.0, 122792525.0, "S06 Prim5 TeloPrime 1.fastq.gz", "0:100 1:100", "A:6341287207;C:5749049203;G:5758305711;T:6709011836;N:851043", 100, 100, null, null, 6341287207, 5749049203, 5758305711, 6709011836, 851043, "SRX6935171", "SRS5465204", "SRA971223", "University of Birmingham|Cancer and Genomic Sciences", "University of Birmingham", 2, 0.85518, 0.83013, 0.01363, 0.01378, 0.80773, 0.80992, 0.38509, 0.39167, 100, 100, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "other", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2019-10-02", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55463, "SRR10423788", "SRX7119878", "SRS5629995", "SRP229377", "PRJNA588504", "Transcriptomic characterization of zebrafish larvae in response to lindane exposure.", "PRJNA588504", "Other", "Lindane is a highly toxic organochlorine pesticide and widespread in aquatic environment that can cause deleterious effects on fish. Although some lindane regulated genes have been investigated in fish  the transcriptional responses of fish larvae to acute lindane exposure are not well understood. In this study  RNA sequencing was used to examine the transcriptional changes in developing zebrafish larvae under a low concentration of lindane exposure from 96 to 120hpf. Our resultes provide useful insights to help further understand the transcriptional response of zebrafish larvae under acute exposure to lindane.", null, null, null, null, "ZC120h", null, "breed:not collected|dev stage:120h|sex:pooled male and female|tissue:whole fish|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "Zebrafish larvae at 96h exposed to normal water for xxx h", "ZC120h", "ZC120h", "zebrafish", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP229377", null, null, "ZC120h_R2.fq.gz ZC120h_R1.fq.gz", "fastq fastq", 12785060978.0, 42334639.0, "ZC120h R1.fq.gz", "0:151 1:151", "A:3341524237;C:3029668010;G:3132163675;T:3281584092;N:120964", 151, 151, null, null, 3341524237, 3029668010, 3132163675, 3281584092, 120964, "SRX7119878", "SRS5629995", "SRA993647", "Wuhan University|Department of Genetics", "Wuhan University", 2, 0.95082, 0.95755, 0.05726, 0.05624, 0.6817, 0.68718, 0.47419, 0.47596, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2019-11-09", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [55464, "SRR10423789", "SRX7119877", "SRS5629994", "SRP229377", "PRJNA588504", "Transcriptomic characterization of zebrafish larvae in response to lindane exposure.", "PRJNA588504", "Other", "Lindane is a highly toxic organochlorine pesticide and widespread in aquatic environment that can cause deleterious effects on fish. Although some lindane regulated genes have been investigated in fish  the transcriptional responses of fish larvae to acute lindane exposure are not well understood. In this study  RNA sequencing was used to examine the transcriptional changes in developing zebrafish larvae under a low concentration of lindane exposure from 96 to 120hpf. Our resultes provide useful insights to help further understand the transcriptional response of zebrafish larvae under acute exposure to lindane.", null, null, null, null, "Lin120h", null, "breed:not collected|dev stage:120h|sex:pooled male and female|tissue:Whole fish|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "Zebrafish larvae at 96h exposed to Lindane for xxx h", "Lin120h", "Lin120h", "zebrafish", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP229377", null, null, "Lin120h_R2.fq.gz Lin120h_R1.fq.gz", "fastq fastq", 14029985008.0, 46456904.0, "Lin120h R1.fq.gz", "0:151 1:151", "A:3703851299;C:3286864966;G:3398465264;T:3640669046;N:134433", 151, 151, null, null, 3703851299, 3286864966, 3398465264, 3640669046, 134433, "SRX7119877", "SRS5629994", "SRA993647", "Wuhan University|Department of Genetics", "Wuhan University", 2, 0.94543, 0.95153, 0.07203, 0.07111, 0.67411, 0.6799, 0.46566, 0.4813, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2019-11-09", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [59169, "SRR11730551", "SRX8289703", "SRS6611331", "SRP260555", "PRJNA631119", "Effect of BDE 47 on zebrafish", "PRJNA631119", "Other", "Behavioral change and transcriptomics reveal the effect of BDE 47 on sonic hedgehog pathway to zebrafish early life stage Danio rerio", null, null, null, null, "100 1", null, "breed:AB strain10|age:7pdf 10|sex:pooled male and female|tissue:Whole fish|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "zebrafish10", "L 10", "L 10", "Illumina protocol", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP260555", null, null, "100_1.raw_2.fastq.gz 100_1.raw_1.fastq.gz", "fastq fastq", 8089178700.0, 26963929.0, "100 1.raw 1.fastq.gz", "0:150 1:150", "A:2177945625;C:1841818410;G:1980677132;T:2088574435;N:163098", 150, 150, null, null, 2177945625, 1841818410, 1980677132, 2088574435, 163098, "SRX8289703", "SRS6611331", "SRA1073316", "Shantou University|Medical Colleg", "Shantou University", 2, 0.94015, 0.93974, 0.09604, 0.09581, 0.65746, 0.65853, 0.48508, 0.48349, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2020-05-08", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [59170, "SRR11730552", "SRX8289702", "SRS6611330", "SRP260555", "PRJNA631119", "Effect of BDE 47 on zebrafish", "PRJNA631119", "Other", "Behavioral change and transcriptomics reveal the effect of BDE 47 on sonic hedgehog pathway to zebrafish early life stage Danio rerio", null, null, null, null, "50 3", null, "breed:AB strain9|age:7pdf 9|sex:pooled male and female|tissue:Whole fish|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "zebrafish9", "L 9", "L 9", "Illumina protocol", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP260555", null, null, "50_3.raw_1.fastq.gz 50_3.raw_2.fastq.gz", "fastq fastq", 7470624600.0, 24902082.0, "50 3.raw 1.fastq.gz", "0:150 1:150", "A:2007517594;C:1686506604;G:1824601005;T:1951849371;N:150026", 150, 150, null, null, 2007517594, 1686506604, 1824601005, 1951849371, 150026, "SRX8289702", "SRS6611330", "SRA1073316", "Shantou University|Medical Colleg", "Shantou University", 2, 0.93949, 0.93816, 0.10339, 0.10268, 0.65705, 0.65762, 0.48799, 0.48874, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2020-05-08", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [59171, "SRR11730553", "SRX8289701", "SRS6611329", "SRP260555", "PRJNA631119", "Effect of BDE 47 on zebrafish", "PRJNA631119", "Other", "Behavioral change and transcriptomics reveal the effect of BDE 47 on sonic hedgehog pathway to zebrafish early life stage Danio rerio", null, null, null, null, "50 2", null, "breed:AB strain8|age:7pdf 8|sex:pooled male and female|tissue:Whole fish|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "zebrafish8", "L 8", "L 8", "Illumina protocol", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP260555", null, null, "50_2.raw_1.fastq.gz 50_2.raw_2.fastq.gz", "fastq fastq", 8861975700.0, 29539919.0, "50 2.raw 1.fastq.gz", "0:150 1:150", "A:2360364654;C:2043721631;G:2183203350;T:2274509353;N:176712", 150, 150, null, null, 2360364654, 2043721631, 2183203350, 2274509353, 176712, "SRX8289701", "SRS6611329", "SRA1073316", "Shantou University|Medical Colleg", "Shantou University", 2, 0.94138, 0.94043, 0.11022, 0.1096, 0.66162, 0.66237, 0.49495, 0.49469, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2020-05-08", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [59172, "SRR11730554", "SRX8289700", "SRS6611328", "SRP260555", "PRJNA631119", "Effect of BDE 47 on zebrafish", "PRJNA631119", "Other", "Behavioral change and transcriptomics reveal the effect of BDE 47 on sonic hedgehog pathway to zebrafish early life stage Danio rerio", null, null, null, null, "50 1", null, "breed:AB strain7|age:7pdf 7|sex:pooled male and female|tissue:Whole fish|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "zebrafish7", "L 7", "L 7", "Illumina protocol", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP260555", null, null, "50_1.raw_2.fastq.gz 50_1.raw_1.fastq.gz", "fastq fastq", 8901558600.0, 29671862.0, "50 1.raw 1.fastq.gz", "0:150 1:150", "A:2404995161;C:2026663404;G:2167517694;T:2302202957;N:179384", 150, 150, null, null, 2404995161, 2026663404, 2167517694, 2302202957, 179384, "SRX8289700", "SRS6611328", "SRA1073316", "Shantou University|Medical Colleg", "Shantou University", 2, 0.93838, 0.93806, 0.09737, 0.09746, 0.65516, 0.65628, 0.48651, 0.48477, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2020-05-08", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [59173, "SRR11730555", "SRX8289699", "SRS6611327", "SRP260555", "PRJNA631119", "Effect of BDE 47 on zebrafish", "PRJNA631119", "Other", "Behavioral change and transcriptomics reveal the effect of BDE 47 on sonic hedgehog pathway to zebrafish early life stage Danio rerio", null, null, null, null, "10 3", null, "breed:AB strain6|age:7pdf 6|sex:pooled male and female|tissue:Whole fish|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "zebrafish6", "L 6", "L 6", "Illumina protocol", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP260555", null, null, "10_3.raw_2.fastq.gz 10_3.raw_1.fastq.gz", "fastq fastq", 7437472800.0, 24791576.0, "10 3.raw 1.fastq.gz", "0:150 1:150", "A:1981462739;C:1710630842;G:1827812172;T:1917416671;N:150376", 150, 150, null, null, 1981462739, 1710630842, 1827812172, 1917416671, 150376, "SRX8289699", "SRS6611327", "SRA1073316", "Shantou University|Medical Colleg", "Shantou University", 2, 0.94181, 0.94033, 0.10285, 0.103, 0.65989, 0.6617, 0.49673, 0.49222, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2020-05-08", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [59174, "SRR11730556", "SRX8289698", "SRS6611326", "SRP260555", "PRJNA631119", "Effect of BDE 47 on zebrafish", "PRJNA631119", "Other", "Behavioral change and transcriptomics reveal the effect of BDE 47 on sonic hedgehog pathway to zebrafish early life stage Danio rerio", null, null, null, null, "10 2", null, "breed:AB strain5|age:7pdf 5|sex:pooled male and female|tissue:Whole fish|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "zebrafish5", "L 5", "L 5", "Illumina protocol", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP260555", null, null, "10_2.raw_1.fastq.gz 10_2.raw_2.fastq.gz", "fastq fastq", 7367983200.0, 24559944.0, "10 2.raw 1.fastq.gz", "0:150 1:150", "A:1983409392;C:1677778205;G:1767715591;T:1938931316;N:148696", 150, 150, null, null, 1983409392, 1677778205, 1767715591, 1938931316, 148696, "SRX8289698", "SRS6611326", "SRA1073316", "Shantou University|Medical Colleg", "Shantou University", 2, 0.9376, 0.93585, 0.10031, 0.10016, 0.65843, 0.65884, 0.47044, 0.49067, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2020-05-08", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [59175, "SRR11730557", "SRX8289697", "SRS6611325", "SRP260555", "PRJNA631119", "Effect of BDE 47 on zebrafish", "PRJNA631119", "Other", "Behavioral change and transcriptomics reveal the effect of BDE 47 on sonic hedgehog pathway to zebrafish early life stage Danio rerio", null, null, null, null, "10 1", null, "breed:AB strain4|age:7pdf 4|sex:pooled male and female|tissue:Whole fish|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "zebrafish4", "L 4", "L 4", "Illumina protocol", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP260555", null, null, "10_1.raw_2.fastq.gz 10_1.raw_1.fastq.gz", "fastq fastq", 7805627700.0, 26018759.0, "10 1.raw 1.fastq.gz", "0:150 1:150", "A:2108625492;C:1771789070;G:1878589306;T:2046466221;N:157611", 150, 150, null, null, 2108625492, 1771789070, 1878589306, 2046466221, 157611, "SRX8289697", "SRS6611325", "SRA1073316", "Shantou University|Medical Colleg", "Shantou University", 2, 0.93771, 0.93697, 0.10318, 0.10317, 0.65821, 0.65782, 0.48837, 0.48785, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2020-05-08", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [59176, "SRR11730558", "SRX8289696", "SRS6611324", "SRP260555", "PRJNA631119", "Effect of BDE 47 on zebrafish", "PRJNA631119", "Other", "Behavioral change and transcriptomics reveal the effect of BDE 47 on sonic hedgehog pathway to zebrafish early life stage Danio rerio", null, null, null, null, "DMSO 3", null, "breed:AB strain3|age:7pdf 3|sex:pooled male and female|tissue:Whole fish|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "zebrafish3", "L 3", "L 3", "Illumina protocol", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP260555", null, null, "DMSO_3.raw_2.fastq.gz DMSO_3.raw_1.fastq.gz", "fastq fastq", 7040839500.0, 23469465.0, "DMSO 3.raw 1.fastq.gz", "0:150 1:150", "A:1899913891;C:1592541018;G:1703285418;T:1844957292;N:141881", 150, 150, null, null, 1899913891, 1592541018, 1703285418, 1844957292, 141881, "SRX8289696", "SRS6611324", "SRA1073316", "Shantou University|Medical Colleg", "Shantou University", 2, 0.93606, 0.93543, 0.10551, 0.10559, 0.65466, 0.65563, 0.48063, 0.47789, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2020-05-08", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [59177, "SRR11730559", "SRX8289695", "SRS6611323", "SRP260555", "PRJNA631119", "Effect of BDE 47 on zebrafish", "PRJNA631119", "Other", "Behavioral change and transcriptomics reveal the effect of BDE 47 on sonic hedgehog pathway to zebrafish early life stage Danio rerio", null, null, null, null, "100 3", null, "breed:AB strain12|age:7pdf 12|sex:pooled male and female|tissue:Whole fish|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "zebrafish12", "L 12", "L 12", "Illumina protocol", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP260555", null, null, "100_3.raw_2.fastq.gz 100_3.raw_1.fastq.gz", "fastq fastq", 8196975600.0, 27323252.0, "100 3.raw 1.fastq.gz", "0:150 1:150", "A:2188101969;C:1877854538;G:2005324994;T:2125529773;N:164326", 150, 150, null, null, 2188101969, 1877854538, 2005324994, 2125529773, 164326, "SRX8289695", "SRS6611323", "SRA1073316", "Shantou University|Medical Colleg", "Shantou University", 2, 0.94287, 0.94017, 0.1017, 0.10057, 0.66158, 0.66358, 0.49402, 0.49056, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2020-05-08", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [59178, "SRR11730560", "SRX8289694", "SRS6611322", "SRP260555", "PRJNA631119", "Effect of BDE 47 on zebrafish", "PRJNA631119", "Other", "Behavioral change and transcriptomics reveal the effect of BDE 47 on sonic hedgehog pathway to zebrafish early life stage Danio rerio", null, null, null, null, "100 2", null, "breed:AB strain11|age:7pdf 11|sex:pooled male and female|tissue:Whole fish|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "zebrafish11", "L 11", "L 11", "Illumina protocol", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP260555", null, null, "100_2.raw_1.fastq.gz 100_2.raw_2.fastq.gz", "fastq fastq", 8773266900.0, 29244223.0, "100 2.raw 1.fastq.gz", "0:150 1:150", "A:2356477425;C:2010587510;G:2129453088;T:2276570805;N:178072", 150, 150, null, null, 2356477425, 2010587510, 2129453088, 2276570805, 178072, "SRX8289694", "SRS6611322", "SRA1073316", "Shantou University|Medical Colleg", "Shantou University", 2, 0.94317, 0.94233, 0.09393, 0.09393, 0.65906, 0.66026, 0.48735, 0.48695, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2020-05-08", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [59179, "SRR11730561", "SRX8289693", "SRS6611321", "SRP260555", "PRJNA631119", "Effect of BDE 47 on zebrafish", "PRJNA631119", "Other", "Behavioral change and transcriptomics reveal the effect of BDE 47 on sonic hedgehog pathway to zebrafish early life stage Danio rerio", null, null, null, null, "DMSO 2", null, "breed:AB strain2|age:7pdf 2|sex:pooled male and female|tissue:Whole fish|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "zebrafish2", "L 2", "L 2", "Illumina protocol", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP260555", null, null, "DMSO_2.raw_2.fastq.gz DMSO_2.raw_1.fastq.gz", "fastq fastq", 7015860000.0, 23386200.0, "DMSO 2.raw 1.fastq.gz", "0:150 1:150", "A:1887684850;C:1594757510;G:1705218972;T:1828056316;N:142352", 150, 150, null, null, 1887684850, 1594757510, 1705218972, 1828056316, 142352, "SRX8289693", "SRS6611321", "SRA1073316", "Shantou University|Medical Colleg", "Shantou University", 2, 0.93989, 0.93831, 0.10215, 0.10153, 0.65476, 0.65662, 0.48064, 0.47997, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2020-05-08", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [59180, "SRR11730562", "SRX8289692", "SRS6611320", "SRP260555", "PRJNA631119", "Effect of BDE 47 on zebrafish", "PRJNA631119", "Other", "Behavioral change and transcriptomics reveal the effect of BDE 47 on sonic hedgehog pathway to zebrafish early life stage Danio rerio", null, null, null, null, "DMSO 1", null, "breed:AB strain1|age:7pdf 1|sex:pooled male and female|tissue:Whole fish|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "zebrafish1", "L 1", "L 1", "Illumina protocol", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP260555", null, null, "DMSO_1.raw_1.fastq.gz DMSO_1.raw_2.fastq.gz", "fastq fastq", 7347884700.0, 24492949.0, "DMSO 1.raw 1.fastq.gz", "0:150 1:150", "A:1975210413;C:1668581787;G:1791007480;T:1912936523;N:148497", 150, 150, null, null, 1975210413, 1668581787, 1791007480, 1912936523, 148497, "SRX8289692", "SRS6611320", "SRA1073316", "Shantou University|Medical Colleg", "Shantou University", 2, 0.93984, 0.9385, 0.09923, 0.09933, 0.65411, 0.65508, 0.47808, 0.48684, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2020-05-08", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [66074, "SRR15871410", "SRX12162473", "SRS10140804", "SRP336826", "PRJNA762494", "Transcriptomes analysis of ercc2/xpd mutant zebrafish", "PRJNA762494", "Other", "to reveal transcriptional changes in ercc2/xpd mutant zerbafish.", null, null, null, null, "sib D7 1", null, "replicate:biological replicate s7 1|isolate:zerafish|age:7 dpf|sex:not collected|tissue:whole larva|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA Seq of zebrafish larvae", "sib D7 1", "sib D7 1", "transcriptional alterations", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP336826", null, null, "sib_D7_1_1.fq.gz sib_D7_1_2.fq.gz", "fastq fastq", 6744360000.0, 22481200.0, "sib D7 1 1.fq.gz", "0:150 1:150", "A:1747659521;C:1633189382;G:1626351046;T:1737068132;N:91919", 150, 150, null, null, 1747659521, 1633189382, 1626351046, 1737068132, 91919, "SRX12162473", "SRS10140804", "SRA1293390", "Fudan University|School of Life Sciences", "Fudan University", 2, 0.96643, 0.96697, 0.04953, 0.04987, 0.71226, 0.71129, 0.46536, 0.46559, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2021-09-13", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [66075, "SRR15871411", "SRX12162472", "SRS10140803", "SRP336826", "PRJNA762494", "Transcriptomes analysis of ercc2/xpd mutant zebrafish", "PRJNA762494", "Other", "to reveal transcriptional changes in ercc2/xpd mutant zerbafish.", null, null, null, null, "sib D5 3", null, "replicate:biological replicate s5 3|isolate:zerafish|age:5 dpf|sex:not collected|tissue:whole larva|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA Seq of zebrafish larvae", "sib D5 3", "sib D5 3", "transcriptional alterations", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP336826", null, null, "sib_D5_3_1.fq.gz sib_D5_3_2.fq.gz", "fastq fastq", 6498325500.0, 21661085.0, "sib D5 3 1.fq.gz", "0:150 1:150", "A:1694468333;C:1564487898;G:1558790522;T:1680507164;N:71583", 150, 150, null, null, 1694468333, 1564487898, 1558790522, 1680507164, 71583, "SRX12162472", "SRS10140803", "SRA1293390", "Fudan University|School of Life Sciences", "Fudan University", 2, 0.96035, 0.95944, 0.05311, 0.05279, 0.68566, 0.68554, 0.46386, 0.46183, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2021-09-13", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [66076, "SRR15871412", "SRX12162471", "SRS10140801", "SRP336826", "PRJNA762494", "Transcriptomes analysis of ercc2/xpd mutant zebrafish", "PRJNA762494", "Other", "to reveal transcriptional changes in ercc2/xpd mutant zerbafish.", null, null, null, null, "sib D5 2", null, "replicate:biological replicate s5 2|isolate:zerafish|age:5 dpf|sex:not collected|tissue:whole larva|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA Seq of zebrafish larvae", "sib D5 2", "sib D5 2", "transcriptional alterations", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP336826", null, null, "sib_D5_2_1.fq.gz sib_D5_2_2.fq.gz", "fastq fastq", 6595106400.0, 21983688.0, "sib D5 2 1.fq.gz", "0:150 1:150", "A:1704058293;C:1602020249;G:1599065139;T:1689885295;N:77424", 150, 150, null, null, 1704058293, 1602020249, 1599065139, 1689885295, 77424, "SRX12162471", "SRS10140801", "SRA1293390", "Fudan University|School of Life Sciences", "Fudan University", 2, 0.97008, 0.96914, 0.0427, 0.04255, 0.70974, 0.70993, 0.47272, 0.46789, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2021-09-13", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [66077, "SRR15871413", "SRX12162470", "SRS10140802", "SRP336826", "PRJNA762494", "Transcriptomes analysis of ercc2/xpd mutant zebrafish", "PRJNA762494", "Other", "to reveal transcriptional changes in ercc2/xpd mutant zerbafish.", null, null, null, null, "sib D5 1", null, "replicate:biological replicate s5 1|isolate:zerafish|age:5 dpf|sex:not collected|tissue:whole larva|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA Seq of zebrafish larvae", "sib D5 1", "sib D5 1", "transcriptional alterations", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP336826", null, null, "sib_D5_1_1.fq.gz sib_D5_1_2.fq.gz", "fastq fastq", 6593214000.0, 21977380.0, "sib D5 1 1.fq.gz", "0:150 1:150", "A:1721390376;C:1584072112;G:1580857939;T:1706812853;N:80720", 150, 150, null, null, 1721390376, 1584072112, 1580857939, 1706812853, 80720, "SRX12162470", "SRS10140802", "SRA1293390", "Fudan University|School of Life Sciences", "Fudan University", 2, 0.96321, 0.96389, 0.05286, 0.05277, 0.69376, 0.69321, 0.46895, 0.46899, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2021-09-13", "Larval", "Larval", "Whole Organism", "All anatomical structures"]], "truncated": false, "filtered_table_rows_count": 122, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"experiment.library_selection\" = :p0 and \"experiment.library_strategy\" = :p1 and \"tissue_curation_coarse\" = :p2 order by rowid limit 101", "params": {"p0": "other", "p1": "RNA-Seq", "p2": "All anatomical structures"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures", "results": [{"value": "RNA-Seq", "label": "RNA-Seq", "count": 122, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation_coarse=All+anatomical+structures", "selected": true}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 121, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures&experiment.library_source=TRANSCRIPTOMIC", "selected": false}, {"value": "TRANSCRIPTOMIC SINGLE CELL", "label": "TRANSCRIPTOMIC SINGLE CELL", "count": 1, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures&experiment.library_source=TRANSCRIPTOMIC+SINGLE+CELL", "selected": false}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures", "results": [{"value": "other", "label": "other", "count": 122, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures", "selected": true}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures", "results": [{"value": "SINGLE", "label": "SINGLE", "count": 68, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures&experiment.library_layout=SINGLE", "selected": false}, {"value": "PAIRED", "label": "PAIRED", "count": 54, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures&experiment.library_layout=PAIRED", "selected": false}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures", "results": [{"value": "ILLUMINA", "label": "ILLUMINA", "count": 122, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures&experiment.platform=ILLUMINA", "selected": false}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures", "results": [{"value": "Embryo", "label": "Embryo", "count": 76, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures&devstage_curation_coarse=Embryo", "selected": false}, {"value": "Larval", "label": "Larval", "count": 45, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures&devstage_curation_coarse=Larval", "selected": false}, {"value": "Adult", "label": "Adult", "count": 1, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures&devstage_curation_coarse=Adult", "selected": false}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures", "results": [{"value": "Larval", "label": "Larval", "count": 45, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures&devstage_curation=Larval", "selected": false}, {"value": "Undetermined", "label": "Undetermined", "count": 31, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures&devstage_curation=Undetermined", "selected": false}, {"value": "Blastula", "label": "Blastula", "count": 13, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures&devstage_curation=Blastula", "selected": false}, {"value": "Cleavage", "label": "Cleavage", "count": 9, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures&devstage_curation=Cleavage", "selected": false}, {"value": "Segmentation", "label": "Segmentation", "count": 7, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures&devstage_curation=Segmentation", "selected": false}, {"value": "Gastrula", "label": "Gastrula", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures&devstage_curation=Gastrula", "selected": false}, {"value": "Hatching", "label": "Hatching", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures&devstage_curation=Hatching", "selected": false}, {"value": "Pharyngula", "label": "Pharyngula", "count": 4, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures&devstage_curation=Pharyngula", "selected": false}, {"value": "Adult", "label": "Adult", "count": 1, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures&devstage_curation=Adult", "selected": false}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures", "results": [{"value": "All anatomical structures", "label": "All anatomical structures", "count": 122, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq", "selected": true}], "truncated": false}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures", "results": [{"value": "Whole Organism", "label": "Whole Organism", "count": 83, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures&tissue_curation=Whole+Organism", "selected": false}, {"value": "Embryo Imprecise", "label": "Embryo Imprecise", "count": 39, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures&tissue_curation=Embryo+Imprecise", "selected": false}], "truncated": false}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures", "results": [{"value": "unknown", "label": "unknown", "count": 121, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures&technology=unknown", "selected": false}, {"value": "10x", "label": "10x", "count": 1, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures&technology=10x", "selected": false}], "truncated": false}}, "suggested_facets": [], "next": "66077", "next_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation_coarse=All+anatomical+structures&_next=66077", "private": false, "allow_execute_sql": true, "query_ms": 142.36671398975886}