{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where experiment.library_selection = \"other\", experiment.library_strategy = \"RNA-Seq\" and tissue_curation = \"Embryo Imprecise\"", "rows": [[36265, "SRR058073", "SRX022206", "SRS084221", "SRP002640", "PRJNA128943", "Expanding the MicroRNA Targeting Code:  A Novel Type of Site with Centered Pairing", "GSE22068", "Other", "We present \u201ccentered sites \u201d a class of microRNA target sites that lacks both perfect seed pairing and three prime compensatory pairing and instead has 11\u201312 contiguous Watson\u2013Crick pairs to the center of the microRNA.  In elevated Mg2+  centered sites impart mRNA cleavage  but in cells  centered sites repress protein output without xxx Agronaute catalyzed cleavage.  Our study also identified novel extensively paired sites that are cleavage substrates in cultured cells and human brain.  This expanded repertoire of cleavage targets and the identification of the centered site type help explain why central regions of many microRNAs are evolutionarily conserved. Overall design: To study centered sites and identify miRNA cleavage targets  mRNA degradomes were sequenced from human brain and HeLa cells  and smallRNAs were sequenced from human brain and zebrafish embryo at 24 hpf. Replicates were combined before the analysis. Fastq files are not available for GSM548638 and GSM548639.", null, "pubmed:20620952", null, "Zebrafish Embryo small RNAs", "GSM548640", null, "source name:Embryo Cells|data type:small RNAs|tissue:embryo", "Zebrafish Embryo small RNAs", "Small RNA sequences from same total RNA samples were mapped to the human genome hg18  requiring a perfect match  and reads co localizing to annotated miRNA loci miRBase  version 11.0 were counted. sequence reads are summarized as frequency counts", "Embryo Cells", null, "The small RNA cDNA libraries were made as described Grimson et al. 2008  except for the three prime adaptor ligation  which was five prime adenylated pTCGTATGCCGTCTTCTGCTTGidT. For a detailed protocol  see http://web.wi.mit.edu/bartel/pub/protocols.html.", null, "data type:small RNAs|tissue:embryo", "GSM548640", "GSM548640: Zebrafish Embryo small RNAs", "GSM548640: Zebrafish Embryo small RNAs", "GSM548640: Zebrafish Embryo small RNAs", "1", null, "GEO Accession:GSM548640", "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP002640", null, "quality book char:@|quality scoring system:log odds", "Zebrafish_embryo_24h.fastq", "fastq", 62213148.0, 1728143.0, "GSM548640 1", "0:36", "A:13550515;C:14269249;G:15670049;T:18673533;N:49802", 36, null, null, null, 13550515, 14269249, 15670049, 18673533, 49802, "SRX022206", "SRS084221", "SRA020539", "GEO", "Bartel lab, Whitehead Institute", 1, 0.02298, null, 0.02186, null, 0.9988, null, 0.3246, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United States", "2010-06-01", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [40214, "SRR2982513", "SRX1471725", "SRS1197481", "SRP067139", "PRJNA305418", "RiboZero mRNA seq across zebrafish development  for study of uORFs", "PRJNA305418", "Other", "Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs  the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing  we find that i uORFs are pervasive within vertebrate transcriptomes  ii the majority show signatures of active translation  and iii uORFs act as potent regulators of translation and RNA levels  with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally  we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values.", null, null, null, "48hpf", "AG00751 mrna r0 48h", null, "strain:TUAB|age:48hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "AG00751 mrna r0 48h", "48h mRNA R0", "1", "Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al  2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific  single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ  single end  75nt reads", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP067139", null, null, "AG00751_SEQ0112_R1.fastq.gz", "fastq", 1859082512.0, 24461612.0, "48h mRNA R0 run1", "0:76", "A:488142494;C:422062452;G:411293722;T:537489879;N:93965", 76, null, null, null, 488142494, 422062452, 411293722, 537489879, 93965, "SRX1471725", "SRS1197481", "SRA314809", "Yale University|Giraldez Lab", "Yale University", 1, 0.8583, null, 0.37297, null, 0.6956, null, 0.46541, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "rrna_depletion", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2015-12-08", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [40215, "SRR2982514", "SRX1471724", "SRS1197482", "SRP067139", "PRJNA305418", "RiboZero mRNA seq across zebrafish development  for study of uORFs", "PRJNA305418", "Other", "Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs  the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing  we find that i uORFs are pervasive within vertebrate transcriptomes  ii the majority show signatures of active translation  and iii uORFs act as potent regulators of translation and RNA levels  with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally  we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values.", null, null, null, "24hpf", "AG00750 mrna r0 24h", null, "strain:TUAB|age:24hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "AG00750 mrna r0 24h", "24h mRNA R0", "1", "Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al  2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific  single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ  single end  75nt reads", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP067139", null, null, "AG00750_SEQ0114_R1.fastq.gz", "fastq", 2124277824.0, 27951024.0, "24h mRNA R0 run1", "0:76", "A:537946274;C:496576029;G:477023623;T:612576823;N:155075", 76, null, null, null, 537946274, 496576029, 477023623, 612576823, 155075, "SRX1471724", "SRS1197482", "SRA314809", "Yale University|Giraldez Lab", "Yale University", 1, 0.86054, null, 0.27207, null, 0.69877, null, 0.47063, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "rrna_depletion", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2015-12-08", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [40216, "SRR2982511", "SRX1471723", "SRS1197479", "SRP067139", "PRJNA305418", "RiboZero mRNA seq across zebrafish development  for study of uORFs", "PRJNA305418", "Other", "Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs  the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing  we find that i uORFs are pervasive within vertebrate transcriptomes  ii the majority show signatures of active translation  and iii uORFs act as potent regulators of translation and RNA levels  with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally  we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values.", null, null, null, "12hpf", "AG00434 mrna r0 12h", null, "strain:TUAB|age:12hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "AG00434 mrna r0 12h", "12h mRNA R0", "1", "Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al  2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific  single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ  single end  75nt reads", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP067139", null, null, "AG00434_SEQ0071_R1.fastq.gz", "fastq", 1990422368.0, 26189768.0, "12h mRNA R0 run1", "0:76", "A:512242204;C:469314942;G:452176134;T:556618667;N:70421", 76, null, null, null, 512242204, 469314942, 452176134, 556618667, 70421, "SRX1471723", "SRS1197479", "SRA314809", "Yale University|Giraldez Lab", "Yale University", 1, 0.88085, null, 0.297, null, 0.71711, null, 0.46053, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "rrna_depletion", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2015-12-08", "Segmentation", "Embryo", "Embryo Imprecise", "All anatomical structures"], [40217, "SRR2982512", "SRX1471722", "SRS1197480", "SRP067139", "PRJNA305418", "RiboZero mRNA seq across zebrafish development  for study of uORFs", "PRJNA305418", "Other", "Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs  the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing  we find that i uORFs are pervasive within vertebrate transcriptomes  ii the majority show signatures of active translation  and iii uORFs act as potent regulators of translation and RNA levels  with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally  we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values.", null, null, null, "5hpf", "AG00749 mrna r0 5h", null, "strain:TUAB|age:5hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "AG00749 mrna r0 5h", "5h mRNA R0", "1", "Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al  2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific  single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ  single end  75nt reads", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP067139", null, null, "AG00749_SEQ0114_R1.fastq.gz", "fastq", 3163721996.0, 41627921.0, "5h mRNA R0 run1", "0:76", "A:724093110;C:806620205;G:798759186;T:834042462;N:207033", 76, null, null, null, 724093110, 806620205, 798759186, 834042462, 207033, "SRX1471722", "SRS1197480", "SRA314809", "Yale University|Giraldez Lab", "Yale University", 1, 0.75274, null, 0.23572, null, 0.75448, null, 0.47885, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "rrna_depletion", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2015-12-08", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [40218, "SRR2982510", "SRX1471511", "SRS1197399", "SRP067139", "PRJNA305418", "RiboZero mRNA seq across zebrafish development  for study of uORFs", "PRJNA305418", "Other", "Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs  the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing  we find that i uORFs are pervasive within vertebrate transcriptomes  ii the majority show signatures of active translation  and iii uORFs act as potent regulators of translation and RNA levels  with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally  we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values.", null, null, null, "2hpf", "AG00244 mrna r0 2h", null, "strain:TUAB|age:2hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "AG00244 mrna r0 2h", "2h mRNA R0", "1", "Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al  2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific  single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ  single end  75nt reads", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP067139", null, null, "AG00244_SEQ0039_R1.fastq.gz", "fastq", 1010085524.0, 13290599.0, "2h mRNA R0 run1", "0:76", "A:196715560;C:309406513;G:286228000;T:217670217;N:65234", 76, null, null, null, 196715560, 309406513, 286228000, 217670217, 65234, "SRX1471511", "SRS1197399", "SRA314809", "Yale University|Giraldez Lab", "Yale University", 1, 0.89974, null, 0.14215, null, 0.79488, null, 0.72171, null, 76, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "rrna_depletion", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2015-12-08", "Cleavage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43402, "SRR5931544", "SRX3091819", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "with difenoconazole", "397969", "397969", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4755826950.0, 31705513.0, "D 500 1 2.fq.gz", "0:0 1:150", "A:1274207449;C:1094727902;G:1122524378;T:1264331427;N:35794", 0, 150, null, null, 1274207449, 1094727902, 1122524378, 1264331427, 35794, "SRX3091819", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.91191, null, 0.10926, null, 0.68341, null, 0.47196, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43403, "SRR5931545", "SRX3091818", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "with difenoconazole", "397968", "397968", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4755826950.0, 31705513.0, "D 500 1 1.fq.gz", "0:150 1:0", "A:1276129214;C:1100761964;G:1115345594;T:1263574047;N:16131", 150, 0, null, null, 1276129214, 1100761964, 1115345594, 1263574047, 16131, "SRX3091818", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.91044, null, 0.10895, null, 0.67659, null, 0.46952, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43404, "SRR5931546", "SRX3091817", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "with difenoconazole", "397967", "397967", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4584658950.0, 30564393.0, "D 50 3 2.fq.gz", "0:0 1:150", "A:1214232270;C:1065003267;G:1091428812;T:1213867330;N:127271", 0, 150, null, null, 1214232270, 1065003267, 1091428812, 1213867330, 127271, "SRX3091817", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.92229, null, 0.10554, null, 0.68667, null, 0.4535, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43405, "SRR5931547", "SRX3091816", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "with difenoconazole", "397966", "397966", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4584658950.0, 30564393.0, "D 50 3 1.fq.gz", "0:150 1:0", "A:1219702088;C:1067643780;G:1085480895;T:1211806100;N:26087", 150, 0, null, null, 1219702088, 1067643780, 1085480895, 1211806100, 26087, "SRX3091816", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.92126, null, 0.10598, null, 0.68398, null, 0.44901, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43406, "SRR5931548", "SRX3091815", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "with difenoconazole", "397973", "397973", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4705867200.0, 31372448.0, "D 500 3 2.fq.gz", "0:0 1:150", "A:1240294141;C:1111008282;G:1125861755;T:1228667971;N:35051", 0, 150, null, null, 1240294141, 1111008282, 1125861755, 1228667971, 35051, "SRX3091815", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.92297, null, 0.09739, null, 0.6856, null, 0.47451, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43407, "SRR5931549", "SRX3091814", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "with difenoconazole", "397972", "397972", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4705867200.0, 31372448.0, "D 500 3 1.fq.gz", "0:150 1:0", "A:1241514886;C:1108723884;G:1123339576;T:1232273510;N:15344", 150, 0, null, null, 1241514886, 1108723884, 1123339576, 1232273510, 15344, "SRX3091814", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.92062, null, 0.09796, null, 0.67856, null, 0.47388, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43408, "SRR5931550", "SRX3091813", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "with difenoconazole", "397971", "397971", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4750951350.0, 31673009.0, "D 500 2 2.fq.gz", "0:0 1:150", "A:1286144024;C:1079544004;G:1112952985;T:1272274928;N:35409", 0, 150, null, null, 1286144024, 1079544004, 1112952985, 1272274928, 35409, "SRX3091813", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.90446, null, 0.13747, null, 0.68639, null, 0.46726, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43409, "SRR5931551", "SRX3091812", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "with difenoconazole", "397970", "397970", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4750951350.0, 31673009.0, "D 500 2 1.fq.gz", "0:150 1:0", "A:1287515334;C:1090783234;G:1101469034;T:1271168008;N:15740", 150, 0, null, null, 1287515334, 1090783234, 1101469034, 1271168008, 15740, "SRX3091812", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.90214, null, 0.13756, null, 0.68158, null, 0.46719, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43410, "SRR5931552", "SRX3091811", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "without xxx", "397957", "397957", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4071934650.0, 27146231.0, "CK 1 2.fq.gz", "0:0 1:150", "A:1052229682;C:975525985;G:991345538;T:1052207035;N:626410", 0, 150, null, null, 1052229682, 975525985, 991345538, 1052207035, 626410, "SRX3091811", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.93603, null, 0.0589, null, 0.71492, null, 0.48298, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43411, "SRR5931553", "SRX3091810", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "without xxx", "397956", "397956", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4071934650.0, 27146231.0, "CK 1 1.fq.gz", "0:150 1:0", "A:1057694098;C:975549420;G:988477956;T:1049766896;N:446280", 150, 0, null, null, 1057694098, 975549420, 988477956, 1049766896, 446280, "SRX3091810", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.93688, null, 0.05854, null, 0.7091, null, 0.48309, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43412, "SRR5931554", "SRX3091809", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "without xxx", "397959", "397959", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4343291550.0, 28955277.0, "CK 2 2.fq.gz", "0:0 1:150", "A:1153253014;C:1007267471;G:1028912357;T:1153739160;N:119548", 0, 150, null, null, 1153253014, 1007267471, 1028912357, 1153739160, 119548, "SRX3091809", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.9209, null, 0.11211, null, 0.68649, null, 0.45293, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43413, "SRR5931555", "SRX3091808", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "without xxx", "397958", "397958", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4343291550.0, 28955277.0, "CK 2 1.fq.gz", "0:150 1:0", "A:1157702407;C:1008975846;G:1024287434;T:1151988746;N:337117", 150, 0, null, null, 1157702407, 1008975846, 1024287434, 1151988746, 337117, "SRX3091808", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.91946, null, 0.11191, null, 0.6828, null, 0.45241, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43414, "SRR5931556", "SRX3091807", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "without xxx", "397961", "397961", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4518061050.0, 30120407.0, "CK 3 2.fq.gz", "0:0 1:150", "A:1188586431;C:1058258572;G:1080153332;T:1190907666;N:155049", 0, 150, null, null, 1188586431, 1058258572, 1080153332, 1190907666, 155049, "SRX3091807", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.92512, null, 0.09744, null, 0.69085, null, 0.45772, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43415, "SRR5931557", "SRX3091806", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "without xxx", "397960", "397960", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4518061050.0, 30120407.0, "CK 3 1.fq.gz", "0:150 1:0", "A:1195164171;C:1059996453;G:1074722334;T:1188143044;N:35048", 150, 0, null, null, 1195164171, 1059996453, 1074722334, 1188143044, 35048, "SRX3091806", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.9249, null, 0.09772, null, 0.68562, null, 0.45606, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43416, "SRR5931558", "SRX3091805", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "with difenoconazole", "397963", "397963", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4572900600.0, 30486004.0, "D 50 1 2.fq.gz", "0:0 1:150", "A:1218364634;C:1054987971;G:1079106780;T:1220261884;N:179331", 0, 150, null, null, 1218364634, 1054987971, 1079106780, 1220261884, 179331, "SRX3091805", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.91953, null, 0.11512, null, 0.68722, null, 0.45056, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43417, "SRR5931559", "SRX3091804", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "with difenoconazole", "397962", "397962", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4572900600.0, 30486004.0, "D 50 1 1.fq.gz", "0:150 1:0", "A:1223844243;C:1057030107;G:1074694968;T:1217286959;N:44323", 150, 0, null, null, 1223844243, 1057030107, 1074694968, 1217286959, 44323, "SRX3091804", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.91779, null, 0.1149, null, 0.68258, null, 0.46006, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43418, "SRR5931560", "SRX3091803", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "with difenoconazole", "397965", "397965", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4595232150.0, 30634881.0, "D 50 2 2.fq.gz", "0:0 1:150", "A:1225033548;C:1062169088;G:1082021478;T:1225833369;N:174667", 0, 150, null, null, 1225033548, 1062169088, 1082021478, 1225833369, 174667, "SRX3091803", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", 1, 0.91827, null, 0.11697, null, 0.68511, null, 0.44407, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [43419, "SRR5931561", "SRX3091802", "SRS2429165", "SRP115388", "PRJNA397956", "Danio rerio strain:AB wild type | isolate:CK  Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads", "PRJNA397956", "Whole Genome Sequencing", "To evaluate underlying environmental risks of difenoconazole in aquatic organisms", null, null, "To evaluate underlying environmental risks of difenoconazole in zebrafish embryo", "Model organism or animal sample from Danio rerio", "Zebrafish", null, "strain:AB wild type|isolate:CK  Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "with difenoconazole", "397964", "397964", "to evulate the environmental risks of difenoconazole in zebrafish embryo", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP115388", null, null, null, null, 4595232150.0, 30634881.0, "D 50 2 1.fq.gz", "0:150 1:0", "A:1231719851;C:1064618233;G:1076698645;T:1222155912;N:39509", 150, 0, null, null, 1231719851, 1064618233, 1076698645, 1222155912, 39509, "SRX3091802", "SRS2429165", "SRA598900", "China Agricultural University|College of Sciences", "China Agricultural University", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2017-08-14", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [47735, "SRR6846413", "SRX3801804", "SRS3053760", "SRP135842", "PRJNA438572", "RNA seq of embryo stimulated by interferons in Danio rerio", "PRJNA438572", "Other", "RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.", null, null, null, null, "IFNY", null, "strain:missing|isolate:missing|breed:missing|cultivar:missing|ecotype:missing|age:missing|dev stage:stimulated by interferons|sex:missing|tissue:embryo|collection date:2017 03 12|geo loc name:China:Wuhan|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA seq of embryo stimulated by interferons in Danio rerio", "IFNY", "IFNY", "RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP135842", null, null, "IFNY_S13_L004_R2_001.fastq.gz IFNY_S13_L004_R1_001.fastq.gz", "fastq fastq", 8611053142.0, 28513421.0, "IFNY S13 L004 R1 001.fastq.gz", "0:151 1:151", "A:2172756042;C:2133682578;G:2133331951;T:2170977207;N:305364", 151, 151, null, null, 2172756042, 2133682578, 2133331951, 2170977207, 305364, "SRX3801804", "SRS3053760", "SRA666995", "Chinese Academy of Sciences|Institute of Hydrobiology", "Chinese Academy of Sciences", 2, 0.955, 0.95804, 0.04308, 0.04392, 0.70218, 0.71033, 0.46525, 0.462, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2018-03-16", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [47736, "SRR6846414", "SRX3801803", "SRS3053759", "SRP135842", "PRJNA438572", "RNA seq of embryo stimulated by interferons in Danio rerio", "PRJNA438572", "Other", "RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.", null, null, null, null, "vector", null, "strain:missing|isolate:missing|breed:missing|cultivar:missing|ecotype:missing|age:missing|dev stage:stimulated by interferons|sex:missing|tissue:embryo|collection date:2017 03 11|geo loc name:China:Wuhan|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA seq of embryo stimulated by interferons in Danio rerio", "vector", "vector", "RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP135842", null, null, "vector_S12_L004_R1_001.fastq.gz vector_S12_L004_R2_001.fastq.gz", "fastq fastq", 10279577472.0, 34038336.0, "vector S12 L004 R1 001.fastq.gz", "0:151 1:151", "A:2615896150;C:2524788585;G:2528030423;T:2610500306;N:362008", 151, 151, null, null, 2615896150, 2524788585, 2528030423, 2610500306, 362008, "SRX3801803", "SRS3053759", "SRA666995", "Chinese Academy of Sciences|Institute of Hydrobiology", "Chinese Academy of Sciences", 2, 0.9555, 0.9579, 0.04617, 0.04728, 0.70337, 0.71072, 0.46191, 0.46954, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2018-03-16", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [47737, "SRR6846415", "SRX3801802", "SRS3053756", "SRP135842", "PRJNA438572", "RNA seq of embryo stimulated by interferons in Danio rerio", "PRJNA438572", "Other", "RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.", null, null, null, null, "IFNG", null, "strain:missing|isolate:missing|breed:missing|cultivar:missing|ecotype:missing|age:missing|dev stage:stimulated by interferons|sex:missing|tissue:embryo|collection date:2017 03 14|geo loc name:China:Wuhan|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA seq of embryo stimulated by interferons in Danio rerio", "IFNG", "IFNG", "RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP135842", null, null, "IFNG_S15_L004_R1_001.fastq.gz IFNG_S15_L004_R2_001.fastq.gz", "fastq fastq", 9082411722.0, 30074211.0, "IFNG S15 L004 R2 001.fastq.gz", "0:151 1:151", "A:2283553036;C:2258886090;G:2257807913;T:2281843116;N:321567", 151, 151, null, null, 2283553036, 2258886090, 2257807913, 2281843116, 321567, "SRX3801802", "SRS3053756", "SRA666995", "Chinese Academy of Sciences|Institute of Hydrobiology", "Chinese Academy of Sciences", 2, 0.95442, 0.95794, 0.03954, 0.04042, 0.70694, 0.71674, 0.45987, 0.45045, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2021-01-01", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [47738, "SRR6846416", "SRX3801801", "SRS3053758", "SRP135842", "PRJNA438572", "RNA seq of embryo stimulated by interferons in Danio rerio", "PRJNA438572", "Other", "RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.", null, null, null, null, "IFN1", null, "strain:missing|isolate:missing|breed:missing|cultivar:missing|ecotype:missing|age:missing|dev stage:stimulated by interferons|sex:missing|tissue:embryo|collection date:2017 03 13|geo loc name:China:Wuhan|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA seq of embryo stimulated by interferons in Danio rerio", "IFN1", "IFN1", "RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP135842", null, null, "IFN1_S14_L004_R1_001.fastq.gz IFN1_S14_L004_R2_001.fastq.gz", "fastq fastq", 9801986820.0, 32456910.0, "IFN1 S14 L004 R2 001.fastq.gz", "0:151 1:151", "A:2476732153;C:2426531434;G:2425138255;T:2473239913;N:345065", 151, 151, null, null, 2476732153, 2426531434, 2425138255, 2473239913, 345065, "SRX3801801", "SRS3053758", "SRA666995", "Chinese Academy of Sciences|Institute of Hydrobiology", "Chinese Academy of Sciences", 2, 0.95422, 0.9559, 0.0427, 0.04366, 0.7068, 0.71467, 0.45683, 0.46354, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2021-01-01", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [47739, "SRR6846417", "SRX3801800", "SRS3053757", "SRP135842", "PRJNA438572", "RNA seq of embryo stimulated by interferons in Danio rerio", "PRJNA438572", "Other", "RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.", null, null, null, null, "IFN3", null, "strain:missing|isolate:missing|breed:missing|cultivar:missing|ecotype:missing|age:missing|dev stage:stimulated by interferons|sex:missing|tissue:embryo|collection date:2017 03 15|geo loc name:China:Wuhan|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA seq of embryo stimulated by interferons in Danio rerio", "IFN3", "IFN3", "RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP135842", null, null, "IFN3_S16_L004_R2_001.fastq.gz IFN3_S16_L004_R1_001.fastq.gz", "fastq fastq", 8628116746.0, 28569923.0, "IFN3 S16 L004 R2 001.fastq.gz", "0:151 1:151", "A:2178313667;C:2137778611;G:2137088678;T:2174631627;N:304163", 151, 151, null, null, 2178313667, 2137778611, 2137088678, 2174631627, 304163, "SRX3801800", "SRS3053757", "SRA666995", "Chinese Academy of Sciences|Institute of Hydrobiology", "Chinese Academy of Sciences", 2, 0.95589, 0.95838, 0.04186, 0.04249, 0.70587, 0.71376, 0.44245, 0.46157, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "China", "2021-01-01", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [69402, "SRR18516945", "SRX14648017", "SRS12413419", "SRP366502", "PRJNA821148", "CAGE seq total and nuclear RNA and nanT iCAGE acrosss 6 developmental stages", "PRJNA821148", "Other", "In order to compare mRNA expression in the whole cell and the nucleus during development  we prepared CAGE seq libraries from total RNA as well as only from nuclear RNA as well as nanti CAGE on 6 developmental stages", null, null, null, null, "DCD007415BS", null, "strain:AB|age:4.7hpf|dev stage:zfs:0000015|sex:not applicable|tissue:early embryonic cell|biomaterial provider:Mueller lab  University of Birmingham|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "nanT iCAGE zfs:0000015", "DCD003635SQ", "DCD003635SQ", "nanT iCAGE with Total RNA  max read depth: 48", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP366502", null, null, "CAGE-seq_Mueller_lab_0008AS.DCD003635SQ.USERirene.stevens.R1.fastq.gz", "fastq", 294441504.0, 6134198.0, "CAGE seq Mueller lab 0008AS.DCD003635SQ.USERirene.stevens.R1.fastq.gz", "0:48 1:0", "A:79426328;C:71077605;G:78480399;T:65051436;N:405736", 48, 0, null, null, 79426328, 71077605, 78480399, 65051436, 405736, "SRX14648017", "SRS12413419", "SRA1393751", "DANIO-CODE|Department for Biosciences and Nutrition", "DANIO-CODE DANIO-CODE", 1, 0.85189, null, 0.16254, null, 0.81716, null, 0.63115, null, 48, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "Unknown", "2022-03-29", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [69403, "SRR18516946", "SRX14648016", "SRS12413419", "SRP366502", "PRJNA821148", "CAGE seq total and nuclear RNA and nanT iCAGE acrosss 6 developmental stages", "PRJNA821148", "Other", "In order to compare mRNA expression in the whole cell and the nucleus during development  we prepared CAGE seq libraries from total RNA as well as only from nuclear RNA as well as nanti CAGE on 6 developmental stages", null, null, null, null, "DCD007415BS", null, "strain:AB|age:4.7hpf|dev stage:zfs:0000015|sex:not applicable|tissue:early embryonic cell|biomaterial provider:Mueller lab  University of Birmingham|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "nanT iCAGE zfs:0000015", "DCD003631SQ", "DCD003631SQ", "nanT iCAGE with Total RNA  max read depth: 48", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP366502", null, null, "CAGE-seq_Mueller_lab_0008AS.DCD003631SQ.USERirene.stevens.R1.fastq.gz", "fastq", 334998768.0, 6979141.0, "CAGE seq Mueller lab 0008AS.DCD003631SQ.USERirene.stevens.R1.fastq.gz", "0:48 1:0", "A:90775534;C:79265953;G:87566501;T:76935994;N:454786", 48, 0, null, null, 90775534, 79265953, 87566501, 76935994, 454786, "SRX14648016", "SRS12413419", "SRA1393751", "DANIO-CODE|Department for Biosciences and Nutrition", "DANIO-CODE DANIO-CODE", 1, 0.82791, null, 0.15938, null, 0.81302, null, 0.61851, null, 48, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "Unknown", "2022-03-29", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [69404, "SRR18516947", "SRX14648015", "SRS12413417", "SRP366502", "PRJNA821148", "CAGE seq total and nuclear RNA and nanT iCAGE acrosss 6 developmental stages", "PRJNA821148", "Other", "In order to compare mRNA expression in the whole cell and the nucleus during development  we prepared CAGE seq libraries from total RNA as well as only from nuclear RNA as well as nanti CAGE on 6 developmental stages", null, null, null, null, "DCD007416BS", null, "strain:AB|age:2.25hpf|dev stage:128 cell|sex:not applicable|tissue:early embryonic cell|biomaterial provider:Mueller lab  University of Birmingham|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "nanT iCAGE 128 cell", "DCD003641SQ", "DCD003641SQ", "nanT iCAGE with Total RNA  max read depth: 48", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP366502", null, null, "CAGE-seq_Mueller_lab_0008AS.DCD003641SQ.USERirene.stevens.R1.fastq.gz", "fastq", 266018592.0, 5542054.0, "CAGE seq Mueller lab 0008AS.DCD003641SQ.USERirene.stevens.R1.fastq.gz", "0:48 1:0", "A:71393510;C:62894111;G:70482522;T:60880917;N:367532", 48, 0, null, null, 71393510, 62894111, 70482522, 60880917, 367532, "SRX14648015", "SRS12413417", "SRA1393751", "DANIO-CODE|Department for Biosciences and Nutrition", "DANIO-CODE DANIO-CODE", 1, 0.82888, null, 0.12766, null, 0.79437, null, 0.67583, null, 48, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "Unknown", "2022-03-29", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [69405, "SRR18516948", "SRX14648014", "SRS12413417", "SRP366502", "PRJNA821148", "CAGE seq total and nuclear RNA and nanT iCAGE acrosss 6 developmental stages", "PRJNA821148", "Other", "In order to compare mRNA expression in the whole cell and the nucleus during development  we prepared CAGE seq libraries from total RNA as well as only from nuclear RNA as well as nanti CAGE on 6 developmental stages", null, null, null, null, "DCD007416BS", null, "strain:AB|age:2.25hpf|dev stage:128 cell|sex:not applicable|tissue:early embryonic cell|biomaterial provider:Mueller lab  University of Birmingham|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "nanT iCAGE 128 cell", "DCD003638SQ", "DCD003638SQ", "nanT iCAGE with Total RNA  max read depth: 48", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP366502", null, null, "CAGE-seq_Mueller_lab_0008AS.DCD003638SQ.USERirene.stevens.R1.fastq.gz", "fastq", 244530816.0, 5094392.0, "CAGE seq Mueller lab 0008AS.DCD003638SQ.USERirene.stevens.R1.fastq.gz", "0:48 1:0", "A:63996450;C:58644251;G:70160025;T:51392278;N:337812", 48, 0, null, null, 63996450, 58644251, 70160025, 51392278, 337812, "SRX14648014", "SRS12413417", "SRA1393751", "DANIO-CODE|Department for Biosciences and Nutrition", "DANIO-CODE DANIO-CODE", 1, 0.86857, null, 0.164, null, 0.80852, null, 0.72718, null, 48, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "Unknown", "2022-03-29", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [69406, "SRR18516949", "SRX14648013", "SRS12413416", "SRP366502", "PRJNA821148", "CAGE seq total and nuclear RNA and nanT iCAGE acrosss 6 developmental stages", "PRJNA821148", "Other", "In order to compare mRNA expression in the whole cell and the nucleus during development  we prepared CAGE seq libraries from total RNA as well as only from nuclear RNA as well as nanti CAGE on 6 developmental stages", null, null, null, null, "DCD007417BS", null, "strain:AB|age:2.75hpf|dev stage:512 cell|sex:not applicable|tissue:early embryonic cell|biomaterial provider:Mueller lab  University of Birmingham|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "nanT iCAGE 512 cell", "DCD003640SQ", "DCD003640SQ", "nanT iCAGE with Total RNA  max read depth: 48", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP366502", null, null, "CAGE-seq_Mueller_lab_0008AS.DCD003640SQ.USERirene.stevens.R1.fastq.gz", "fastq", 389471904.0, 8113998.0, "CAGE seq Mueller lab 0008AS.DCD003640SQ.USERirene.stevens.R1.fastq.gz", "0:48 1:0", "A:106010507;C:93511522;G:101307749;T:88105339;N:536787", 48, 0, null, null, 106010507, 93511522, 101307749, 88105339, 536787, "SRX14648013", "SRS12413416", "SRA1393751", "DANIO-CODE|Department for Biosciences and Nutrition", "DANIO-CODE DANIO-CODE", 1, 0.88886, null, 0.17661, null, 0.80624, null, 0.71804, null, 48, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "Unknown", "2022-03-29", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [69407, "SRR18516950", "SRX14648012", "SRS12413416", "SRP366502", "PRJNA821148", "CAGE seq total and nuclear RNA and nanT iCAGE acrosss 6 developmental stages", "PRJNA821148", "Other", "In order to compare mRNA expression in the whole cell and the nucleus during development  we prepared CAGE seq libraries from total RNA as well as only from nuclear RNA as well as nanti CAGE on 6 developmental stages", null, null, null, null, "DCD007417BS", null, "strain:AB|age:2.75hpf|dev stage:512 cell|sex:not applicable|tissue:early embryonic cell|biomaterial provider:Mueller lab  University of Birmingham|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "nanT iCAGE 512 cell", "DCD003642SQ", "DCD003642SQ", "nanT iCAGE with Total RNA  max read depth: 48", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP366502", null, null, "CAGE-seq_Mueller_lab_0008AS.DCD003642SQ.USERirene.stevens.R1.fastq.gz", "fastq", 336311136.0, 7006482.0, "CAGE seq Mueller lab 0008AS.DCD003642SQ.USERirene.stevens.R1.fastq.gz", "0:48 1:0", "A:90213623;C:77505515;G:88574792;T:79555106;N:462100", 48, 0, null, null, 90213623, 77505515, 88574792, 79555106, 462100, "SRX14648012", "SRS12413416", "SRA1393751", "DANIO-CODE|Department for Biosciences and Nutrition", "DANIO-CODE DANIO-CODE", 1, 0.81351, null, 0.11572, null, 0.78792, null, 0.61957, null, 48, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "Unknown", "2022-03-29", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [69408, "SRR18516951", "SRX14648011", "SRS12413418", "SRP366502", "PRJNA821148", "CAGE seq total and nuclear RNA and nanT iCAGE acrosss 6 developmental stages", "PRJNA821148", "Other", "In order to compare mRNA expression in the whole cell and the nucleus during development  we prepared CAGE seq libraries from total RNA as well as only from nuclear RNA as well as nanti CAGE on 6 developmental stages", null, null, null, null, "DCD007418BS", null, "strain:AB|age:24hpf|dev stage:Prim 5|sex:not applicable|tissue:early embryonic cell|biomaterial provider:Mueller lab  University of Birmingham|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "tagging CAGE Prim 5", "DCD003639SQ", "DCD003639SQ", "tagging CAGE with Nuclear RNA  max read depth: 27", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP366502", null, null, "CAGE-seq_Mueller_lab_0007AS.DCD003639SQ.USERirene.stevens.R1.fastq.gz", "fastq", 1328398677.0, 49199951.0, "CAGE seq Mueller lab 0007AS.DCD003639SQ.USERirene.stevens.R1.fastq.gz", "0:27 1:0", "A:347247893;C:293260323;G:377992379;T:309837948;N:60134", 27, 0, null, null, 347247893, 293260323, 377992379, 309837948, 60134, "SRX14648011", "SRS12413418", "SRA1393751", "DANIO-CODE|Department for Biosciences and Nutrition", "DANIO-CODE DANIO-CODE", 1, 0.46699, null, 0.13006, null, 0.78332, null, 0.8225, null, 27, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "Unknown", "2022-03-29", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [69409, "SRR18516952", "SRX14648010", "SRS12413415", "SRP366502", "PRJNA821148", "CAGE seq total and nuclear RNA and nanT iCAGE acrosss 6 developmental stages", "PRJNA821148", "Other", "In order to compare mRNA expression in the whole cell and the nucleus during development  we prepared CAGE seq libraries from total RNA as well as only from nuclear RNA as well as nanti CAGE on 6 developmental stages", null, null, null, null, "DCD007419BS", null, "strain:AB|age:1.5hpf|dev stage:16 cell|sex:not applicable|tissue:early embryonic cell|biomaterial provider:Mueller lab  University of Birmingham|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "nanT iCAGE 16 cell", "DCD003632SQ", "DCD003632SQ", "nanT iCAGE with Total RNA  max read depth: 48", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP366502", null, null, "CAGE-seq_Mueller_lab_0008AS.DCD003632SQ.USERirene.stevens.R1.fastq.gz", "fastq", 392835168.0, 8184066.0, "CAGE seq Mueller lab 0008AS.DCD003632SQ.USERirene.stevens.R1.fastq.gz", "0:48 1:0", "A:106127709;C:94140127;G:103587770;T:88439881;N:539681", 48, 0, null, null, 106127709, 94140127, 103587770, 88439881, 539681, "SRX14648010", "SRS12413415", "SRA1393751", "DANIO-CODE|Department for Biosciences and Nutrition", "DANIO-CODE DANIO-CODE", 1, 0.87892, null, 0.18576, null, 0.80509, null, 0.63419, null, 48, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "Unknown", "2022-03-29", "Cleavage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [69410, "SRR18516953", "SRX14648009", "SRS12413415", "SRP366502", "PRJNA821148", "CAGE seq total and nuclear RNA and nanT iCAGE acrosss 6 developmental stages", "PRJNA821148", "Other", "In order to compare mRNA expression in the whole cell and the nucleus during development  we prepared CAGE seq libraries from total RNA as well as only from nuclear RNA as well as nanti CAGE on 6 developmental stages", null, null, null, null, "DCD007419BS", null, "strain:AB|age:1.5hpf|dev stage:16 cell|sex:not applicable|tissue:early embryonic cell|biomaterial provider:Mueller lab  University of Birmingham|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "nanT iCAGE 16 cell", "DCD003637SQ", "DCD003637SQ", "nanT iCAGE with Total RNA  max read depth: 48", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP366502", null, null, "CAGE-seq_Mueller_lab_0008AS.DCD003637SQ.USERirene.stevens.R1.fastq.gz", "fastq", 225142368.0, 4690466.0, "CAGE seq Mueller lab 0008AS.DCD003637SQ.USERirene.stevens.R1.fastq.gz", "0:48 1:0", "A:61697148;C:52348969;G:58818293;T:51968512;N:309446", 48, 0, null, null, 61697148, 52348969, 58818293, 51968512, 309446, "SRX14648009", "SRS12413415", "SRA1393751", "DANIO-CODE|Department for Biosciences and Nutrition", "DANIO-CODE DANIO-CODE", 1, 0.8438, null, 0.1185, null, 0.78476, null, 0.66042, null, 48, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "bulk", "unknown", "unknown", null, "Unknown", "2022-03-29", "Cleavage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [75444, "SRR24630527", "SRX20411156", "SRS17723880", "SRP438317", "PRJNA973246", "Differentiating zebrafish slow muscle precursor expression profiles", "PRJNA973246", "Other", "Zebrafish slow muscle precursor stereotypical behaviours were well characterized  but their related gene signatures remained unknown. We characterized the trajectory and gene signatures of differentiating slow muscle precursor using single cell RNA sequencing.", null, null, null, "Model organism or animal sample from Danio rerio", "differentiating adaxial cell", null, "strain:smyhc1:gfp injected|age:18 hpf|dev stage:18 hpf|sex:missing|tissue:embryos|collection date:2021 03 04|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "scRNAseq of smyhc1:gfp zebrafish cells", "Lib Adaxial cells 10X", "Lib Adaxial cells 10X", "10X genomics single cell three prime v3.1", null, null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "other", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP438317", null, "loader:fastq load.py", "Lib_Adaxial_cells_10X_13_21_R1_001.fastq.gz Lib_Adaxial_cells_10X_13_21_R2_001.fastq.gz", "fastq fastq", 97290535840.0, 608065849.0, "Lib Adaxial cells 10X 13 21 R1 001.fastq.gz", "0:28 1:132", "A:31239174068;C:19321240292;G:21191429606;T:25387874670;N:150817204", 28, 132, null, null, 31239174068, 19321240292, 21191429606, 25387874670, 150817204, "SRX20411156", "SRS17723880", "SRA1639828", "Institut de Genomique Fonctionnelle de Lyon|ENS de Lyon, CNRS", "Institut de Genomique Fonctionnelle de Lyon", 2, 0.00774, 0.8686, 0.00239, 0.15226, 0.99082, 0.81945, 0.30856, 0.50916, 28, 132, "T", "B", "sc-like readlen", "illumina", "nextseq", "unknown", "other", "unknown", "sc", "single_cell_droplet", "10x", null, "France", "2023-05-18", "Segmentation", "Embryo", "Embryo Imprecise", "All anatomical structures"]], "truncated": false, "filtered_table_rows_count": 39, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"experiment.library_selection\" = :p0 and \"experiment.library_strategy\" = :p1 and \"tissue_curation\" = :p2 order by rowid limit 101", "params": {"p0": "other", "p1": "RNA-Seq", "p2": "Embryo Imprecise"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation=Embryo+Imprecise", "results": [{"value": "RNA-Seq", "label": "RNA-Seq", "count": 39, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&tissue_curation=Embryo+Imprecise", "selected": true}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation=Embryo+Imprecise", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 38, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation=Embryo+Imprecise&experiment.library_source=TRANSCRIPTOMIC", "selected": false}, {"value": "TRANSCRIPTOMIC SINGLE CELL", "label": "TRANSCRIPTOMIC SINGLE CELL", "count": 1, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation=Embryo+Imprecise&experiment.library_source=TRANSCRIPTOMIC+SINGLE+CELL", "selected": false}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation=Embryo+Imprecise", "results": [{"value": "other", "label": "other", "count": 39, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Embryo+Imprecise", "selected": true}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation=Embryo+Imprecise", "results": [{"value": "SINGLE", "label": "SINGLE", "count": 33, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation=Embryo+Imprecise&experiment.library_layout=SINGLE", "selected": false}, {"value": "PAIRED", "label": "PAIRED", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation=Embryo+Imprecise&experiment.library_layout=PAIRED", "selected": false}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation=Embryo+Imprecise", "results": [{"value": "ILLUMINA", "label": "ILLUMINA", "count": 39, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation=Embryo+Imprecise&experiment.platform=ILLUMINA", "selected": false}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation=Embryo+Imprecise", "results": [{"value": "Embryo", "label": "Embryo", "count": 39, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation=Embryo+Imprecise&devstage_curation_coarse=Embryo", "selected": false}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation=Embryo+Imprecise", "results": [{"value": "Undetermined", "label": "Undetermined", "count": 24, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation=Embryo+Imprecise&devstage_curation=Undetermined", "selected": false}, {"value": "Blastula", "label": "Blastula", "count": 7, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation=Embryo+Imprecise&devstage_curation=Blastula", "selected": false}, {"value": "Cleavage", "label": "Cleavage", "count": 3, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation=Embryo+Imprecise&devstage_curation=Cleavage", "selected": false}, {"value": "Pharyngula", "label": "Pharyngula", "count": 2, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation=Embryo+Imprecise&devstage_curation=Pharyngula", "selected": false}, {"value": "Segmentation", "label": "Segmentation", "count": 2, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation=Embryo+Imprecise&devstage_curation=Segmentation", "selected": false}, {"value": "Hatching", "label": "Hatching", "count": 1, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation=Embryo+Imprecise&devstage_curation=Hatching", "selected": false}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation=Embryo+Imprecise", "results": [{"value": "All anatomical structures", "label": "All anatomical structures", "count": 39, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation=Embryo+Imprecise&tissue_curation_coarse=All+anatomical+structures", "selected": false}], "truncated": false}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation=Embryo+Imprecise", "results": [{"value": "Embryo Imprecise", "label": "Embryo Imprecise", "count": 39, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq", "selected": true}], "truncated": false}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation=Embryo+Imprecise", "results": [{"value": "unknown", "label": "unknown", "count": 38, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation=Embryo+Imprecise&technology=unknown", "selected": false}, {"value": "10x", "label": "10x", "count": 1, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=other&experiment.library_strategy=RNA-Seq&tissue_curation=Embryo+Imprecise&technology=10x", "selected": false}], "truncated": false}}, "suggested_facets": [], "next": null, "next_url": null, "private": false, "allow_execute_sql": true, "query_ms": 108.00622399983695}