{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where experiment.library_selection = \"cDNA\", experiment.platform = \"ION_TORRENT\" and tissue_curation_coarse = \"All anatomical structures\"", "rows": [[41404, "SRR4423134", "SRX2245318", "SRS1745863", "SRP091534", "PRJNA347637", "Danio rerio and Xenopus laevis Raw sequence reads", "PRJNA347637", "Other", "To study the transcriptome during development", null, null, null, null, "Time course 10 Dr", null, "strain:not applicable|isolate:not applicable|breed:ABTL|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:prim 16 stage|sex:not determined|tissue:single embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA Seq of Zebrafish: prim 16 stage31 hpf", "347 10", "347 10", "Libraries were generated according to the manufacturers\u2019 protocols using the Ion Total RNA Seq Kit v2 and the Ion Xpress\u2122 RNA Seq bar coding kit Thermo Fisher Scientific.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP091534", null, null, "S10large.fastq", "fastq", 641713718.0, 5457079.0, "S10large.fastq", "0:117.59", "A:150550840;C:168565594;G:198254445;T:124342839;N:0", 117, null, null, null, 150550840, 168565594, 198254445, 124342839, 0, "SRX2245318", "SRS1745863", "SRA485147", "Universiteit van Amsterdam|SILS", "Universiteit van Amsterdam", 1, 0.94199, null, 0.27559, null, 0.93772, null, 0.79623, null, 104, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2016-10-19", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41405, "SRR4423133", "SRX2245317", "SRS1745862", "SRP091534", "PRJNA347637", "Danio rerio and Xenopus laevis Raw sequence reads", "PRJNA347637", "Other", "To study the transcriptome during development", null, null, null, null, "Time course 9 Dr", null, "strain:not applicable|isolate:not applicable|breed:ABTL|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:prim 5 stage|sex:not determined|tissue:single embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA Seq of Zebrafish: prim 5 stage24 hpf", "347 9", "347 9", "Libraries were generated according to the manufacturers\u2019 protocols using the Ion Total RNA Seq Kit v2 and the Ion Xpress\u2122 RNA Seq bar coding kit Thermo Fisher Scientific.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP091534", null, null, "S09large.fastq", "fastq", 583272900.0, 4872369.0, "S09large.fastq", "0:119.71", "A:133536706;C:155614585;G:187341444;T:106780165;N:0", 119, null, null, null, 133536706, 155614585, 187341444, 106780165, 0, "SRX2245317", "SRS1745862", "SRA485147", "Universiteit van Amsterdam|SILS", "Universiteit van Amsterdam", 1, 0.96394, null, 0.25145, null, 0.95785, null, 0.77358, null, 147, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2016-10-19", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41406, "SRR4423130", "SRX2245314", "SRS1745863", "SRP091534", "PRJNA347637", "Danio rerio and Xenopus laevis Raw sequence reads", "PRJNA347637", "Other", "To study the transcriptome during development", null, null, null, null, "Time course 10 Dr", null, "strain:not applicable|isolate:not applicable|breed:ABTL|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:prim 16 stage|sex:not determined|tissue:single embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "miRNA Seq of Zebrafish: prim 16 stage31 hpf", "348 10", "348 10", "Libraries were generated according to the manufacturers\u2019 protocols using the Ion Total RNA Seq Kit v2 and the Ion Xpress\u2122 RNA Seq bar coding kit Thermo Fisher Scientific. A few modifications were made during purification steps in the small RNAseq to allow sequencing of longer RNAs up to 200 nt than with standard sRNA protocols. Namely: 153 \u00b5l ethanol instead of 120 \u00b5l during purification of cDNA and 134 \u00b5l ethanol instead of 110 \u00b5l in protocol.", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP091534", null, null, "S10small.fastq", "fastq", 427409571.0, 5026564.0, "S10small.fastq", "0:85.03", "A:98026046;C:116630773;G:114413502;T:98339250;N:0", 85, null, null, null, 98026046, 116630773, 114413502, 98339250, 0, "SRX2245314", "SRS1745863", "SRA485147", "Universiteit van Amsterdam|SILS", "Universiteit van Amsterdam", 1, 0.81583, null, 0.17938, null, 0.9094, null, 0.63072, null, 126, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2016-10-19", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41407, "SRR4423129", "SRX2245313", "SRS1745862", "SRP091534", "PRJNA347637", "Danio rerio and Xenopus laevis Raw sequence reads", "PRJNA347637", "Other", "To study the transcriptome during development", null, null, null, null, "Time course 9 Dr", null, "strain:not applicable|isolate:not applicable|breed:ABTL|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:prim 5 stage|sex:not determined|tissue:single embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "miRNA Seq of Zebrafish: prim 5 stage24 hpf", "348 9", "348 9", "Libraries were generated according to the manufacturers\u2019 protocols using the Ion Total RNA Seq Kit v2 and the Ion Xpress\u2122 RNA Seq bar coding kit Thermo Fisher Scientific. A few modifications were made during purification steps in the small RNAseq to allow sequencing of longer RNAs up to 200 nt than with standard sRNA protocols. Namely: 153 \u00b5l ethanol instead of 120 \u00b5l during purification of cDNA and 134 \u00b5l ethanol instead of 110 \u00b5l in protocol.", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP091534", null, null, "S09small.fastq", "fastq", 516614705.0, 6246071.0, "S09small.fastq", "0:82.71", "A:117786535;C:140799134;G:139362428;T:118666608;N:0", 82, null, null, null, 117786535, 140799134, 139362428, 118666608, 0, "SRX2245313", "SRS1745862", "SRA485147", "Universiteit van Amsterdam|SILS", "Universiteit van Amsterdam", 1, 0.81132, null, 0.18952, null, 0.88925, null, 0.69719, null, 17, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2016-10-19", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41408, "SRR4423128", "SRX2245312", "SRS1745850", "SRP091534", "PRJNA347637", "Danio rerio and Xenopus laevis Raw sequence reads", "PRJNA347637", "Other", "To study the transcriptome during development", null, null, null, null, "Time course 12 Dr", null, "strain:not applicable|isolate:not applicable|breed:ABTL|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:protruding mouth stage|sex:not determined|tissue:single embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "miRNA Seq of Zebrafish: protruding mouth stage72 hpf", "348 12", "348 12", "Libraries were generated according to the manufacturers\u2019 protocols using the Ion Total RNA Seq Kit v2 and the Ion Xpress\u2122 RNA Seq bar coding kit Thermo Fisher Scientific. A few modifications were made during purification steps in the small RNAseq to allow sequencing of longer RNAs up to 200 nt than with standard sRNA protocols. Namely: 153 \u00b5l ethanol instead of 120 \u00b5l during purification of cDNA and 134 \u00b5l ethanol instead of 110 \u00b5l in protocol.", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP091534", null, null, "S12small.fastq", "fastq", 186817590.0, 3062463.0, "S12small.fastq", "0:61.00", "A:42863072;C:49941244;G:49513828;T:44499446;N:0", 61, null, null, null, 42863072, 49941244, 49513828, 44499446, 0, "SRX2245312", "SRS1745850", "SRA485147", "Universiteit van Amsterdam|SILS", "Universiteit van Amsterdam", 1, 0.77668, null, 0.17381, null, 0.8915, null, 0.54189, null, 36, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2016-10-19", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [41409, "SRR4423127", "SRX2245311", "SRS1745851", "SRP091534", "PRJNA347637", "Danio rerio and Xenopus laevis Raw sequence reads", "PRJNA347637", "Other", "To study the transcriptome during development", null, null, null, null, "Time course 11 Dr", null, "strain:not applicable|isolate:not applicable|breed:ABTL|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:long pec stage|sex:not determined|tissue:single embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "miRNA Seq of Zebrafish: long pec stage48 hpf", "348 11", "348 11", "Libraries were generated according to the manufacturers\u2019 protocols using the Ion Total RNA Seq Kit v2 and the Ion Xpress\u2122 RNA Seq bar coding kit Thermo Fisher Scientific. A few modifications were made during purification steps in the small RNAseq to allow sequencing of longer RNAs up to 200 nt than with standard sRNA protocols. Namely: 153 \u00b5l ethanol instead of 120 \u00b5l during purification of cDNA and 134 \u00b5l ethanol instead of 110 \u00b5l in protocol.", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP091534", null, null, "S11small.fastq", "fastq", 405003101.0, 5197273.0, "S11small.fastq", "0:77.93", "A:93494059;C:109265919;G:106696649;T:95546474;N:0", 77, null, null, null, 93494059, 109265919, 106696649, 95546474, 0, "SRX2245311", "SRS1745851", "SRA485147", "Universiteit van Amsterdam|SILS", "Universiteit van Amsterdam", 1, 0.78244, null, 0.17047, null, 0.93379, null, 0.6272, null, 30, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2016-10-19", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41410, "SRR4423126", "SRX2245310", "SRS1745848", "SRP091534", "PRJNA347637", "Danio rerio and Xenopus laevis Raw sequence reads", "PRJNA347637", "Other", "To study the transcriptome during development", null, null, null, null, "Time course 8 Dr", null, "strain:not applicable|isolate:not applicable|breed:ABTL|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:22 somite stage|sex:not determined|tissue:single embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA Seq of Zebrafish: 22 somite stage20 hpf", "347 8", "347 8", "Libraries were generated according to the manufacturers\u2019 protocols using the Ion Total RNA Seq Kit v2 and the Ion Xpress\u2122 RNA Seq bar coding kit Thermo Fisher Scientific.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP091534", null, null, "S08large.fastq", "fastq", 436406791.0, 4063942.0, "S08large.fastq", "0:107.39", "A:101104674;C:116028113;G:134686941;T:84587063;N:0", 107, null, null, null, 101104674, 116028113, 134686941, 84587063, 0, "SRX2245310", "SRS1745848", "SRA485147", "Universiteit van Amsterdam|SILS", "Universiteit van Amsterdam", 1, 0.93717, null, 0.24651, null, 0.93933, null, 0.83386, null, 120, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2016-10-19", "Segmentation", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41411, "SRR4423125", "SRX2245309", "SRS1745849", "SRP091534", "PRJNA347637", "Danio rerio and Xenopus laevis Raw sequence reads", "PRJNA347637", "Other", "To study the transcriptome during development", null, null, null, null, "Time course 7 Dr", null, "strain:not applicable|isolate:not applicable|breed:ABTL|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:12 somite stage|sex:not determined|tissue:single embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA Seq of Zebrafish: 12 somite stage15 hpf", "347 7", "347 7", "Libraries were generated according to the manufacturers\u2019 protocols using the Ion Total RNA Seq Kit v2 and the Ion Xpress\u2122 RNA Seq bar coding kit Thermo Fisher Scientific.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP091534", null, null, "S07large.fastq", "fastq", 537626793.0, 4843104.0, "S07large.fastq", "0:111.01", "A:126939058;C:142383462;G:163136732;T:105167541;N:0", 111, null, null, null, 126939058, 142383462, 163136732, 105167541, 0, "SRX2245309", "SRS1745849", "SRA485147", "Universiteit van Amsterdam|SILS", "Universiteit van Amsterdam", 1, 0.9417, null, 0.29157, null, 0.93488, null, 0.84573, null, 122, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2016-10-19", "Segmentation", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41412, "SRR4423124", "SRX2245308", "SRS1745856", "SRP091534", "PRJNA347637", "Danio rerio and Xenopus laevis Raw sequence reads", "PRJNA347637", "Other", "To study the transcriptome during development", null, null, null, null, "Time course 6 Dr", null, "strain:not applicable|isolate:not applicable|breed:ABTL|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:4 somite stage|sex:not determined|tissue:single embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA Seq of Zebrafish: 4 somite stage11.3 hpf", "347 6", "347 6", "Libraries were generated according to the manufacturers\u2019 protocols using the Ion Total RNA Seq Kit v2 and the Ion Xpress\u2122 RNA Seq bar coding kit Thermo Fisher Scientific.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP091534", null, null, "S06large.fastq", "fastq", 442838850.0, 4133196.0, "S06large.fastq", "0:107.14", "A:102648557;C:119062787;G:133773678;T:87353828;N:0", 107, null, null, null, 102648557, 119062787, 133773678, 87353828, 0, "SRX2245308", "SRS1745856", "SRA485147", "Universiteit van Amsterdam|SILS", "Universiteit van Amsterdam", 1, 0.92856, null, 0.24819, null, 0.92622, null, 0.85191, null, 53, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2016-10-14", "Segmentation", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41413, "SRR4423123", "SRX2245307", "SRS1745857", "SRP091534", "PRJNA347637", "Danio rerio and Xenopus laevis Raw sequence reads", "PRJNA347637", "Other", "To study the transcriptome during development", null, null, null, null, "Time course 5 Dr", null, "strain:not applicable|isolate:not applicable|breed:ABTL|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:90% epiboly stage|sex:not determined|tissue:single embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA Seq of Zebrafish: 90% epiboly stage 9 hpf", "347 5", "347 5", "Libraries were generated according to the manufacturers\u2019 protocols using the Ion Total RNA Seq Kit v2 and the Ion Xpress\u2122 RNA Seq bar coding kit Thermo Fisher Scientific.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP091534", null, null, "S05large.fastq", "fastq", 543194698.0, 4904291.0, "S05large.fastq", "0:110.76", "A:121453575;C:151300395;G:154852537;T:115588191;N:0", 110, null, null, null, 121453575, 151300395, 154852537, 115588191, 0, "SRX2245307", "SRS1745857", "SRA485147", "Universiteit van Amsterdam|SILS", "Universiteit van Amsterdam", 1, 0.91124, null, 0.15426, null, 0.92376, null, 0.7134, null, 80, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2016-10-19", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41414, "SRR4423122", "SRX2245306", "SRS1745855", "SRP091534", "PRJNA347637", "Danio rerio and Xenopus laevis Raw sequence reads", "PRJNA347637", "Other", "To study the transcriptome during development", null, null, null, null, "Time course 4 Dr", null, "strain:not applicable|isolate:not applicable|breed:ABTL|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:70% epiboly stage|sex:not determined|tissue:single embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA Seq of Zebrafish: 70% epiboly stage7 hpf", "347 4", "347 4", "Libraries were generated according to the manufacturers\u2019 protocols using the Ion Total RNA Seq Kit v2 and the Ion Xpress\u2122 RNA Seq bar coding kit Thermo Fisher Scientific.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP091534", null, null, "S04large.fastq", "fastq", 510714551.0, 4424058.0, "S04large.fastq", "0:115.44", "A:118836759;C:137564730;G:154371968;T:99941094;N:0", 115, null, null, null, 118836759, 137564730, 154371968, 99941094, 0, "SRX2245306", "SRS1745855", "SRA485147", "Universiteit van Amsterdam|SILS", "Universiteit van Amsterdam", 1, 0.94415, null, 0.2715, null, 0.93324, null, 0.84886, null, 180, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2016-10-19", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41415, "SRR4423121", "SRX2245305", "SRS1745854", "SRP091534", "PRJNA347637", "Danio rerio and Xenopus laevis Raw sequence reads", "PRJNA347637", "Other", "To study the transcriptome during development", null, null, null, null, "Time course 3 Dr", null, "strain:not applicable|isolate:not applicable|breed:ABTL|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:zfs:0000015 stage|sex:not determined|tissue:single embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA Seq of Zebrafish: zfs:0000015 stage 4.7 hpf", "347 3", "347 3", "Libraries were generated according to the manufacturers\u2019 protocols using the Ion Total RNA Seq Kit v2 and the Ion Xpress\u2122 RNA Seq bar coding kit Thermo Fisher Scientific.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP091534", null, null, "S03large.fastq", "fastq", 615798661.0, 4903481.0, "S03large.fastq", "0:125.58", "A:142134014;C:166761818;G:191551564;T:115351265;N:0", 125, null, null, null, 142134014, 166761818, 191551564, 115351265, 0, "SRX2245305", "SRS1745854", "SRA485147", "Universiteit van Amsterdam|SILS", "Universiteit van Amsterdam", 1, 0.93992, null, 0.29626, null, 0.95408, null, 0.89833, null, 91, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2016-10-19", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41416, "SRR4423120", "SRX2245304", "SRS1745852", "SRP091534", "PRJNA347637", "Danio rerio and Xenopus laevis Raw sequence reads", "PRJNA347637", "Other", "To study the transcriptome during development", null, null, null, null, "Time course 2 Dr", null, "strain:not applicable|isolate:not applicable|breed:ABTL|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:high stage|sex:not determined|tissue:single embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA Seq of Zebrafish: high stage3.3 hpf", "347 2", "347 2", "Libraries were generated according to the manufacturers\u2019 protocols using the Ion Total RNA Seq Kit v2 and the Ion Xpress\u2122 RNA Seq bar coding kit Thermo Fisher Scientific.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP091534", null, null, "S02large.fastq", "fastq", 399030043.0, 3512248.0, "S02large.fastq", "0:113.61", "A:91615111;C:108172506;G:123312384;T:75930042;N:0", 113, null, null, null, 91615111, 108172506, 123312384, 75930042, 0, "SRX2245304", "SRS1745852", "SRA485147", "Universiteit van Amsterdam|SILS", "Universiteit van Amsterdam", 1, 0.92466, null, 0.24175, null, 0.94197, null, 0.89366, null, 92, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2016-10-19", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41417, "SRR4423119", "SRX2245303", "SRS1745853", "SRP091534", "PRJNA347637", "Danio rerio and Xenopus laevis Raw sequence reads", "PRJNA347637", "Other", "To study the transcriptome during development", null, null, null, null, "Time course 1 Dr", null, "strain:not applicable|isolate:not applicable|breed:ABTL|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:64 cells|sex:not determined|tissue:single embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA Seq of Zebrafish: 64 cells2 hpf", "347 1", "347 1", "Libraries were generated according to the manufacturers\u2019 protocols using the Ion Total RNA Seq Kit v2 and the Ion Xpress\u2122 RNA Seq bar coding kit Thermo Fisher Scientific.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP091534", null, null, "S01large.fastq", "fastq", 406838773.0, 3451573.0, "S01large.fastq", "0:117.87", "A:90440106;C:114282886;G:115318720;T:86797061;N:0", 117, null, null, null, 90440106, 114282886, 115318720, 86797061, 0, "SRX2245303", "SRS1745853", "SRA485147", "Universiteit van Amsterdam|SILS", "Universiteit van Amsterdam", 1, 0.9203, null, 0.10547, null, 0.93095, null, 0.75003, null, 158, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2016-10-19", "Cleavage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41428, "SRR4423108", "SRX2245292", "SRS1745857", "SRP091534", "PRJNA347637", "Danio rerio and Xenopus laevis Raw sequence reads", "PRJNA347637", "Other", "To study the transcriptome during development", null, null, null, null, "Time course 5 Dr", null, "strain:not applicable|isolate:not applicable|breed:ABTL|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:90% epiboly stage|sex:not determined|tissue:single embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "miRNA Seq of Zebrafish: 90% epiboly stage 9 hpf", "348 5", "348 5", "Libraries were generated according to the manufacturers\u2019 protocols using the Ion Total RNA Seq Kit v2 and the Ion Xpress\u2122 RNA Seq bar coding kit Thermo Fisher Scientific. A few modifications were made during purification steps in the small RNAseq to allow sequencing of longer RNAs up to 200 nt than with standard sRNA protocols. Namely: 153 \u00b5l ethanol instead of 120 \u00b5l during purification of cDNA and 134 \u00b5l ethanol instead of 110 \u00b5l in protocol.", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP091534", null, null, "S05small.fastq", "fastq", 412237561.0, 3386443.0, "S05small.fastq", "0:121.73", "A:91644321;C:118905395;G:115070912;T:86616933;N:0", 121, null, null, null, 91644321, 118905395, 115070912, 86616933, 0, "SRX2245292", "SRS1745857", "SRA485147", "Universiteit van Amsterdam|SILS", "Universiteit van Amsterdam", 1, 0.81233, null, 0.06309, null, 0.93385, null, 0.93973, null, 163, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2016-10-19", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41429, "SRR4423107", "SRX2245291", "SRS1745856", "SRP091534", "PRJNA347637", "Danio rerio and Xenopus laevis Raw sequence reads", "PRJNA347637", "Other", "To study the transcriptome during development", null, null, null, null, "Time course 6 Dr", null, "strain:not applicable|isolate:not applicable|breed:ABTL|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:4 somite stage|sex:not determined|tissue:single embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "miRNA Seq of Zebrafish: 4 somite stage11.3 hpf", "348 6", "348 6", "Libraries were generated according to the manufacturers\u2019 protocols using the Ion Total RNA Seq Kit v2 and the Ion Xpress\u2122 RNA Seq bar coding kit Thermo Fisher Scientific. A few modifications were made during purification steps in the small RNAseq to allow sequencing of longer RNAs up to 200 nt than with standard sRNA protocols. Namely: 153 \u00b5l ethanol instead of 120 \u00b5l during purification of cDNA and 134 \u00b5l ethanol instead of 110 \u00b5l in protocol.", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP091534", null, null, "S06small.fastq", "fastq", 535288776.0, 4443685.0, "S06small.fastq", "0:120.46", "A:119322177;C:152704452;G:149509408;T:113752739;N:0", 120, null, null, null, 119322177, 152704452, 149509408, 113752739, 0, "SRX2245291", "SRS1745856", "SRA485147", "Universiteit van Amsterdam|SILS", "Universiteit van Amsterdam", 1, 0.82872, null, 0.09035, null, 0.93194, null, 0.81296, null, 159, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2016-10-19", "Segmentation", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41430, "SRR4423106", "SRX2245290", "SRS1745854", "SRP091534", "PRJNA347637", "Danio rerio and Xenopus laevis Raw sequence reads", "PRJNA347637", "Other", "To study the transcriptome during development", null, null, null, null, "Time course 3 Dr", null, "strain:not applicable|isolate:not applicable|breed:ABTL|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:zfs:0000015 stage|sex:not determined|tissue:single embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "miRNA Seq of Zebrafish: zfs:0000015 stage 4.7 hpf", "348 3", "348 3", "Libraries were generated according to the manufacturers\u2019 protocols using the Ion Total RNA Seq Kit v2 and the Ion Xpress\u2122 RNA Seq bar coding kit Thermo Fisher Scientific. A few modifications were made during purification steps in the small RNAseq to allow sequencing of longer RNAs up to 200 nt than with standard sRNA protocols. Namely: 153 \u00b5l ethanol instead of 120 \u00b5l during purification of cDNA and 134 \u00b5l ethanol instead of 110 \u00b5l in protocol.", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP091534", null, null, "S03small.fastq", "fastq", 1025732824.0, 7452991.0, "S03small.fastq", "0:137.63", "A:225573059;C:298586545;G:288470386;T:213102834;N:0", 137, null, null, null, 225573059, 298586545, 288470386, 213102834, 0, "SRX2245290", "SRS1745854", "SRA485147", "Universiteit van Amsterdam|SILS", "Universiteit van Amsterdam", 1, 0.8983, null, 0.04271, null, 0.95546, null, 0.91281, null, 159, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2016-10-19", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41431, "SRR4423105", "SRX2245289", "SRS1745855", "SRP091534", "PRJNA347637", "Danio rerio and Xenopus laevis Raw sequence reads", "PRJNA347637", "Other", "To study the transcriptome during development", null, null, null, null, "Time course 4 Dr", null, "strain:not applicable|isolate:not applicable|breed:ABTL|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:70% epiboly stage|sex:not determined|tissue:single embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "miRNA Seq of Zebrafish: 70% epiboly stage7 hpf", "348 4", "348 4", "Libraries were generated according to the manufacturers\u2019 protocols using the Ion Total RNA Seq Kit v2 and the Ion Xpress\u2122 RNA Seq bar coding kit Thermo Fisher Scientific. A few modifications were made during purification steps in the small RNAseq to allow sequencing of longer RNAs up to 200 nt than with standard sRNA protocols. Namely: 153 \u00b5l ethanol instead of 120 \u00b5l during purification of cDNA and 134 \u00b5l ethanol instead of 110 \u00b5l in protocol.", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP091534", null, null, "S04small.fastq", "fastq", 193259658.0, 1840126.0, "S04small.fastq", "0:105.03", "A:43516548;C:54669405;G:53501927;T:41571778;N:0", 105, null, null, null, 43516548, 54669405, 53501927, 41571778, 0, "SRX2245289", "SRS1745855", "SRA485147", "Universiteit van Amsterdam|SILS", "Universiteit van Amsterdam", 1, 0.81053, null, 0.16265, null, 0.90698, null, 0.92112, null, 159, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2016-10-19", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41432, "SRR4423104", "SRX2245288", "SRS1745853", "SRP091534", "PRJNA347637", "Danio rerio and Xenopus laevis Raw sequence reads", "PRJNA347637", "Other", "To study the transcriptome during development", null, null, null, null, "Time course 1 Dr", null, "strain:not applicable|isolate:not applicable|breed:ABTL|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:64 cells|sex:not determined|tissue:single embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "miRNA Seq of Zebrafish: 64 cells2 hpf", "348 1", "348 1", "Libraries were generated according to the manufacturers\u2019 protocols using the Ion Total RNA Seq Kit v2 and the Ion Xpress\u2122 RNA Seq bar coding kit Thermo Fisher Scientific. A few modifications were made during purification steps in the small RNAseq to allow sequencing of longer RNAs up to 200 nt than with standard sRNA protocols. Namely: 153 \u00b5l ethanol instead of 120 \u00b5l during purification of cDNA and 134 \u00b5l ethanol instead of 110 \u00b5l in protocol.", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP091534", null, null, "S01small.fastq", "fastq", 91910627.0, 1396009.0, "S01small.fastq", "0:65.84", "A:21663404;C:25661192;G:25069267;T:19516764;N:0", 65, null, null, null, 21663404, 25661192, 25069267, 19516764, 0, "SRX2245288", "SRS1745853", "SRA485147", "Universiteit van Amsterdam|SILS", "Universiteit van Amsterdam", 1, 0.56828, null, 0.1715, null, 0.92435, null, 0.90047, null, 34, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2016-10-19", "Cleavage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41433, "SRR4423103", "SRX2245287", "SRS1745852", "SRP091534", "PRJNA347637", "Danio rerio and Xenopus laevis Raw sequence reads", "PRJNA347637", "Other", "To study the transcriptome during development", null, null, null, null, "Time course 2 Dr", null, "strain:not applicable|isolate:not applicable|breed:ABTL|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:high stage|sex:not determined|tissue:single embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "miRNA Seq of Zebrafish: high stage3.3 hpf", "348 2", "348 2", "Libraries were generated according to the manufacturers\u2019 protocols using the Ion Total RNA Seq Kit v2 and the Ion Xpress\u2122 RNA Seq bar coding kit Thermo Fisher Scientific. A few modifications were made during purification steps in the small RNAseq to allow sequencing of longer RNAs up to 200 nt than with standard sRNA protocols. Namely: 153 \u00b5l ethanol instead of 120 \u00b5l during purification of cDNA and 134 \u00b5l ethanol instead of 110 \u00b5l in protocol.", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP091534", null, null, "S02small.fastq", "fastq", 304535574.0, 3376105.0, "S02small.fastq", "0:90.20", "A:69193719;C:84372087;G:86707481;T:64262287;N:0", 90, null, null, null, 69193719, 84372087, 86707481, 64262287, 0, "SRX2245287", "SRS1745852", "SRA485147", "Universiteit van Amsterdam|SILS", "Universiteit van Amsterdam", 1, 0.56812, null, 0.09695, null, 0.93474, null, 0.93654, null, 51, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2016-10-19", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41434, "SRR4423102", "SRX2245286", "SRS1745851", "SRP091534", "PRJNA347637", "Danio rerio and Xenopus laevis Raw sequence reads", "PRJNA347637", "Other", "To study the transcriptome during development", null, null, null, null, "Time course 11 Dr", null, "strain:not applicable|isolate:not applicable|breed:ABTL|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:long pec stage|sex:not determined|tissue:single embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA Seq of Zebrafish: long pec stage48 hpf", "347 11", "347 11", "Libraries were generated according to the manufacturers\u2019 protocols using the Ion Total RNA Seq Kit v2 and the Ion Xpress\u2122 RNA Seq bar coding kit Thermo Fisher Scientific.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP091534", null, null, "S11large.fastq", "fastq", 535498199.0, 5737354.0, "S11large.fastq", "0:93.34", "A:121755741;C:143034204;G:168067337;T:102640917;N:0", 93, null, null, null, 121755741, 143034204, 168067337, 102640917, 0, "SRX2245286", "SRS1745851", "SRA485147", "Universiteit van Amsterdam|SILS", "Universiteit van Amsterdam", 1, 0.9065, null, 0.26226, null, 0.9388, null, 0.73978, null, 95, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2016-10-19", "Hatching", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41435, "SRR4423101", "SRX2245285", "SRS1745850", "SRP091534", "PRJNA347637", "Danio rerio and Xenopus laevis Raw sequence reads", "PRJNA347637", "Other", "To study the transcriptome during development", null, null, null, null, "Time course 12 Dr", null, "strain:not applicable|isolate:not applicable|breed:ABTL|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:protruding mouth stage|sex:not determined|tissue:single embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA Seq of Zebrafish: protruding mouth stage72 hpf", "347 12", "347 12", "Libraries were generated according to the manufacturers\u2019 protocols using the Ion Total RNA Seq Kit v2 and the Ion Xpress\u2122 RNA Seq bar coding kit Thermo Fisher Scientific.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP091534", null, null, "S12large.fastq", "fastq", 2735647095.0, 28978873.0, "S12large.fastq", "0:94.40", "A:650857562;C:721265476;G:776126849;T:587397208;N:0", 94, null, null, null, 650857562, 721265476, 776126849, 587397208, 0, "SRX2245285", "SRS1745850", "SRA485147", "Universiteit van Amsterdam|SILS", "Universiteit van Amsterdam", 1, 0.87809, null, 0.18943, null, 0.88797, null, 0.71439, null, 27, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2016-10-19", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [41436, "SRR4423100", "SRX2245284", "SRS1745849", "SRP091534", "PRJNA347637", "Danio rerio and Xenopus laevis Raw sequence reads", "PRJNA347637", "Other", "To study the transcriptome during development", null, null, null, null, "Time course 7 Dr", null, "strain:not applicable|isolate:not applicable|breed:ABTL|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:12 somite stage|sex:not determined|tissue:single embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "miRNA Seq of Zebrafish: 12 somite stage15 hpf", "348 7", "348 7", "Libraries were generated according to the manufacturers\u2019 protocols using the Ion Total RNA Seq Kit v2 and the Ion Xpress\u2122 RNA Seq bar coding kit Thermo Fisher Scientific. A few modifications were made during purification steps in the small RNAseq to allow sequencing of longer RNAs up to 200 nt than with standard sRNA protocols. Namely: 153 \u00b5l ethanol instead of 120 \u00b5l during purification of cDNA and 134 \u00b5l ethanol instead of 110 \u00b5l in protocol.", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP091534", null, null, "S07small.fastq", "fastq", 279201769.0, 2713759.0, "S07small.fastq", "0:102.88", "A:61655863;C:78667355;G:77702440;T:61176111;N:0", 102, null, null, null, 61655863, 78667355, 77702440, 61176111, 0, "SRX2245284", "SRS1745849", "SRA485147", "Universiteit van Amsterdam|SILS", "Universiteit van Amsterdam", 1, 0.79087, null, 0.10046, null, 0.89221, null, 0.77892, null, 158, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2016-10-19", "Segmentation", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41437, "SRR4423099", "SRX2245283", "SRS1745848", "SRP091534", "PRJNA347637", "Danio rerio and Xenopus laevis Raw sequence reads", "PRJNA347637", "Other", "To study the transcriptome during development", null, null, null, null, "Time course 8 Dr", null, "strain:not applicable|isolate:not applicable|breed:ABTL|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:22 somite stage|sex:not determined|tissue:single embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "miRNA Seq of Zebrafish: 22 somite stage20 hpf", "348 8", "348 8", "Libraries were generated according to the manufacturers\u2019 protocols using the Ion Total RNA Seq Kit v2 and the Ion Xpress\u2122 RNA Seq bar coding kit Thermo Fisher Scientific. A few modifications were made during purification steps in the small RNAseq to allow sequencing of longer RNAs up to 200 nt than with standard sRNA protocols. Namely: 153 \u00b5l ethanol instead of 120 \u00b5l during purification of cDNA and 134 \u00b5l ethanol instead of 110 \u00b5l in protocol.", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP091534", null, null, "S08small.fastq", "fastq", 520785540.0, 4495080.0, "S08small.fastq", "0:115.86", "A:115224831;C:149325753;G:144978190;T:111256766;N:0", 115, null, null, null, 115224831, 149325753, 144978190, 111256766, 0, "SRX2245283", "SRS1745848", "SRA485147", "Universiteit van Amsterdam|SILS", "Universiteit van Amsterdam", 1, 0.83781, null, 0.08976, null, 0.92904, null, 0.80492, null, 183, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2016-10-19", "Segmentation", "Embryo", "Embryo Imprecise", "All anatomical structures"], [41457, "SRR4449278", "SRX2267734", "SRS1758938", "SRP092030", "PRJNA350377", "Zebrafish Danio Rerio small RNA seq at approx. 50% epiboly", "PRJNA350377", "Transcriptome Analysis", "Small RNAseq experiment of individual embryos from the 8 different spawns  taken at gastrulation at approximately 50% epiboly", null, null, "Danio rerio embryo at approx. 50% epiboly", "Danio rerio embryo at approx. 50% epiboly", "S09 RID0445", null, "strain:ABTL|dev stage:54% epiboly|sex:not applicable|tissue:whole embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "S09", "S09 RID0445", "S09 RID0445", "Bar coded small RNA sequencing libraries were generated using the Ion Total RNA Seq Kit v2 and the Ion Xpress RNA Seq bar coding kit Thermo Fisher Scientific. Size distribution and yield of the resulting barcoded libraries were assessed using the 2200 TapeStation System with Agilent D1K ScreenTapes Agilent Technologies. Libraries were prepared for sequencing on the Ion Chef System Thermo Fisher Scientific. Sequencing was performed on an Ion Proton System using Ion PI v3 chips Thermo Fisher Scientific.", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP092030", null, null, "IonXpressRNA_009_rawlib.basecaller.bam", "bam", 56886794.0, 2186951.0, "IonXpressRNA 009 rawlib.basecaller.bam", "0:26.01", "A:15763527;C:12934017;G:13233004;T:14956246;N:0", 26, null, null, null, 15763527, 12934017, 13233004, 14956246, 0, "SRX2267734", "SRS1758938", "SRA486759", "UNIVERSITY OF AMSTERDAM, SILS|RB&amp;AB", "UNIVERSITY OF AMSTERDAM, SILS", 1, 0.6501, null, 0.44849, null, 0.83465, null, 0.59625, null, 26, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2016-10-25", "Gastrula", "Embryo", "Whole Organism", "All anatomical structures"], [41458, "SRR4449277", "SRX2267733", "SRS1758937", "SRP092030", "PRJNA350377", "Zebrafish Danio Rerio small RNA seq at approx. 50% epiboly", "PRJNA350377", "Transcriptome Analysis", "Small RNAseq experiment of individual embryos from the 8 different spawns  taken at gastrulation at approximately 50% epiboly", null, null, "Danio rerio embryo at approx. 50% epiboly", "Danio rerio embryo at approx. 50% epiboly", "S10 RID0445", null, "strain:ABTL|dev stage:51% epiboly|sex:not applicable|tissue:whole embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "S10", "S10 RID0445", "S10 RID0445", "Bar coded small RNA sequencing libraries were generated using the Ion Total RNA Seq Kit v2 and the Ion Xpress RNA Seq bar coding kit Thermo Fisher Scientific. Size distribution and yield of the resulting barcoded libraries were assessed using the 2200 TapeStation System with Agilent D1K ScreenTapes Agilent Technologies. Libraries were prepared for sequencing on the Ion Chef System Thermo Fisher Scientific. Sequencing was performed on an Ion Proton System using Ion PI v3 chips Thermo Fisher Scientific.", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP092030", null, null, "IonXpressRNA_010_rawlib.basecaller.bam", "bam", 63108712.0, 2361941.0, "IonXpressRNA 010 rawlib.basecaller.bam", "0:26.72", "A:16956361;C:14496251;G:15049416;T:16606684;N:0", 26, null, null, null, 16956361, 14496251, 15049416, 16606684, 0, "SRX2267733", "SRS1758937", "SRA486759", "UNIVERSITY OF AMSTERDAM, SILS|RB&amp;AB", "UNIVERSITY OF AMSTERDAM, SILS", 1, 0.64387, null, 0.42592, null, 0.81091, null, 0.58276, null, 22, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2017-11-01", "Gastrula", "Embryo", "Whole Organism", "All anatomical structures"], [41459, "SRR4449276", "SRX2267732", "SRS1758936", "SRP092030", "PRJNA350377", "Zebrafish Danio Rerio small RNA seq at approx. 50% epiboly", "PRJNA350377", "Transcriptome Analysis", "Small RNAseq experiment of individual embryos from the 8 different spawns  taken at gastrulation at approximately 50% epiboly", null, null, "Danio rerio embryo at approx. 50% epiboly", "Danio rerio embryo at approx. 50% epiboly", "S07 RID0445", null, "strain:ABTL|dev stage:47% epiboly|sex:not applicable|tissue:whole embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "S07", "S07 RID0445", "S07 RID0445", "Bar coded small RNA sequencing libraries were generated using the Ion Total RNA Seq Kit v2 and the Ion Xpress RNA Seq bar coding kit Thermo Fisher Scientific. Size distribution and yield of the resulting barcoded libraries were assessed using the 2200 TapeStation System with Agilent D1K ScreenTapes Agilent Technologies. Libraries were prepared for sequencing on the Ion Chef System Thermo Fisher Scientific. Sequencing was performed on an Ion Proton System using Ion PI v3 chips Thermo Fisher Scientific.", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP092030", null, null, "IonXpressRNA_007_rawlib.basecaller.bam", "bam", 50356775.0, 1885340.0, "IonXpressRNA 007 rawlib.basecaller.bam", "0:26.71", "A:13603929;C:11508700;G:12096780;T:13147366;N:0", 26, null, null, null, 13603929, 11508700, 12096780, 13147366, 0, "SRX2267732", "SRS1758936", "SRA486759", "UNIVERSITY OF AMSTERDAM, SILS|RB&amp;AB", "UNIVERSITY OF AMSTERDAM, SILS", 1, 0.63582, null, 0.39586, null, 0.79839, null, 0.56846, null, 22, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2017-11-01", "Gastrula", "Embryo", "Whole Organism", "All anatomical structures"], [41460, "SRR4449275", "SRX2267731", "SRS1758935", "SRP092030", "PRJNA350377", "Zebrafish Danio Rerio small RNA seq at approx. 50% epiboly", "PRJNA350377", "Transcriptome Analysis", "Small RNAseq experiment of individual embryos from the 8 different spawns  taken at gastrulation at approximately 50% epiboly", null, null, "Danio rerio embryo at approx. 50% epiboly", "Danio rerio embryo at approx. 50% epiboly", "S08 RID0445", null, "strain:ABTL|dev stage:53% epiboly|sex:not applicable|tissue:whole embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "S08", "S08 RID0445", "S08 RID0445", "Bar coded small RNA sequencing libraries were generated using the Ion Total RNA Seq Kit v2 and the Ion Xpress RNA Seq bar coding kit Thermo Fisher Scientific. Size distribution and yield of the resulting barcoded libraries were assessed using the 2200 TapeStation System with Agilent D1K ScreenTapes Agilent Technologies. Libraries were prepared for sequencing on the Ion Chef System Thermo Fisher Scientific. Sequencing was performed on an Ion Proton System using Ion PI v3 chips Thermo Fisher Scientific.", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP092030", null, null, "IonXpressRNA_008_rawlib.basecaller.bam", "bam", 63655011.0, 2486240.0, "IonXpressRNA 008 rawlib.basecaller.bam", "0:25.60", "A:17274215;C:14286496;G:15277222;T:16817078;N:0", 25, null, null, null, 17274215, 14286496, 15277222, 16817078, 0, "SRX2267731", "SRS1758935", "SRA486759", "UNIVERSITY OF AMSTERDAM, SILS|RB&amp;AB", "UNIVERSITY OF AMSTERDAM, SILS", 1, 0.64165, null, 0.41617, null, 0.79931, null, 0.56754, null, 34, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2017-11-01", "Gastrula", "Embryo", "Whole Organism", "All anatomical structures"], [41461, "SRR4449274", "SRX2267730", "SRS1758933", "SRP092030", "PRJNA350377", "Zebrafish Danio Rerio small RNA seq at approx. 50% epiboly", "PRJNA350377", "Transcriptome Analysis", "Small RNAseq experiment of individual embryos from the 8 different spawns  taken at gastrulation at approximately 50% epiboly", null, null, "Danio rerio embryo at approx. 50% epiboly", "Danio rerio embryo at approx. 50% epiboly", "S05 RID0445", null, "strain:ABTL|dev stage:58% epiboly|sex:not applicable|tissue:whole embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "S05", "S05 RID0445", "S05 RID0445", "Bar coded small RNA sequencing libraries were generated using the Ion Total RNA Seq Kit v2 and the Ion Xpress RNA Seq bar coding kit Thermo Fisher Scientific. Size distribution and yield of the resulting barcoded libraries were assessed using the 2200 TapeStation System with Agilent D1K ScreenTapes Agilent Technologies. Libraries were prepared for sequencing on the Ion Chef System Thermo Fisher Scientific. Sequencing was performed on an Ion Proton System using Ion PI v3 chips Thermo Fisher Scientific.", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP092030", null, null, "IonXpressRNA_005_rawlib.basecaller.bam", "bam", 36352941.0, 1403002.0, "IonXpressRNA 005 rawlib.basecaller.bam", "0:25.91", "A:10088289;C:8176923;G:8667822;T:9419907;N:0", 25, null, null, null, 10088289, 8176923, 8667822, 9419907, 0, "SRX2267730", "SRS1758933", "SRA486759", "UNIVERSITY OF AMSTERDAM, SILS|RB&amp;AB", "UNIVERSITY OF AMSTERDAM, SILS", 1, 0.59289, null, 0.36407, null, 0.80213, null, 0.57695, null, 26, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2017-11-01", "Gastrula", "Embryo", "Whole Organism", "All anatomical structures"], [41462, "SRR4449273", "SRX2267729", "SRS1758934", "SRP092030", "PRJNA350377", "Zebrafish Danio Rerio small RNA seq at approx. 50% epiboly", "PRJNA350377", "Transcriptome Analysis", "Small RNAseq experiment of individual embryos from the 8 different spawns  taken at gastrulation at approximately 50% epiboly", null, null, "Danio rerio embryo at approx. 50% epiboly", "Danio rerio embryo at approx. 50% epiboly", "S06 RID0445", null, "strain:ABTL|dev stage:43% epiboly|sex:not applicable|tissue:whole embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "S06", "S06 RID0445", "S06 RID0445", "Bar coded small RNA sequencing libraries were generated using the Ion Total RNA Seq Kit v2 and the Ion Xpress RNA Seq bar coding kit Thermo Fisher Scientific. Size distribution and yield of the resulting barcoded libraries were assessed using the 2200 TapeStation System with Agilent D1K ScreenTapes Agilent Technologies. Libraries were prepared for sequencing on the Ion Chef System Thermo Fisher Scientific. Sequencing was performed on an Ion Proton System using Ion PI v3 chips Thermo Fisher Scientific.", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP092030", null, null, "IonXpressRNA_006_rawlib.basecaller.bam", "bam", 41157611.0, 1592351.0, "IonXpressRNA 006 rawlib.basecaller.bam", "0:25.85", "A:11322629;C:9228187;G:9750979;T:10855816;N:0", 25, null, null, null, 11322629, 9228187, 9750979, 10855816, 0, "SRX2267729", "SRS1758934", "SRA486759", "UNIVERSITY OF AMSTERDAM, SILS|RB&amp;AB", "UNIVERSITY OF AMSTERDAM, SILS", 1, 0.63095, null, 0.40683, null, 0.8003, null, 0.56985, null, 29, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2017-11-01", "Gastrula", "Embryo", "Whole Organism", "All anatomical structures"], [41463, "SRR4449272", "SRX2267728", "SRS1758932", "SRP092030", "PRJNA350377", "Zebrafish Danio Rerio small RNA seq at approx. 50% epiboly", "PRJNA350377", "Transcriptome Analysis", "Small RNAseq experiment of individual embryos from the 8 different spawns  taken at gastrulation at approximately 50% epiboly", null, null, "Danio rerio embryo at approx. 50% epiboly", "Danio rerio embryo at approx. 50% epiboly", "S03 RID0445", null, "strain:ABTL|dev stage:55% epiboly|sex:not applicable|tissue:whole embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "S03", "S03 RID0445", "S03 RID0445", "Bar coded small RNA sequencing libraries were generated using the Ion Total RNA Seq Kit v2 and the Ion Xpress RNA Seq bar coding kit Thermo Fisher Scientific. Size distribution and yield of the resulting barcoded libraries were assessed using the 2200 TapeStation System with Agilent D1K ScreenTapes Agilent Technologies. Libraries were prepared for sequencing on the Ion Chef System Thermo Fisher Scientific. Sequencing was performed on an Ion Proton System using Ion PI v3 chips Thermo Fisher Scientific.", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP092030", null, null, "IonXpressRNA_003_rawlib.basecaller.bam", "bam", 60356442.0, 2057592.0, "IonXpressRNA 003 rawlib.basecaller.bam", "0:29.33", "A:17060096;C:13661341;G:13721228;T:15913777;N:0", 29, null, null, null, 17060096, 13661341, 13721228, 15913777, 0, "SRX2267728", "SRS1758932", "SRA486759", "UNIVERSITY OF AMSTERDAM, SILS|RB&amp;AB", "UNIVERSITY OF AMSTERDAM, SILS", 1, 0.73029, null, 0.49935, null, 0.8225, null, 0.56029, null, 30, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2017-11-01", "Gastrula", "Embryo", "Whole Organism", "All anatomical structures"], [41464, "SRR4449271", "SRX2267727", "SRS1758931", "SRP092030", "PRJNA350377", "Zebrafish Danio Rerio small RNA seq at approx. 50% epiboly", "PRJNA350377", "Transcriptome Analysis", "Small RNAseq experiment of individual embryos from the 8 different spawns  taken at gastrulation at approximately 50% epiboly", null, null, "Danio rerio embryo at approx. 50% epiboly", "Danio rerio embryo at approx. 50% epiboly", "S04 RID0445", null, "strain:ABTL|dev stage:54% epiboly|sex:not applicable|tissue:whole embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "S04", "S04 RID0445", "S04 RID0445", "Bar coded small RNA sequencing libraries were generated using the Ion Total RNA Seq Kit v2 and the Ion Xpress RNA Seq bar coding kit Thermo Fisher Scientific. Size distribution and yield of the resulting barcoded libraries were assessed using the 2200 TapeStation System with Agilent D1K ScreenTapes Agilent Technologies. Libraries were prepared for sequencing on the Ion Chef System Thermo Fisher Scientific. Sequencing was performed on an Ion Proton System using Ion PI v3 chips Thermo Fisher Scientific.", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP092030", null, null, "IonXpressRNA_004_rawlib.basecaller.bam", "bam", 55705225.0, 2055064.0, "IonXpressRNA 004 rawlib.basecaller.bam", "0:27.11", "A:15806355;C:12308008;G:12579212;T:15011650;N:0", 27, null, null, null, 15806355, 12308008, 12579212, 15011650, 0, "SRX2267727", "SRS1758931", "SRA486759", "UNIVERSITY OF AMSTERDAM, SILS|RB&amp;AB", "UNIVERSITY OF AMSTERDAM, SILS", 1, 0.70796, null, 0.49815, null, 0.81444, null, 0.54452, null, 41, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2017-11-01", "Gastrula", "Embryo", "Whole Organism", "All anatomical structures"], [41465, "SRR4449270", "SRX2267726", "SRS1758930", "SRP092030", "PRJNA350377", "Zebrafish Danio Rerio small RNA seq at approx. 50% epiboly", "PRJNA350377", "Transcriptome Analysis", "Small RNAseq experiment of individual embryos from the 8 different spawns  taken at gastrulation at approximately 50% epiboly", null, null, "Danio rerio embryo at approx. 50% epiboly", "Danio rerio embryo at approx. 50% epiboly", "S01 RID0445", null, "strain:ABTL|dev stage:50% epiboly|sex:not applicable|tissue:whole embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "S01", "S01 RID0445", "S01 RID0445", "Bar coded small RNA sequencing libraries were generated using the Ion Total RNA Seq Kit v2 and the Ion Xpress RNA Seq bar coding kit Thermo Fisher Scientific. Size distribution and yield of the resulting barcoded libraries were assessed using the 2200 TapeStation System with Agilent D1K ScreenTapes Agilent Technologies. Libraries were prepared for sequencing on the Ion Chef System Thermo Fisher Scientific. Sequencing was performed on an Ion Proton System using Ion PI v3 chips Thermo Fisher Scientific.", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP092030", null, null, "IonXpressRNA_001_rawlib.basecaller.bam", "bam", 35407241.0, 1342552.0, "IonXpressRNA 001 rawlib.basecaller.bam", "0:26.37", "A:9988109;C:7841340;G:8187069;T:9390723;N:0", 26, null, null, null, 9988109, 7841340, 8187069, 9390723, 0, "SRX2267726", "SRS1758930", "SRA486759", "UNIVERSITY OF AMSTERDAM, SILS|RB&amp;AB", "UNIVERSITY OF AMSTERDAM, SILS", 1, 0.63621, null, 0.43661, null, 0.80992, null, 0.53899, null, 31, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2017-11-01", "Gastrula", "Embryo", "Whole Organism", "All anatomical structures"], [41466, "SRR4449269", "SRX2267725", "SRS1758928", "SRP092030", "PRJNA350377", "Zebrafish Danio Rerio small RNA seq at approx. 50% epiboly", "PRJNA350377", "Transcriptome Analysis", "Small RNAseq experiment of individual embryos from the 8 different spawns  taken at gastrulation at approximately 50% epiboly", null, null, "Danio rerio embryo at approx. 50% epiboly", "Danio rerio embryo at approx. 50% epiboly", "S02 RID0445", null, "strain:ABTL|dev stage:55% epiboly|sex:not applicable|tissue:whole embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "S02", "S02 RID0445", "S02 RID0445", "Bar coded small RNA sequencing libraries were generated using the Ion Total RNA Seq Kit v2 and the Ion Xpress RNA Seq bar coding kit Thermo Fisher Scientific. Size distribution and yield of the resulting barcoded libraries were assessed using the 2200 TapeStation System with Agilent D1K ScreenTapes Agilent Technologies. Libraries were prepared for sequencing on the Ion Chef System Thermo Fisher Scientific. Sequencing was performed on an Ion Proton System using Ion PI v3 chips Thermo Fisher Scientific.", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP092030", null, null, "IonXpressRNA_002_rawlib.basecaller.bam", "bam", 40875445.0, 1512601.0, "IonXpressRNA 002 rawlib.basecaller.bam", "0:27.02", "A:11593378;C:9124451;G:9444184;T:10713432;N:0", 27, null, null, null, 11593378, 9124451, 9444184, 10713432, 0, "SRX2267725", "SRS1758928", "SRA486759", "UNIVERSITY OF AMSTERDAM, SILS|RB&amp;AB", "UNIVERSITY OF AMSTERDAM, SILS", 1, 0.66621, null, 0.45417, null, 0.8127, null, 0.55033, null, 21, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2017-11-01", "Gastrula", "Embryo", "Whole Organism", "All anatomical structures"], [41467, "SRR4449267", "SRX2267724", "SRS1758927", "SRP092030", "PRJNA350377", "Zebrafish Danio Rerio small RNA seq at approx. 50% epiboly", "PRJNA350377", "Transcriptome Analysis", "Small RNAseq experiment of individual embryos from the 8 different spawns  taken at gastrulation at approximately 50% epiboly", null, null, "Danio rerio embryo at approx. 50% epiboly", "Danio rerio embryo at approx. 50% epiboly", "S15 RID0445", null, "strain:ABTL|dev stage:52% epiboly|sex:not applicable|tissue:whole embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "S15", "S15 RID0445", "S15 RID0445", "Bar coded small RNA sequencing libraries were generated using the Ion Total RNA Seq Kit v2 and the Ion Xpress RNA Seq bar coding kit Thermo Fisher Scientific. Size distribution and yield of the resulting barcoded libraries were assessed using the 2200 TapeStation System with Agilent D1K ScreenTapes Agilent Technologies. Libraries were prepared for sequencing on the Ion Chef System Thermo Fisher Scientific. Sequencing was performed on an Ion Proton System using Ion PI v3 chips Thermo Fisher Scientific.", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP092030", null, null, "IonXpressRNA_015_rawlib.basecaller.bam", "bam", 58421266.0, 2091074.0, "IonXpressRNA 015 rawlib.basecaller.bam", "0:27.94", "A:16715618;C:13019609;G:13014639;T:15671400;N:0", 27, null, null, null, 16715618, 13019609, 13014639, 15671400, 0, "SRX2267724", "SRS1758927", "SRA486759", "UNIVERSITY OF AMSTERDAM, SILS|RB&amp;AB", "UNIVERSITY OF AMSTERDAM, SILS", 1, 0.71786, null, 0.51457, null, 0.83863, null, 0.53442, null, 29, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2017-11-01", "Gastrula", "Embryo", "Whole Organism", "All anatomical structures"], [41468, "SRR4449266", "SRX2267723", "SRS1758929", "SRP092030", "PRJNA350377", "Zebrafish Danio Rerio small RNA seq at approx. 50% epiboly", "PRJNA350377", "Transcriptome Analysis", "Small RNAseq experiment of individual embryos from the 8 different spawns  taken at gastrulation at approximately 50% epiboly", null, null, "Danio rerio embryo at approx. 50% epiboly", "Danio rerio embryo at approx. 50% epiboly", "S16 RID0445", null, "strain:ABTL|dev stage:54% epiboly|sex:not applicable|tissue:whole embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "S16", "S16 RID0445", "S16 RID0445", "Bar coded small RNA sequencing libraries were generated using the Ion Total RNA Seq Kit v2 and the Ion Xpress RNA Seq bar coding kit Thermo Fisher Scientific. Size distribution and yield of the resulting barcoded libraries were assessed using the 2200 TapeStation System with Agilent D1K ScreenTapes Agilent Technologies. Libraries were prepared for sequencing on the Ion Chef System Thermo Fisher Scientific. Sequencing was performed on an Ion Proton System using Ion PI v3 chips Thermo Fisher Scientific.", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP092030", null, null, "IonXpressRNA_016_rawlib.basecaller.bam", "bam", 55022551.0, 2073507.0, "IonXpressRNA 016 rawlib.basecaller.bam", "0:26.54", "A:15319738;C:12288588;G:12653066;T:14761159;N:0", 26, null, null, null, 15319738, 12288588, 12653066, 14761159, 0, "SRX2267723", "SRS1758929", "SRA486759", "UNIVERSITY OF AMSTERDAM, SILS|RB&amp;AB", "UNIVERSITY OF AMSTERDAM, SILS", 1, 0.68905, null, 0.46941, null, 0.80306, null, 0.55981, null, 26, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2017-11-01", "Gastrula", "Embryo", "Whole Organism", "All anatomical structures"], [41469, "SRR4449265", "SRX2267722", "SRS1758926", "SRP092030", "PRJNA350377", "Zebrafish Danio Rerio small RNA seq at approx. 50% epiboly", "PRJNA350377", "Transcriptome Analysis", "Small RNAseq experiment of individual embryos from the 8 different spawns  taken at gastrulation at approximately 50% epiboly", null, null, "Danio rerio embryo at approx. 50% epiboly", "Danio rerio embryo at approx. 50% epiboly", "S13 RID0445", null, "strain:ABTL|dev stage:55% epiboly|sex:not applicable|tissue:whole embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "S13", "S13 RID0445", "S13 RID0445", "Bar coded small RNA sequencing libraries were generated using the Ion Total RNA Seq Kit v2 and the Ion Xpress RNA Seq bar coding kit Thermo Fisher Scientific. Size distribution and yield of the resulting barcoded libraries were assessed using the 2200 TapeStation System with Agilent D1K ScreenTapes Agilent Technologies. Libraries were prepared for sequencing on the Ion Chef System Thermo Fisher Scientific. Sequencing was performed on an Ion Proton System using Ion PI v3 chips Thermo Fisher Scientific.", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP092030", null, null, "IonXpressRNA_013_rawlib.basecaller.bam", "bam", 49641484.0, 2028008.0, "IonXpressRNA 013 rawlib.basecaller.bam", "0:24.48", "A:13840820;C:11016762;G:11715475;T:13068427;N:0", 24, null, null, null, 13840820, 11016762, 11715475, 13068427, 0, "SRX2267722", "SRS1758926", "SRA486759", "UNIVERSITY OF AMSTERDAM, SILS|RB&amp;AB", "UNIVERSITY OF AMSTERDAM, SILS", 1, 0.55355, null, 0.3659, null, 0.81576, null, 0.55987, null, 22, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2017-11-01", "Gastrula", "Embryo", "Whole Organism", "All anatomical structures"], [41470, "SRR4449264", "SRX2267721", "SRS1758925", "SRP092030", "PRJNA350377", "Zebrafish Danio Rerio small RNA seq at approx. 50% epiboly", "PRJNA350377", "Transcriptome Analysis", "Small RNAseq experiment of individual embryos from the 8 different spawns  taken at gastrulation at approximately 50% epiboly", null, null, "Danio rerio embryo at approx. 50% epiboly", "Danio rerio embryo at approx. 50% epiboly", "S14 RID0445", null, "strain:ABTL|dev stage:56% epiboly|sex:not applicable|tissue:whole embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "S14", "S14 RID0445", "S14 RID0445", "Bar coded small RNA sequencing libraries were generated using the Ion Total RNA Seq Kit v2 and the Ion Xpress RNA Seq bar coding kit Thermo Fisher Scientific. Size distribution and yield of the resulting barcoded libraries were assessed using the 2200 TapeStation System with Agilent D1K ScreenTapes Agilent Technologies. Libraries were prepared for sequencing on the Ion Chef System Thermo Fisher Scientific. Sequencing was performed on an Ion Proton System using Ion PI v3 chips Thermo Fisher Scientific.", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP092030", null, null, "IonXpressRNA_014_rawlib.basecaller.bam", "bam", 52969826.0, 2019609.0, "IonXpressRNA 014 rawlib.basecaller.bam", "0:26.23", "A:14762618;C:11847782;G:12164393;T:14195033;N:0", 26, null, null, null, 14762618, 11847782, 12164393, 14195033, 0, "SRX2267721", "SRS1758925", "SRA486759", "UNIVERSITY OF AMSTERDAM, SILS|RB&amp;AB", "UNIVERSITY OF AMSTERDAM, SILS", 1, 0.65926, null, 0.45113, null, 0.80515, null, 0.56221, null, 22, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2017-11-01", "Gastrula", "Embryo", "Whole Organism", "All anatomical structures"], [41471, "SRR4449263", "SRX2267720", "SRS1758923", "SRP092030", "PRJNA350377", "Zebrafish Danio Rerio small RNA seq at approx. 50% epiboly", "PRJNA350377", "Transcriptome Analysis", "Small RNAseq experiment of individual embryos from the 8 different spawns  taken at gastrulation at approximately 50% epiboly", null, null, "Danio rerio embryo at approx. 50% epiboly", "Danio rerio embryo at approx. 50% epiboly", "S11 RID0445", null, "strain:ABTL|dev stage:56% epiboly|sex:not applicable|tissue:whole embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "S11", "S11 RID0445", "S11 RID0445", "Bar coded small RNA sequencing libraries were generated using the Ion Total RNA Seq Kit v2 and the Ion Xpress RNA Seq bar coding kit Thermo Fisher Scientific. Size distribution and yield of the resulting barcoded libraries were assessed using the 2200 TapeStation System with Agilent D1K ScreenTapes Agilent Technologies. Libraries were prepared for sequencing on the Ion Chef System Thermo Fisher Scientific. Sequencing was performed on an Ion Proton System using Ion PI v3 chips Thermo Fisher Scientific.", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP092030", null, null, "IonXpressRNA_011_rawlib.basecaller.bam", "bam", 54877334.0, 2122171.0, "IonXpressRNA 011 rawlib.basecaller.bam", "0:25.86", "A:14884144;C:12539815;G:13173981;T:14279394;N:0", 25, null, null, null, 14884144, 12539815, 13173981, 14279394, 0, "SRX2267720", "SRS1758923", "SRA486759", "UNIVERSITY OF AMSTERDAM, SILS|RB&amp;AB", "UNIVERSITY OF AMSTERDAM, SILS", 1, 0.62581, null, 0.40704, null, 0.82002, null, 0.59605, null, 20, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2017-11-01", "Gastrula", "Embryo", "Whole Organism", "All anatomical structures"], [41472, "SRR4449262", "SRX2267719", "SRS1758924", "SRP092030", "PRJNA350377", "Zebrafish Danio Rerio small RNA seq at approx. 50% epiboly", "PRJNA350377", "Transcriptome Analysis", "Small RNAseq experiment of individual embryos from the 8 different spawns  taken at gastrulation at approximately 50% epiboly", null, null, "Danio rerio embryo at approx. 50% epiboly", "Danio rerio embryo at approx. 50% epiboly", "S12 RID0445", null, "strain:ABTL|dev stage:53% epiboly|sex:not applicable|tissue:whole embryo|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "S12", "S12 RID0445", "S12 RID0445", "Bar coded small RNA sequencing libraries were generated using the Ion Total RNA Seq Kit v2 and the Ion Xpress RNA Seq bar coding kit Thermo Fisher Scientific. Size distribution and yield of the resulting barcoded libraries were assessed using the 2200 TapeStation System with Agilent D1K ScreenTapes Agilent Technologies. Libraries were prepared for sequencing on the Ion Chef System Thermo Fisher Scientific. Sequencing was performed on an Ion Proton System using Ion PI v3 chips Thermo Fisher Scientific.", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP092030", null, null, "IonXpressRNA_012_rawlib.basecaller.bam", "bam", 51987914.0, 1937451.0, "IonXpressRNA 012 rawlib.basecaller.bam", "0:26.83", "A:14499922;C:11778716;G:11957347;T:13751929;N:0", 26, null, null, null, 14499922, 11778716, 11957347, 13751929, 0, "SRX2267719", "SRS1758924", "SRA486759", "UNIVERSITY OF AMSTERDAM, SILS|RB&amp;AB", "UNIVERSITY OF AMSTERDAM, SILS", 1, 0.67286, null, 0.44698, null, 0.80919, null, 0.58291, null, 29, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2017-11-01", "Gastrula", "Embryo", "Whole Organism", "All anatomical structures"], [43774, "SRR6113350", "SRX3228188", "SRS2552755", "SRP119063", "PRJNA412499", "Analysis of gene expression changes by knock down of hace1 tumour suppressor in zebrafish", "GSE104380", "Transcriptome Analysis", "Background:  In this study we reveal a previously undescribed role of the HACE1 HECT domain and Ankyrin repeat Containing E3 ubiquitin protein ligase 1 tumor suppressor protein in normal vertebrate heart development using the zebrafish Danio rerio model.  We examined the link between the cardiac phenotypes associated with hace1 loss of function to the expression of the Rho small family GTPase  rac1  which is a known target of HACE1 and promotes ROS production via its interaction with NADPH oxidase holoenzymes. We examined expression changes induced by knock down of hace1 in zebrafish at 48 hpf  the stage when heart abnormalities are observed. This was done by collecting duplicate samples of control and hace1 morphant embryos and performing RNA sequencing on them. Conclusions:  Our study demonstrates that HACE1 is critical in the normal development and proper function of the heart via a ROS dependent mechanism. Overall design: 2 samples of control and hace1 morphant zebrafish embryos at 48 hpf were analyzed", null, "pubmed:29024245", null, "48 hpf hace1 MO injected sample B", "GSM2796627", null, "tissue:whole embryos|morpholino:hace1|strain:Tubingen|Stage:48 hpf", "48 hpf hace1 MO injected sample B", "Torrent Suite 4.2.1 used for basecalling Trimming with Cutadapt v1.2.1 Second pass trimming with home made script in order to remove reads shorter than 17bp and larger than 300bp and Q<20 2 steps alignement for RNA with tophat v2.0.6 and bowtie2 v2.0.2 Quantification and normalization with StrandNGS Version 2.1 with the following settings Strand specific reads: false Consider partial reads: true Max EM Iterations: 1000 Convergence criterion for EM: 0.0010 Normalization Type = DeSeq Threshold for normalization = 1 Baseline type =  median of all samples Genome build: Danio rerio Zv9 78 Transcripts 2015.01.22 Supplementary files format and content: tab delimited text files include normalised values or raw counts for each sample", "whole embryos", "The hace1 HECT 5\u2019 CCCTCGAACTGTTAGACAGAATAAA 3\u2019 and standard control morpholinos 5\u2019 CCTCTTACCTCAGTTACAATTTATA 3\u2019 were purchased from Genetools LLC Philomath  OR.  The hace1 morpholino splice site resides within the catalytically active HECT domain  upstream of the critical cysteine residue required for hace1 ubiquitin ligase function.  Knockdown of hace1 was verified by RT PCR as described in Daugaard et al Daugaard et al.  2013.", "TRIzol Reagent RNA Extraction protocol Ambion RNA Life technologies was used to extract RNA from pooled samples of hace1 or control morphants n=6 per group.  Approximately 100 embryos per sample were used.  Tubingen wild type strain TU fish were previously injected with either hace1 MO or control MO using the injection protocol noted above.  RNA samples were quantified using the NanoDrop Spectrophotometer ND 1000 Thermo Fisher Scientific  Wilmington  DE.  RNA yields for this experiment were lower than the 100\u00b5g of RNA needed for RNA sequencing  so 3 samples were pooled into one  for a final n=2 for each of the hace1 MO and control MO groups. Barcoded cDNA libraries were prepared using RNA Seq Version 2 kit from Life Technologies following their recommended protocol. Library preparations were assayed for both quality control and quantity using Experion DNA 1K chip Life Technologies and diluted to 16 pM concentration. Samples were sequenced using a Proton Sequencer from Life Technologies on a PI chip following the manufacturer recommended protocol. Each chip was loaded with 2 samples.", "Zebrafish housing  breeding conditions  and developmental staging of larvae  were performed according to Westerfield Westerfield  2000.  Use of zebrafish in this study was approved by the Dalhousie University Committee on Laboratory Animals Protocol 15 123.  All zebrafish embryos were maintained in E3 embryo medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4 in 10 cm Petri dishes at 28oC.", "morpholino:hace1|strain:Tubingen|Stage:48 hpf", "GSM2796627", "GSM2796627: 48 hpf hace1 MO injected sample B; Danio rerio; RNA Seq", "GSM2796627", null, "1", "TRIzol Reagent RNA Extraction protocol Ambion RNA Life technologies was used to extract RNA from pooled samples of hace1 or control morphants n=6 per group.  Approximately 100 embryos per sample were used.  Tubingen wild type strain TU fish were previously injected with either hace1 MO or control MO using the injection protocol noted above.  RNA samples were quantified using the NanoDrop Spectrophotometer ND 1000 Thermo Fisher Scientific  Wilmington  DE.  RNA yields for this experiment were lower than the 100\u00b5g of RNA needed for RNA sequencing  so 3 samples were pooled into one  for a final n=2 for each of the hace1 MO and control MO groups. Barcoded cDNA libraries were prepared using RNA Seq Version 2 kit from Life Technologies following their recommended protocol. Library preparations were assayed for both quality control and quantity using Experion DNA 1K chip Life Technologies and diluted to 16 pM concentration. Samples were sequenced using a Proton Sequencer from Life Technologies on a PI chip following the manufacturer recommended protocol. Each chip was loaded with 2 samples.", "GEO Accession:GSM2796627", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP119063", null, null, "Hace1_B_raw.fastq.gz", "fastq", 1757670144.0, 24750483.0, "GSM2796627 r1", "0:71.02", "A:487716171;C:407071737;G:421621529;T:441260707;N:0", 71, null, null, null, 487716171, 407071737, 421621529, 441260707, 0, "SRX3228188", "SRS2552755", "SRA615148", "GEO", "Life Sciences Research Institute", 1, 0.58062, null, 0.04606, null, 0.7933, null, 0.45369, null, 113, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2017-09-28", "Hatching", "Embryo", "Whole Organism", "All anatomical structures"], [43775, "SRR6113349", "SRX3228187", "SRS2552754", "SRP119063", "PRJNA412499", "Analysis of gene expression changes by knock down of hace1 tumour suppressor in zebrafish", "GSE104380", "Transcriptome Analysis", "Background:  In this study we reveal a previously undescribed role of the HACE1 HECT domain and Ankyrin repeat Containing E3 ubiquitin protein ligase 1 tumor suppressor protein in normal vertebrate heart development using the zebrafish Danio rerio model.  We examined the link between the cardiac phenotypes associated with hace1 loss of function to the expression of the Rho small family GTPase  rac1  which is a known target of HACE1 and promotes ROS production via its interaction with NADPH oxidase holoenzymes. We examined expression changes induced by knock down of hace1 in zebrafish at 48 hpf  the stage when heart abnormalities are observed. This was done by collecting duplicate samples of control and hace1 morphant embryos and performing RNA sequencing on them. Conclusions:  Our study demonstrates that HACE1 is critical in the normal development and proper function of the heart via a ROS dependent mechanism. Overall design: 2 samples of control and hace1 morphant zebrafish embryos at 48 hpf were analyzed", null, "pubmed:29024245", null, "48 hpf hace1 MO injected sample A", "GSM2796626", null, "tissue:whole embryos|morpholino:hace1|strain:Tubingen|Stage:48 hpf", "48 hpf hace1 MO injected sample A", "Torrent Suite 4.2.1 used for basecalling Trimming with Cutadapt v1.2.1 Second pass trimming with home made script in order to remove reads shorter than 17bp and larger than 300bp and Q<20 2 steps alignement for RNA with tophat v2.0.6 and bowtie2 v2.0.2 Quantification and normalization with StrandNGS Version 2.1 with the following settings Strand specific reads: false Consider partial reads: true Max EM Iterations: 1000 Convergence criterion for EM: 0.0010 Normalization Type = DeSeq Threshold for normalization = 1 Baseline type =  median of all samples Genome build: Danio rerio Zv9 78 Transcripts 2015.01.22 Supplementary files format and content: tab delimited text files include normalised values or raw counts for each sample", "whole embryos", "The hace1 HECT 5\u2019 CCCTCGAACTGTTAGACAGAATAAA 3\u2019 and standard control morpholinos 5\u2019 CCTCTTACCTCAGTTACAATTTATA 3\u2019 were purchased from Genetools LLC Philomath  OR.  The hace1 morpholino splice site resides within the catalytically active HECT domain  upstream of the critical cysteine residue required for hace1 ubiquitin ligase function.  Knockdown of hace1 was verified by RT PCR as described in Daugaard et al Daugaard et al.  2013.", "TRIzol Reagent RNA Extraction protocol Ambion RNA Life technologies was used to extract RNA from pooled samples of hace1 or control morphants n=6 per group.  Approximately 100 embryos per sample were used.  Tubingen wild type strain TU fish were previously injected with either hace1 MO or control MO using the injection protocol noted above.  RNA samples were quantified using the NanoDrop Spectrophotometer ND 1000 Thermo Fisher Scientific  Wilmington  DE.  RNA yields for this experiment were lower than the 100\u00b5g of RNA needed for RNA sequencing  so 3 samples were pooled into one  for a final n=2 for each of the hace1 MO and control MO groups. Barcoded cDNA libraries were prepared using RNA Seq Version 2 kit from Life Technologies following their recommended protocol. Library preparations were assayed for both quality control and quantity using Experion DNA 1K chip Life Technologies and diluted to 16 pM concentration. Samples were sequenced using a Proton Sequencer from Life Technologies on a PI chip following the manufacturer recommended protocol. Each chip was loaded with 2 samples.", "Zebrafish housing  breeding conditions  and developmental staging of larvae  were performed according to Westerfield Westerfield  2000.  Use of zebrafish in this study was approved by the Dalhousie University Committee on Laboratory Animals Protocol 15 123.  All zebrafish embryos were maintained in E3 embryo medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4 in 10 cm Petri dishes at 28oC.", "morpholino:hace1|strain:Tubingen|Stage:48 hpf", "GSM2796626", "GSM2796626: 48 hpf hace1 MO injected sample A; Danio rerio; RNA Seq", "GSM2796626", null, "1", "TRIzol Reagent RNA Extraction protocol Ambion RNA Life technologies was used to extract RNA from pooled samples of hace1 or control morphants n=6 per group.  Approximately 100 embryos per sample were used.  Tubingen wild type strain TU fish were previously injected with either hace1 MO or control MO using the injection protocol noted above.  RNA samples were quantified using the NanoDrop Spectrophotometer ND 1000 Thermo Fisher Scientific  Wilmington  DE.  RNA yields for this experiment were lower than the 100\u00b5g of RNA needed for RNA sequencing  so 3 samples were pooled into one  for a final n=2 for each of the hace1 MO and control MO groups. Barcoded cDNA libraries were prepared using RNA Seq Version 2 kit from Life Technologies following their recommended protocol. Library preparations were assayed for both quality control and quantity using Experion DNA 1K chip Life Technologies and diluted to 16 pM concentration. Samples were sequenced using a Proton Sequencer from Life Technologies on a PI chip following the manufacturer recommended protocol. Each chip was loaded with 2 samples.", "GEO Accession:GSM2796626", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP119063", null, null, "Hace1_A_raw.fastq.gz", "fastq", 1715877862.0, 25355156.0, "GSM2796626 r1", "0:67.67", "A:472676520;C:396977327;G:417115591;T:429108424;N:0", 67, null, null, null, 472676520, 396977327, 417115591, 429108424, 0, "SRX3228187", "SRS2552754", "SRA615148", "GEO", "Life Sciences Research Institute", 1, 0.62221, null, 0.05775, null, 0.80373, null, 0.45358, null, 13, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2017-09-28", "Hatching", "Embryo", "Whole Organism", "All anatomical structures"], [43776, "SRR6113348", "SRX3228186", "SRS2552753", "SRP119063", "PRJNA412499", "Analysis of gene expression changes by knock down of hace1 tumour suppressor in zebrafish", "GSE104380", "Transcriptome Analysis", "Background:  In this study we reveal a previously undescribed role of the HACE1 HECT domain and Ankyrin repeat Containing E3 ubiquitin protein ligase 1 tumor suppressor protein in normal vertebrate heart development using the zebrafish Danio rerio model.  We examined the link between the cardiac phenotypes associated with hace1 loss of function to the expression of the Rho small family GTPase  rac1  which is a known target of HACE1 and promotes ROS production via its interaction with NADPH oxidase holoenzymes. We examined expression changes induced by knock down of hace1 in zebrafish at 48 hpf  the stage when heart abnormalities are observed. This was done by collecting duplicate samples of control and hace1 morphant embryos and performing RNA sequencing on them. Conclusions:  Our study demonstrates that HACE1 is critical in the normal development and proper function of the heart via a ROS dependent mechanism. Overall design: 2 samples of control and hace1 morphant zebrafish embryos at 48 hpf were analyzed", null, "pubmed:29024245", null, "48 hpf control MO injected sample B", "GSM2796625", null, "tissue:whole embryos|morpholino:control|strain:Tubingen|Stage:48 hpf", "48 hpf control MO injected sample B", "Torrent Suite 4.2.1 used for basecalling Trimming with Cutadapt v1.2.1 Second pass trimming with home made script in order to remove reads shorter than 17bp and larger than 300bp and Q<20 2 steps alignement for RNA with tophat v2.0.6 and bowtie2 v2.0.2 Quantification and normalization with StrandNGS Version 2.1 with the following settings Strand specific reads: false Consider partial reads: true Max EM Iterations: 1000 Convergence criterion for EM: 0.0010 Normalization Type = DeSeq Threshold for normalization = 1 Baseline type =  median of all samples Genome build: Danio rerio Zv9 78 Transcripts 2015.01.22 Supplementary files format and content: tab delimited text files include normalised values or raw counts for each sample", "whole embryos", "The hace1 HECT 5\u2019 CCCTCGAACTGTTAGACAGAATAAA 3\u2019 and standard control morpholinos 5\u2019 CCTCTTACCTCAGTTACAATTTATA 3\u2019 were purchased from Genetools LLC Philomath  OR.  The hace1 morpholino splice site resides within the catalytically active HECT domain  upstream of the critical cysteine residue required for hace1 ubiquitin ligase function.  Knockdown of hace1 was verified by RT PCR as described in Daugaard et al Daugaard et al.  2013.", "TRIzol Reagent RNA Extraction protocol Ambion RNA Life technologies was used to extract RNA from pooled samples of hace1 or control morphants n=6 per group.  Approximately 100 embryos per sample were used.  Tubingen wild type strain TU fish were previously injected with either hace1 MO or control MO using the injection protocol noted above.  RNA samples were quantified using the NanoDrop Spectrophotometer ND 1000 Thermo Fisher Scientific  Wilmington  DE.  RNA yields for this experiment were lower than the 100\u00b5g of RNA needed for RNA sequencing  so 3 samples were pooled into one  for a final n=2 for each of the hace1 MO and control MO groups. Barcoded cDNA libraries were prepared using RNA Seq Version 2 kit from Life Technologies following their recommended protocol. Library preparations were assayed for both quality control and quantity using Experion DNA 1K chip Life Technologies and diluted to 16 pM concentration. Samples were sequenced using a Proton Sequencer from Life Technologies on a PI chip following the manufacturer recommended protocol. Each chip was loaded with 2 samples.", "Zebrafish housing  breeding conditions  and developmental staging of larvae  were performed according to Westerfield Westerfield  2000.  Use of zebrafish in this study was approved by the Dalhousie University Committee on Laboratory Animals Protocol 15 123.  All zebrafish embryos were maintained in E3 embryo medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4 in 10 cm Petri dishes at 28oC.", "morpholino:control|strain:Tubingen|Stage:48 hpf", "GSM2796625", "GSM2796625: 48 hpf control MO injected sample B; Danio rerio; RNA Seq", "GSM2796625", null, "1", "TRIzol Reagent RNA Extraction protocol Ambion RNA Life technologies was used to extract RNA from pooled samples of hace1 or control morphants n=6 per group.  Approximately 100 embryos per sample were used.  Tubingen wild type strain TU fish were previously injected with either hace1 MO or control MO using the injection protocol noted above.  RNA samples were quantified using the NanoDrop Spectrophotometer ND 1000 Thermo Fisher Scientific  Wilmington  DE.  RNA yields for this experiment were lower than the 100\u00b5g of RNA needed for RNA sequencing  so 3 samples were pooled into one  for a final n=2 for each of the hace1 MO and control MO groups. Barcoded cDNA libraries were prepared using RNA Seq Version 2 kit from Life Technologies following their recommended protocol. Library preparations were assayed for both quality control and quantity using Experion DNA 1K chip Life Technologies and diluted to 16 pM concentration. Samples were sequenced using a Proton Sequencer from Life Technologies on a PI chip following the manufacturer recommended protocol. Each chip was loaded with 2 samples.", "GEO Accession:GSM2796625", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP119063", null, null, "Ctl_B_raw.fastq.gz", "fastq", 1645083935.0, 24006365.0, "GSM2796625 r1", "0:68.53", "A:451390140;C:379131185;G:405300969;T:409261641;N:0", 68, null, null, null, 451390140, 379131185, 405300969, 409261641, 0, "SRX3228186", "SRS2552753", "SRA615148", "GEO", "Life Sciences Research Institute", 1, 0.70292, null, 0.09465, null, 0.78776, null, 0.4826, null, 50, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2017-09-28", "Hatching", "Embryo", "Whole Organism", "All anatomical structures"], [43777, "SRR6113347", "SRX3228185", "SRS2552752", "SRP119063", "PRJNA412499", "Analysis of gene expression changes by knock down of hace1 tumour suppressor in zebrafish", "GSE104380", "Transcriptome Analysis", "Background:  In this study we reveal a previously undescribed role of the HACE1 HECT domain and Ankyrin repeat Containing E3 ubiquitin protein ligase 1 tumor suppressor protein in normal vertebrate heart development using the zebrafish Danio rerio model.  We examined the link between the cardiac phenotypes associated with hace1 loss of function to the expression of the Rho small family GTPase  rac1  which is a known target of HACE1 and promotes ROS production via its interaction with NADPH oxidase holoenzymes. We examined expression changes induced by knock down of hace1 in zebrafish at 48 hpf  the stage when heart abnormalities are observed. This was done by collecting duplicate samples of control and hace1 morphant embryos and performing RNA sequencing on them. Conclusions:  Our study demonstrates that HACE1 is critical in the normal development and proper function of the heart via a ROS dependent mechanism. Overall design: 2 samples of control and hace1 morphant zebrafish embryos at 48 hpf were analyzed", null, "pubmed:29024245", null, "48 hpf control MO injected sample A", "GSM2796624", null, "tissue:whole embryos|morpholino:control|strain:Tubingen|Stage:48 hpf", "48 hpf control MO injected sample A", "Torrent Suite 4.2.1 used for basecalling Trimming with Cutadapt v1.2.1 Second pass trimming with home made script in order to remove reads shorter than 17bp and larger than 300bp and Q<20 2 steps alignement for RNA with tophat v2.0.6 and bowtie2 v2.0.2 Quantification and normalization with StrandNGS Version 2.1 with the following settings Strand specific reads: false Consider partial reads: true Max EM Iterations: 1000 Convergence criterion for EM: 0.0010 Normalization Type = DeSeq Threshold for normalization = 1 Baseline type =  median of all samples Genome build: Danio rerio Zv9 78 Transcripts 2015.01.22 Supplementary files format and content: tab delimited text files include normalised values or raw counts for each sample", "whole embryos", "The hace1 HECT 5\u2019 CCCTCGAACTGTTAGACAGAATAAA 3\u2019 and standard control morpholinos 5\u2019 CCTCTTACCTCAGTTACAATTTATA 3\u2019 were purchased from Genetools LLC Philomath  OR.  The hace1 morpholino splice site resides within the catalytically active HECT domain  upstream of the critical cysteine residue required for hace1 ubiquitin ligase function.  Knockdown of hace1 was verified by RT PCR as described in Daugaard et al Daugaard et al.  2013.", "TRIzol Reagent RNA Extraction protocol Ambion RNA Life technologies was used to extract RNA from pooled samples of hace1 or control morphants n=6 per group.  Approximately 100 embryos per sample were used.  Tubingen wild type strain TU fish were previously injected with either hace1 MO or control MO using the injection protocol noted above.  RNA samples were quantified using the NanoDrop Spectrophotometer ND 1000 Thermo Fisher Scientific  Wilmington  DE.  RNA yields for this experiment were lower than the 100\u00b5g of RNA needed for RNA sequencing  so 3 samples were pooled into one  for a final n=2 for each of the hace1 MO and control MO groups. Barcoded cDNA libraries were prepared using RNA Seq Version 2 kit from Life Technologies following their recommended protocol. Library preparations were assayed for both quality control and quantity using Experion DNA 1K chip Life Technologies and diluted to 16 pM concentration. Samples were sequenced using a Proton Sequencer from Life Technologies on a PI chip following the manufacturer recommended protocol. Each chip was loaded with 2 samples.", "Zebrafish housing  breeding conditions  and developmental staging of larvae  were performed according to Westerfield Westerfield  2000.  Use of zebrafish in this study was approved by the Dalhousie University Committee on Laboratory Animals Protocol 15 123.  All zebrafish embryos were maintained in E3 embryo medium 5 mM NaCl  0.17 mM KCl  0.33 mM CaCl2  0.33 mM MgSO4 in 10 cm Petri dishes at 28oC.", "morpholino:control|strain:Tubingen|Stage:48 hpf", "GSM2796624", "GSM2796624: 48 hpf control MO injected sample A; Danio rerio; RNA Seq", "GSM2796624", null, "1", "TRIzol Reagent RNA Extraction protocol Ambion RNA Life technologies was used to extract RNA from pooled samples of hace1 or control morphants n=6 per group.  Approximately 100 embryos per sample were used.  Tubingen wild type strain TU fish were previously injected with either hace1 MO or control MO using the injection protocol noted above.  RNA samples were quantified using the NanoDrop Spectrophotometer ND 1000 Thermo Fisher Scientific  Wilmington  DE.  RNA yields for this experiment were lower than the 100\u00b5g of RNA needed for RNA sequencing  so 3 samples were pooled into one  for a final n=2 for each of the hace1 MO and control MO groups. Barcoded cDNA libraries were prepared using RNA Seq Version 2 kit from Life Technologies following their recommended protocol. Library preparations were assayed for both quality control and quantity using Experion DNA 1K chip Life Technologies and diluted to 16 pM concentration. Samples were sequenced using a Proton Sequencer from Life Technologies on a PI chip following the manufacturer recommended protocol. Each chip was loaded with 2 samples.", "GEO Accession:GSM2796624", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP119063", null, null, "Ctl_A_raw.fastq.gz", "fastq", 1286925679.0, 21135316.0, "GSM2796624 r1", "0:60.89", "A:358307800;C:293470722;G:312171155;T:322976002;N:0", 60, null, null, null, 358307800, 293470722, 312171155, 322976002, 0, "SRX3228185", "SRS2552752", "SRA615148", "GEO", "Life Sciences Research Institute", 1, 0.65876, null, 0.09304, null, 0.77441, null, 0.48609, null, 15, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2017-09-28", "Hatching", "Embryo", "Whole Organism", "All anatomical structures"], [55735, "SRR10747736", "SRX7423118", "SRS5869238", "SRP238398", "PRJNA597022", "RNA seq analysis of gene regulation by miR 34a and expression changes induced by DNA damage in zebrafish", "GSE142440", "Transcriptome Analysis", "Li Fraumeni syndrome LFS is a disorder due to inherited mutations in the TP53 gene resulting in an increased risk of developing several types of cancer. MicroRNA miR 34a has been implicated downstream of p53 on the basis of being a direct transcriptional target and  when over expressed  having pro apoptotic phenotypes in cell lines. Moreover  miR 34a has been shown to be a modifier gene in the context of LFS  since its epigenetic silencing increases the likelihood of tumour development in patients with mutant TP53.  However  the in vivo consequences of miR 34 loss are still unclear. For example  mice lacking all three a b c miR 34 homologs show no detectable abnormalities in p53 responses. The relative expression of different miR 34 genes in zebrafish was studied using qRT PCR with specific assays. The miR 34a  miR 34b and miR 34c display unique onset of developmental expression and expression levels  with miR 34a being the most abundant and constant in expression. All of the miR 34 genes also showed clear induction by p53 when DNA damaging treatments are performed. Using CRISPR Cas9 technology  we generated a zebrafish miR 34a deletion mutant to further investigate the roles of miR 34a on its own and its association with the p53 pathway. Predictably  a miR 34a deletion mutant demonstrated absence of miR 34a  though without xxx 34b and miR 34c compensation beyond baseline expression levels. Mutants survive to maturity  show no overt phenotypes and have normal apoptotic responses to DNA damaging irradiation or camptothecin treatments. To further explore the effects of miR 34a  we performed gene expression profiling using RNA seq of wild type and miR 34a deletion mutant zebrafish embryos at 28 hpf with or without xxx with a DNA damaging drug camptothecin. The results of this RNA seq experiments showed that the loss of miR 34a does not strongly affect induction of genes by DNA damage. However  the overall pattern of gene expression is significantly different as shown by Principal Component Analysis and there is a group of about 100 genes which are differentially expressed due to loss of miR 34a. The dataset we present in this submission was used to reach these conclusions. Overall design: Zebrafish embryos at 24 hpf of wild type and miR 34a /  genotypes were dechorionated and the control DMSO or 1 uM camptothecin treatment for 4 hours was performed followed by RNA extraction from all samples.", null, null, null, "28 hpf miR 34a /  treated with 1\u03bcM CPT rep3", "GSM4227412", null, "tissue:whole embryo|genotype:miR 34a / |Stage:28 hpf|treatment:4 hours with 1\u03bcM camptothecin", "28 hpf miR 34a /  treated with 1\u03bcM CPT rep3", "Read trimming: the raw reads had the adapters \u201cATCACCGAC\u201d removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts", "whole embryo", "Camptothecin CPT treatments were performed by adding either DMSO control groups or the 2 mM stock CPT solution in DMSO to fish water for 1 \u00b5M concentration and incubating embryos for 4 hours.", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University of Ottawa Animal Care Committee approval number: CHEOe 3168 A1. Zebrafish embryos were maintained at 28.5 \u00b0C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock.", "genotype:miR 34a / |Stage:28 hpf|treatment:4 hours with 1\u03bcM camptothecin", "GSM4227412", "GSM4227412: 28 hpf miR 34a /  treated with 1\u03bcM CPT rep3; Danio rerio; RNA Seq", "GSM4227412", null, "1", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "GEO Accession:GSM4227412", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP238398", null, null, "28h_miR34a_CPT3.fastq.gz", "fastq", 2466204640.0, 30514491.0, "GSM4227412 r1", "0:80.82", "A:674261100;C:584057064;G:643569450;T:564317026;N:0", 80, null, null, null, 674261100, 584057064, 643569450, 564317026, 0, "SRX7423118", "SRS5869238", "SRA1014962", "GEO", "Berman Lab, CHEO Research Institute/University of Ottawa", 1, 0.75398, null, 0.07249, null, 0.75018, null, 0.47891, null, 61, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-12-20", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55736, "SRR10747735", "SRX7423117", "SRS5869237", "SRP238398", "PRJNA597022", "RNA seq analysis of gene regulation by miR 34a and expression changes induced by DNA damage in zebrafish", "GSE142440", "Transcriptome Analysis", "Li Fraumeni syndrome LFS is a disorder due to inherited mutations in the TP53 gene resulting in an increased risk of developing several types of cancer. MicroRNA miR 34a has been implicated downstream of p53 on the basis of being a direct transcriptional target and  when over expressed  having pro apoptotic phenotypes in cell lines. Moreover  miR 34a has been shown to be a modifier gene in the context of LFS  since its epigenetic silencing increases the likelihood of tumour development in patients with mutant TP53.  However  the in vivo consequences of miR 34 loss are still unclear. For example  mice lacking all three a b c miR 34 homologs show no detectable abnormalities in p53 responses. The relative expression of different miR 34 genes in zebrafish was studied using qRT PCR with specific assays. The miR 34a  miR 34b and miR 34c display unique onset of developmental expression and expression levels  with miR 34a being the most abundant and constant in expression. All of the miR 34 genes also showed clear induction by p53 when DNA damaging treatments are performed. Using CRISPR Cas9 technology  we generated a zebrafish miR 34a deletion mutant to further investigate the roles of miR 34a on its own and its association with the p53 pathway. Predictably  a miR 34a deletion mutant demonstrated absence of miR 34a  though without xxx 34b and miR 34c compensation beyond baseline expression levels. Mutants survive to maturity  show no overt phenotypes and have normal apoptotic responses to DNA damaging irradiation or camptothecin treatments. To further explore the effects of miR 34a  we performed gene expression profiling using RNA seq of wild type and miR 34a deletion mutant zebrafish embryos at 28 hpf with or without xxx with a DNA damaging drug camptothecin. The results of this RNA seq experiments showed that the loss of miR 34a does not strongly affect induction of genes by DNA damage. However  the overall pattern of gene expression is significantly different as shown by Principal Component Analysis and there is a group of about 100 genes which are differentially expressed due to loss of miR 34a. The dataset we present in this submission was used to reach these conclusions. Overall design: Zebrafish embryos at 24 hpf of wild type and miR 34a /  genotypes were dechorionated and the control DMSO or 1 uM camptothecin treatment for 4 hours was performed followed by RNA extraction from all samples.", null, null, null, "28 hpf miR 34a /  treated with 1\u03bcM CPT rep2", "GSM4227411", null, "tissue:whole embryo|genotype:miR 34a / |Stage:28 hpf|treatment:4 hours with 1\u03bcM camptothecin", "28 hpf miR 34a /  treated with 1\u03bcM CPT rep2", "Read trimming: the raw reads had the adapters \u201cATCACCGAC\u201d removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts", "whole embryo", "Camptothecin CPT treatments were performed by adding either DMSO control groups or the 2 mM stock CPT solution in DMSO to fish water for 1 \u00b5M concentration and incubating embryos for 4 hours.", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University of Ottawa Animal Care Committee approval number: CHEOe 3168 A1. Zebrafish embryos were maintained at 28.5 \u00b0C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock.", "genotype:miR 34a / |Stage:28 hpf|treatment:4 hours with 1\u03bcM camptothecin", "GSM4227411", "GSM4227411: 28 hpf miR 34a /  treated with 1\u03bcM CPT rep2; Danio rerio; RNA Seq", "GSM4227411", null, "1", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "GEO Accession:GSM4227411", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP238398", null, null, "28h_miR34a_CPT2.fastq.gz", "fastq", 2799449877.0, 35729096.0, "GSM4227411 r1", "0:78.35", "A:774111861;C:655625280;G:720330370;T:649382366;N:0", 78, null, null, null, 774111861, 655625280, 720330370, 649382366, 0, "SRX7423117", "SRS5869237", "SRA1014962", "GEO", "Berman Lab, CHEO Research Institute/University of Ottawa", 1, 0.75821, null, 0.06442, null, 0.75528, null, 0.47533, null, 39, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-12-20", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55737, "SRR10747734", "SRX7423116", "SRS5869236", "SRP238398", "PRJNA597022", "RNA seq analysis of gene regulation by miR 34a and expression changes induced by DNA damage in zebrafish", "GSE142440", "Transcriptome Analysis", "Li Fraumeni syndrome LFS is a disorder due to inherited mutations in the TP53 gene resulting in an increased risk of developing several types of cancer. MicroRNA miR 34a has been implicated downstream of p53 on the basis of being a direct transcriptional target and  when over expressed  having pro apoptotic phenotypes in cell lines. Moreover  miR 34a has been shown to be a modifier gene in the context of LFS  since its epigenetic silencing increases the likelihood of tumour development in patients with mutant TP53.  However  the in vivo consequences of miR 34 loss are still unclear. For example  mice lacking all three a b c miR 34 homologs show no detectable abnormalities in p53 responses. The relative expression of different miR 34 genes in zebrafish was studied using qRT PCR with specific assays. The miR 34a  miR 34b and miR 34c display unique onset of developmental expression and expression levels  with miR 34a being the most abundant and constant in expression. All of the miR 34 genes also showed clear induction by p53 when DNA damaging treatments are performed. Using CRISPR Cas9 technology  we generated a zebrafish miR 34a deletion mutant to further investigate the roles of miR 34a on its own and its association with the p53 pathway. Predictably  a miR 34a deletion mutant demonstrated absence of miR 34a  though without xxx 34b and miR 34c compensation beyond baseline expression levels. Mutants survive to maturity  show no overt phenotypes and have normal apoptotic responses to DNA damaging irradiation or camptothecin treatments. To further explore the effects of miR 34a  we performed gene expression profiling using RNA seq of wild type and miR 34a deletion mutant zebrafish embryos at 28 hpf with or without xxx with a DNA damaging drug camptothecin. The results of this RNA seq experiments showed that the loss of miR 34a does not strongly affect induction of genes by DNA damage. However  the overall pattern of gene expression is significantly different as shown by Principal Component Analysis and there is a group of about 100 genes which are differentially expressed due to loss of miR 34a. The dataset we present in this submission was used to reach these conclusions. Overall design: Zebrafish embryos at 24 hpf of wild type and miR 34a /  genotypes were dechorionated and the control DMSO or 1 uM camptothecin treatment for 4 hours was performed followed by RNA extraction from all samples.", null, null, null, "28 hpf miR 34a /  treated with 1\u03bcM CPT rep1", "GSM4227410", null, "tissue:whole embryo|genotype:miR 34a / |Stage:28 hpf|treatment:4 hours with 1\u03bcM camptothecin", "28 hpf miR 34a /  treated with 1\u03bcM CPT rep1", "Read trimming: the raw reads had the adapters \u201cATCACCGAC\u201d removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts", "whole embryo", "Camptothecin CPT treatments were performed by adding either DMSO control groups or the 2 mM stock CPT solution in DMSO to fish water for 1 \u00b5M concentration and incubating embryos for 4 hours.", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University of Ottawa Animal Care Committee approval number: CHEOe 3168 A1. Zebrafish embryos were maintained at 28.5 \u00b0C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock.", "genotype:miR 34a / |Stage:28 hpf|treatment:4 hours with 1\u03bcM camptothecin", "GSM4227410", "GSM4227410: 28 hpf miR 34a /  treated with 1\u03bcM CPT rep1; Danio rerio; RNA Seq", "GSM4227410", null, "1", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "GEO Accession:GSM4227410", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP238398", null, null, "28h_miR34a_CPT1.fastq.gz", "fastq", 3324553506.0, 48175746.0, "GSM4227410 r1", "0:69.01", "A:917927255;C:782740771;G:859994003;T:763891477;N:0", 69, null, null, null, 917927255, 782740771, 859994003, 763891477, 0, "SRX7423116", "SRS5869236", "SRA1014962", "GEO", "Berman Lab, CHEO Research Institute/University of Ottawa", 1, 0.76943, null, 0.06284, null, 0.7428, null, 0.47633, null, 115, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-12-20", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55738, "SRR10747733", "SRX7423115", "SRS5869235", "SRP238398", "PRJNA597022", "RNA seq analysis of gene regulation by miR 34a and expression changes induced by DNA damage in zebrafish", "GSE142440", "Transcriptome Analysis", "Li Fraumeni syndrome LFS is a disorder due to inherited mutations in the TP53 gene resulting in an increased risk of developing several types of cancer. MicroRNA miR 34a has been implicated downstream of p53 on the basis of being a direct transcriptional target and  when over expressed  having pro apoptotic phenotypes in cell lines. Moreover  miR 34a has been shown to be a modifier gene in the context of LFS  since its epigenetic silencing increases the likelihood of tumour development in patients with mutant TP53.  However  the in vivo consequences of miR 34 loss are still unclear. For example  mice lacking all three a b c miR 34 homologs show no detectable abnormalities in p53 responses. The relative expression of different miR 34 genes in zebrafish was studied using qRT PCR with specific assays. The miR 34a  miR 34b and miR 34c display unique onset of developmental expression and expression levels  with miR 34a being the most abundant and constant in expression. All of the miR 34 genes also showed clear induction by p53 when DNA damaging treatments are performed. Using CRISPR Cas9 technology  we generated a zebrafish miR 34a deletion mutant to further investigate the roles of miR 34a on its own and its association with the p53 pathway. Predictably  a miR 34a deletion mutant demonstrated absence of miR 34a  though without xxx 34b and miR 34c compensation beyond baseline expression levels. Mutants survive to maturity  show no overt phenotypes and have normal apoptotic responses to DNA damaging irradiation or camptothecin treatments. To further explore the effects of miR 34a  we performed gene expression profiling using RNA seq of wild type and miR 34a deletion mutant zebrafish embryos at 28 hpf with or without xxx with a DNA damaging drug camptothecin. The results of this RNA seq experiments showed that the loss of miR 34a does not strongly affect induction of genes by DNA damage. However  the overall pattern of gene expression is significantly different as shown by Principal Component Analysis and there is a group of about 100 genes which are differentially expressed due to loss of miR 34a. The dataset we present in this submission was used to reach these conclusions. Overall design: Zebrafish embryos at 24 hpf of wild type and miR 34a /  genotypes were dechorionated and the control DMSO or 1 uM camptothecin treatment for 4 hours was performed followed by RNA extraction from all samples.", null, null, null, "28 hpf miR 34a /  DMSO control rep3", "GSM4227409", null, "tissue:whole embryo|genotype:miR 34a / |Stage:28 hpf|treatment:4 hours with 0.005% DMSO", "28 hpf miR 34a /  DMSO control rep3", "Read trimming: the raw reads had the adapters \u201cATCACCGAC\u201d removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts", "whole embryo", "Camptothecin CPT treatments were performed by adding either DMSO control groups or the 2 mM stock CPT solution in DMSO to fish water for 1 \u00b5M concentration and incubating embryos for 4 hours.", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University of Ottawa Animal Care Committee approval number: CHEOe 3168 A1. Zebrafish embryos were maintained at 28.5 \u00b0C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock.", "genotype:miR 34a / |Stage:28 hpf|treatment:4 hours with 0.005% DMSO", "GSM4227409", "GSM4227409: 28 hpf miR 34a /  DMSO control rep3; Danio rerio; RNA Seq", "GSM4227409", null, "1", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "GEO Accession:GSM4227409", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP238398", null, null, "28h_miR34a_DMSO3.fastq.gz", "fastq", 2998520813.0, 37166834.0, "GSM4227409 r1", "0:80.68", "A:831969226;C:705126074;G:792553026;T:668872487;N:0", 80, null, null, null, 831969226, 705126074, 792553026, 668872487, 0, "SRX7423115", "SRS5869235", "SRA1014962", "GEO", "Berman Lab, CHEO Research Institute/University of Ottawa", 1, 0.80425, null, 0.05204, null, 0.73143, null, 0.46724, null, 44, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-12-20", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55739, "SRR10747732", "SRX7423114", "SRS5869234", "SRP238398", "PRJNA597022", "RNA seq analysis of gene regulation by miR 34a and expression changes induced by DNA damage in zebrafish", "GSE142440", "Transcriptome Analysis", "Li Fraumeni syndrome LFS is a disorder due to inherited mutations in the TP53 gene resulting in an increased risk of developing several types of cancer. MicroRNA miR 34a has been implicated downstream of p53 on the basis of being a direct transcriptional target and  when over expressed  having pro apoptotic phenotypes in cell lines. Moreover  miR 34a has been shown to be a modifier gene in the context of LFS  since its epigenetic silencing increases the likelihood of tumour development in patients with mutant TP53.  However  the in vivo consequences of miR 34 loss are still unclear. For example  mice lacking all three a b c miR 34 homologs show no detectable abnormalities in p53 responses. The relative expression of different miR 34 genes in zebrafish was studied using qRT PCR with specific assays. The miR 34a  miR 34b and miR 34c display unique onset of developmental expression and expression levels  with miR 34a being the most abundant and constant in expression. All of the miR 34 genes also showed clear induction by p53 when DNA damaging treatments are performed. Using CRISPR Cas9 technology  we generated a zebrafish miR 34a deletion mutant to further investigate the roles of miR 34a on its own and its association with the p53 pathway. Predictably  a miR 34a deletion mutant demonstrated absence of miR 34a  though without xxx 34b and miR 34c compensation beyond baseline expression levels. Mutants survive to maturity  show no overt phenotypes and have normal apoptotic responses to DNA damaging irradiation or camptothecin treatments. To further explore the effects of miR 34a  we performed gene expression profiling using RNA seq of wild type and miR 34a deletion mutant zebrafish embryos at 28 hpf with or without xxx with a DNA damaging drug camptothecin. The results of this RNA seq experiments showed that the loss of miR 34a does not strongly affect induction of genes by DNA damage. However  the overall pattern of gene expression is significantly different as shown by Principal Component Analysis and there is a group of about 100 genes which are differentially expressed due to loss of miR 34a. The dataset we present in this submission was used to reach these conclusions. Overall design: Zebrafish embryos at 24 hpf of wild type and miR 34a /  genotypes were dechorionated and the control DMSO or 1 uM camptothecin treatment for 4 hours was performed followed by RNA extraction from all samples.", null, null, null, "28 hpf miR 34a /  DMSO control rep2", "GSM4227408", null, "tissue:whole embryo|genotype:miR 34a / |Stage:28 hpf|treatment:4 hours with 0.005% DMSO", "28 hpf miR 34a /  DMSO control rep2", "Read trimming: the raw reads had the adapters \u201cATCACCGAC\u201d removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts", "whole embryo", "Camptothecin CPT treatments were performed by adding either DMSO control groups or the 2 mM stock CPT solution in DMSO to fish water for 1 \u00b5M concentration and incubating embryos for 4 hours.", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University of Ottawa Animal Care Committee approval number: CHEOe 3168 A1. Zebrafish embryos were maintained at 28.5 \u00b0C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock.", "genotype:miR 34a / |Stage:28 hpf|treatment:4 hours with 0.005% DMSO", "GSM4227408", "GSM4227408: 28 hpf miR 34a /  DMSO control rep2; Danio rerio; RNA Seq", "GSM4227408", null, "1", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "GEO Accession:GSM4227408", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP238398", null, null, "28h_miR34a_DMSO2.fastq.gz", "fastq", 3717672599.0, 48384751.0, "GSM4227408 r1", "0:76.84", "A:1007096699;C:899919892;G:1013267190;T:797388818;N:0", 76, null, null, null, 1007096699, 899919892, 1013267190, 797388818, 0, "SRX7423114", "SRS5869234", "SRA1014962", "GEO", "Berman Lab, CHEO Research Institute/University of Ottawa", 1, 0.7766, null, 0.06285, null, 0.74393, null, 0.46447, null, 115, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-12-20", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55740, "SRR10747731", "SRX7423113", "SRS5869233", "SRP238398", "PRJNA597022", "RNA seq analysis of gene regulation by miR 34a and expression changes induced by DNA damage in zebrafish", "GSE142440", "Transcriptome Analysis", "Li Fraumeni syndrome LFS is a disorder due to inherited mutations in the TP53 gene resulting in an increased risk of developing several types of cancer. MicroRNA miR 34a has been implicated downstream of p53 on the basis of being a direct transcriptional target and  when over expressed  having pro apoptotic phenotypes in cell lines. Moreover  miR 34a has been shown to be a modifier gene in the context of LFS  since its epigenetic silencing increases the likelihood of tumour development in patients with mutant TP53.  However  the in vivo consequences of miR 34 loss are still unclear. For example  mice lacking all three a b c miR 34 homologs show no detectable abnormalities in p53 responses. The relative expression of different miR 34 genes in zebrafish was studied using qRT PCR with specific assays. The miR 34a  miR 34b and miR 34c display unique onset of developmental expression and expression levels  with miR 34a being the most abundant and constant in expression. All of the miR 34 genes also showed clear induction by p53 when DNA damaging treatments are performed. Using CRISPR Cas9 technology  we generated a zebrafish miR 34a deletion mutant to further investigate the roles of miR 34a on its own and its association with the p53 pathway. Predictably  a miR 34a deletion mutant demonstrated absence of miR 34a  though without xxx 34b and miR 34c compensation beyond baseline expression levels. Mutants survive to maturity  show no overt phenotypes and have normal apoptotic responses to DNA damaging irradiation or camptothecin treatments. To further explore the effects of miR 34a  we performed gene expression profiling using RNA seq of wild type and miR 34a deletion mutant zebrafish embryos at 28 hpf with or without xxx with a DNA damaging drug camptothecin. The results of this RNA seq experiments showed that the loss of miR 34a does not strongly affect induction of genes by DNA damage. However  the overall pattern of gene expression is significantly different as shown by Principal Component Analysis and there is a group of about 100 genes which are differentially expressed due to loss of miR 34a. The dataset we present in this submission was used to reach these conclusions. Overall design: Zebrafish embryos at 24 hpf of wild type and miR 34a /  genotypes were dechorionated and the control DMSO or 1 uM camptothecin treatment for 4 hours was performed followed by RNA extraction from all samples.", null, null, null, "28 hpf miR 34a /  DMSO control rep1", "GSM4227407", null, "tissue:whole embryo|genotype:miR 34a / |Stage:28 hpf|treatment:4 hours with 0.005% DMSO", "28 hpf miR 34a /  DMSO control rep1", "Read trimming: the raw reads had the adapters \u201cATCACCGAC\u201d removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts", "whole embryo", "Camptothecin CPT treatments were performed by adding either DMSO control groups or the 2 mM stock CPT solution in DMSO to fish water for 1 \u00b5M concentration and incubating embryos for 4 hours.", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University of Ottawa Animal Care Committee approval number: CHEOe 3168 A1. Zebrafish embryos were maintained at 28.5 \u00b0C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock.", "genotype:miR 34a / |Stage:28 hpf|treatment:4 hours with 0.005% DMSO", "GSM4227407", "GSM4227407: 28 hpf miR 34a /  DMSO control rep1; Danio rerio; RNA Seq", "GSM4227407", null, "1", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "GEO Accession:GSM4227407", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP238398", null, null, "28h_miR34a_DMSO1.fastq.gz", "fastq", 2648513845.0, 34032135.0, "GSM4227407 r1", "0:77.82", "A:723351205;C:631864519;G:693886300;T:599411821;N:0", 77, null, null, null, 723351205, 631864519, 693886300, 599411821, 0, "SRX7423113", "SRS5869233", "SRA1014962", "GEO", "Berman Lab, CHEO Research Institute/University of Ottawa", 1, 0.73119, null, 0.05014, null, 0.7417, null, 0.46453, null, 115, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-12-20", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55741, "SRR10747730", "SRX7423112", "SRS5869232", "SRP238398", "PRJNA597022", "RNA seq analysis of gene regulation by miR 34a and expression changes induced by DNA damage in zebrafish", "GSE142440", "Transcriptome Analysis", "Li Fraumeni syndrome LFS is a disorder due to inherited mutations in the TP53 gene resulting in an increased risk of developing several types of cancer. MicroRNA miR 34a has been implicated downstream of p53 on the basis of being a direct transcriptional target and  when over expressed  having pro apoptotic phenotypes in cell lines. Moreover  miR 34a has been shown to be a modifier gene in the context of LFS  since its epigenetic silencing increases the likelihood of tumour development in patients with mutant TP53.  However  the in vivo consequences of miR 34 loss are still unclear. For example  mice lacking all three a b c miR 34 homologs show no detectable abnormalities in p53 responses. The relative expression of different miR 34 genes in zebrafish was studied using qRT PCR with specific assays. The miR 34a  miR 34b and miR 34c display unique onset of developmental expression and expression levels  with miR 34a being the most abundant and constant in expression. All of the miR 34 genes also showed clear induction by p53 when DNA damaging treatments are performed. Using CRISPR Cas9 technology  we generated a zebrafish miR 34a deletion mutant to further investigate the roles of miR 34a on its own and its association with the p53 pathway. Predictably  a miR 34a deletion mutant demonstrated absence of miR 34a  though without xxx 34b and miR 34c compensation beyond baseline expression levels. Mutants survive to maturity  show no overt phenotypes and have normal apoptotic responses to DNA damaging irradiation or camptothecin treatments. To further explore the effects of miR 34a  we performed gene expression profiling using RNA seq of wild type and miR 34a deletion mutant zebrafish embryos at 28 hpf with or without xxx with a DNA damaging drug camptothecin. The results of this RNA seq experiments showed that the loss of miR 34a does not strongly affect induction of genes by DNA damage. However  the overall pattern of gene expression is significantly different as shown by Principal Component Analysis and there is a group of about 100 genes which are differentially expressed due to loss of miR 34a. The dataset we present in this submission was used to reach these conclusions. Overall design: Zebrafish embryos at 24 hpf of wild type and miR 34a /  genotypes were dechorionated and the control DMSO or 1 uM camptothecin treatment for 4 hours was performed followed by RNA extraction from all samples.", null, null, null, "28 hpf wild type treated with 1\u03bcM CPT rep3", "GSM4227406", null, "tissue:whole embryo|genotype:wild type|Stage:28 hpf|treatment:4 hours with 1\u03bcM camptothecin", "28 hpf wild type treated with 1\u03bcM CPT rep3", "Read trimming: the raw reads had the adapters \u201cATCACCGAC\u201d removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts", "whole embryo", "Camptothecin CPT treatments were performed by adding either DMSO control groups or the 2 mM stock CPT solution in DMSO to fish water for 1 \u00b5M concentration and incubating embryos for 4 hours.", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University of Ottawa Animal Care Committee approval number: CHEOe 3168 A1. Zebrafish embryos were maintained at 28.5 \u00b0C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock.", "genotype:wild type|Stage:28 hpf|treatment:4 hours with 1\u03bcM camptothecin", "GSM4227406", "GSM4227406: 28 hpf wild type treated with 1\u03bcM CPT rep3; Danio rerio; RNA Seq", "GSM4227406", null, "1", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "GEO Accession:GSM4227406", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP238398", null, null, "28h_wt_CPT3.fastq.gz", "fastq", 4910665916.0, 54209032.0, "GSM4227406 r1", "0:90.59", "A:1333252314;C:1180672328;G:1270082657;T:1126658617;N:0", 90, null, null, null, 1333252314, 1180672328, 1270082657, 1126658617, 0, "SRX7423112", "SRS5869232", "SRA1014962", "GEO", "Berman Lab, CHEO Research Institute/University of Ottawa", 1, 0.74851, null, 0.0448, null, 0.74793, null, 0.47706, null, 81, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-12-20", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55742, "SRR10747729", "SRX7423111", "SRS5869231", "SRP238398", "PRJNA597022", "RNA seq analysis of gene regulation by miR 34a and expression changes induced by DNA damage in zebrafish", "GSE142440", "Transcriptome Analysis", "Li Fraumeni syndrome LFS is a disorder due to inherited mutations in the TP53 gene resulting in an increased risk of developing several types of cancer. MicroRNA miR 34a has been implicated downstream of p53 on the basis of being a direct transcriptional target and  when over expressed  having pro apoptotic phenotypes in cell lines. Moreover  miR 34a has been shown to be a modifier gene in the context of LFS  since its epigenetic silencing increases the likelihood of tumour development in patients with mutant TP53.  However  the in vivo consequences of miR 34 loss are still unclear. For example  mice lacking all three a b c miR 34 homologs show no detectable abnormalities in p53 responses. The relative expression of different miR 34 genes in zebrafish was studied using qRT PCR with specific assays. The miR 34a  miR 34b and miR 34c display unique onset of developmental expression and expression levels  with miR 34a being the most abundant and constant in expression. All of the miR 34 genes also showed clear induction by p53 when DNA damaging treatments are performed. Using CRISPR Cas9 technology  we generated a zebrafish miR 34a deletion mutant to further investigate the roles of miR 34a on its own and its association with the p53 pathway. Predictably  a miR 34a deletion mutant demonstrated absence of miR 34a  though without xxx 34b and miR 34c compensation beyond baseline expression levels. Mutants survive to maturity  show no overt phenotypes and have normal apoptotic responses to DNA damaging irradiation or camptothecin treatments. To further explore the effects of miR 34a  we performed gene expression profiling using RNA seq of wild type and miR 34a deletion mutant zebrafish embryos at 28 hpf with or without xxx with a DNA damaging drug camptothecin. The results of this RNA seq experiments showed that the loss of miR 34a does not strongly affect induction of genes by DNA damage. However  the overall pattern of gene expression is significantly different as shown by Principal Component Analysis and there is a group of about 100 genes which are differentially expressed due to loss of miR 34a. The dataset we present in this submission was used to reach these conclusions. Overall design: Zebrafish embryos at 24 hpf of wild type and miR 34a /  genotypes were dechorionated and the control DMSO or 1 uM camptothecin treatment for 4 hours was performed followed by RNA extraction from all samples.", null, null, null, "28 hpf wild type treated with 1\u03bcM CPT rep2", "GSM4227405", null, "tissue:whole embryo|genotype:wild type|Stage:28 hpf|treatment:4 hours with 1\u03bcM camptothecin", "28 hpf wild type treated with 1\u03bcM CPT rep2", "Read trimming: the raw reads had the adapters \u201cATCACCGAC\u201d removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts", "whole embryo", "Camptothecin CPT treatments were performed by adding either DMSO control groups or the 2 mM stock CPT solution in DMSO to fish water for 1 \u00b5M concentration and incubating embryos for 4 hours.", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University of Ottawa Animal Care Committee approval number: CHEOe 3168 A1. Zebrafish embryos were maintained at 28.5 \u00b0C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock.", "genotype:wild type|Stage:28 hpf|treatment:4 hours with 1\u03bcM camptothecin", "GSM4227405", "GSM4227405: 28 hpf wild type treated with 1\u03bcM CPT rep2; Danio rerio; RNA Seq", "GSM4227405", null, "1", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "GEO Accession:GSM4227405", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP238398", null, null, "28h_wt_CPT2.fastq.gz", "fastq", 4706787896.0, 52433187.0, "GSM4227405 r1", "0:89.77", "A:1271959985;C:1139661957;G:1248571859;T:1046594095;N:0", 89, null, null, null, 1271959985, 1139661957, 1248571859, 1046594095, 0, "SRX7423111", "SRS5869231", "SRA1014962", "GEO", "Berman Lab, CHEO Research Institute/University of Ottawa", 1, 0.75052, null, 0.06118, null, 0.7667, null, 0.48756, null, 86, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-12-20", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55743, "SRR10747728", "SRX7423110", "SRS5869230", "SRP238398", "PRJNA597022", "RNA seq analysis of gene regulation by miR 34a and expression changes induced by DNA damage in zebrafish", "GSE142440", "Transcriptome Analysis", "Li Fraumeni syndrome LFS is a disorder due to inherited mutations in the TP53 gene resulting in an increased risk of developing several types of cancer. MicroRNA miR 34a has been implicated downstream of p53 on the basis of being a direct transcriptional target and  when over expressed  having pro apoptotic phenotypes in cell lines. Moreover  miR 34a has been shown to be a modifier gene in the context of LFS  since its epigenetic silencing increases the likelihood of tumour development in patients with mutant TP53.  However  the in vivo consequences of miR 34 loss are still unclear. For example  mice lacking all three a b c miR 34 homologs show no detectable abnormalities in p53 responses. The relative expression of different miR 34 genes in zebrafish was studied using qRT PCR with specific assays. The miR 34a  miR 34b and miR 34c display unique onset of developmental expression and expression levels  with miR 34a being the most abundant and constant in expression. All of the miR 34 genes also showed clear induction by p53 when DNA damaging treatments are performed. Using CRISPR Cas9 technology  we generated a zebrafish miR 34a deletion mutant to further investigate the roles of miR 34a on its own and its association with the p53 pathway. Predictably  a miR 34a deletion mutant demonstrated absence of miR 34a  though without xxx 34b and miR 34c compensation beyond baseline expression levels. Mutants survive to maturity  show no overt phenotypes and have normal apoptotic responses to DNA damaging irradiation or camptothecin treatments. To further explore the effects of miR 34a  we performed gene expression profiling using RNA seq of wild type and miR 34a deletion mutant zebrafish embryos at 28 hpf with or without xxx with a DNA damaging drug camptothecin. The results of this RNA seq experiments showed that the loss of miR 34a does not strongly affect induction of genes by DNA damage. However  the overall pattern of gene expression is significantly different as shown by Principal Component Analysis and there is a group of about 100 genes which are differentially expressed due to loss of miR 34a. The dataset we present in this submission was used to reach these conclusions. Overall design: Zebrafish embryos at 24 hpf of wild type and miR 34a /  genotypes were dechorionated and the control DMSO or 1 uM camptothecin treatment for 4 hours was performed followed by RNA extraction from all samples.", null, null, null, "28 hpf wild type treated with 1\u03bcM CPT rep1", "GSM4227404", null, "tissue:whole embryo|genotype:wild type|Stage:28 hpf|treatment:4 hours with 1\u03bcM camptothecin", "28 hpf wild type treated with 1\u03bcM CPT rep1", "Read trimming: the raw reads had the adapters \u201cATCACCGAC\u201d removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts", "whole embryo", "Camptothecin CPT treatments were performed by adding either DMSO control groups or the 2 mM stock CPT solution in DMSO to fish water for 1 \u00b5M concentration and incubating embryos for 4 hours.", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University of Ottawa Animal Care Committee approval number: CHEOe 3168 A1. Zebrafish embryos were maintained at 28.5 \u00b0C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock.", "genotype:wild type|Stage:28 hpf|treatment:4 hours with 1\u03bcM camptothecin", "GSM4227404", "GSM4227404: 28 hpf wild type treated with 1\u03bcM CPT rep1; Danio rerio; RNA Seq", "GSM4227404", null, "1", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "GEO Accession:GSM4227404", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP238398", null, null, "28h_wt_CPT1.fastq.gz", "fastq", 4344364040.0, 47174313.0, "GSM4227404 r1", "0:92.09", "A:1162056747;C:1055561948;G:1156595580;T:970149765;N:0", 92, null, null, null, 1162056747, 1055561948, 1156595580, 970149765, 0, "SRX7423110", "SRS5869230", "SRA1014962", "GEO", "Berman Lab, CHEO Research Institute/University of Ottawa", 1, 0.68985, null, 0.07087, null, 0.79078, null, 0.49968, null, 106, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-12-20", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55744, "SRR10747727", "SRX7423109", "SRS5869228", "SRP238398", "PRJNA597022", "RNA seq analysis of gene regulation by miR 34a and expression changes induced by DNA damage in zebrafish", "GSE142440", "Transcriptome Analysis", "Li Fraumeni syndrome LFS is a disorder due to inherited mutations in the TP53 gene resulting in an increased risk of developing several types of cancer. MicroRNA miR 34a has been implicated downstream of p53 on the basis of being a direct transcriptional target and  when over expressed  having pro apoptotic phenotypes in cell lines. Moreover  miR 34a has been shown to be a modifier gene in the context of LFS  since its epigenetic silencing increases the likelihood of tumour development in patients with mutant TP53.  However  the in vivo consequences of miR 34 loss are still unclear. For example  mice lacking all three a b c miR 34 homologs show no detectable abnormalities in p53 responses. The relative expression of different miR 34 genes in zebrafish was studied using qRT PCR with specific assays. The miR 34a  miR 34b and miR 34c display unique onset of developmental expression and expression levels  with miR 34a being the most abundant and constant in expression. All of the miR 34 genes also showed clear induction by p53 when DNA damaging treatments are performed. Using CRISPR Cas9 technology  we generated a zebrafish miR 34a deletion mutant to further investigate the roles of miR 34a on its own and its association with the p53 pathway. Predictably  a miR 34a deletion mutant demonstrated absence of miR 34a  though without xxx 34b and miR 34c compensation beyond baseline expression levels. Mutants survive to maturity  show no overt phenotypes and have normal apoptotic responses to DNA damaging irradiation or camptothecin treatments. To further explore the effects of miR 34a  we performed gene expression profiling using RNA seq of wild type and miR 34a deletion mutant zebrafish embryos at 28 hpf with or without xxx with a DNA damaging drug camptothecin. The results of this RNA seq experiments showed that the loss of miR 34a does not strongly affect induction of genes by DNA damage. However  the overall pattern of gene expression is significantly different as shown by Principal Component Analysis and there is a group of about 100 genes which are differentially expressed due to loss of miR 34a. The dataset we present in this submission was used to reach these conclusions. Overall design: Zebrafish embryos at 24 hpf of wild type and miR 34a /  genotypes were dechorionated and the control DMSO or 1 uM camptothecin treatment for 4 hours was performed followed by RNA extraction from all samples.", null, null, null, "28 hpf wild type DMSO control rep3", "GSM4227403", null, "tissue:whole embryo|genotype:wild type|Stage:28 hpf|treatment:4 hours with 0.005% DMSO", "28 hpf wild type DMSO control rep3", "Read trimming: the raw reads had the adapters \u201cATCACCGAC\u201d removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts", "whole embryo", "Camptothecin CPT treatments were performed by adding either DMSO control groups or the 2 mM stock CPT solution in DMSO to fish water for 1 \u00b5M concentration and incubating embryos for 4 hours.", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University of Ottawa Animal Care Committee approval number: CHEOe 3168 A1. Zebrafish embryos were maintained at 28.5 \u00b0C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock.", "genotype:wild type|Stage:28 hpf|treatment:4 hours with 0.005% DMSO", "GSM4227403", "GSM4227403: 28 hpf wild type DMSO control rep3; Danio rerio; RNA Seq", "GSM4227403", null, "1", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "GEO Accession:GSM4227403", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP238398", null, null, "28h_wt_DMSO3.fastq.gz", "fastq", 4067298489.0, 50935402.0, "GSM4227403 r1", "0:79.85", "A:1113757653;C:963268241;G:1062451618;T:927820977;N:0", 79, null, null, null, 1113757653, 963268241, 1062451618, 927820977, 0, "SRX7423109", "SRS5869228", "SRA1014962", "GEO", "Berman Lab, CHEO Research Institute/University of Ottawa", 1, 0.77461, null, 0.06582, null, 0.74633, null, 0.47778, null, 86, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-12-20", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55745, "SRR10747726", "SRX7423108", "SRS5869229", "SRP238398", "PRJNA597022", "RNA seq analysis of gene regulation by miR 34a and expression changes induced by DNA damage in zebrafish", "GSE142440", "Transcriptome Analysis", "Li Fraumeni syndrome LFS is a disorder due to inherited mutations in the TP53 gene resulting in an increased risk of developing several types of cancer. MicroRNA miR 34a has been implicated downstream of p53 on the basis of being a direct transcriptional target and  when over expressed  having pro apoptotic phenotypes in cell lines. Moreover  miR 34a has been shown to be a modifier gene in the context of LFS  since its epigenetic silencing increases the likelihood of tumour development in patients with mutant TP53.  However  the in vivo consequences of miR 34 loss are still unclear. For example  mice lacking all three a b c miR 34 homologs show no detectable abnormalities in p53 responses. The relative expression of different miR 34 genes in zebrafish was studied using qRT PCR with specific assays. The miR 34a  miR 34b and miR 34c display unique onset of developmental expression and expression levels  with miR 34a being the most abundant and constant in expression. All of the miR 34 genes also showed clear induction by p53 when DNA damaging treatments are performed. Using CRISPR Cas9 technology  we generated a zebrafish miR 34a deletion mutant to further investigate the roles of miR 34a on its own and its association with the p53 pathway. Predictably  a miR 34a deletion mutant demonstrated absence of miR 34a  though without xxx 34b and miR 34c compensation beyond baseline expression levels. Mutants survive to maturity  show no overt phenotypes and have normal apoptotic responses to DNA damaging irradiation or camptothecin treatments. To further explore the effects of miR 34a  we performed gene expression profiling using RNA seq of wild type and miR 34a deletion mutant zebrafish embryos at 28 hpf with or without xxx with a DNA damaging drug camptothecin. The results of this RNA seq experiments showed that the loss of miR 34a does not strongly affect induction of genes by DNA damage. However  the overall pattern of gene expression is significantly different as shown by Principal Component Analysis and there is a group of about 100 genes which are differentially expressed due to loss of miR 34a. The dataset we present in this submission was used to reach these conclusions. Overall design: Zebrafish embryos at 24 hpf of wild type and miR 34a /  genotypes were dechorionated and the control DMSO or 1 uM camptothecin treatment for 4 hours was performed followed by RNA extraction from all samples.", null, null, null, "28 hpf wild type DMSO control rep2", "GSM4227402", null, "tissue:whole embryo|genotype:wild type|Stage:28 hpf|treatment:4 hours with 0.005% DMSO", "28 hpf wild type DMSO control rep2", "Read trimming: the raw reads had the adapters \u201cATCACCGAC\u201d removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts", "whole embryo", "Camptothecin CPT treatments were performed by adding either DMSO control groups or the 2 mM stock CPT solution in DMSO to fish water for 1 \u00b5M concentration and incubating embryos for 4 hours.", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University of Ottawa Animal Care Committee approval number: CHEOe 3168 A1. Zebrafish embryos were maintained at 28.5 \u00b0C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock.", "genotype:wild type|Stage:28 hpf|treatment:4 hours with 0.005% DMSO", "GSM4227402", "GSM4227402: 28 hpf wild type DMSO control rep2; Danio rerio; RNA Seq", "GSM4227402", null, "1", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "GEO Accession:GSM4227402", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP238398", null, null, "28h_wt_DMSO2.fastq.gz", "fastq", 3977775840.0, 46861941.0, "GSM4227402 r1", "0:84.88", "A:1100615887;C:933911324;G:1061089489;T:882159140;N:0", 84, null, null, null, 1100615887, 933911324, 1061089489, 882159140, 0, "SRX7423108", "SRS5869229", "SRA1014962", "GEO", "Berman Lab, CHEO Research Institute/University of Ottawa", 1, 0.7831, null, 0.06264, null, 0.74117, null, 0.47727, null, 98, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-12-20", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55746, "SRR10747725", "SRX7423107", "SRS5869227", "SRP238398", "PRJNA597022", "RNA seq analysis of gene regulation by miR 34a and expression changes induced by DNA damage in zebrafish", "GSE142440", "Transcriptome Analysis", "Li Fraumeni syndrome LFS is a disorder due to inherited mutations in the TP53 gene resulting in an increased risk of developing several types of cancer. MicroRNA miR 34a has been implicated downstream of p53 on the basis of being a direct transcriptional target and  when over expressed  having pro apoptotic phenotypes in cell lines. Moreover  miR 34a has been shown to be a modifier gene in the context of LFS  since its epigenetic silencing increases the likelihood of tumour development in patients with mutant TP53.  However  the in vivo consequences of miR 34 loss are still unclear. For example  mice lacking all three a b c miR 34 homologs show no detectable abnormalities in p53 responses. The relative expression of different miR 34 genes in zebrafish was studied using qRT PCR with specific assays. The miR 34a  miR 34b and miR 34c display unique onset of developmental expression and expression levels  with miR 34a being the most abundant and constant in expression. All of the miR 34 genes also showed clear induction by p53 when DNA damaging treatments are performed. Using CRISPR Cas9 technology  we generated a zebrafish miR 34a deletion mutant to further investigate the roles of miR 34a on its own and its association with the p53 pathway. Predictably  a miR 34a deletion mutant demonstrated absence of miR 34a  though without xxx 34b and miR 34c compensation beyond baseline expression levels. Mutants survive to maturity  show no overt phenotypes and have normal apoptotic responses to DNA damaging irradiation or camptothecin treatments. To further explore the effects of miR 34a  we performed gene expression profiling using RNA seq of wild type and miR 34a deletion mutant zebrafish embryos at 28 hpf with or without xxx with a DNA damaging drug camptothecin. The results of this RNA seq experiments showed that the loss of miR 34a does not strongly affect induction of genes by DNA damage. However  the overall pattern of gene expression is significantly different as shown by Principal Component Analysis and there is a group of about 100 genes which are differentially expressed due to loss of miR 34a. The dataset we present in this submission was used to reach these conclusions. Overall design: Zebrafish embryos at 24 hpf of wild type and miR 34a /  genotypes were dechorionated and the control DMSO or 1 uM camptothecin treatment for 4 hours was performed followed by RNA extraction from all samples.", null, null, null, "28 hpf wild type DMSO control rep1", "GSM4227401", null, "tissue:whole embryo|genotype:wild type|Stage:28 hpf|treatment:4 hours with 0.005% DMSO", "28 hpf wild type DMSO control rep1", "Read trimming: the raw reads had the adapters \u201cATCACCGAC\u201d removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts", "whole embryo", "Camptothecin CPT treatments were performed by adding either DMSO control groups or the 2 mM stock CPT solution in DMSO to fish water for 1 \u00b5M concentration and incubating embryos for 4 hours.", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University of Ottawa Animal Care Committee approval number: CHEOe 3168 A1. Zebrafish embryos were maintained at 28.5 \u00b0C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock.", "genotype:wild type|Stage:28 hpf|treatment:4 hours with 0.005% DMSO", "GSM4227401", "GSM4227401: 28 hpf wild type DMSO control rep1; Danio rerio; RNA Seq", "GSM4227401", null, "1", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "GEO Accession:GSM4227401", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP238398", null, null, "28h_wt_DMSO1.fastq.gz", "fastq", 3589144707.0, 44402480.0, "GSM4227401 r1", "0:80.83", "A:982842105;C:850942867;G:952092389;T:803267346;N:0", 80, null, null, null, 982842105, 850942867, 952092389, 803267346, 0, "SRX7423107", "SRS5869227", "SRA1014962", "GEO", "Berman Lab, CHEO Research Institute/University of Ottawa", 1, 0.74503, null, 0.06357, null, 0.74207, null, 0.47311, null, 59, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-12-20", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55924, "SRR10767295", "SRX7441213", "SRS5885540", "SRP238807", "PRJNA597725", "A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia", "GSE142599", "Transcriptome Analysis", "JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage  from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B  SOCS3A  SOCS3B  PIAS2 as well as patways involved in hematopoiesis  immunity  response to interferon and response to biotic stimuli. Overall design: Total RNA from casper  JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation", null, null, null, "36 hpf JAK1 WT transgenic rep 3", "GSM4232679", null, "tissue:whole embryo|genotype:Tgubi:cDNA JAK1 WT p2A sfGFP|developmental stage:36 hpf embryo", "36 hpf JAK1 WT transgenic rep 3", "Read trimming: the raw reads had the adapters \u201cATCACCGAC\u201d removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts", "whole embryo", null, "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 \u00b0C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock.", "genotype:Tgubi:cDNA JAK1 WT p2A sfGFP|developmental stage:36 hpf embryo", "GSM4232679", "GSM4232679: 36 hpf JAK1 WT transgenic rep 3; Danio rerio; RNA Seq", "GSM4232679", null, "1", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "GEO Accession:GSM4232679", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP238807", null, null, "36h_JAK1_WT_3.fastq.gz", "fastq", 3207715934.0, 39511938.0, "GSM4232679 r1", "0:81.18", "A:896166458;C:753209973;G:826542873;T:731796630;N:0", 81, null, null, null, 896166458, 753209973, 826542873, 731796630, 0, "SRX7441213", "SRS5885540", "SRA1016603", "GEO", "Berman Lab, CHEO Research Institute/University of Ottawa", 1, 0.72565, null, 0.04702, null, 0.74466, null, 0.46784, null, 195, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-12-26", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55925, "SRR10767294", "SRX7441212", "SRS5885539", "SRP238807", "PRJNA597725", "A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia", "GSE142599", "Transcriptome Analysis", "JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage  from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B  SOCS3A  SOCS3B  PIAS2 as well as patways involved in hematopoiesis  immunity  response to interferon and response to biotic stimuli. Overall design: Total RNA from casper  JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation", null, null, null, "36 hpf JAK1 WT transgenic rep 2", "GSM4232678", null, "tissue:whole embryo|genotype:Tgubi:cDNA JAK1 WT p2A sfGFP|developmental stage:36 hpf embryo", "36 hpf JAK1 WT transgenic rep 2", "Read trimming: the raw reads had the adapters \u201cATCACCGAC\u201d removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts", "whole embryo", null, "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 \u00b0C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock.", "genotype:Tgubi:cDNA JAK1 WT p2A sfGFP|developmental stage:36 hpf embryo", "GSM4232678", "GSM4232678: 36 hpf JAK1 WT transgenic rep 2; Danio rerio; RNA Seq", "GSM4232678", null, "1", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "GEO Accession:GSM4232678", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP238807", null, null, "36h_JAK1_WT_2.fastq.gz", "fastq", 2560460349.0, 43193416.0, "GSM4232678 r1", "0:59.28", "A:730124916;C:589981787;G:645350763;T:595002883;N:0", 59, null, null, null, 730124916, 589981787, 645350763, 595002883, 0, "SRX7441212", "SRS5885539", "SRA1016603", "GEO", "Berman Lab, CHEO Research Institute/University of Ottawa", 1, 0.75327, null, 0.05174, null, 0.74752, null, 0.45367, null, 72, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-12-26", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55926, "SRR10767293", "SRX7441211", "SRS5885538", "SRP238807", "PRJNA597725", "A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia", "GSE142599", "Transcriptome Analysis", "JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage  from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B  SOCS3A  SOCS3B  PIAS2 as well as patways involved in hematopoiesis  immunity  response to interferon and response to biotic stimuli. Overall design: Total RNA from casper  JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation", null, null, null, "36 hpf JAK1 WT transgenic rep 1", "GSM4232677", null, "tissue:whole embryo|genotype:Tgubi:cDNA JAK1 WT p2A sfGFP|developmental stage:36 hpf embryo", "36 hpf JAK1 WT transgenic rep 1", "Read trimming: the raw reads had the adapters \u201cATCACCGAC\u201d removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts", "whole embryo", null, "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 \u00b0C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock.", "genotype:Tgubi:cDNA JAK1 WT p2A sfGFP|developmental stage:36 hpf embryo", "GSM4232677", "GSM4232677: 36 hpf JAK1 WT transgenic rep 1; Danio rerio; RNA Seq", "GSM4232677", null, "1", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "GEO Accession:GSM4232677", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP238807", null, "loader:fastq load.py", "36h_JAK1_WT_1.fastq.gz", "fastq", 2094453215.0, 31942604.0, "GSM4232677 r1", "0:65.57", "A:592981403;C:482525539;G:529643794;T:489302479;N:0", 65, null, null, null, 592981403, 482525539, 529643794, 489302479, 0, "SRX7441211", "SRS5885538", "SRA1016603", "GEO", "Berman Lab, CHEO Research Institute/University of Ottawa", 1, 0.73635, null, 0.05607, null, 0.75635, null, 0.47675, null, 61, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-12-26", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55927, "SRR10767292", "SRX7441210", "SRS5885537", "SRP238807", "PRJNA597725", "A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia", "GSE142599", "Transcriptome Analysis", "JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage  from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B  SOCS3A  SOCS3B  PIAS2 as well as patways involved in hematopoiesis  immunity  response to interferon and response to biotic stimuli. Overall design: Total RNA from casper  JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation", null, null, null, "36 hpf JAK1 A634D transgenic rep 3", "GSM4232676", null, "tissue:whole embryo|genotype:Tgubi:cDNA JAK1 A634D p2A sfGFP|developmental stage:36 hpf embryo", "36 hpf JAK1 A634D transgenic rep 3", "Read trimming: the raw reads had the adapters \u201cATCACCGAC\u201d removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts", "whole embryo", null, "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 \u00b0C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock.", "genotype:Tgubi:cDNA JAK1 A634D p2A sfGFP|developmental stage:36 hpf embryo", "GSM4232676", "GSM4232676: 36 hpf JAK1 A634D transgenic rep 3; Danio rerio; RNA Seq", "GSM4232676", null, "1", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "GEO Accession:GSM4232676", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP238807", null, null, "36h_JAK1_A634D_3.fastq.gz", "fastq", 4241535970.0, 47169114.0, "GSM4232676 r1", "0:89.92", "A:1179967764;C:1000306138;G:1078691404;T:982570664;N:0", 89, null, null, null, 1179967764, 1000306138, 1078691404, 982570664, 0, "SRX7441210", "SRS5885537", "SRA1016603", "GEO", "Berman Lab, CHEO Research Institute/University of Ottawa", 1, 0.69334, null, 0.04467, null, 0.74773, null, 0.46809, null, 46, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-12-26", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55928, "SRR10767291", "SRX7441209", "SRS5885536", "SRP238807", "PRJNA597725", "A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia", "GSE142599", "Transcriptome Analysis", "JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage  from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B  SOCS3A  SOCS3B  PIAS2 as well as patways involved in hematopoiesis  immunity  response to interferon and response to biotic stimuli. Overall design: Total RNA from casper  JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation", null, null, null, "36 hpf JAK1 A634D transgenic rep 2", "GSM4232675", null, "tissue:whole embryo|genotype:Tgubi:cDNA JAK1 A634D p2A sfGFP|developmental stage:36 hpf embryo", "36 hpf JAK1 A634D transgenic rep 2", "Read trimming: the raw reads had the adapters \u201cATCACCGAC\u201d removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts", "whole embryo", null, "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 \u00b0C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock.", "genotype:Tgubi:cDNA JAK1 A634D p2A sfGFP|developmental stage:36 hpf embryo", "GSM4232675", "GSM4232675: 36 hpf JAK1 A634D transgenic rep 2; Danio rerio; RNA Seq", "GSM4232675", null, "1", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "GEO Accession:GSM4232675", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP238807", null, null, "36h_JAK1_A634D_2.fastq.gz", "fastq", 2456466408.0, 32142937.0, "GSM4232675 r1", "0:76.42", "A:709646128;C:553448600;G:580023523;T:613348157;N:0", 76, null, null, null, 709646128, 553448600, 580023523, 613348157, 0, "SRX7441209", "SRS5885536", "SRA1016603", "GEO", "Berman Lab, CHEO Research Institute/University of Ottawa", 1, 0.67769, null, 0.05801, null, 0.76059, null, 0.48545, null, 39, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-12-26", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55929, "SRR10767290", "SRX7441208", "SRS5885535", "SRP238807", "PRJNA597725", "A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia", "GSE142599", "Transcriptome Analysis", "JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage  from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B  SOCS3A  SOCS3B  PIAS2 as well as patways involved in hematopoiesis  immunity  response to interferon and response to biotic stimuli. Overall design: Total RNA from casper  JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation", null, null, null, "36 hpf JAK1 A634D transgenic rep 1", "GSM4232674", null, "tissue:whole embryo|genotype:Tgubi:cDNA JAK1 A634D p2A sfGFP|developmental stage:36 hpf embryo", "36 hpf JAK1 A634D transgenic rep 1", "Read trimming: the raw reads had the adapters \u201cATCACCGAC\u201d removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts", "whole embryo", null, "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 \u00b0C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock.", "genotype:Tgubi:cDNA JAK1 A634D p2A sfGFP|developmental stage:36 hpf embryo", "GSM4232674", "GSM4232674: 36 hpf JAK1 A634D transgenic rep 1; Danio rerio; RNA Seq", "GSM4232674", null, "1", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "GEO Accession:GSM4232674", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP238807", null, null, "36h_JAK1_A634D_1.fastq.gz", "fastq", 2197901663.0, 33128985.0, "GSM4232674 r1", "0:66.34", "A:621605948;C:508292358;G:560418617;T:507584740;N:0", 66, null, null, null, 621605948, 508292358, 560418617, 507584740, 0, "SRX7441208", "SRS5885535", "SRA1016603", "GEO", "Berman Lab, CHEO Research Institute/University of Ottawa", 1, 0.73924, null, 0.05937, null, 0.77234, null, 0.46385, null, 50, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-12-26", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55930, "SRR10767289", "SRX7441207", "SRS5885534", "SRP238807", "PRJNA597725", "A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia", "GSE142599", "Transcriptome Analysis", "JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage  from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B  SOCS3A  SOCS3B  PIAS2 as well as patways involved in hematopoiesis  immunity  response to interferon and response to biotic stimuli. Overall design: Total RNA from casper  JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation", null, null, null, "36 hpf wild type rep3", "GSM4232673", null, "tissue:whole embryo|genotype:wild type|developmental stage:36 hpf embryo", "36 hpf wild type rep3", "Read trimming: the raw reads had the adapters \u201cATCACCGAC\u201d removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts", "whole embryo", null, "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 \u00b0C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock.", "genotype:wild type|developmental stage:36 hpf embryo", "GSM4232673", "GSM4232673: 36 hpf wild type rep3; Danio rerio; RNA Seq", "GSM4232673", null, "1", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "GEO Accession:GSM4232673", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP238807", null, null, "36h_Casper_3.fastq.gz", "fastq", 2521721766.0, 35478367.0, "GSM4232673 r1", "0:71.08", "A:700525735;C:596259331;G:641495563;T:583441137;N:0", 71, null, null, null, 700525735, 596259331, 641495563, 583441137, 0, "SRX7441207", "SRS5885534", "SRA1016603", "GEO", "Berman Lab, CHEO Research Institute/University of Ottawa", 1, 0.70683, null, 0.03758, null, 0.77764, null, 0.46898, null, 113, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-12-26", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55931, "SRR10767288", "SRX7441206", "SRS5885533", "SRP238807", "PRJNA597725", "A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia", "GSE142599", "Transcriptome Analysis", "JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage  from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B  SOCS3A  SOCS3B  PIAS2 as well as patways involved in hematopoiesis  immunity  response to interferon and response to biotic stimuli. Overall design: Total RNA from casper  JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation", null, null, null, "36 hpf wild type rep2", "GSM4232672", null, "tissue:whole embryo|genotype:wild type|developmental stage:36 hpf embryo", "36 hpf wild type rep2", "Read trimming: the raw reads had the adapters \u201cATCACCGAC\u201d removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts", "whole embryo", null, "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 \u00b0C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock.", "genotype:wild type|developmental stage:36 hpf embryo", "GSM4232672", "GSM4232672: 36 hpf wild type rep2; Danio rerio; RNA Seq", "GSM4232672", null, "1", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "GEO Accession:GSM4232672", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP238807", null, null, "36h_Casper_2.fastq.gz", "fastq", 2178583599.0, 36369833.0, "GSM4232672 r1", "0:59.90", "A:614435594;C:523772191;G:571455142;T:468920672;N:0", 59, null, null, null, 614435594, 523772191, 571455142, 468920672, 0, "SRX7441206", "SRS5885533", "SRA1016603", "GEO", "Berman Lab, CHEO Research Institute/University of Ottawa", 1, 0.79523, null, 0.0396, null, 0.78677, null, 0.48417, null, 76, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-12-26", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55932, "SRR10767287", "SRX7441205", "SRS5885532", "SRP238807", "PRJNA597725", "A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia", "GSE142599", "Transcriptome Analysis", "JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage  from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B  SOCS3A  SOCS3B  PIAS2 as well as patways involved in hematopoiesis  immunity  response to interferon and response to biotic stimuli. Overall design: Total RNA from casper  JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation", null, null, null, "36 hpf wild type rep1", "GSM4232671", null, "tissue:whole embryo|genotype:wild type|developmental stage:36 hpf embryo", "36 hpf wild type rep1", "Read trimming: the raw reads had the adapters \u201cATCACCGAC\u201d removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts", "whole embryo", null, "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 \u00b0C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock.", "genotype:wild type|developmental stage:36 hpf embryo", "GSM4232671", "GSM4232671: 36 hpf wild type rep1; Danio rerio; RNA Seq", "GSM4232671", null, "1", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "GEO Accession:GSM4232671", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP238807", null, null, "36h_Casper_1.fastq.gz", "fastq", 2051080839.0, 29493121.0, "GSM4232671 r1", "0:69.54", "A:568337886;C:483385131;G:533547242;T:465810580;N:0", 69, null, null, null, 568337886, 483385131, 533547242, 465810580, 0, "SRX7441205", "SRS5885532", "SRA1016603", "GEO", "Berman Lab, CHEO Research Institute/University of Ottawa", 1, 0.76599, null, 0.08449, null, 0.7553, null, 0.48389, null, 62, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-12-26", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55933, "SRR10767286", "SRX7441204", "SRS5885531", "SRP238807", "PRJNA597725", "A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia", "GSE142599", "Transcriptome Analysis", "JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage  from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B  SOCS3A  SOCS3B  PIAS2 as well as patways involved in hematopoiesis  immunity  response to interferon and response to biotic stimuli. Overall design: Total RNA from casper  JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation", null, null, null, "28 hpf JAK1 WT transgenic rep 3", "GSM4232670", null, "tissue:whole embryo|genotype:Tgubi:cDNA JAK1 WT p2A sfGFP|developmental stage:28 hpf embryo", "28 hpf JAK1 WT transgenic rep 3", "Read trimming: the raw reads had the adapters \u201cATCACCGAC\u201d removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts", "whole embryo", null, "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 \u00b0C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock.", "genotype:Tgubi:cDNA JAK1 WT p2A sfGFP|developmental stage:28 hpf embryo", "GSM4232670", "GSM4232670: 28 hpf JAK1 WT transgenic rep 3; Danio rerio; RNA Seq", "GSM4232670", null, "1", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "GEO Accession:GSM4232670", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP238807", null, null, "28h_JAK1_WT_3.fastq.gz", "fastq", 3005037417.0, 40912443.0, "GSM4232670 r1", "0:73.45", "A:846279597;C:696356412;G:763013287;T:699388121;N:0", 73, null, null, null, 846279597, 696356412, 763013287, 699388121, 0, "SRX7441204", "SRS5885531", "SRA1016603", "GEO", "Berman Lab, CHEO Research Institute/University of Ottawa", 1, 0.74899, null, 0.06252, null, 0.73708, null, 0.46159, null, 164, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-12-26", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55934, "SRR10767285", "SRX7441203", "SRS5885530", "SRP238807", "PRJNA597725", "A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia", "GSE142599", "Transcriptome Analysis", "JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage  from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B  SOCS3A  SOCS3B  PIAS2 as well as patways involved in hematopoiesis  immunity  response to interferon and response to biotic stimuli. Overall design: Total RNA from casper  JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation", null, null, null, "28 hpf JAK1 WT transgenic rep 2", "GSM4232669", null, "tissue:whole embryo|genotype:Tgubi:cDNA JAK1 WT p2A sfGFP|developmental stage:28 hpf embryo", "28 hpf JAK1 WT transgenic rep 2", "Read trimming: the raw reads had the adapters \u201cATCACCGAC\u201d removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts", "whole embryo", null, "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 \u00b0C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock.", "genotype:Tgubi:cDNA JAK1 WT p2A sfGFP|developmental stage:28 hpf embryo", "GSM4232669", "GSM4232669: 28 hpf JAK1 WT transgenic rep 2; Danio rerio; RNA Seq", "GSM4232669", null, "1", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "GEO Accession:GSM4232669", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP238807", null, null, "28h_JAK1_WT_2.fastq.gz", "fastq", 2973958523.0, 36683139.0, "GSM4232669 r1", "0:81.07", "A:836795761;C:679113153;G:741994649;T:716054960;N:0", 81, null, null, null, 836795761, 679113153, 741994649, 716054960, 0, "SRX7441203", "SRS5885530", "SRA1016603", "GEO", "Berman Lab, CHEO Research Institute/University of Ottawa", 1, 0.7064, null, 0.07418, null, 0.74501, null, 0.46732, null, 94, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-12-26", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55935, "SRR10767284", "SRX7441202", "SRS5885529", "SRP238807", "PRJNA597725", "A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia", "GSE142599", "Transcriptome Analysis", "JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage  from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B  SOCS3A  SOCS3B  PIAS2 as well as patways involved in hematopoiesis  immunity  response to interferon and response to biotic stimuli. Overall design: Total RNA from casper  JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation", null, null, null, "28 hpf JAK1 WT transgenic rep 1", "GSM4232668", null, "tissue:whole embryo|genotype:Tgubi:cDNA JAK1 WT p2A sfGFP|developmental stage:28 hpf embryo", "28 hpf JAK1 WT transgenic rep 1", "Read trimming: the raw reads had the adapters \u201cATCACCGAC\u201d removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts", "whole embryo", null, "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 \u00b0C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock.", "genotype:Tgubi:cDNA JAK1 WT p2A sfGFP|developmental stage:28 hpf embryo", "GSM4232668", "GSM4232668: 28 hpf JAK1 WT transgenic rep 1; Danio rerio; RNA Seq", "GSM4232668", null, "1", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "GEO Accession:GSM4232668", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP238807", null, null, "28h_JAK1_WT_1.fastq.gz", "fastq", 1691518079.0, 28932427.0, "GSM4232668 r1", "0:58.46", "A:475931203;C:396253965;G:439590903;T:379742008;N:0", 58, null, null, null, 475931203, 396253965, 439590903, 379742008, 0, "SRX7441202", "SRS5885529", "SRA1016603", "GEO", "Berman Lab, CHEO Research Institute/University of Ottawa", 1, 0.73552, null, 0.05663, null, 0.75089, null, 0.46344, null, 64, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-12-26", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55936, "SRR10767283", "SRX7441201", "SRS5885528", "SRP238807", "PRJNA597725", "A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia", "GSE142599", "Transcriptome Analysis", "JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage  from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B  SOCS3A  SOCS3B  PIAS2 as well as patways involved in hematopoiesis  immunity  response to interferon and response to biotic stimuli. Overall design: Total RNA from casper  JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation", null, null, null, "28 hpf JAK1 A634D transgenic rep 3", "GSM4232667", null, "tissue:whole embryo|genotype:Tgubi:cDNA JAK1 A634D p2A sfGFP|developmental stage:28 hpf embryo", "28 hpf JAK1 A634D transgenic rep 3", "Read trimming: the raw reads had the adapters \u201cATCACCGAC\u201d removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts", "whole embryo", null, "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 \u00b0C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock.", "genotype:Tgubi:cDNA JAK1 A634D p2A sfGFP|developmental stage:28 hpf embryo", "GSM4232667", "GSM4232667: 28 hpf JAK1 A634D transgenic rep 3; Danio rerio; RNA Seq", "GSM4232667", null, "1", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "GEO Accession:GSM4232667", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP238807", null, null, "28h_JAK1_A634D_3.fastq.gz", "fastq", 3045470999.0, 42256971.0, "GSM4232667 r1", "0:72.07", "A:852249654;C:717480980;G:783460499;T:692279866;N:0", 72, null, null, null, 852249654, 717480980, 783460499, 692279866, 0, "SRX7441201", "SRS5885528", "SRA1016603", "GEO", "Berman Lab, CHEO Research Institute/University of Ottawa", 1, 0.74394, null, 0.05129, null, 0.73097, null, 0.47382, null, 76, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-12-26", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55937, "SRR10767282", "SRX7441200", "SRS5885527", "SRP238807", "PRJNA597725", "A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia", "GSE142599", "Transcriptome Analysis", "JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage  from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B  SOCS3A  SOCS3B  PIAS2 as well as patways involved in hematopoiesis  immunity  response to interferon and response to biotic stimuli. Overall design: Total RNA from casper  JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation", null, null, null, "28 hpf JAK1 A634D transgenic rep 2", "GSM4232666", null, "tissue:whole embryo|genotype:Tgubi:cDNA JAK1 A634D p2A sfGFP|developmental stage:28 hpf embryo", "28 hpf JAK1 A634D transgenic rep 2", "Read trimming: the raw reads had the adapters \u201cATCACCGAC\u201d removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts", "whole embryo", null, "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 \u00b0C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock.", "genotype:Tgubi:cDNA JAK1 A634D p2A sfGFP|developmental stage:28 hpf embryo", "GSM4232666", "GSM4232666: 28 hpf JAK1 A634D transgenic rep 2; Danio rerio; RNA Seq", "GSM4232666", null, "1", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "GEO Accession:GSM4232666", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP238807", null, null, "28h_JAK1_A634D_2.fastq.gz", "fastq", 2828148639.0, 42710224.0, "GSM4232666 r1", "0:66.22", "A:810947164;C:659404496;G:725958457;T:631838522;N:0", 66, null, null, null, 810947164, 659404496, 725958457, 631838522, 0, "SRX7441200", "SRS5885527", "SRA1016603", "GEO", "Berman Lab, CHEO Research Institute/University of Ottawa", 1, 0.76652, null, 0.04812, null, 0.7638, null, 0.48652, null, 28, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-12-26", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55938, "SRR10767281", "SRX7441199", "SRS5885526", "SRP238807", "PRJNA597725", "A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia", "GSE142599", "Transcriptome Analysis", "JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage  from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B  SOCS3A  SOCS3B  PIAS2 as well as patways involved in hematopoiesis  immunity  response to interferon and response to biotic stimuli. Overall design: Total RNA from casper  JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation", null, null, null, "28 hpf JAK1 A634D transgenic rep 1", "GSM4232665", null, "tissue:whole embryo|genotype:Tgubi:cDNA JAK1 A634D p2A sfGFP|developmental stage:28 hpf embryo", "28 hpf JAK1 A634D transgenic rep 1", "Read trimming: the raw reads had the adapters \u201cATCACCGAC\u201d removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts", "whole embryo", null, "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 \u00b0C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock.", "genotype:Tgubi:cDNA JAK1 A634D p2A sfGFP|developmental stage:28 hpf embryo", "GSM4232665", "GSM4232665: 28 hpf JAK1 A634D transgenic rep 1; Danio rerio; RNA Seq", "GSM4232665", null, "1", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "GEO Accession:GSM4232665", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP238807", null, null, "28h_JAK1_A634D_1.fastq.gz", "fastq", 2435214022.0, 32006444.0, "GSM4232665 r1", "0:76.09", "A:671766129;C:571275330;G:623388119;T:568784444;N:0", 76, null, null, null, 671766129, 571275330, 623388119, 568784444, 0, "SRX7441199", "SRS5885526", "SRA1016603", "GEO", "Berman Lab, CHEO Research Institute/University of Ottawa", 1, 0.70175, null, 0.0702, null, 0.74925, null, 0.48275, null, 136, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-12-26", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55939, "SRR10767280", "SRX7441198", "SRS5885525", "SRP238807", "PRJNA597725", "A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia", "GSE142599", "Transcriptome Analysis", "JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage  from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B  SOCS3A  SOCS3B  PIAS2 as well as patways involved in hematopoiesis  immunity  response to interferon and response to biotic stimuli. Overall design: Total RNA from casper  JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation", null, null, null, "28 hpf wild type rep3", "GSM4232664", null, "tissue:whole embryo|genotype:wild type|developmental stage:28 hpf embryo", "28 hpf wild type rep3", "Read trimming: the raw reads had the adapters \u201cATCACCGAC\u201d removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts", "whole embryo", null, "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 \u00b0C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock.", "genotype:wild type|developmental stage:28 hpf embryo", "GSM4232664", "GSM4232664: 28 hpf wild type rep3; Danio rerio; RNA Seq", "GSM4232664", null, "1", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "GEO Accession:GSM4232664", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP238807", null, null, "28h_Casper_3.fastq.gz", "fastq", 1904992285.0, 29766503.0, "GSM4232664 r1", "0:64.00", "A:533559701;C:445590246;G:489978228;T:435864110;N:0", 64, null, null, null, 533559701, 445590246, 489978228, 435864110, 0, "SRX7441198", "SRS5885525", "SRA1016603", "GEO", "Berman Lab, CHEO Research Institute/University of Ottawa", 1, 0.75479, null, 0.06238, null, 0.74458, null, 0.47429, null, 9, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-12-26", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55940, "SRR10767279", "SRX7441197", "SRS5885524", "SRP238807", "PRJNA597725", "A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia", "GSE142599", "Transcriptome Analysis", "JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage  from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B  SOCS3A  SOCS3B  PIAS2 as well as patways involved in hematopoiesis  immunity  response to interferon and response to biotic stimuli. Overall design: Total RNA from casper  JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation", null, null, null, "28 hpf wild type rep2", "GSM4232663", null, "tissue:whole embryo|genotype:wild type|developmental stage:28 hpf embryo", "28 hpf wild type rep2", "Read trimming: the raw reads had the adapters \u201cATCACCGAC\u201d removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts", "whole embryo", null, "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 \u00b0C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock.", "genotype:wild type|developmental stage:28 hpf embryo", "GSM4232663", "GSM4232663: 28 hpf wild type rep2; Danio rerio; RNA Seq", "GSM4232663", null, "1", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "GEO Accession:GSM4232663", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP238807", null, null, "28h_Casper_2.fastq.gz", "fastq", 1993805090.0, 28272142.0, "GSM4232663 r1", "0:70.52", "A:556500481;C:463867930;G:517077272;T:456359407;N:0", 70, null, null, null, 556500481, 463867930, 517077272, 456359407, 0, "SRX7441197", "SRS5885524", "SRA1016603", "GEO", "Berman Lab, CHEO Research Institute/University of Ottawa", 1, 0.70292, null, 0.06841, null, 0.74588, null, 0.45622, null, 58, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-12-26", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55941, "SRR10767278", "SRX7441196", "SRS5885523", "SRP238807", "PRJNA597725", "A Zebrafish JAK1 A634D Gain of Function Model Provides New Insights into the Pathogenesis of Familial Hypereosinophilia", "GSE142599", "Transcriptome Analysis", "JAK1 plays an important role during zebrafish development as hematopoietic regulator with a specific impact in the myeloid lineage  from where the eosinophils arise. Several genes in the JAK STAT pathway are elevated in the transgenic mutants STAT1B  SOCS3A  SOCS3B  PIAS2 as well as patways involved in hematopoiesis  immunity  response to interferon and response to biotic stimuli. Overall design: Total RNA from casper  JAK1 WT and JAK1 A634D zebrafish embryos at 28 hpf and 36 hpf was extracted to characterize the transcriptomic effects of the JAK1 A634D gain of function mutation", null, null, null, "28 hpf wild type rep1", "GSM4232662", null, "tissue:whole embryo|genotype:wild type|developmental stage:28 hpf embryo", "28 hpf wild type rep1", "Read trimming: the raw reads had the adapters \u201cATCACCGAC\u201d removed and filtered by the quality of 20 with the Trim Galore v0.4.4. Read mapping: The reads passed through the two step mapping for RNA Seq data from Ion proton: first with STAR v2.7 and then mapping the unmapped reads from the first alignment using bowtie2. The two mapped files were merged with Picard tools v2.5.0. Read counting: The counts were extracted using HTSeq V0.9.1. Genome build: danRer11 Supplementary files format and content: read counts", "whole embryo", null, "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "Zebrafish experiments and husbandry follows standard protocols in accordance with the standards of the University Committee on Laboratory Animals UCLA of Dalhousie University. Zebrafish embryos were maintained at 28.5 \u00b0C during development and as adults. Embryos were grown in egg water 1x E3 prepared from 60x E3 stock.", "genotype:wild type|developmental stage:28 hpf embryo", "GSM4232662", "GSM4232662: 28 hpf wild type rep1; Danio rerio; RNA Seq", "GSM4232662", null, "1", "Each total RNA sample was extracted from 30 50 zebrafish embryos by homogenizing them in 500 \u00b5L Trizol reagent Thermo Fisher Scientific  15596026 using 1 mL syringe and 22G needle. Lysates were centrifuged at 12 000 g at 4\u00baC for 5 minutes and the supernatant was transferred to Phasemaker Tubes Thermo Fisher Scientific  A33248 and RNA was purified according to the Phasemaker Tubes protocol manual. Total RNA samples were measured and analyzed for integrity on Agilent Tape Station. Samples with RNA integration number \u22658 were selected for library preparation. Poly A enrichment was performed from 20 \u00b5g of total RNA to enrich for mRNA Dyna beads mRNA direct micro Kit. 100ng of poly A enriched RNA was fragmented using RNase III and purified using magnetic bead clean up module RNA Seq V2 kit  Life Technologies. The size distribution of the fragmented RNA was assessed on Agilent Tape Station using RNA HS screen tape assay and 50 ng of fragmented polyA enriched RNA was used to prepare whole transcriptome library RNA seq V2. Yield and size distribution of the library was analyzed on Agilent Tape Station using D1000 screen tape. Barcoded library was equally pooled and amplified onto Ion Sphere\u2122 Particles ISPs from Ion Pi HiQ OT2 kit Life Technologies. ISPs enriched with template library were loaded onto Ion PI chip V3 and sequenced on Ion Proton from Thermo Fisher.", "GEO Accession:GSM4232662", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP238807", null, null, "28h_Casper_1.fastq.gz", "fastq", 2987237440.0, 38462041.0, "GSM4232662 r1", "0:77.67", "A:823935737;C:709854466;G:784861423;T:668585814;N:0", 77, null, null, null, 823935737, 709854466, 784861423, 668585814, 0, "SRX7441196", "SRS5885523", "SRA1016603", "GEO", "Berman Lab, CHEO Research Institute/University of Ottawa", 1, 0.79137, null, 0.06249, null, 0.76615, null, 0.47782, null, 70, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-12-26", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [62959, "SRR13520382", "SRX9931400", "SRS8106885", "SRP303129", "PRJNA694577", "Next Generation Sequencing Facilitates Quantitative Analysis of different developmental stage pEGFP N1 injected zebrafish embryos and untreated group transcriptomes", "GSE165422", "Transcriptome Analysis", "Purpose: Next generation sequencing NGS has revolutionized systems based analysis of cellular pathways. The goals of this study are to compare the early stage of pEGFP N1 injected zebrafish embros transcriptome profiling RNA seq to microarray and quantitative reverse transcription polymerase chain reaction qRT\u2013PCR methods and to evaluate protocols for optimal high throughput data analysis Methods: we injected the plasmid pEGFP N1 into zebrafish zygotes by microinjection  and then when the embryos to develop ttwo xxx hpf  6 hpf and 12 hpf  these groups was collected respectively by deep sequencing  in triplicate  using Illumina GAIIx. The sequence reads that passed quality filters were analyzed at the transcript isoform level with two methods: Burrows\u2013Wheeler Aligner BWA followed by ANOVA ANOVA and TopHat followed by Cufflinks. qRT\u2013PCR validation was performed using TaqMan and SYBR Green assays Results: Bioinformatics analysis of the transcriptome sequencing found that the expression levels of genes related to the apoptosis process Fig.1A  endogenous immune response and tumor necrosis factor mediated signaling pathways were abnormal up regulation  mainly including isg15  foxo3b  phlda3  cdkn1a  zgc:136826  and si:dkey 204l11.1  compared with the non injected group at xxxhpf. These genes are found in somatic cells to deal with foreign plasmids invasion. Overall design: Zebrafish embryos in 1hpf  6hpf and 12hpf mRNA profiles of pEGFP N1 injected and untreated group", null, "pubmed:35690839", null, "G8 12: pEGFP N1 injected at 12hpf", "GSM5033117", null, "source name:zebrafish embryos|strain:TU|developmental stage:12hpf|tissue:embryo", "G8 12: pEGFP N1 injected at 12hpf", "Reads filtering under criteria removing reads with 20% of the base quality lower than 13 Clean Reads mapped to GRCz10  genome using Mapsplice v2.1.8 with  parameters  s 22  p 15   ins 6   del 6   non canonical   bam  o count counting Genome build: GRCz10 Supplementary files format and content: TXT file contain counts for each sample", "zebrafish embryos", "In the 1 cell stage of zebrafish embryos  8ng/\u03bcL pEGFP N1 was injected  and the embryos of the injected group and the non injected group were collected when the embryos developed ttwo xxxhpf  6hpf and 12hpf. Add 1mL TRIzol Invitrogen  USA  store at  80\u2103", "RNA was harvested using Trizol reagent Invitrogen. RNA library using standard Ion proton RNA Seq Kit v2.0 protocol", null, "strain:TU|developmental stage:12hpf|tissue:embryo", "GSM5033117", "GSM5033117: G8 12: pEGFP N1 injected at 12hpf; Danio rerio; RNA Seq", "GSM5033117", null, "1", "RNA was harvested using Trizol reagent Invitrogen. RNA library using standard Ion proton RNA Seq Kit v2.0 protocol", "GEO Accession:GSM5033117", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP303129", null, null, "G8-12.fastq.gz", "fastq", 2163053937.0, 12776614.0, "GSM5033117 r1", "0:169.30", "A:581602408;C:540446105;G:566494100;T:474511324;N:0", 169, null, null, null, 581602408, 540446105, 566494100, 474511324, 0, "SRX9931400", "SRS8106885", "SRA1187495", "GEO", "Qingshun Zhao", 1, 0.73901, null, 0.01942, null, 0.7726, null, 0.47694, null, 169, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Unknown", "2021-01-25", "Segmentation", "Embryo", "Embryo Imprecise", "All anatomical structures"], [62960, "SRR13520381", "SRX9931399", "SRS8106884", "SRP303129", "PRJNA694577", "Next Generation Sequencing Facilitates Quantitative Analysis of different developmental stage pEGFP N1 injected zebrafish embryos and untreated group transcriptomes", "GSE165422", "Transcriptome Analysis", "Purpose: Next generation sequencing NGS has revolutionized systems based analysis of cellular pathways. The goals of this study are to compare the early stage of pEGFP N1 injected zebrafish embros transcriptome profiling RNA seq to microarray and quantitative reverse transcription polymerase chain reaction qRT\u2013PCR methods and to evaluate protocols for optimal high throughput data analysis Methods: we injected the plasmid pEGFP N1 into zebrafish zygotes by microinjection  and then when the embryos to develop ttwo xxx hpf  6 hpf and 12 hpf  these groups was collected respectively by deep sequencing  in triplicate  using Illumina GAIIx. The sequence reads that passed quality filters were analyzed at the transcript isoform level with two methods: Burrows\u2013Wheeler Aligner BWA followed by ANOVA ANOVA and TopHat followed by Cufflinks. qRT\u2013PCR validation was performed using TaqMan and SYBR Green assays Results: Bioinformatics analysis of the transcriptome sequencing found that the expression levels of genes related to the apoptosis process Fig.1A  endogenous immune response and tumor necrosis factor mediated signaling pathways were abnormal up regulation  mainly including isg15  foxo3b  phlda3  cdkn1a  zgc:136826  and si:dkey 204l11.1  compared with the non injected group at xxxhpf. These genes are found in somatic cells to deal with foreign plasmids invasion. Overall design: Zebrafish embryos in 1hpf  6hpf and 12hpf mRNA profiles of pEGFP N1 injected and untreated group", null, "pubmed:35690839", null, "G8 6: pEGFP N1 injected at 6pf", "GSM5033116", null, "source name:zebrafish embryos|strain:TU|developmental stage:6pf|tissue:embryo", "G8 6: pEGFP N1 injected at 6pf", "Reads filtering under criteria removing reads with 20% of the base quality lower than 13 Clean Reads mapped to GRCz10  genome using Mapsplice v2.1.8 with  parameters  s 22  p 15   ins 6   del 6   non canonical   bam  o count counting Genome build: GRCz10 Supplementary files format and content: TXT file contain counts for each sample", "zebrafish embryos", "In the 1 cell stage of zebrafish embryos  8ng/\u03bcL pEGFP N1 was injected  and the embryos of the injected group and the non injected group were collected when the embryos developed ttwo xxxhpf  6hpf and 12hpf. Add 1mL TRIzol Invitrogen  USA  store at  80\u2103", "RNA was harvested using Trizol reagent Invitrogen. RNA library using standard Ion proton RNA Seq Kit v2.0 protocol", null, "strain:TU|developmental stage:6pf|tissue:embryo", "GSM5033116", "GSM5033116: G8 6: pEGFP N1 injected at 6pf; Danio rerio; RNA Seq", "GSM5033116", null, "1", "RNA was harvested using Trizol reagent Invitrogen. RNA library using standard Ion proton RNA Seq Kit v2.0 protocol", "GEO Accession:GSM5033116", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP303129", null, null, "G8-6.fastq.gz", "fastq", 2116443238.0, 12869630.0, "GSM5033116 r1", "0:164.45", "A:580007846;C:516340658;G:549230787;T:470863947;N:0", 164, null, null, null, 580007846, 516340658, 549230787, 470863947, 0, "SRX9931399", "SRS8106884", "SRA1187495", "GEO", "Qingshun Zhao", 1, 0.73674, null, 0.02266, null, 0.79722, null, 0.49168, null, 119, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Unknown", "2021-01-25", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [62961, "SRR13520380", "SRX9931398", "SRS8106883", "SRP303129", "PRJNA694577", "Next Generation Sequencing Facilitates Quantitative Analysis of different developmental stage pEGFP N1 injected zebrafish embryos and untreated group transcriptomes", "GSE165422", "Transcriptome Analysis", "Purpose: Next generation sequencing NGS has revolutionized systems based analysis of cellular pathways. The goals of this study are to compare the early stage of pEGFP N1 injected zebrafish embros transcriptome profiling RNA seq to microarray and quantitative reverse transcription polymerase chain reaction qRT\u2013PCR methods and to evaluate protocols for optimal high throughput data analysis Methods: we injected the plasmid pEGFP N1 into zebrafish zygotes by microinjection  and then when the embryos to develop ttwo xxx hpf  6 hpf and 12 hpf  these groups was collected respectively by deep sequencing  in triplicate  using Illumina GAIIx. The sequence reads that passed quality filters were analyzed at the transcript isoform level with two methods: Burrows\u2013Wheeler Aligner BWA followed by ANOVA ANOVA and TopHat followed by Cufflinks. qRT\u2013PCR validation was performed using TaqMan and SYBR Green assays Results: Bioinformatics analysis of the transcriptome sequencing found that the expression levels of genes related to the apoptosis process Fig.1A  endogenous immune response and tumor necrosis factor mediated signaling pathways were abnormal up regulation  mainly including isg15  foxo3b  phlda3  cdkn1a  zgc:136826  and si:dkey 204l11.1  compared with the non injected group at xxxhpf. These genes are found in somatic cells to deal with foreign plasmids invasion. Overall design: Zebrafish embryos in 1hpf  6hpf and 12hpf mRNA profiles of pEGFP N1 injected and untreated group", null, "pubmed:35690839", null, "G8 1: pEGFP N1 injected at 1hpf", "GSM5033115", null, "source name:zebrafish embryos|strain:TU|developmental stage:1hpf|tissue:embryo", "G8 1: pEGFP N1 injected at 1hpf", "Reads filtering under criteria removing reads with 20% of the base quality lower than 13 Clean Reads mapped to GRCz10  genome using Mapsplice v2.1.8 with  parameters  s 22  p 15   ins 6   del 6   non canonical   bam  o count counting Genome build: GRCz10 Supplementary files format and content: TXT file contain counts for each sample", "zebrafish embryos", "In the 1 cell stage of zebrafish embryos  8ng/\u03bcL pEGFP N1 was injected  and the embryos of the injected group and the non injected group were collected when the embryos developed ttwo xxxhpf  6hpf and 12hpf. Add 1mL TRIzol Invitrogen  USA  store at  80\u2103", "RNA was harvested using Trizol reagent Invitrogen. RNA library using standard Ion proton RNA Seq Kit v2.0 protocol", null, "strain:TU|developmental stage:1hpf|tissue:embryo", "GSM5033115", "GSM5033115: G8 1: pEGFP N1 injected at 1hpf; Danio rerio; RNA Seq", "GSM5033115", null, "1", "RNA was harvested using Trizol reagent Invitrogen. RNA library using standard Ion proton RNA Seq Kit v2.0 protocol", "GEO Accession:GSM5033115", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP303129", null, null, "G8-1.fastq.gz", "fastq", 2029634086.0, 12394054.0, "GSM5033115 r1", "0:163.76", "A:548662597;C:501840467;G:525047427;T:454083595;N:0", 163, null, null, null, 548662597, 501840467, 525047427, 454083595, 0, "SRX9931398", "SRS8106883", "SRA1187495", "GEO", "Qingshun Zhao", 1, 0.81344, null, 0.01015, null, 0.78058, null, 0.48067, null, 90, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Unknown", "2021-01-25", "Cleavage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [62962, "SRR13520379", "SRX9931397", "SRS8106882", "SRP303129", "PRJNA694577", "Next Generation Sequencing Facilitates Quantitative Analysis of different developmental stage pEGFP N1 injected zebrafish embryos and untreated group transcriptomes", "GSE165422", "Transcriptome Analysis", "Purpose: Next generation sequencing NGS has revolutionized systems based analysis of cellular pathways. The goals of this study are to compare the early stage of pEGFP N1 injected zebrafish embros transcriptome profiling RNA seq to microarray and quantitative reverse transcription polymerase chain reaction qRT\u2013PCR methods and to evaluate protocols for optimal high throughput data analysis Methods: we injected the plasmid pEGFP N1 into zebrafish zygotes by microinjection  and then when the embryos to develop ttwo xxx hpf  6 hpf and 12 hpf  these groups was collected respectively by deep sequencing  in triplicate  using Illumina GAIIx. The sequence reads that passed quality filters were analyzed at the transcript isoform level with two methods: Burrows\u2013Wheeler Aligner BWA followed by ANOVA ANOVA and TopHat followed by Cufflinks. qRT\u2013PCR validation was performed using TaqMan and SYBR Green assays Results: Bioinformatics analysis of the transcriptome sequencing found that the expression levels of genes related to the apoptosis process Fig.1A  endogenous immune response and tumor necrosis factor mediated signaling pathways were abnormal up regulation  mainly including isg15  foxo3b  phlda3  cdkn1a  zgc:136826  and si:dkey 204l11.1  compared with the non injected group at xxxhpf. These genes are found in somatic cells to deal with foreign plasmids invasion. Overall design: Zebrafish embryos in 1hpf  6hpf and 12hpf mRNA profiles of pEGFP N1 injected and untreated group", null, "pubmed:35690839", null, "C12: un injected at 12hpf", "GSM5033114", null, "source name:zebrafish embryos|strain:TU|developmental stage:12hpf|tissue:embryo", "C12: un injected at 12hpf", "Reads filtering under criteria removing reads with 20% of the base quality lower than 13 Clean Reads mapped to GRCz10  genome using Mapsplice v2.1.8 with  parameters  s 22  p 15   ins 6   del 6   non canonical   bam  o count counting Genome build: GRCz10 Supplementary files format and content: TXT file contain counts for each sample", "zebrafish embryos", "In the 1 cell stage of zebrafish embryos  8ng/\u03bcL pEGFP N1 was injected  and the embryos of the injected group and the non injected group were collected when the embryos developed ttwo xxxhpf  6hpf and 12hpf. Add 1mL TRIzol Invitrogen  USA  store at  80\u2103", "RNA was harvested using Trizol reagent Invitrogen. RNA library using standard Ion proton RNA Seq Kit v2.0 protocol", null, "strain:TU|developmental stage:12hpf|tissue:embryo", "GSM5033114", "GSM5033114: C12: un injected at 12hpf; Danio rerio; RNA Seq", "GSM5033114", null, "1", "RNA was harvested using Trizol reagent Invitrogen. RNA library using standard Ion proton RNA Seq Kit v2.0 protocol", "GEO Accession:GSM5033114", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP303129", null, null, "C12.fastq.gz", "fastq", 2287177824.0, 14569411.0, "GSM5033114 r1", "0:156.98", "A:618744606;C:567027488;G:600125143;T:501280587;N:0", 156, null, null, null, 618744606, 567027488, 600125143, 501280587, 0, "SRX9931397", "SRS8106882", "SRA1187495", "GEO", "Qingshun Zhao", 1, 0.74656, null, 0.02098, null, 0.76928, null, 0.47392, null, 184, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Unknown", "2021-01-25", "Segmentation", "Embryo", "Embryo Imprecise", "All anatomical structures"], [62963, "SRR13520378", "SRX9931396", "SRS8106881", "SRP303129", "PRJNA694577", "Next Generation Sequencing Facilitates Quantitative Analysis of different developmental stage pEGFP N1 injected zebrafish embryos and untreated group transcriptomes", "GSE165422", "Transcriptome Analysis", "Purpose: Next generation sequencing NGS has revolutionized systems based analysis of cellular pathways. The goals of this study are to compare the early stage of pEGFP N1 injected zebrafish embros transcriptome profiling RNA seq to microarray and quantitative reverse transcription polymerase chain reaction qRT\u2013PCR methods and to evaluate protocols for optimal high throughput data analysis Methods: we injected the plasmid pEGFP N1 into zebrafish zygotes by microinjection  and then when the embryos to develop ttwo xxx hpf  6 hpf and 12 hpf  these groups was collected respectively by deep sequencing  in triplicate  using Illumina GAIIx. The sequence reads that passed quality filters were analyzed at the transcript isoform level with two methods: Burrows\u2013Wheeler Aligner BWA followed by ANOVA ANOVA and TopHat followed by Cufflinks. qRT\u2013PCR validation was performed using TaqMan and SYBR Green assays Results: Bioinformatics analysis of the transcriptome sequencing found that the expression levels of genes related to the apoptosis process Fig.1A  endogenous immune response and tumor necrosis factor mediated signaling pathways were abnormal up regulation  mainly including isg15  foxo3b  phlda3  cdkn1a  zgc:136826  and si:dkey 204l11.1  compared with the non injected group at xxxhpf. These genes are found in somatic cells to deal with foreign plasmids invasion. Overall design: Zebrafish embryos in 1hpf  6hpf and 12hpf mRNA profiles of pEGFP N1 injected and untreated group", null, "pubmed:35690839", null, "C6: un injected at 6pf", "GSM5033113", null, "source name:zebrafish embryos|strain:TU|developmental stage:6pf|tissue:embryo", "C6: un injected at 6pf", "Reads filtering under criteria removing reads with 20% of the base quality lower than 13 Clean Reads mapped to GRCz10  genome using Mapsplice v2.1.8 with  parameters  s 22  p 15   ins 6   del 6   non canonical   bam  o count counting Genome build: GRCz10 Supplementary files format and content: TXT file contain counts for each sample", "zebrafish embryos", "In the 1 cell stage of zebrafish embryos  8ng/\u03bcL pEGFP N1 was injected  and the embryos of the injected group and the non injected group were collected when the embryos developed ttwo xxxhpf  6hpf and 12hpf. Add 1mL TRIzol Invitrogen  USA  store at  80\u2103", "RNA was harvested using Trizol reagent Invitrogen. RNA library using standard Ion proton RNA Seq Kit v2.0 protocol", null, "strain:TU|developmental stage:6pf|tissue:embryo", "GSM5033113", "GSM5033113: C6: un injected at 6pf; Danio rerio; RNA Seq", "GSM5033113", null, "1", "RNA was harvested using Trizol reagent Invitrogen. RNA library using standard Ion proton RNA Seq Kit v2.0 protocol", "GEO Accession:GSM5033113", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP303129", null, null, "C6.fastq.gz", "fastq", 1998132252.0, 12473595.0, "GSM5033113 r1", "0:160.19", "A:548408269;C:485097126;G:517913632;T:446713225;N:0", 160, null, null, null, 548408269, 485097126, 517913632, 446713225, 0, "SRX9931396", "SRS8106881", "SRA1187495", "GEO", "Qingshun Zhao", 1, 0.73967, null, 0.02632, null, 0.79482, null, 0.48895, null, 160, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Unknown", "2021-01-25", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [62964, "SRR13520377", "SRX9931395", "SRS8106880", "SRP303129", "PRJNA694577", "Next Generation Sequencing Facilitates Quantitative Analysis of different developmental stage pEGFP N1 injected zebrafish embryos and untreated group transcriptomes", "GSE165422", "Transcriptome Analysis", "Purpose: Next generation sequencing NGS has revolutionized systems based analysis of cellular pathways. The goals of this study are to compare the early stage of pEGFP N1 injected zebrafish embros transcriptome profiling RNA seq to microarray and quantitative reverse transcription polymerase chain reaction qRT\u2013PCR methods and to evaluate protocols for optimal high throughput data analysis Methods: we injected the plasmid pEGFP N1 into zebrafish zygotes by microinjection  and then when the embryos to develop ttwo xxx hpf  6 hpf and 12 hpf  these groups was collected respectively by deep sequencing  in triplicate  using Illumina GAIIx. The sequence reads that passed quality filters were analyzed at the transcript isoform level with two methods: Burrows\u2013Wheeler Aligner BWA followed by ANOVA ANOVA and TopHat followed by Cufflinks. qRT\u2013PCR validation was performed using TaqMan and SYBR Green assays Results: Bioinformatics analysis of the transcriptome sequencing found that the expression levels of genes related to the apoptosis process Fig.1A  endogenous immune response and tumor necrosis factor mediated signaling pathways were abnormal up regulation  mainly including isg15  foxo3b  phlda3  cdkn1a  zgc:136826  and si:dkey 204l11.1  compared with the non injected group at xxxhpf. These genes are found in somatic cells to deal with foreign plasmids invasion. Overall design: Zebrafish embryos in 1hpf  6hpf and 12hpf mRNA profiles of pEGFP N1 injected and untreated group", null, "pubmed:35690839", null, "C1: un injected at 1hpf", "GSM5033112", null, "source name:zebrafish embryos|strain:TU|developmental stage:1hpf|tissue:embryo", "C1: un injected at 1hpf", "Reads filtering under criteria removing reads with 20% of the base quality lower than 13 Clean Reads mapped to GRCz10  genome using Mapsplice v2.1.8 with  parameters  s 22  p 15   ins 6   del 6   non canonical   bam  o count counting Genome build: GRCz10 Supplementary files format and content: TXT file contain counts for each sample", "zebrafish embryos", "In the 1 cell stage of zebrafish embryos  8ng/\u03bcL pEGFP N1 was injected  and the embryos of the injected group and the non injected group were collected when the embryos developed ttwo xxxhpf  6hpf and 12hpf. Add 1mL TRIzol Invitrogen  USA  store at  80\u2103", "RNA was harvested using Trizol reagent Invitrogen. RNA library using standard Ion proton RNA Seq Kit v2.0 protocol", null, "strain:TU|developmental stage:1hpf|tissue:embryo", "GSM5033112", "GSM5033112: C1: un injected at 1hpf; Danio rerio; RNA Seq", "GSM5033112", null, "1", "RNA was harvested using Trizol reagent Invitrogen. RNA library using standard Ion proton RNA Seq Kit v2.0 protocol", "GEO Accession:GSM5033112", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP303129", null, null, "C1.fastq.gz", "fastq", 2073298475.0, 13102880.0, "GSM5033112 r1", "0:158.23", "A:558146987;C:513562209;G:538130597;T:463458682;N:0", 158, null, null, null, 558146987, 513562209, 538130597, 463458682, 0, "SRX9931395", "SRS8106880", "SRA1187495", "GEO", "Qingshun Zhao", 1, 0.83706, null, 0.01172, null, 0.77948, null, 0.48172, null, 233, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Unknown", "2021-01-25", "Cleavage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [75396, "SRR24497420", "SRX20282374", "SRS17609397", "SRP436940", "PRJNA971233", "MCPIP1 functions as a safeguard of early embryonic development", "GSE232220", "Transcriptome Analysis", "Expression of zc3h12a encoding Mcpip1 is tightly controlled within first cell divisions of zebrafish. Overexpression of Mcpip1 leads to the profound transcriptomic changes in the developing embryos and impairs early embryonic development of zebrafish. Overall design: RNA seq was performed to analyse transcriptome of zebrafish embryos overexpressing Mcpip1 wild type and catalytically inactive mutant.", null, "pubmed:37805647", null, "Mcpip1 DN replicate3", "GSM7321058", null, "source name:embryo 6 hpf|tissue:embryo 6 hpf|genotype:AB/TL|treatment:microinjection with mRNA encoding zebrafish Mcpip1 D112N|geo loc name:missing|collection date:missing", "Mcpip1 DN replicate3", "Signal processing and basecalling was performed with Torrent Suite version 5.14.0. Raw reads were mapped to Danio rerio Ensembl genome version GRCz11 using STAR version 2.7.10a  PMID: 23104886 and bowtie2 version 2.4.4 PMID: 22388286 for unmapped reads. Gene counts were created with htseq count PMID: 25260700  using Ensembl gene model. Differential expression was tested with DESeq2 version version 1.40.1 PMID: 2551628 Assembly: Danio rerio Ensembl genome version GRCz11 Supplementary files format and content: DESeq2 normalized count", "embryo 6 hpf", "Zebrafish eggs at 1 cell stage were microinjected with mRNA using WPI Picopump PV820 microinjector.", "Zebrafish embryos were collected in Fenozol A&A Biotechnology  Gdansk  Polska and stored at  80\u00b0C  prior to analysis. For RNA isolation  the samples were homogenized in Fenozol using a tissue homogenizer OMNI International  Kennesaw  GA  USA. The poly A mRNA fraction from total RNA was isolated with Dynabeads\u00ae mRNA DIRECT\u2122 Micro Kit Thermo. The sequencing library for each RNA sample was prepared according to the protocol provided by the manufacturer using the Ion Total RNA Seq Kit v2 Thermo. The libraries were generated from 1 15 ng of mRNA by fragmenting the mRNA with RNaseIII  purifying the fragmented RNA  and hybridizing and ligating it with Ion adaptors. Subsequently  the RNA products were reverse transcribed and amplified to double stranded cDNA  and then purified using a magnetic bead based method. The molar concentration and size of each cDNA library was determined using the DNA HS Kit on Bioanalyzer 2100 Agilent. Each library was diluted to 53 pM concentration before template preparation. Up to three barcoded libraries were mixed in equal volume and used for automatic template preparation on the Ion Chef instrument Thermo using reagents from the Ion PI Hi Q 200 Kit Thermo and Ion PI v3 Proton Chip.", "AB/TL zebrafish were maintained in a continuous recirculating closed system aquarium with a light/dark cycle of 14/10 hours at 280C. Larvae were incubated in E3 medium at 28\u00b0C according to standard protocols.", "tissue:embryo 6 hpf|genotype:AB/TL|treatment:microinjection with mRNA encoding zebrafish Mcpip1 D112N", "GSM7321058", "GSM7321058: Mcpip1 DN replicate3; Danio rerio; RNA Seq", "GSM7321058 r1", "GSM7321058", "1", "Zebrafish embryos were collected in Fenozol A&A Biotechnology  Gdansk  Polska and stored at  80\u00b0C  prior to analysis. For RNA isolation  the samples were homogenized in Fenozol using a tissue homogenizer OMNI International  Kennesaw  GA  USA. The poly A mRNA fraction from total RNA was isolated with Dynabeads\u00ae mRNA DIRECT\u2122 Micro Kit Thermo. The sequencing library for each RNA sample was prepared according to the protocol provided by the manufacturer using the Ion Total RNA Seq Kit v2 Thermo. The libraries were generated from 1 15 ng of mRNA by fragmenting the mRNA with RNaseIII  purifying the fragmented RNA  and hybridizing and ligating it with Ion adaptors. Subsequently  the RNA products were reverse transcribed and amplified to double stranded cDNA  and then purified using a magnetic bead based method. The molar concentration and size of each cDNA library was determined using the DNA HS Kit on Bioanalyzer 2100 Agilent. Each library was diluted to 53 pM concentration before template preparation. Up to three barcoded libraries were mixed in equal volume and used for automatic template preparation on the Ion Chef instrument Thermo using reagents from the Ion PI Hi Q 200 Kit Thermo and Ion PI v3 Proton Chip.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP436940", null, null, "DN_C24.fastq.gz", "fastq", 4215951250.0, 27509986.0, "GSM7321058 r1", "0:153.25", "A:1174686445;C:999279135;G:1076390086;T:965595584;N:0", 153, null, null, null, 1174686445, 999279135, 1076390086, 965595584, 0, "SRX20282374", "SRS17609397", "SRA1636184", "Genetics, Maria Sklodowska-Curie National Research Institute of Oncology", "Genetics, Maria Sk\u0142odowska-Curie National Research Institute of Oncology", 1, 0.7271, null, 0.04079, null, 0.77583, null, 0.48331, null, 128, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "Poland", "2023-05-10", "Multi-stage", "Multi-stage", "Embryo Imprecise", "All anatomical structures"], [75397, "SRR24497423", "SRX20282373", "SRS17609396", "SRP436940", "PRJNA971233", "MCPIP1 functions as a safeguard of early embryonic development", "GSE232220", "Transcriptome Analysis", "Expression of zc3h12a encoding Mcpip1 is tightly controlled within first cell divisions of zebrafish. Overexpression of Mcpip1 leads to the profound transcriptomic changes in the developing embryos and impairs early embryonic development of zebrafish. Overall design: RNA seq was performed to analyse transcriptome of zebrafish embryos overexpressing Mcpip1 wild type and catalytically inactive mutant.", null, "pubmed:37805647", null, "Mcpip1 DN replicate2", "GSM7321057", null, "source name:embryo 6 hpf|tissue:embryo 6 hpf|genotype:AB/TL|treatment:microinjection with mRNA encoding zebrafish Mcpip1 D112N|geo loc name:missing|collection date:missing", "Mcpip1 DN replicate2", "Signal processing and basecalling was performed with Torrent Suite version 5.14.0. Raw reads were mapped to Danio rerio Ensembl genome version GRCz11 using STAR version 2.7.10a  PMID: 23104886 and bowtie2 version 2.4.4 PMID: 22388286 for unmapped reads. Gene counts were created with htseq count PMID: 25260700  using Ensembl gene model. Differential expression was tested with DESeq2 version version 1.40.1 PMID: 2551628 Assembly: Danio rerio Ensembl genome version GRCz11 Supplementary files format and content: DESeq2 normalized count", "embryo 6 hpf", "Zebrafish eggs at 1 cell stage were microinjected with mRNA using WPI Picopump PV820 microinjector.", "Zebrafish embryos were collected in Fenozol A&A Biotechnology  Gdansk  Polska and stored at  80\u00b0C  prior to analysis. For RNA isolation  the samples were homogenized in Fenozol using a tissue homogenizer OMNI International  Kennesaw  GA  USA. The poly A mRNA fraction from total RNA was isolated with Dynabeads\u00ae mRNA DIRECT\u2122 Micro Kit Thermo. The sequencing library for each RNA sample was prepared according to the protocol provided by the manufacturer using the Ion Total RNA Seq Kit v2 Thermo. The libraries were generated from 1 15 ng of mRNA by fragmenting the mRNA with RNaseIII  purifying the fragmented RNA  and hybridizing and ligating it with Ion adaptors. Subsequently  the RNA products were reverse transcribed and amplified to double stranded cDNA  and then purified using a magnetic bead based method. The molar concentration and size of each cDNA library was determined using the DNA HS Kit on Bioanalyzer 2100 Agilent. Each library was diluted to 53 pM concentration before template preparation. Up to three barcoded libraries were mixed in equal volume and used for automatic template preparation on the Ion Chef instrument Thermo using reagents from the Ion PI Hi Q 200 Kit Thermo and Ion PI v3 Proton Chip.", "AB/TL zebrafish were maintained in a continuous recirculating closed system aquarium with a light/dark cycle of 14/10 hours at 280C. Larvae were incubated in E3 medium at 28\u00b0C according to standard protocols.", "tissue:embryo 6 hpf|genotype:AB/TL|treatment:microinjection with mRNA encoding zebrafish Mcpip1 D112N", "GSM7321057", "GSM7321057: Mcpip1 DN replicate2; Danio rerio; RNA Seq", "GSM7321057 r1", "GSM7321057", "1", "Zebrafish embryos were collected in Fenozol A&A Biotechnology  Gdansk  Polska and stored at  80\u00b0C  prior to analysis. For RNA isolation  the samples were homogenized in Fenozol using a tissue homogenizer OMNI International  Kennesaw  GA  USA. The poly A mRNA fraction from total RNA was isolated with Dynabeads\u00ae mRNA DIRECT\u2122 Micro Kit Thermo. The sequencing library for each RNA sample was prepared according to the protocol provided by the manufacturer using the Ion Total RNA Seq Kit v2 Thermo. The libraries were generated from 1 15 ng of mRNA by fragmenting the mRNA with RNaseIII  purifying the fragmented RNA  and hybridizing and ligating it with Ion adaptors. Subsequently  the RNA products were reverse transcribed and amplified to double stranded cDNA  and then purified using a magnetic bead based method. The molar concentration and size of each cDNA library was determined using the DNA HS Kit on Bioanalyzer 2100 Agilent. Each library was diluted to 53 pM concentration before template preparation. Up to three barcoded libraries were mixed in equal volume and used for automatic template preparation on the Ion Chef instrument Thermo using reagents from the Ion PI Hi Q 200 Kit Thermo and Ion PI v3 Proton Chip.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP436940", null, null, "DN_B16.fastq.gz", "fastq", 4150646040.0, 29771678.0, "GSM7321057 r1", "0:139.42", "A:1158168842;C:981804106;G:1077873702;T:932799390;N:0", 139, null, null, null, 1158168842, 981804106, 1077873702, 932799390, 0, "SRX20282373", "SRS17609396", "SRA1636184", "Genetics, Maria Sklodowska-Curie National Research Institute of Oncology", "Genetics, Maria Sk\u0142odowska-Curie National Research Institute of Oncology", 1, 0.83432, null, 0.03292, null, 0.77068, null, 0.48489, null, 149, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "Poland", "2023-05-10", "Multi-stage", "Multi-stage", "Embryo Imprecise", "All anatomical structures"], [75398, "SRR24497421", "SRX20282372", "SRS17609394", "SRP436940", "PRJNA971233", "MCPIP1 functions as a safeguard of early embryonic development", "GSE232220", "Transcriptome Analysis", "Expression of zc3h12a encoding Mcpip1 is tightly controlled within first cell divisions of zebrafish. Overexpression of Mcpip1 leads to the profound transcriptomic changes in the developing embryos and impairs early embryonic development of zebrafish. Overall design: RNA seq was performed to analyse transcriptome of zebrafish embryos overexpressing Mcpip1 wild type and catalytically inactive mutant.", null, "pubmed:37805647", null, "Mcpip1 DN replicate1", "GSM7321056", null, "source name:embryo 6 hpf|tissue:embryo 6 hpf|genotype:AB/TL|treatment:microinjection with mRNA encoding zebrafish Mcpip1 D112N|geo loc name:missing|collection date:missing", "Mcpip1 DN replicate1", "Signal processing and basecalling was performed with Torrent Suite version 5.14.0. Raw reads were mapped to Danio rerio Ensembl genome version GRCz11 using STAR version 2.7.10a  PMID: 23104886 and bowtie2 version 2.4.4 PMID: 22388286 for unmapped reads. Gene counts were created with htseq count PMID: 25260700  using Ensembl gene model. Differential expression was tested with DESeq2 version version 1.40.1 PMID: 2551628 Assembly: Danio rerio Ensembl genome version GRCz11 Supplementary files format and content: DESeq2 normalized count", "embryo 6 hpf", "Zebrafish eggs at 1 cell stage were microinjected with mRNA using WPI Picopump PV820 microinjector.", "Zebrafish embryos were collected in Fenozol A&A Biotechnology  Gdansk  Polska and stored at  80\u00b0C  prior to analysis. For RNA isolation  the samples were homogenized in Fenozol using a tissue homogenizer OMNI International  Kennesaw  GA  USA. The poly A mRNA fraction from total RNA was isolated with Dynabeads\u00ae mRNA DIRECT\u2122 Micro Kit Thermo. The sequencing library for each RNA sample was prepared according to the protocol provided by the manufacturer using the Ion Total RNA Seq Kit v2 Thermo. The libraries were generated from 1 15 ng of mRNA by fragmenting the mRNA with RNaseIII  purifying the fragmented RNA  and hybridizing and ligating it with Ion adaptors. Subsequently  the RNA products were reverse transcribed and amplified to double stranded cDNA  and then purified using a magnetic bead based method. The molar concentration and size of each cDNA library was determined using the DNA HS Kit on Bioanalyzer 2100 Agilent. Each library was diluted to 53 pM concentration before template preparation. Up to three barcoded libraries were mixed in equal volume and used for automatic template preparation on the Ion Chef instrument Thermo using reagents from the Ion PI Hi Q 200 Kit Thermo and Ion PI v3 Proton Chip.", "AB/TL zebrafish were maintained in a continuous recirculating closed system aquarium with a light/dark cycle of 14/10 hours at 280C. Larvae were incubated in E3 medium at 28\u00b0C according to standard protocols.", "tissue:embryo 6 hpf|genotype:AB/TL|treatment:microinjection with mRNA encoding zebrafish Mcpip1 D112N", "GSM7321056", "GSM7321056: Mcpip1 DN replicate1; Danio rerio; RNA Seq", "GSM7321056 r1", "GSM7321056", "1", "Zebrafish embryos were collected in Fenozol A&A Biotechnology  Gdansk  Polska and stored at  80\u00b0C  prior to analysis. For RNA isolation  the samples were homogenized in Fenozol using a tissue homogenizer OMNI International  Kennesaw  GA  USA. The poly A mRNA fraction from total RNA was isolated with Dynabeads\u00ae mRNA DIRECT\u2122 Micro Kit Thermo. The sequencing library for each RNA sample was prepared according to the protocol provided by the manufacturer using the Ion Total RNA Seq Kit v2 Thermo. The libraries were generated from 1 15 ng of mRNA by fragmenting the mRNA with RNaseIII  purifying the fragmented RNA  and hybridizing and ligating it with Ion adaptors. Subsequently  the RNA products were reverse transcribed and amplified to double stranded cDNA  and then purified using a magnetic bead based method. The molar concentration and size of each cDNA library was determined using the DNA HS Kit on Bioanalyzer 2100 Agilent. Each library was diluted to 53 pM concentration before template preparation. Up to three barcoded libraries were mixed in equal volume and used for automatic template preparation on the Ion Chef instrument Thermo using reagents from the Ion PI Hi Q 200 Kit Thermo and Ion PI v3 Proton Chip.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP436940", null, null, "DN_A8.fastq.gz", "fastq", 3405374389.0, 22617333.0, "GSM7321056 r1", "0:150.56", "A:943415180;C:825787941;G:885910600;T:750260668;N:0", 150, null, null, null, 943415180, 825787941, 885910600, 750260668, 0, "SRX20282372", "SRS17609394", "SRA1636184", "Genetics, Maria Sklodowska-Curie National Research Institute of Oncology", "Genetics, Maria Sk\u0142odowska-Curie National Research Institute of Oncology", 1, 0.85916, null, 0.04442, null, 0.78344, null, 0.48648, null, 177, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "Poland", "2023-05-10", "Multi-stage", "Multi-stage", "Embryo Imprecise", "All anatomical structures"], [75399, "SRR24497422", "SRX20282371", "SRS17609395", "SRP436940", "PRJNA971233", "MCPIP1 functions as a safeguard of early embryonic development", "GSE232220", "Transcriptome Analysis", "Expression of zc3h12a encoding Mcpip1 is tightly controlled within first cell divisions of zebrafish. Overexpression of Mcpip1 leads to the profound transcriptomic changes in the developing embryos and impairs early embryonic development of zebrafish. Overall design: RNA seq was performed to analyse transcriptome of zebrafish embryos overexpressing Mcpip1 wild type and catalytically inactive mutant.", null, "pubmed:37805647", null, "Mcpip1 WT replicate3", "GSM7321055", null, "source name:embryo 6 hpf|tissue:embryo 6 hpf|genotype:AB/TL|treatment:microinjection with mRNA encoding zebrafish Mcpip1|geo loc name:missing|collection date:missing", "Mcpip1 WT replicate3", "Signal processing and basecalling was performed with Torrent Suite version 5.14.0. Raw reads were mapped to Danio rerio Ensembl genome version GRCz11 using STAR version 2.7.10a  PMID: 23104886 and bowtie2 version 2.4.4 PMID: 22388286 for unmapped reads. Gene counts were created with htseq count PMID: 25260700  using Ensembl gene model. Differential expression was tested with DESeq2 version version 1.40.1 PMID: 2551628 Assembly: Danio rerio Ensembl genome version GRCz11 Supplementary files format and content: DESeq2 normalized count", "embryo 6 hpf", "Zebrafish eggs at 1 cell stage were microinjected with mRNA using WPI Picopump PV820 microinjector.", "Zebrafish embryos were collected in Fenozol A&A Biotechnology  Gdansk  Polska and stored at  80\u00b0C  prior to analysis. For RNA isolation  the samples were homogenized in Fenozol using a tissue homogenizer OMNI International  Kennesaw  GA  USA. The poly A mRNA fraction from total RNA was isolated with Dynabeads\u00ae mRNA DIRECT\u2122 Micro Kit Thermo. The sequencing library for each RNA sample was prepared according to the protocol provided by the manufacturer using the Ion Total RNA Seq Kit v2 Thermo. The libraries were generated from 1 15 ng of mRNA by fragmenting the mRNA with RNaseIII  purifying the fragmented RNA  and hybridizing and ligating it with Ion adaptors. Subsequently  the RNA products were reverse transcribed and amplified to double stranded cDNA  and then purified using a magnetic bead based method. The molar concentration and size of each cDNA library was determined using the DNA HS Kit on Bioanalyzer 2100 Agilent. Each library was diluted to 53 pM concentration before template preparation. Up to three barcoded libraries were mixed in equal volume and used for automatic template preparation on the Ion Chef instrument Thermo using reagents from the Ion PI Hi Q 200 Kit Thermo and Ion PI v3 Proton Chip.", "AB/TL zebrafish were maintained in a continuous recirculating closed system aquarium with a light/dark cycle of 14/10 hours at 280C. Larvae were incubated in E3 medium at 28\u00b0C according to standard protocols.", "tissue:embryo 6 hpf|genotype:AB/TL|treatment:microinjection with mRNA encoding zebrafish Mcpip1", "GSM7321055", "GSM7321055: Mcpip1 WT replicate3; Danio rerio; RNA Seq", "GSM7321055 r1", "GSM7321055", "1", "Zebrafish embryos were collected in Fenozol A&A Biotechnology  Gdansk  Polska and stored at  80\u00b0C  prior to analysis. For RNA isolation  the samples were homogenized in Fenozol using a tissue homogenizer OMNI International  Kennesaw  GA  USA. The poly A mRNA fraction from total RNA was isolated with Dynabeads\u00ae mRNA DIRECT\u2122 Micro Kit Thermo. The sequencing library for each RNA sample was prepared according to the protocol provided by the manufacturer using the Ion Total RNA Seq Kit v2 Thermo. The libraries were generated from 1 15 ng of mRNA by fragmenting the mRNA with RNaseIII  purifying the fragmented RNA  and hybridizing and ligating it with Ion adaptors. Subsequently  the RNA products were reverse transcribed and amplified to double stranded cDNA  and then purified using a magnetic bead based method. The molar concentration and size of each cDNA library was determined using the DNA HS Kit on Bioanalyzer 2100 Agilent. Each library was diluted to 53 pM concentration before template preparation. Up to three barcoded libraries were mixed in equal volume and used for automatic template preparation on the Ion Chef instrument Thermo using reagents from the Ion PI Hi Q 200 Kit Thermo and Ion PI v3 Proton Chip.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP436940", null, null, "WT_C23.fastq.gz", "fastq", 3644157793.0, 27473010.0, "GSM7321055 r1", "0:132.65", "A:1014320322;C:878841963;G:948316248;T:802679260;N:0", 132, null, null, null, 1014320322, 878841963, 948316248, 802679260, 0, "SRX20282371", "SRS17609395", "SRA1636184", "Genetics, Maria Sklodowska-Curie National Research Institute of Oncology", "Genetics, Maria Sk\u0142odowska-Curie National Research Institute of Oncology", 1, 0.88531, null, 0.03151, null, 0.75101, null, 0.49337, null, 123, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "Poland", "2023-05-10", "Multi-stage", "Multi-stage", "Embryo Imprecise", "All anatomical structures"], [75400, "SRR24497424", "SRX20282370", "SRS17609393", "SRP436940", "PRJNA971233", "MCPIP1 functions as a safeguard of early embryonic development", "GSE232220", "Transcriptome Analysis", "Expression of zc3h12a encoding Mcpip1 is tightly controlled within first cell divisions of zebrafish. Overexpression of Mcpip1 leads to the profound transcriptomic changes in the developing embryos and impairs early embryonic development of zebrafish. Overall design: RNA seq was performed to analyse transcriptome of zebrafish embryos overexpressing Mcpip1 wild type and catalytically inactive mutant.", null, "pubmed:37805647", null, "Mcpip1 WT replicate2", "GSM7321054", null, "source name:embryo 6 hpf|tissue:embryo 6 hpf|genotype:AB/TL|treatment:microinjection with mRNA encoding zebrafish Mcpip1|geo loc name:missing|collection date:missing", "Mcpip1 WT replicate2", "Signal processing and basecalling was performed with Torrent Suite version 5.14.0. Raw reads were mapped to Danio rerio Ensembl genome version GRCz11 using STAR version 2.7.10a  PMID: 23104886 and bowtie2 version 2.4.4 PMID: 22388286 for unmapped reads. Gene counts were created with htseq count PMID: 25260700  using Ensembl gene model. Differential expression was tested with DESeq2 version version 1.40.1 PMID: 2551628 Assembly: Danio rerio Ensembl genome version GRCz11 Supplementary files format and content: DESeq2 normalized count", "embryo 6 hpf", "Zebrafish eggs at 1 cell stage were microinjected with mRNA using WPI Picopump PV820 microinjector.", "Zebrafish embryos were collected in Fenozol A&A Biotechnology  Gdansk  Polska and stored at  80\u00b0C  prior to analysis. For RNA isolation  the samples were homogenized in Fenozol using a tissue homogenizer OMNI International  Kennesaw  GA  USA. The poly A mRNA fraction from total RNA was isolated with Dynabeads\u00ae mRNA DIRECT\u2122 Micro Kit Thermo. The sequencing library for each RNA sample was prepared according to the protocol provided by the manufacturer using the Ion Total RNA Seq Kit v2 Thermo. The libraries were generated from 1 15 ng of mRNA by fragmenting the mRNA with RNaseIII  purifying the fragmented RNA  and hybridizing and ligating it with Ion adaptors. Subsequently  the RNA products were reverse transcribed and amplified to double stranded cDNA  and then purified using a magnetic bead based method. The molar concentration and size of each cDNA library was determined using the DNA HS Kit on Bioanalyzer 2100 Agilent. Each library was diluted to 53 pM concentration before template preparation. Up to three barcoded libraries were mixed in equal volume and used for automatic template preparation on the Ion Chef instrument Thermo using reagents from the Ion PI Hi Q 200 Kit Thermo and Ion PI v3 Proton Chip.", "AB/TL zebrafish were maintained in a continuous recirculating closed system aquarium with a light/dark cycle of 14/10 hours at 280C. Larvae were incubated in E3 medium at 28\u00b0C according to standard protocols.", "tissue:embryo 6 hpf|genotype:AB/TL|treatment:microinjection with mRNA encoding zebrafish Mcpip1", "GSM7321054", "GSM7321054: Mcpip1 WT replicate2; Danio rerio; RNA Seq", "GSM7321054 r1", "GSM7321054", "1", "Zebrafish embryos were collected in Fenozol A&A Biotechnology  Gdansk  Polska and stored at  80\u00b0C  prior to analysis. For RNA isolation  the samples were homogenized in Fenozol using a tissue homogenizer OMNI International  Kennesaw  GA  USA. The poly A mRNA fraction from total RNA was isolated with Dynabeads\u00ae mRNA DIRECT\u2122 Micro Kit Thermo. The sequencing library for each RNA sample was prepared according to the protocol provided by the manufacturer using the Ion Total RNA Seq Kit v2 Thermo. The libraries were generated from 1 15 ng of mRNA by fragmenting the mRNA with RNaseIII  purifying the fragmented RNA  and hybridizing and ligating it with Ion adaptors. Subsequently  the RNA products were reverse transcribed and amplified to double stranded cDNA  and then purified using a magnetic bead based method. The molar concentration and size of each cDNA library was determined using the DNA HS Kit on Bioanalyzer 2100 Agilent. Each library was diluted to 53 pM concentration before template preparation. Up to three barcoded libraries were mixed in equal volume and used for automatic template preparation on the Ion Chef instrument Thermo using reagents from the Ion PI Hi Q 200 Kit Thermo and Ion PI v3 Proton Chip.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP436940", null, null, "WT_B15.fastq.gz", "fastq", 4930632556.0, 30493682.0, "GSM7321054 r1", "0:161.69", "A:1385638764;C:1206486517;G:1269832302;T:1068674973;N:0", 161, null, null, null, 1385638764, 1206486517, 1269832302, 1068674973, 0, "SRX20282370", "SRS17609393", "SRA1636184", "Genetics, Maria Sklodowska-Curie National Research Institute of Oncology", "Genetics, Maria Sk\u0142odowska-Curie National Research Institute of Oncology", 1, 0.86405, null, 0.03935, null, 0.78324, null, 0.49971, null, 107, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "Poland", "2023-05-10", "Multi-stage", "Multi-stage", "Embryo Imprecise", "All anatomical structures"], [75401, "SRR24497425", "SRX20282369", "SRS17609392", "SRP436940", "PRJNA971233", "MCPIP1 functions as a safeguard of early embryonic development", "GSE232220", "Transcriptome Analysis", "Expression of zc3h12a encoding Mcpip1 is tightly controlled within first cell divisions of zebrafish. Overexpression of Mcpip1 leads to the profound transcriptomic changes in the developing embryos and impairs early embryonic development of zebrafish. Overall design: RNA seq was performed to analyse transcriptome of zebrafish embryos overexpressing Mcpip1 wild type and catalytically inactive mutant.", null, "pubmed:37805647", null, "Mcpip1 WT replicate1", "GSM7321053", null, "source name:embryo 6 hpf|tissue:embryo 6 hpf|genotype:AB/TL|treatment:microinjection with mRNA encoding zebrafish Mcpip1|geo loc name:missing|collection date:missing", "Mcpip1 WT replicate1", "Signal processing and basecalling was performed with Torrent Suite version 5.14.0. Raw reads were mapped to Danio rerio Ensembl genome version GRCz11 using STAR version 2.7.10a  PMID: 23104886 and bowtie2 version 2.4.4 PMID: 22388286 for unmapped reads. Gene counts were created with htseq count PMID: 25260700  using Ensembl gene model. Differential expression was tested with DESeq2 version version 1.40.1 PMID: 2551628 Assembly: Danio rerio Ensembl genome version GRCz11 Supplementary files format and content: DESeq2 normalized count", "embryo 6 hpf", "Zebrafish eggs at 1 cell stage were microinjected with mRNA using WPI Picopump PV820 microinjector.", "Zebrafish embryos were collected in Fenozol A&A Biotechnology  Gdansk  Polska and stored at  80\u00b0C  prior to analysis. For RNA isolation  the samples were homogenized in Fenozol using a tissue homogenizer OMNI International  Kennesaw  GA  USA. The poly A mRNA fraction from total RNA was isolated with Dynabeads\u00ae mRNA DIRECT\u2122 Micro Kit Thermo. The sequencing library for each RNA sample was prepared according to the protocol provided by the manufacturer using the Ion Total RNA Seq Kit v2 Thermo. The libraries were generated from 1 15 ng of mRNA by fragmenting the mRNA with RNaseIII  purifying the fragmented RNA  and hybridizing and ligating it with Ion adaptors. Subsequently  the RNA products were reverse transcribed and amplified to double stranded cDNA  and then purified using a magnetic bead based method. The molar concentration and size of each cDNA library was determined using the DNA HS Kit on Bioanalyzer 2100 Agilent. Each library was diluted to 53 pM concentration before template preparation. Up to three barcoded libraries were mixed in equal volume and used for automatic template preparation on the Ion Chef instrument Thermo using reagents from the Ion PI Hi Q 200 Kit Thermo and Ion PI v3 Proton Chip.", "AB/TL zebrafish were maintained in a continuous recirculating closed system aquarium with a light/dark cycle of 14/10 hours at 280C. Larvae were incubated in E3 medium at 28\u00b0C according to standard protocols.", "tissue:embryo 6 hpf|genotype:AB/TL|treatment:microinjection with mRNA encoding zebrafish Mcpip1", "GSM7321053", "GSM7321053: Mcpip1 WT replicate1; Danio rerio; RNA Seq", "GSM7321053 r1", "GSM7321053", "1", "Zebrafish embryos were collected in Fenozol A&A Biotechnology  Gdansk  Polska and stored at  80\u00b0C  prior to analysis. For RNA isolation  the samples were homogenized in Fenozol using a tissue homogenizer OMNI International  Kennesaw  GA  USA. The poly A mRNA fraction from total RNA was isolated with Dynabeads\u00ae mRNA DIRECT\u2122 Micro Kit Thermo. The sequencing library for each RNA sample was prepared according to the protocol provided by the manufacturer using the Ion Total RNA Seq Kit v2 Thermo. The libraries were generated from 1 15 ng of mRNA by fragmenting the mRNA with RNaseIII  purifying the fragmented RNA  and hybridizing and ligating it with Ion adaptors. Subsequently  the RNA products were reverse transcribed and amplified to double stranded cDNA  and then purified using a magnetic bead based method. The molar concentration and size of each cDNA library was determined using the DNA HS Kit on Bioanalyzer 2100 Agilent. Each library was diluted to 53 pM concentration before template preparation. Up to three barcoded libraries were mixed in equal volume and used for automatic template preparation on the Ion Chef instrument Thermo using reagents from the Ion PI Hi Q 200 Kit Thermo and Ion PI v3 Proton Chip.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP436940", null, null, "WT_A7.fastq.gz", "fastq", 4888312783.0, 29414563.0, "GSM7321053 r1", "0:166.19", "A:1356799075;C:1172146709;G:1273947582;T:1085419417;N:0", 166, null, null, null, 1356799075, 1172146709, 1273947582, 1085419417, 0, "SRX20282369", "SRS17609392", "SRA1636184", "Genetics, Maria Sklodowska-Curie National Research Institute of Oncology", "Genetics, Maria Sk\u0142odowska-Curie National Research Institute of Oncology", 1, 0.82661, null, 0.05547, null, 0.7751, null, 0.49668, null, 188, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "Poland", "2023-05-10", "Multi-stage", "Multi-stage", "Embryo Imprecise", "All anatomical structures"]], "truncated": false, "filtered_table_rows_count": 86, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"experiment.library_selection\" = :p0 and \"experiment.platform\" = :p1 and \"tissue_curation_coarse\" = :p2 order by rowid limit 101", "params": {"p0": "cDNA", "p1": "ION_TORRENT", "p2": "All anatomical structures"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=cDNA&experiment.platform=ION_TORRENT&tissue_curation_coarse=All+anatomical+structures", "results": [{"value": "RNA-Seq", "label": "RNA-Seq", "count": 58, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=cDNA&experiment.platform=ION_TORRENT&tissue_curation_coarse=All+anatomical+structures&experiment.library_strategy=RNA-Seq", "selected": false}, {"value": "miRNA-Seq", "label": "miRNA-Seq", "count": 28, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=cDNA&experiment.platform=ION_TORRENT&tissue_curation_coarse=All+anatomical+structures&experiment.library_strategy=miRNA-Seq", "selected": false}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=cDNA&experiment.platform=ION_TORRENT&tissue_curation_coarse=All+anatomical+structures", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 86, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=cDNA&experiment.platform=ION_TORRENT&tissue_curation_coarse=All+anatomical+structures&experiment.library_source=TRANSCRIPTOMIC", "selected": false}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=cDNA&experiment.platform=ION_TORRENT&tissue_curation_coarse=All+anatomical+structures", "results": [{"value": "cDNA", "label": "cDNA", "count": 86, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.platform=ION_TORRENT&tissue_curation_coarse=All+anatomical+structures", "selected": true}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=cDNA&experiment.platform=ION_TORRENT&tissue_curation_coarse=All+anatomical+structures", "results": [{"value": "SINGLE", "label": "SINGLE", "count": 86, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=cDNA&experiment.platform=ION_TORRENT&tissue_curation_coarse=All+anatomical+structures&experiment.library_layout=SINGLE", "selected": false}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=cDNA&experiment.platform=ION_TORRENT&tissue_curation_coarse=All+anatomical+structures", "results": [{"value": "ION_TORRENT", "label": "ION_TORRENT", "count": 86, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=cDNA&tissue_curation_coarse=All+anatomical+structures", "selected": true}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=cDNA&experiment.platform=ION_TORRENT&tissue_curation_coarse=All+anatomical+structures", "results": [{"value": "Embryo", "label": "Embryo", "count": 78, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=cDNA&experiment.platform=ION_TORRENT&tissue_curation_coarse=All+anatomical+structures&devstage_curation_coarse=Embryo", "selected": false}, {"value": "Multi-stage", "label": "Multi-stage", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=cDNA&experiment.platform=ION_TORRENT&tissue_curation_coarse=All+anatomical+structures&devstage_curation_coarse=Multi-stage", "selected": false}, {"value": "Larval", "label": "Larval", "count": 2, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=cDNA&experiment.platform=ION_TORRENT&tissue_curation_coarse=All+anatomical+structures&devstage_curation_coarse=Larval", "selected": false}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=cDNA&experiment.platform=ION_TORRENT&tissue_curation_coarse=All+anatomical+structures", "results": [{"value": "Pharyngula", "label": "Pharyngula", "count": 34, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=cDNA&experiment.platform=ION_TORRENT&tissue_curation_coarse=All+anatomical+structures&devstage_curation=Pharyngula", "selected": false}, {"value": "Gastrula", "label": "Gastrula", "count": 20, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=cDNA&experiment.platform=ION_TORRENT&tissue_curation_coarse=All+anatomical+structures&devstage_curation=Gastrula", "selected": false}, {"value": "Multi-stage", "label": "Multi-stage", "count": 8, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=cDNA&experiment.platform=ION_TORRENT&tissue_curation_coarse=All+anatomical+structures&devstage_curation=Multi-stage", "selected": false}, {"value": "Segmentation", "label": "Segmentation", "count": 8, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=cDNA&experiment.platform=ION_TORRENT&tissue_curation_coarse=All+anatomical+structures&devstage_curation=Segmentation", "selected": false}, {"value": "Hatching", "label": "Hatching", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=cDNA&experiment.platform=ION_TORRENT&tissue_curation_coarse=All+anatomical+structures&devstage_curation=Hatching", "selected": false}, {"value": "Blastula", "label": "Blastula", "count": 4, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=cDNA&experiment.platform=ION_TORRENT&tissue_curation_coarse=All+anatomical+structures&devstage_curation=Blastula", "selected": false}, {"value": "Cleavage", "label": "Cleavage", "count": 4, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=cDNA&experiment.platform=ION_TORRENT&tissue_curation_coarse=All+anatomical+structures&devstage_curation=Cleavage", "selected": false}, {"value": "Larval", "label": "Larval", "count": 2, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=cDNA&experiment.platform=ION_TORRENT&tissue_curation_coarse=All+anatomical+structures&devstage_curation=Larval", "selected": false}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=cDNA&experiment.platform=ION_TORRENT&tissue_curation_coarse=All+anatomical+structures", "results": [{"value": "All anatomical structures", "label": "All anatomical structures", "count": 86, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=cDNA&experiment.platform=ION_TORRENT", "selected": true}], "truncated": false}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=cDNA&experiment.platform=ION_TORRENT&tissue_curation_coarse=All+anatomical+structures", "results": [{"value": "Whole Organism", "label": "Whole Organism", "count": 50, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=cDNA&experiment.platform=ION_TORRENT&tissue_curation_coarse=All+anatomical+structures&tissue_curation=Whole+Organism", "selected": false}, {"value": "Embryo Imprecise", "label": "Embryo Imprecise", "count": 36, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=cDNA&experiment.platform=ION_TORRENT&tissue_curation_coarse=All+anatomical+structures&tissue_curation=Embryo+Imprecise", "selected": false}], "truncated": false}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_selection=cDNA&experiment.platform=ION_TORRENT&tissue_curation_coarse=All+anatomical+structures", "results": [{"value": "unknown", "label": "unknown", "count": 80, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=cDNA&experiment.platform=ION_TORRENT&tissue_curation_coarse=All+anatomical+structures&technology=unknown", "selected": false}, {"value": "bulk", "label": "bulk", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=cDNA&experiment.platform=ION_TORRENT&tissue_curation_coarse=All+anatomical+structures&technology=bulk", "selected": false}], "truncated": false}}, "suggested_facets": [], "next": null, "next_url": null, "private": false, "allow_execute_sql": true, "query_ms": 108.72642600588733}