{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where experiment.library_layout = \"SINGLE\" and tissue_curation = \"Oocyte\"", "rows": [[15550, "ERR647595", "ERX604031", "ERS557915", "ERP007147", "PRJEB7420", "Two Sets of Synthetic Spike in Controls for Size Selection and Data Normalisation in small RNA seq", "ena-STUDY-UNIVERSITY OF AMSTERDAM-01-10-2014-14:02:22:856-622", "Other", "There is an increasing interest in complementing standard RNA seq experiments with small RNA expression data to obtain a comprehensive view of the transcriptome. Two aspects need to be considered when small RNA seq sRNA seq is used. First  sRNA seq protocols are size selective and typically optimized for sequencing miRNAs. Second  given the dynamic composition of the small RNA fraction a reliable normalization strategy is needed to identify differentially expressed sRNAs. To address both issues we here present two sets of synthetic RNA spike in controls for monitoring size selectivity and for performing normalization. Size spike ins comprising 18 oligoribonucleotides 10\u2013300 nucleotides were designed and tested using controlled modifications to the size selectivity of sRNA seq. As an applied example  the loss of RNA molecules <30 nucleotides during small RNA isolation from zebrafish oocytes is demonstrated. Normalization spike ins comprising 19 oligoribonucleotides were designed to use as an external reference for DESeq normalization. Spike in based normalization improved the quantification of predetermined fold changes. Lastly  sRNA seq on female and male zebrafish demonstrated that the higher miRNA content in males was correctly preserved post spike in based normalization.", null, null, null, "Egg", "SAMEA2796300", "UNIVERSITY OF AMSTERDAM", "Alias:Egg|ENA checklist:ERC000011|INSDC center alias:UNIVERSITY OF AMSTERDAM|INSDC center name:UNIVERSITY OF AMSTERDAM|INSDC first public:2014 11 29T17:02:28Z|INSDC last update:2014 10 01T14:29:23Z|INSDC status:public|SRA accession:ERS557915|Sample Name:ERS557915|Title:Zebrafish Egg samples|dev stage:Oocytes", null, null, null, null, null, null, null, null, "Ion Torrent Proton sequencing", "ena EXPERIMENT UNIVERSITY OF AMSTERDAM 01 10 2014 14:25:29:391 1", "RID0024", "1", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "ERP007147", "Ion Torrent Proton sequencing", "ENA FIRST PUBLIC:2014 11 29|ENA LAST UPDATE:2018 11 16", "RID0024_016.fastq.gz", "fastq", 6684767188.0, 89052017.0, "ena RUN UNIVERSITY OF AMSTERDAM 01 10 2014 14:25:29:391 1", "0:75.07", "A:1523328157;C:1795624453;G:1849675240;T:1516139338;N:0", 75, null, null, null, 1523328157, 1795624453, 1849675240, 1516139338, 0, "ERX604031", "ERS557915", "ERA363845", "UNIVERSITY OF AMSTERDAM", "UNIVERSITY OF AMSTERDAM", 1, 0.89536, null, 0.15322, null, 0.91421, null, 0.69019, null, 73, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2014-10-01", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [25293, "SRR25764131", "SRX21486791", "SRS18719090", "SRP457111", "PRJNA1009808", "Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq]", "GSE241754", "Transcriptome Analysis", "Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points  namelyat the 256 cell 2.5 hpf  1000 cell 3 hpf  sphere 4 hpf  shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis  polysome profiling  ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.", "parent bioproject:PRJNA1009800", "pubmed:39402326", null, "WT egg 0 hpf tRNA seq rep2", "GSM7734772", null, "source name:Unfertilized egg|strain:TLAB strain|tissue:Unfertilized egg|developmental stage:unfertilized egg 0 hpf|genotype:WT|geo loc name:missing|collection date:missing", "WT egg 0 hpf tRNA seq rep2", "Read demultiplexing and adapter trimming performed with cutadapt v3.5  where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained  and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5\u2019 RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters   species Drer   cluster id 0.93   min cov 0.001   max mismatches 0.075   control condition Egg   deconv cov ratio 0.4   remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters  and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts", "Unfertilized egg", "unperturbed growth conditions in E3 medium for zebrafish embryos.", "50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4  100 mM LiCl  2 mM EDTA  5 mM DTT  pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021  2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq", "Embryos were grown in standard housing conditions namely28\u00b0C at a 14/10 hour light/dark cycle.", "strain:TLAB strain|tissue:Unfertilized egg|developmental stage:unfertilized egg 0 hpf|genotype:WT", "GSM7734772", "GSM7734772: WT egg 0 hpf tRNA seq rep2; Danio rerio; ncRNA Seq", "GSM7734772 r1", "GSM7734772", "1", "50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4  100 mM LiCl  2 mM EDTA  5 mM DTT  pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021  2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP457111", null, null, "WT_tRNA_egg_2.fastq.gz", "fastq", 206374994.0, 3181706.0, "GSM7734772 r1", "0:64.86", "A:41195250;C:56578032;G:56479855;T:52121365;N:492", 64, null, null, null, 41195250, 56578032, 56479855, 52121365, 492, "SRX21486791", "SRS18719090", "SRA1700461", "Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry", "Max Planck Institute of Biochemistry", 1, 0.28659, null, 0.02017, null, 0.9207, null, 0.48536, null, 78, null, "B", null, "usable mapping rate", "illumina", "nextseq", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2023-08-28", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [25294, "SRR25764132", "SRX21486790", "SRS18719089", "SRP457111", "PRJNA1009808", "Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq]", "GSE241754", "Transcriptome Analysis", "Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points  namelyat the 256 cell 2.5 hpf  1000 cell 3 hpf  sphere 4 hpf  shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis  polysome profiling  ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.", "parent bioproject:PRJNA1009800", "pubmed:39402326", null, "WT egg 0 hpf tRNA seq rep1", "GSM7734771", null, "source name:Unfertilized egg|strain:TLAB strain|tissue:Unfertilized egg|developmental stage:unfertilized egg 0 hpf|genotype:WT|geo loc name:missing|collection date:missing", "WT egg 0 hpf tRNA seq rep1", "Read demultiplexing and adapter trimming performed with cutadapt v3.5  where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained  and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5\u2019 RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters   species Drer   cluster id 0.93   min cov 0.001   max mismatches 0.075   control condition Egg   deconv cov ratio 0.4   remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters  and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts", "Unfertilized egg", "unperturbed growth conditions in E3 medium for zebrafish embryos.", "50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4  100 mM LiCl  2 mM EDTA  5 mM DTT  pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021  2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq", "Embryos were grown in standard housing conditions namely28\u00b0C at a 14/10 hour light/dark cycle.", "strain:TLAB strain|tissue:Unfertilized egg|developmental stage:unfertilized egg 0 hpf|genotype:WT", "GSM7734771", "GSM7734771: WT egg 0 hpf tRNA seq rep1; Danio rerio; ncRNA Seq", "GSM7734771 r1", "GSM7734771", "1", "50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4  100 mM LiCl  2 mM EDTA  5 mM DTT  pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021  2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP457111", null, null, "WT_tRNA_egg_1.fastq.gz", "fastq", 86021968.0, 1304769.0, "GSM7734771 r1", "0:65.93", "A:17511521;C:23474625;G:23300759;T:21734864;N:199", 65, null, null, null, 17511521, 23474625, 23300759, 21734864, 199, "SRX21486790", "SRS18719089", "SRA1700461", "Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry", "Max Planck Institute of Biochemistry", 1, 0.29829, null, 0.02027, null, 0.92245, null, 0.48877, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2023-08-28", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [30755, "SRR28348921", "SRX23954975", "SRS20755396", "SRP495323", "PRJNA1088158", "Protein profiling of zebrafish embryos unmasks regulatory layers during early embryogenesis.", "GSE261646", "Transcriptome Analysis", "The maternal to zygotic transition is crucial in embryonic development  marked by the degradation of maternally provided mRNAs and initiation of zygotic gene expression. However  the changes occurring at the protein level during this transition remain unclear. Here  we conducted protein profiling throughout zebrafish embryogenesis using quantitative mass spectrometry  integrating transcriptomics and translatomics datasets. Our data shows that unlike RNA changes  protein changes are less dynamic. Further  increases in protein levels correlate with mRNA translation  whereas declines in protein levels do not  suggesting active protein degradation processes. Interestingly  proteins from pure zygotic genes are present at fertilization  challenging existing mRNA based gene classifications. As a proof of concept  we utilized CRISPR Cas13d to target znf281b mRNA  a gene whose protein significantly accumulates within the first two hpf  demonstrating its crucial role in development. Consequently  our protein profiling  coupled with CRISPR Cas13d  offers a new approach to unravel maternal mRNAs function during embryonic development. Overall design: Two biological replicate samples containing 50 zebrafish oocytes per stage were collected by pairing females in natural matings to ''purge'' mature eggs and used to establish an oogenesis time line. Fish were euthanized and ovaries harvested within 1\u201311 days post purging dpp. Stage I and II oocytes were collected at 1\u20132 dpp  stage III oocytes germinal vesicle in central position at 4\u20137 dpp  and stage IV oocytes germinal vesicle asymmetrically located at 8\u201310 dpp. Oocyte isolations were based on73  and conducted in isolation medium Leibovitz L 15 Sigma Aldrich #L5520 plus Collagenase I and II depending on the stages as follows. Stages I and II were isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130 and 3 mg/mL Collagenase II Gibco 17101015. Stage III was isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130. Stage IV was isolated by mechanical stripping with forceps and needle without xxx use of Collagenases. Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. Three biological replicate samples containing 20 dechorionated zebrafish embryos were snap frozen in TRIzol Invitrogen #15596026. Four time points of embryonic development were included: 1 cell stage 0 hpf  hpf  2 hpf  4 hpf  and 6 hpf. RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols.", null, "pubmed:39302832", null, "Zebrafish Oocyte  Stage IV  rep2", "GSM8147872", null, "source name:Oocyte|tissue:Oocyte|developmental stage:Stage IV|genotype:AB  TF and TLF|geo loc name:missing|collection date:missing", "Zebrafish Oocyte  Stage IV  rep2", "Raw reads from zebrafish oocytes stages I IV and embryos 0   2   4   and 6 hpf were demultiplexed into FASTQ format allowing up to one mismatch using Illumina bcl convert 3.10.5. Reads were aligned to UCSC genome danRer11 with STAR aligner version 2.7.3a  using Ensembl 106 gene models. Counts were converted to TPM values using RSEM version v1.3.0 and all subsequent analysis was done using TPM. Assembly: danRer11 Ensembl 106 gene models Supplementary files format and content: comma separated files with TPMs from all replicates", "Oocyte", null, "Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer\u2019s protocols. 0   2   4  and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer\u2019s protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0   2   4   and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA  as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer\u2019s directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598  and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled  quantified  and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing  Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA  as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer\u2019s instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina  Cat. No. 20020598  and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized  pooled  and sequenced on a NextSeq 500 instrument Illumina  as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing  Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.", null, "tissue:Oocyte|developmental stage:Stage IV|genotype:AB  TF and TLF", "GSM8147872", "GSM8147872: Zebrafish Oocyte  Stage IV  rep2; Danio rerio; RNA Seq", "GSM8147872 r1", "GSM8147872", "1", "Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. 0   2   4  and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0   2   4   and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA  as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer's directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598  and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled  quantified  and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing  Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA  as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer's instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina  Cat. No. 20020598  and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized  pooled  and sequenced on a NextSeq 500 instrument Illumina  as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing  Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP495323", null, null, "Z_oocyte_stage_4_2_Pa.fastq", "fastq", 2456514332.0, 32322557.0, "GSM8147872 r1", "0:76", "A:588246161;C:609187233;G:593122683;T:665837765;N:120490", 76, null, null, null, 588246161, 609187233, 593122683, 665837765, 120490, "SRX23954975", "SRS20755396", "SRA1824599", "Computational Biology, Stowers Institute for Medical Research", "Computational Biology, Stowers Institute for Medical Research", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2024-03-14", "Multi-stage", "Embryo", "Oocyte", "Reproductive System"], [30756, "SRR28348922", "SRX23954974", "SRS20755395", "SRP495323", "PRJNA1088158", "Protein profiling of zebrafish embryos unmasks regulatory layers during early embryogenesis.", "GSE261646", "Transcriptome Analysis", "The maternal to zygotic transition is crucial in embryonic development  marked by the degradation of maternally provided mRNAs and initiation of zygotic gene expression. However  the changes occurring at the protein level during this transition remain unclear. Here  we conducted protein profiling throughout zebrafish embryogenesis using quantitative mass spectrometry  integrating transcriptomics and translatomics datasets. Our data shows that unlike RNA changes  protein changes are less dynamic. Further  increases in protein levels correlate with mRNA translation  whereas declines in protein levels do not  suggesting active protein degradation processes. Interestingly  proteins from pure zygotic genes are present at fertilization  challenging existing mRNA based gene classifications. As a proof of concept  we utilized CRISPR Cas13d to target znf281b mRNA  a gene whose protein significantly accumulates within the first two hpf  demonstrating its crucial role in development. Consequently  our protein profiling  coupled with CRISPR Cas13d  offers a new approach to unravel maternal mRNAs function during embryonic development. Overall design: Two biological replicate samples containing 50 zebrafish oocytes per stage were collected by pairing females in natural matings to ''purge'' mature eggs and used to establish an oogenesis time line. Fish were euthanized and ovaries harvested within 1\u201311 days post purging dpp. Stage I and II oocytes were collected at 1\u20132 dpp  stage III oocytes germinal vesicle in central position at 4\u20137 dpp  and stage IV oocytes germinal vesicle asymmetrically located at 8\u201310 dpp. Oocyte isolations were based on73  and conducted in isolation medium Leibovitz L 15 Sigma Aldrich #L5520 plus Collagenase I and II depending on the stages as follows. Stages I and II were isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130 and 3 mg/mL Collagenase II Gibco 17101015. Stage III was isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130. Stage IV was isolated by mechanical stripping with forceps and needle without xxx use of Collagenases. Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. Three biological replicate samples containing 20 dechorionated zebrafish embryos were snap frozen in TRIzol Invitrogen #15596026. Four time points of embryonic development were included: 1 cell stage 0 hpf  hpf  2 hpf  4 hpf  and 6 hpf. RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols.", null, "pubmed:39302832", null, "Zebrafish Oocyte  Stage IV  rep1", "GSM8147871", null, "source name:Oocyte|tissue:Oocyte|developmental stage:Stage IV|genotype:AB  TF and TLF|geo loc name:missing|collection date:missing", "Zebrafish Oocyte  Stage IV  rep1", "Raw reads from zebrafish oocytes stages I IV and embryos 0   2   4   and 6 hpf were demultiplexed into FASTQ format allowing up to one mismatch using Illumina bcl convert 3.10.5. Reads were aligned to UCSC genome danRer11 with STAR aligner version 2.7.3a  using Ensembl 106 gene models. Counts were converted to TPM values using RSEM version v1.3.0 and all subsequent analysis was done using TPM. Assembly: danRer11 Ensembl 106 gene models Supplementary files format and content: comma separated files with TPMs from all replicates", "Oocyte", null, "Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer\u2019s protocols. 0   2   4  and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer\u2019s protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0   2   4   and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA  as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer\u2019s directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598  and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled  quantified  and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing  Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA  as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer\u2019s instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina  Cat. No. 20020598  and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized  pooled  and sequenced on a NextSeq 500 instrument Illumina  as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing  Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.", null, "tissue:Oocyte|developmental stage:Stage IV|genotype:AB  TF and TLF", "GSM8147871", "GSM8147871: Zebrafish Oocyte  Stage IV  rep1; Danio rerio; RNA Seq", "GSM8147871 r1", "GSM8147871", "1", "Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. 0   2   4  and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0   2   4   and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA  as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer's directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598  and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled  quantified  and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing  Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA  as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer's instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina  Cat. No. 20020598  and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized  pooled  and sequenced on a NextSeq 500 instrument Illumina  as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing  Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP495323", null, null, "Z_oocyte_stage_4_1_Pa.fastq", "fastq", 2650784696.0, 34878746.0, "GSM8147871 r1", "0:76", "A:649971632;C:640667370;G:632570967;T:727447552;N:127175", 76, null, null, null, 649971632, 640667370, 632570967, 727447552, 127175, "SRX23954974", "SRS20755395", "SRA1824599", "Computational Biology, Stowers Institute for Medical Research", "Computational Biology, Stowers Institute for Medical Research", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2024-03-14", "Multi-stage", "Embryo", "Oocyte", "Reproductive System"], [30757, "SRR28348923", "SRX23954973", "SRS20755394", "SRP495323", "PRJNA1088158", "Protein profiling of zebrafish embryos unmasks regulatory layers during early embryogenesis.", "GSE261646", "Transcriptome Analysis", "The maternal to zygotic transition is crucial in embryonic development  marked by the degradation of maternally provided mRNAs and initiation of zygotic gene expression. However  the changes occurring at the protein level during this transition remain unclear. Here  we conducted protein profiling throughout zebrafish embryogenesis using quantitative mass spectrometry  integrating transcriptomics and translatomics datasets. Our data shows that unlike RNA changes  protein changes are less dynamic. Further  increases in protein levels correlate with mRNA translation  whereas declines in protein levels do not  suggesting active protein degradation processes. Interestingly  proteins from pure zygotic genes are present at fertilization  challenging existing mRNA based gene classifications. As a proof of concept  we utilized CRISPR Cas13d to target znf281b mRNA  a gene whose protein significantly accumulates within the first two hpf  demonstrating its crucial role in development. Consequently  our protein profiling  coupled with CRISPR Cas13d  offers a new approach to unravel maternal mRNAs function during embryonic development. Overall design: Two biological replicate samples containing 50 zebrafish oocytes per stage were collected by pairing females in natural matings to ''purge'' mature eggs and used to establish an oogenesis time line. Fish were euthanized and ovaries harvested within 1\u201311 days post purging dpp. Stage I and II oocytes were collected at 1\u20132 dpp  stage III oocytes germinal vesicle in central position at 4\u20137 dpp  and stage IV oocytes germinal vesicle asymmetrically located at 8\u201310 dpp. Oocyte isolations were based on73  and conducted in isolation medium Leibovitz L 15 Sigma Aldrich #L5520 plus Collagenase I and II depending on the stages as follows. Stages I and II were isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130 and 3 mg/mL Collagenase II Gibco 17101015. Stage III was isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130. Stage IV was isolated by mechanical stripping with forceps and needle without xxx use of Collagenases. Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. Three biological replicate samples containing 20 dechorionated zebrafish embryos were snap frozen in TRIzol Invitrogen #15596026. Four time points of embryonic development were included: 1 cell stage 0 hpf  hpf  2 hpf  4 hpf  and 6 hpf. RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols.", null, "pubmed:39302832", null, "Zebrafish Oocyte  Stage III  rep2", "GSM8147870", null, "source name:Oocyte|tissue:Oocyte|developmental stage:Stage III|genotype:AB  TF and TLF|geo loc name:missing|collection date:missing", "Zebrafish Oocyte  Stage III  rep2", "Raw reads from zebrafish oocytes stages I IV and embryos 0   2   4   and 6 hpf were demultiplexed into FASTQ format allowing up to one mismatch using Illumina bcl convert 3.10.5. Reads were aligned to UCSC genome danRer11 with STAR aligner version 2.7.3a  using Ensembl 106 gene models. Counts were converted to TPM values using RSEM version v1.3.0 and all subsequent analysis was done using TPM. Assembly: danRer11 Ensembl 106 gene models Supplementary files format and content: comma separated files with TPMs from all replicates", "Oocyte", null, "Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer\u2019s protocols. 0   2   4  and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer\u2019s protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0   2   4   and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA  as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer\u2019s directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598  and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled  quantified  and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing  Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA  as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer\u2019s instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina  Cat. No. 20020598  and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized  pooled  and sequenced on a NextSeq 500 instrument Illumina  as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing  Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.", null, "tissue:Oocyte|developmental stage:Stage III|genotype:AB  TF and TLF", "GSM8147870", "GSM8147870: Zebrafish Oocyte  Stage III  rep2; Danio rerio; RNA Seq", "GSM8147870 r1", "GSM8147870", "1", "Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. 0   2   4  and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0   2   4   and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA  as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer's directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598  and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled  quantified  and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing  Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA  as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer's instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina  Cat. No. 20020598  and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized  pooled  and sequenced on a NextSeq 500 instrument Illumina  as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing  Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP495323", null, null, "Z_oocyte_stage_3_2_Pa.fastq", "fastq", 2809957956.0, 36973131.0, "GSM8147870 r1", "0:76", "A:679041537;C:690924547;G:702857353;T:736996218;N:138301", 76, null, null, null, 679041537, 690924547, 702857353, 736996218, 138301, "SRX23954973", "SRS20755394", "SRA1824599", "Computational Biology, Stowers Institute for Medical Research", "Computational Biology, Stowers Institute for Medical Research", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2024-03-14", "Multi-stage", "Embryo", "Oocyte", "Reproductive System"], [30758, "SRR28348924", "SRX23954972", "SRS20755393", "SRP495323", "PRJNA1088158", "Protein profiling of zebrafish embryos unmasks regulatory layers during early embryogenesis.", "GSE261646", "Transcriptome Analysis", "The maternal to zygotic transition is crucial in embryonic development  marked by the degradation of maternally provided mRNAs and initiation of zygotic gene expression. However  the changes occurring at the protein level during this transition remain unclear. Here  we conducted protein profiling throughout zebrafish embryogenesis using quantitative mass spectrometry  integrating transcriptomics and translatomics datasets. Our data shows that unlike RNA changes  protein changes are less dynamic. Further  increases in protein levels correlate with mRNA translation  whereas declines in protein levels do not  suggesting active protein degradation processes. Interestingly  proteins from pure zygotic genes are present at fertilization  challenging existing mRNA based gene classifications. As a proof of concept  we utilized CRISPR Cas13d to target znf281b mRNA  a gene whose protein significantly accumulates within the first two hpf  demonstrating its crucial role in development. Consequently  our protein profiling  coupled with CRISPR Cas13d  offers a new approach to unravel maternal mRNAs function during embryonic development. Overall design: Two biological replicate samples containing 50 zebrafish oocytes per stage were collected by pairing females in natural matings to ''purge'' mature eggs and used to establish an oogenesis time line. Fish were euthanized and ovaries harvested within 1\u201311 days post purging dpp. Stage I and II oocytes were collected at 1\u20132 dpp  stage III oocytes germinal vesicle in central position at 4\u20137 dpp  and stage IV oocytes germinal vesicle asymmetrically located at 8\u201310 dpp. Oocyte isolations were based on73  and conducted in isolation medium Leibovitz L 15 Sigma Aldrich #L5520 plus Collagenase I and II depending on the stages as follows. Stages I and II were isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130 and 3 mg/mL Collagenase II Gibco 17101015. Stage III was isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130. Stage IV was isolated by mechanical stripping with forceps and needle without xxx use of Collagenases. Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. Three biological replicate samples containing 20 dechorionated zebrafish embryos were snap frozen in TRIzol Invitrogen #15596026. Four time points of embryonic development were included: 1 cell stage 0 hpf  hpf  2 hpf  4 hpf  and 6 hpf. RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols.", null, "pubmed:39302832", null, "Zebrafish Oocyte  Stage III  rep1", "GSM8147869", null, "source name:Oocyte|tissue:Oocyte|developmental stage:Stage III|genotype:AB  TF and TLF|geo loc name:missing|collection date:missing", "Zebrafish Oocyte  Stage III  rep1", "Raw reads from zebrafish oocytes stages I IV and embryos 0   2   4   and 6 hpf were demultiplexed into FASTQ format allowing up to one mismatch using Illumina bcl convert 3.10.5. Reads were aligned to UCSC genome danRer11 with STAR aligner version 2.7.3a  using Ensembl 106 gene models. Counts were converted to TPM values using RSEM version v1.3.0 and all subsequent analysis was done using TPM. Assembly: danRer11 Ensembl 106 gene models Supplementary files format and content: comma separated files with TPMs from all replicates", "Oocyte", null, "Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer\u2019s protocols. 0   2   4  and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer\u2019s protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0   2   4   and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA  as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer\u2019s directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598  and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled  quantified  and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing  Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA  as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer\u2019s instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina  Cat. No. 20020598  and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized  pooled  and sequenced on a NextSeq 500 instrument Illumina  as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing  Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.", null, "tissue:Oocyte|developmental stage:Stage III|genotype:AB  TF and TLF", "GSM8147869", "GSM8147869: Zebrafish Oocyte  Stage III  rep1; Danio rerio; RNA Seq", "GSM8147869 r1", "GSM8147869", "1", "Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. 0   2   4  and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0   2   4   and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA  as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer's directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598  and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled  quantified  and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing  Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA  as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer's instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina  Cat. No. 20020598  and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized  pooled  and sequenced on a NextSeq 500 instrument Illumina  as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing  Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP495323", null, null, "Z_oocyte_stage_3_1_Pa.fastq", "fastq", 2828372376.0, 37215426.0, "GSM8147869 r1", "0:76", "A:701751055;C:680571938;G:664212213;T:781698241;N:138929", 76, null, null, null, 701751055, 680571938, 664212213, 781698241, 138929, "SRX23954972", "SRS20755393", "SRA1824599", "Computational Biology, Stowers Institute for Medical Research", "Computational Biology, Stowers Institute for Medical Research", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2024-03-14", "Multi-stage", "Embryo", "Oocyte", "Reproductive System"], [30759, "SRR28348925", "SRX23954971", "SRS20755392", "SRP495323", "PRJNA1088158", "Protein profiling of zebrafish embryos unmasks regulatory layers during early embryogenesis.", "GSE261646", "Transcriptome Analysis", "The maternal to zygotic transition is crucial in embryonic development  marked by the degradation of maternally provided mRNAs and initiation of zygotic gene expression. However  the changes occurring at the protein level during this transition remain unclear. Here  we conducted protein profiling throughout zebrafish embryogenesis using quantitative mass spectrometry  integrating transcriptomics and translatomics datasets. Our data shows that unlike RNA changes  protein changes are less dynamic. Further  increases in protein levels correlate with mRNA translation  whereas declines in protein levels do not  suggesting active protein degradation processes. Interestingly  proteins from pure zygotic genes are present at fertilization  challenging existing mRNA based gene classifications. As a proof of concept  we utilized CRISPR Cas13d to target znf281b mRNA  a gene whose protein significantly accumulates within the first two hpf  demonstrating its crucial role in development. Consequently  our protein profiling  coupled with CRISPR Cas13d  offers a new approach to unravel maternal mRNAs function during embryonic development. Overall design: Two biological replicate samples containing 50 zebrafish oocytes per stage were collected by pairing females in natural matings to ''purge'' mature eggs and used to establish an oogenesis time line. Fish were euthanized and ovaries harvested within 1\u201311 days post purging dpp. Stage I and II oocytes were collected at 1\u20132 dpp  stage III oocytes germinal vesicle in central position at 4\u20137 dpp  and stage IV oocytes germinal vesicle asymmetrically located at 8\u201310 dpp. Oocyte isolations were based on73  and conducted in isolation medium Leibovitz L 15 Sigma Aldrich #L5520 plus Collagenase I and II depending on the stages as follows. Stages I and II were isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130 and 3 mg/mL Collagenase II Gibco 17101015. Stage III was isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130. Stage IV was isolated by mechanical stripping with forceps and needle without xxx use of Collagenases. Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. Three biological replicate samples containing 20 dechorionated zebrafish embryos were snap frozen in TRIzol Invitrogen #15596026. Four time points of embryonic development were included: 1 cell stage 0 hpf  hpf  2 hpf  4 hpf  and 6 hpf. RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols.", null, "pubmed:39302832", null, "Zebrafish Oocyte  Stage II  rep2", "GSM8147868", null, "source name:Oocyte|tissue:Oocyte|developmental stage:Stage II|genotype:AB  TF and TLF|geo loc name:missing|collection date:missing", "Zebrafish Oocyte  Stage II  rep2", "Raw reads from zebrafish oocytes stages I IV and embryos 0   2   4   and 6 hpf were demultiplexed into FASTQ format allowing up to one mismatch using Illumina bcl convert 3.10.5. Reads were aligned to UCSC genome danRer11 with STAR aligner version 2.7.3a  using Ensembl 106 gene models. Counts were converted to TPM values using RSEM version v1.3.0 and all subsequent analysis was done using TPM. Assembly: danRer11 Ensembl 106 gene models Supplementary files format and content: comma separated files with TPMs from all replicates", "Oocyte", null, "Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer\u2019s protocols. 0   2   4  and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer\u2019s protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0   2   4   and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA  as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer\u2019s directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598  and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled  quantified  and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing  Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA  as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer\u2019s instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina  Cat. No. 20020598  and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized  pooled  and sequenced on a NextSeq 500 instrument Illumina  as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing  Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.", null, "tissue:Oocyte|developmental stage:Stage II|genotype:AB  TF and TLF", "GSM8147868", "GSM8147868: Zebrafish Oocyte  Stage II  rep2; Danio rerio; RNA Seq", "GSM8147868 r1", "GSM8147868", "1", "Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. 0   2   4  and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0   2   4   and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA  as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer's directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598  and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled  quantified  and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing  Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA  as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer's instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina  Cat. No. 20020598  and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized  pooled  and sequenced on a NextSeq 500 instrument Illumina  as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing  Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP495323", null, null, "Z_oocyte_stage_2_2_Pa.fastq", "fastq", 2837652432.0, 37337532.0, "GSM8147868 r1", "0:76", "A:698931608;C:681467909;G:683751172;T:773364392;N:137351", 76, null, null, null, 698931608, 681467909, 683751172, 773364392, 137351, "SRX23954971", "SRS20755392", "SRA1824599", "Computational Biology, Stowers Institute for Medical Research", "Computational Biology, Stowers Institute for Medical Research", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2024-03-14", "Multi-stage", "Embryo", "Oocyte", "Reproductive System"], [30760, "SRR28348926", "SRX23954970", "SRS20755391", "SRP495323", "PRJNA1088158", "Protein profiling of zebrafish embryos unmasks regulatory layers during early embryogenesis.", "GSE261646", "Transcriptome Analysis", "The maternal to zygotic transition is crucial in embryonic development  marked by the degradation of maternally provided mRNAs and initiation of zygotic gene expression. However  the changes occurring at the protein level during this transition remain unclear. Here  we conducted protein profiling throughout zebrafish embryogenesis using quantitative mass spectrometry  integrating transcriptomics and translatomics datasets. Our data shows that unlike RNA changes  protein changes are less dynamic. Further  increases in protein levels correlate with mRNA translation  whereas declines in protein levels do not  suggesting active protein degradation processes. Interestingly  proteins from pure zygotic genes are present at fertilization  challenging existing mRNA based gene classifications. As a proof of concept  we utilized CRISPR Cas13d to target znf281b mRNA  a gene whose protein significantly accumulates within the first two hpf  demonstrating its crucial role in development. Consequently  our protein profiling  coupled with CRISPR Cas13d  offers a new approach to unravel maternal mRNAs function during embryonic development. Overall design: Two biological replicate samples containing 50 zebrafish oocytes per stage were collected by pairing females in natural matings to ''purge'' mature eggs and used to establish an oogenesis time line. Fish were euthanized and ovaries harvested within 1\u201311 days post purging dpp. Stage I and II oocytes were collected at 1\u20132 dpp  stage III oocytes germinal vesicle in central position at 4\u20137 dpp  and stage IV oocytes germinal vesicle asymmetrically located at 8\u201310 dpp. Oocyte isolations were based on73  and conducted in isolation medium Leibovitz L 15 Sigma Aldrich #L5520 plus Collagenase I and II depending on the stages as follows. Stages I and II were isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130 and 3 mg/mL Collagenase II Gibco 17101015. Stage III was isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130. Stage IV was isolated by mechanical stripping with forceps and needle without xxx use of Collagenases. Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. Three biological replicate samples containing 20 dechorionated zebrafish embryos were snap frozen in TRIzol Invitrogen #15596026. Four time points of embryonic development were included: 1 cell stage 0 hpf  hpf  2 hpf  4 hpf  and 6 hpf. RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols.", null, "pubmed:39302832", null, "Zebrafish Oocyte  Stage II  rep1", "GSM8147867", null, "source name:Oocyte|tissue:Oocyte|developmental stage:Stage II|genotype:AB  TF and TLF|geo loc name:missing|collection date:missing", "Zebrafish Oocyte  Stage II  rep1", "Raw reads from zebrafish oocytes stages I IV and embryos 0   2   4   and 6 hpf were demultiplexed into FASTQ format allowing up to one mismatch using Illumina bcl convert 3.10.5. Reads were aligned to UCSC genome danRer11 with STAR aligner version 2.7.3a  using Ensembl 106 gene models. Counts were converted to TPM values using RSEM version v1.3.0 and all subsequent analysis was done using TPM. Assembly: danRer11 Ensembl 106 gene models Supplementary files format and content: comma separated files with TPMs from all replicates", "Oocyte", null, "Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer\u2019s protocols. 0   2   4  and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer\u2019s protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0   2   4   and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA  as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer\u2019s directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598  and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled  quantified  and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing  Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA  as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer\u2019s instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina  Cat. No. 20020598  and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized  pooled  and sequenced on a NextSeq 500 instrument Illumina  as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing  Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.", null, "tissue:Oocyte|developmental stage:Stage II|genotype:AB  TF and TLF", "GSM8147867", "GSM8147867: Zebrafish Oocyte  Stage II  rep1; Danio rerio; RNA Seq", "GSM8147867 r1", "GSM8147867", "1", "Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. 0   2   4  and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0   2   4   and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA  as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer's directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598  and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled  quantified  and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing  Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA  as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer's instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina  Cat. No. 20020598  and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized  pooled  and sequenced on a NextSeq 500 instrument Illumina  as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing  Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP495323", null, null, "Z_oocyte_stage_2_1_Pa.fastq", "fastq", 3360126820.0, 44212195.0, "GSM8147867 r1", "0:76", "A:829333798;C:802089215;G:804982077;T:923557236;N:164494", 76, null, null, null, 829333798, 802089215, 804982077, 923557236, 164494, "SRX23954970", "SRS20755391", "SRA1824599", "Computational Biology, Stowers Institute for Medical Research", "Computational Biology, Stowers Institute for Medical Research", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2024-03-14", "Multi-stage", "Embryo", "Oocyte", "Reproductive System"], [30761, "SRR28348927", "SRX23954969", "SRS20755390", "SRP495323", "PRJNA1088158", "Protein profiling of zebrafish embryos unmasks regulatory layers during early embryogenesis.", "GSE261646", "Transcriptome Analysis", "The maternal to zygotic transition is crucial in embryonic development  marked by the degradation of maternally provided mRNAs and initiation of zygotic gene expression. However  the changes occurring at the protein level during this transition remain unclear. Here  we conducted protein profiling throughout zebrafish embryogenesis using quantitative mass spectrometry  integrating transcriptomics and translatomics datasets. Our data shows that unlike RNA changes  protein changes are less dynamic. Further  increases in protein levels correlate with mRNA translation  whereas declines in protein levels do not  suggesting active protein degradation processes. Interestingly  proteins from pure zygotic genes are present at fertilization  challenging existing mRNA based gene classifications. As a proof of concept  we utilized CRISPR Cas13d to target znf281b mRNA  a gene whose protein significantly accumulates within the first two hpf  demonstrating its crucial role in development. Consequently  our protein profiling  coupled with CRISPR Cas13d  offers a new approach to unravel maternal mRNAs function during embryonic development. Overall design: Two biological replicate samples containing 50 zebrafish oocytes per stage were collected by pairing females in natural matings to ''purge'' mature eggs and used to establish an oogenesis time line. Fish were euthanized and ovaries harvested within 1\u201311 days post purging dpp. Stage I and II oocytes were collected at 1\u20132 dpp  stage III oocytes germinal vesicle in central position at 4\u20137 dpp  and stage IV oocytes germinal vesicle asymmetrically located at 8\u201310 dpp. Oocyte isolations were based on73  and conducted in isolation medium Leibovitz L 15 Sigma Aldrich #L5520 plus Collagenase I and II depending on the stages as follows. Stages I and II were isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130 and 3 mg/mL Collagenase II Gibco 17101015. Stage III was isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130. Stage IV was isolated by mechanical stripping with forceps and needle without xxx use of Collagenases. Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. Three biological replicate samples containing 20 dechorionated zebrafish embryos were snap frozen in TRIzol Invitrogen #15596026. Four time points of embryonic development were included: 1 cell stage 0 hpf  hpf  2 hpf  4 hpf  and 6 hpf. RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols.", null, "pubmed:39302832", null, "Zebrafish Oocyte  Stage I  rep2", "GSM8147866", null, "source name:Oocyte|tissue:Oocyte|developmental stage:Stage I|genotype:AB  TF and TLF|geo loc name:missing|collection date:missing", "Zebrafish Oocyte  Stage I  rep2", "Raw reads from zebrafish oocytes stages I IV and embryos 0   2   4   and 6 hpf were demultiplexed into FASTQ format allowing up to one mismatch using Illumina bcl convert 3.10.5. Reads were aligned to UCSC genome danRer11 with STAR aligner version 2.7.3a  using Ensembl 106 gene models. Counts were converted to TPM values using RSEM version v1.3.0 and all subsequent analysis was done using TPM. Assembly: danRer11 Ensembl 106 gene models Supplementary files format and content: comma separated files with TPMs from all replicates", "Oocyte", null, "Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer\u2019s protocols. 0   2   4  and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer\u2019s protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0   2   4   and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA  as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer\u2019s directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598  and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled  quantified  and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing  Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA  as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer\u2019s instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina  Cat. No. 20020598  and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized  pooled  and sequenced on a NextSeq 500 instrument Illumina  as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing  Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.", null, "tissue:Oocyte|developmental stage:Stage I|genotype:AB  TF and TLF", "GSM8147866", "GSM8147866: Zebrafish Oocyte  Stage I  rep2; Danio rerio; RNA Seq", "GSM8147866 r1", "GSM8147866", "1", "Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. 0   2   4  and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0   2   4   and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA  as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer's directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598  and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled  quantified  and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing  Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA  as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer's instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina  Cat. No. 20020598  and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized  pooled  and sequenced on a NextSeq 500 instrument Illumina  as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing  Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP495323", null, null, "Z_oocyte_stage_1_2_Pa.fastq", "fastq", 2739674220.0, 36048345.0, "GSM8147866 r1", "0:76", "A:653441701;C:681445567;G:663740568;T:740918288;N:128096", 76, null, null, null, 653441701, 681445567, 663740568, 740918288, 128096, "SRX23954969", "SRS20755390", "SRA1824599", "Computational Biology, Stowers Institute for Medical Research", "Computational Biology, Stowers Institute for Medical Research", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2024-03-14", "Multi-stage", "Embryo", "Oocyte", "Reproductive System"], [30762, "SRR28348928", "SRX23954968", "SRS20755389", "SRP495323", "PRJNA1088158", "Protein profiling of zebrafish embryos unmasks regulatory layers during early embryogenesis.", "GSE261646", "Transcriptome Analysis", "The maternal to zygotic transition is crucial in embryonic development  marked by the degradation of maternally provided mRNAs and initiation of zygotic gene expression. However  the changes occurring at the protein level during this transition remain unclear. Here  we conducted protein profiling throughout zebrafish embryogenesis using quantitative mass spectrometry  integrating transcriptomics and translatomics datasets. Our data shows that unlike RNA changes  protein changes are less dynamic. Further  increases in protein levels correlate with mRNA translation  whereas declines in protein levels do not  suggesting active protein degradation processes. Interestingly  proteins from pure zygotic genes are present at fertilization  challenging existing mRNA based gene classifications. As a proof of concept  we utilized CRISPR Cas13d to target znf281b mRNA  a gene whose protein significantly accumulates within the first two hpf  demonstrating its crucial role in development. Consequently  our protein profiling  coupled with CRISPR Cas13d  offers a new approach to unravel maternal mRNAs function during embryonic development. Overall design: Two biological replicate samples containing 50 zebrafish oocytes per stage were collected by pairing females in natural matings to ''purge'' mature eggs and used to establish an oogenesis time line. Fish were euthanized and ovaries harvested within 1\u201311 days post purging dpp. Stage I and II oocytes were collected at 1\u20132 dpp  stage III oocytes germinal vesicle in central position at 4\u20137 dpp  and stage IV oocytes germinal vesicle asymmetrically located at 8\u201310 dpp. Oocyte isolations were based on73  and conducted in isolation medium Leibovitz L 15 Sigma Aldrich #L5520 plus Collagenase I and II depending on the stages as follows. Stages I and II were isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130 and 3 mg/mL Collagenase II Gibco 17101015. Stage III was isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130. Stage IV was isolated by mechanical stripping with forceps and needle without xxx use of Collagenases. Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. Three biological replicate samples containing 20 dechorionated zebrafish embryos were snap frozen in TRIzol Invitrogen #15596026. Four time points of embryonic development were included: 1 cell stage 0 hpf  hpf  2 hpf  4 hpf  and 6 hpf. RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols.", null, "pubmed:39302832", null, "Zebrafish Oocyte  Stage I  rep1", "GSM8147865", null, "source name:Oocyte|tissue:Oocyte|developmental stage:Stage I|genotype:AB  TF and TLF|geo loc name:missing|collection date:missing", "Zebrafish Oocyte  Stage I  rep1", "Raw reads from zebrafish oocytes stages I IV and embryos 0   2   4   and 6 hpf were demultiplexed into FASTQ format allowing up to one mismatch using Illumina bcl convert 3.10.5. Reads were aligned to UCSC genome danRer11 with STAR aligner version 2.7.3a  using Ensembl 106 gene models. Counts were converted to TPM values using RSEM version v1.3.0 and all subsequent analysis was done using TPM. Assembly: danRer11 Ensembl 106 gene models Supplementary files format and content: comma separated files with TPMs from all replicates", "Oocyte", null, "Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer\u2019s protocols. 0   2   4  and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer\u2019s protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0   2   4   and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA  as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer\u2019s directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598  and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled  quantified  and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing  Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA  as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer\u2019s instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina  Cat. No. 20020598  and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized  pooled  and sequenced on a NextSeq 500 instrument Illumina  as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing  Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.", null, "tissue:Oocyte|developmental stage:Stage I|genotype:AB  TF and TLF", "GSM8147865", "GSM8147865: Zebrafish Oocyte  Stage I  rep1; Danio rerio; RNA Seq", "GSM8147865 r1", "GSM8147865", "1", "Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. 0   2   4  and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0   2   4   and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA  as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer's directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598  and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled  quantified  and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing  Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA  as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer's instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina  Cat. No. 20020598  and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized  pooled  and sequenced on a NextSeq 500 instrument Illumina  as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing  Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP495323", null, null, "Z_oocyte_stage_1_1_Pa.fastq", "fastq", 3348831852.0, 44063577.0, "GSM8147865 r1", "0:76", "A:815134657;C:817210346;G:809175239;T:907149915;N:161695", 76, null, null, null, 815134657, 817210346, 809175239, 907149915, 161695, "SRX23954968", "SRS20755389", "SRA1824599", "Computational Biology, Stowers Institute for Medical Research", "Computational Biology, Stowers Institute for Medical Research", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2024-03-14", "Multi-stage", "Embryo", "Oocyte", "Reproductive System"], [36260, "SRR062657", "SRX025025", "SRS085804", "SRP003165", "PRJNA127881", "High throughput sequencing of mRNA from oocyte  1 cell  16/32 cells  128/256 cells  3.5hpf and 5.3hpf zebrafish embryos Wild type; AB line", "GSE22830", "Transcriptome Analysis", "mRNA seq based approach to determine the transcriptome dynamics during early development To study the mechanisms regulating this developmental event in zebrafish  we applied RNA deep sequencing technology and generated comprehensive transcriptome profiles of 6 developmental stages from oocyte to early gastrulation. We determined the expression levels of maternal and zygotic transcripts and clustered them based on expression pattern. We identified a large number of novel transcribed regions in un annotated regions of the genome  as well as splice variants with an estimated frequency of 40 75% during early zebrafish embryogenesis. Our data constitute a useful resource for developmental studies  gene discovery  and genome annotation. Overall design: RNA was extracted from pooled embryos of desired stages and one RNA seq library was generated for each sample.  Totally 6 stages were selected: Maternal  1cell  16/32 cells  128/256 cells  3.5hpf and 5.3hpf", null, "pubmed:21555364;pubmed:24586560;pubmed:23676078", null, "Maternal", "GSM564427", null, "tissue:Unfertilized egg|background:AB; wild type|developmental stage:unfertilized eggs", "Maternal", "ABI pipeline BioScope v1.0.1 Data analysis: The SOLiD generated RNA Seq reads was in 50bp length and an initial filtering process was taken to remove any non desirable contamination sequences  such as rRNA  tRNA  and repeats etc. A seed and extension mapping approach was developed to map the 50bp reads into reference genome zv7 and also into the respective zv7 refGene annotation separately. During mapping of the reads to the refGene annotation  a splice junction database fasta file is generated to which the reads are mapped to. This database contains known and putative junction sequences  created by taking 46bp from the joining ends of adjacent and non adjacent exons for each gene and putting them together  simulating the genomic sequences of known and putative junctions respectively. The first 25bp of the 50bp read was used as the seed for alignment for each read. When an alignment cannot be found using these 25bp seed  the seed window is shifted and the next 25bp seed is taken from the 21st to the 45th base of the read. An extension step follows when the seed is able to map  and a score generated for each extended base to determine best alignment. A merging step is performed on the genome mapping and splice junction mapping to determine a set of alignments for each read  from which a unique alignment is found based on the score generated for these alignments. Mapping parameters:\u00a0 Mapping was done using Applied Biosystems\u2019 SOLiD BioScope alignment for whole transcriptome analysis pipeline.\u00a0 Two mismatches were allowed in the 25bp color space seed sequence with extension alignment performed to find the full mapping location.\u00a0 A score is computed for each mapping location and any location that scored <22 were filtered. Generation of gff and bedgraph files: GFF files were produced by parsing the output BAM format and extracted for unique alignments with score >22. The bedgraph files are then produced with the resulting gff file.", "Unfertilized egg", "Embryos were frozen at the desired developmental stages and RNAs was extracted for sequencing.", "mRNA seq was performed by Mission Biotech Taiwan. SOLiD sequencing libraries were prepared using the Whole Transcriptome Library Preparation for SOLiD\u2122 Sequencing kit ABI according to manufacturer\u2019s instructions. About 200 280 \u00b5g of total RNAs were used as starting materials  which were subjected to polyA selection using Applied Biosystems PolyA Purist Kit AM1916  fragmentation  and library construction using distinct adapters for each library SOLiD Barcoding. From each library  equal volumes were pooled together and sequenced in SOLiD3 ABI platform generating 50bp tags.", "Zebrafish embryos AB background collected just post fertilization  were reared and harvested at  desired time points.   Unfertilized oocytes were collected by squeezing the abdomen of spawning females. Harvested embryos were snap frozen in liquid nitrogen and stored in \u221280\u00b0C. Total RNA was extracted from whole embryos using Trizol Invitrogen according to manufacturer\u2019s instructions. RNA concentrations were determined using NanoDrop 2000 Thermo Scientific. Integrity of RNA samples were determined using Agilent RNA 6000 Nano chip and size separated using Agilent 2100 Bioanalyzer. Total RNA obtained per 100 embryos at each developmental stage was calculated for data normalization purposes.", "background:AB; wild type|developmental stage:unfertilized eggs", "GSM564427", "GSM564427: Maternal", "GSM564427: Maternal", "GSM564427: Maternal", "1", null, "GEO Accession:GSM564427", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ABI_SOLID", "AB SOLiD System 3.0", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP003165", null, null, null, null, 1566199300.0, 31323986.0, "GSM564427 1", "0:50", null, 50, null, null, null, null, null, null, null, null, "SRX025025", "SRS085804", "SRA022850", "GEO", "Computational and Systems Biology, Genome Institute of Singapore", 1, 0.72688, null, 0.05657, null, 0.876, null, 0.51223, null, 50, null, "B", null, "usable mapping rate", "legacy", "early", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Singapore", "2010-07-08", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [36424, "SRR516545", "SRX156307", "SRS347187", "SRP013950", "PRJNA169500", "Danio rerio embryonic promoterome", "PRJNA169500", "Transcriptome Analysis", "Goal of this study is to generate genome wide maps of transcription initiation throughout early embryonic development of zebrafish Danio rerio. Cap analysis of gene expression CAGE is used to detect transcription start sites at 1bp resolution. CAGE data is complemented by ChIPseq datasets for promoter associated histone modifications to study dynamic changes of promoter usage and chromatin configuration throughout early embryonic development.", null, "pubmed:24531765", "Zebrafish wild type AB strain   unfertilized egg", "D. rerio unfertilized egg", "D. rerio unfertilized egg", null, null, null, null, null, null, null, null, null, null, "CAGE   D. rerio unfertilized egg", "CAGE   D. rerio unfertilized egg run2", "D. rerio unfertilized egg", "1", null, null, "OTHER", "TRANSCRIPTOMIC", "CAGE", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer IIx", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP013950", null, null, null, null, 115273233.0, 4269379.0, "CAGE   D. rerio unfertilized egg run1", "0:27", "A:29909511;C:24823784;G:32519899;T:28020039;N:0", 27, null, null, null, 29909511, 24823784, 32519899, 28020039, 0, "SRX156307", "SRS347187", "SRA055273", "University of Bergen", "ZEPROME consortium", 1, 0.49872, null, 0.07655, null, 0.81673, null, 0.80445, null, 27, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "cage", "unknown", "bulk", "unknown", "unknown", null, "Unknown", "2012-06-28", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [36425, "SRR516546", "SRX156307", "SRS347187", "SRP013950", "PRJNA169500", "Danio rerio embryonic promoterome", "PRJNA169500", "Transcriptome Analysis", "Goal of this study is to generate genome wide maps of transcription initiation throughout early embryonic development of zebrafish Danio rerio. Cap analysis of gene expression CAGE is used to detect transcription start sites at 1bp resolution. CAGE data is complemented by ChIPseq datasets for promoter associated histone modifications to study dynamic changes of promoter usage and chromatin configuration throughout early embryonic development.", null, "pubmed:24531765", "Zebrafish wild type AB strain   unfertilized egg", "D. rerio unfertilized egg", "D. rerio unfertilized egg", null, null, null, null, null, null, null, null, null, null, "CAGE   D. rerio unfertilized egg", "CAGE   D. rerio unfertilized egg run2", "D. rerio unfertilized egg", "1", null, null, "OTHER", "TRANSCRIPTOMIC", "CAGE", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer IIx", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP013950", null, null, null, null, 112673943.0, 4173109.0, "CAGE   D. rerio unfertilized egg run2", "0:27", "A:28315221;C:24199098;G:32599482;T:27560142;N:0", 27, null, null, null, 28315221, 24199098, 32599482, 27560142, 0, "SRX156307", "SRS347187", "SRA055273", "University of Bergen", "ZEPROME consortium", 1, 0.46201, null, 0.06422, null, 0.82118, null, 0.82184, null, 27, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "cage", "unknown", "bulk", "unknown", "unknown", null, "Unknown", "2012-06-28", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [38256, "SRR1596061", "SRX719267", "SRS715451", "SRP048591", "PRJNA262865", "Identification and Characterization of MicroRNAs in Zebrafish Spermatozoa by Illumina Sequencing", "GSE61984", "Other", "MicroRNAs miRNAs are involved in nearly every biological process examined to date. Mounting evidence show that some spermatozoa specific miRNAs play important roles in the regulation of spermatogenesis and germ cells development  but little is known of the exact identity and function of miRNA in sperm cells or their potential involvement in spermatogenesis and germ cells development. Here  we investigated the spermatozoa miRNA profiles using illumina deep sequencing combined with bioinformatic analysis using zebrafish as a model system. Deep sequencing of small RNAs yielded 12 million raw reads from zebrafish spermatozoa. Analysis showed that the noncoding RNA of the spermatozoa included tRNA  rRNA  snRNA  snoRNA and miRNA. By mapping to the zebrafish genome  we identified 400 novel and 204 conserved miRNAs which could be grouped into 104 families  including zebrafish specific families  such as mir 731  mir 724  mir 725  mir 729 and mir 2185. We report the first characterization of the miRNAs profiling in zebrafish spermatozoa. The obtained spermatozoa miRNAs profiling will serve as valuable resources to systematically study spermatogenesis in fish and vertebrate. Overall design: Examination of small RNA populations in zebrafish spermatozoa", null, "pubmed:26418264", null, "zebrafish sperm", "GSM1517943", null, "tissue:Zebrafish Spermatozoa|cell type:Spermatozoa|strain:AB wild type", "zebrafish sperm", "The sequencing data were analyzed as described previously by Xu et al 2014. The low quality reads were filtered to remove reads without xxx 3\u2019 adaptor  5\u2019 adaptor contaminant reads  reads without xxx insert fragment  reads containing polyA stretches  and reads of less than 18 nt. Next  the remaining sequences clean reads were mapped to the zebrafish genome using SOAP with a tolerance of one mismatch to analyze their distribution The sequences were aligned against known miRNA precursors and mature miRNAs deposited in the miRBase 20.0 to identify conserved miRNAs. The clean reads were compared against the sRNAs rRNAs  tRNAs  snRNAs  snoRNA  miRNA deposited in the GenBank and Rfam http://www.sanger.ac.uk/resources/databases/rfam.html databases to annotate the sRNA sequences. Because some sRNA tags might map to more than one category we used priority rules to ensure that every unique sRNA was mapped to only one annotation as follows: rRNA etc. GenBank >Rfam >known miRNA >repeat >exon >intron. Genome build: miRBase 20.0 Supplementary files format and content: zebrafish miRNA count.txt include RPKM values of each known miRNA in this sample", "Zebrafish Spermatozoa", null, "Total RNA was isolated from sample using Trizol reagent Invitrogen  USA in accordance with the manufacturer\u2019s protocol. RNA integrity was confirmed using the 2100 Bioanalyzer Agilent Technologies. RNA samples that passed the quality check were sent to BGI Shenzhen  China for sRNA library construction and Solexa sequencing using standard protocols on the Illumina Hiseq 2000 platform.", null, "cell type:Spermatozoa|strain:AB wild type", "GSM1517943", "GSM1517943: zebrafish sperm; Danio rerio; miRNA Seq", "GSM1517943", null, "1", "Total RNA was isolated from sample using Trizol reagent Invitrogen  USA in accordance with the manufacturer\u2019s protocol. RNA integrity was confirmed using the 2100 Bioanalyzer Agilent Technologies. RNA samples that passed the quality check were sent to BGI Shenzhen  China for sRNA library construction and Solexa sequencing using standard protocols on the Illumina Hiseq 2000 platform.", "GEO Accession:GSM1517943", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP048591", null, null, "zebrafish-sperm5.fq.bz2", "fastq", 588000000.0, 12000000.0, "GSM1517943 r1", "0:49", "A:122673394;C:136175879;G:140377184;T:188702650;N:70893", 49, null, null, null, 122673394, 136175879, 140377184, 188702650, 70893, "SRX719267", "SRS715451", "SRA188511", "GEO", "SUN YAT-SEN UNIVERSITY", 1, 2e-05, null, 0.0, null, 0.99997, null, 1.0, null, 49, null, "T", null, "under 1.2% mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "China", "2014-10-02", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [40701, "SRR3231363", "SRX1637111", "SRS1342926", "SRP071849", "PRJNA315400", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [RIP Seq]", "GSE79161", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: RNA was extracted from ovary tissue or from RIP experiments by Trizol extraction.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "Input 3", "GSM2087141", null, "tissue:Zebrafish Zygotes|fraction:Input", "Input 3", "Reads were mapped to Zv9 using tophat trapnell et al  2009to the ENSEMBLE gene build and further processing of the read counts was performed using Deseq Anders et al  2009 Genome build: zv9 Supplementary files format and content: The mRNA counts.csv contains the DESeq normalized read counts per Ensemble gene as indicated. Headers indicate the sample name.", "Zebrafish Zygotes", null, "mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing.", "Zebrafish were maintained under standard conditions.", "fraction:Input", "GSM2087141", "GSM2087141: Input 3; Danio rerio; RIP Seq", "GSM2087141", null, "1", "mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing.", "GEO Accession:GSM2087141", "RIP-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP071849", null, null, "WT_Input_3.fastq.gz", "fastq", 1902296226.0, 37299926.0, "GSM2087141 r1", "0:51", "A:466290166;C:465344039;G:486942278;T:483240280;N:479463", 51, null, null, null, 466290166, 465344039, 486942278, 483240280, 479463, "SRX1637111", "SRS1342926", "SRA385813", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.85793, null, 0.14814, null, 0.79941, null, 0.55214, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2016-03-13", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [40702, "SRR3231362", "SRX1637110", "SRS1342927", "SRP071849", "PRJNA315400", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [RIP Seq]", "GSE79161", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: RNA was extracted from ovary tissue or from RIP experiments by Trizol extraction.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "Input 2", "GSM2087140", null, "tissue:Zebrafish Zygotes|fraction:Input", "Input 2", "Reads were mapped to Zv9 using tophat trapnell et al  2009to the ENSEMBLE gene build and further processing of the read counts was performed using Deseq Anders et al  2009 Genome build: zv9 Supplementary files format and content: The mRNA counts.csv contains the DESeq normalized read counts per Ensemble gene as indicated. Headers indicate the sample name.", "Zebrafish Zygotes", null, "mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing.", "Zebrafish were maintained under standard conditions.", "fraction:Input", "GSM2087140", "GSM2087140: Input 2; Danio rerio; RIP Seq", "GSM2087140", null, "1", "mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing.", "GEO Accession:GSM2087140", "RIP-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP071849", null, null, "WT_Input_2.fastq.gz", "fastq", 1540737999.0, 30210549.0, "GSM2087140 r1", "0:51", "A:380481772;C:379741192;G:395453141;T:384675313;N:386581", 51, null, null, null, 380481772, 379741192, 395453141, 384675313, 386581, "SRX1637110", "SRS1342927", "SRA385813", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.8787, null, 0.14935, null, 0.79202, null, 0.54381, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2016-03-13", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [40703, "SRR3231361", "SRX1637109", "SRS1342928", "SRP071849", "PRJNA315400", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [RIP Seq]", "GSE79161", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: RNA was extracted from ovary tissue or from RIP experiments by Trizol extraction.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "Input 1", "GSM2087139", null, "tissue:Zebrafish Zygotes|fraction:Input", "Input 1", "Reads were mapped to Zv9 using tophat trapnell et al  2009to the ENSEMBLE gene build and further processing of the read counts was performed using Deseq Anders et al  2009 Genome build: zv9 Supplementary files format and content: The mRNA counts.csv contains the DESeq normalized read counts per Ensemble gene as indicated. Headers indicate the sample name.", "Zebrafish Zygotes", null, "mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing.", "Zebrafish were maintained under standard conditions.", "fraction:Input", "GSM2087139", "GSM2087139: Input 1; Danio rerio; RIP Seq", "GSM2087139", null, "1", "mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing.", "GEO Accession:GSM2087139", "RIP-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP071849", null, null, "WT_Input_1.fastq.gz", "fastq", 1109818905.0, 21761155.0, "GSM2087139 r1", null, null, null, null, null, null, null, null, null, null, null, "SRX1637109", "SRS1342928", "SRA385813", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.87467, null, 0.18794, null, 0.79411, null, 0.63378, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2016-03-13", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [40704, "SRR3231360", "SRX1637108", "SRS1342929", "SRP071849", "PRJNA315400", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [RIP Seq]", "GSE79161", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: RNA was extracted from ovary tissue or from RIP experiments by Trizol extraction.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "Tdrd6a IP 3", "GSM2087138", null, "tissue:Zebrafish Zygotes|fraction:Tdrd6a IP", "Tdrd6a IP 3", "Reads were mapped to Zv9 using tophat trapnell et al  2009to the ENSEMBLE gene build and further processing of the read counts was performed using Deseq Anders et al  2009 Genome build: zv9 Supplementary files format and content: The mRNA counts.csv contains the DESeq normalized read counts per Ensemble gene as indicated. Headers indicate the sample name.", "Zebrafish Zygotes", null, "mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing.", "Zebrafish were maintained under standard conditions.", "fraction:Tdrd6a IP", "GSM2087138", "GSM2087138: Tdrd6a IP 3; Danio rerio; RIP Seq", "GSM2087138", null, "1", "mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing.", "GEO Accession:GSM2087138", "RIP-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP071849", null, null, "WT_Tdrd6a_IP_3.fastq.gz", "fastq", 843641439.0, 16541989.0, "GSM2087138 r1", "0:51", "A:216465581;C:196892096;G:207722567;T:222361382;N:199813", 51, null, null, null, 216465581, 196892096, 207722567, 222361382, 199813, "SRX1637108", "SRS1342929", "SRA385813", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.84615, null, 0.08957, null, 0.78768, null, 0.50612, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2016-03-13", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [40705, "SRR3231359", "SRX1637107", "SRS1342930", "SRP071849", "PRJNA315400", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [RIP Seq]", "GSE79161", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: RNA was extracted from ovary tissue or from RIP experiments by Trizol extraction.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "Tdrd6a IP 2", "GSM2087137", null, "tissue:Zebrafish Zygotes|fraction:Tdrd6a IP", "Tdrd6a IP 2", "Reads were mapped to Zv9 using tophat trapnell et al  2009to the ENSEMBLE gene build and further processing of the read counts was performed using Deseq Anders et al  2009 Genome build: zv9 Supplementary files format and content: The mRNA counts.csv contains the DESeq normalized read counts per Ensemble gene as indicated. Headers indicate the sample name.", "Zebrafish Zygotes", null, "mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing.", "Zebrafish were maintained under standard conditions.", "fraction:Tdrd6a IP", "GSM2087137", "GSM2087137: Tdrd6a IP 2; Danio rerio; RIP Seq", "GSM2087137", null, "1", "mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing.", "GEO Accession:GSM2087137", "RIP-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP071849", null, null, "WT_Tdrd6a_IP_2.fastq.gz", "fastq", 391198050.0, 7670550.0, "GSM2087137 r1", "0:51", "A:99015594;C:91525929;G:97155710;T:103371571;N:129246", 51, null, null, null, 99015594, 91525929, 97155710, 103371571, 129246, "SRX1637107", "SRS1342930", "SRA385813", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.85778, null, 0.12015, null, 0.80515, null, 0.47541, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2016-03-13", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [40706, "SRR3231358", "SRX1637106", "SRS1342931", "SRP071849", "PRJNA315400", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [RIP Seq]", "GSE79161", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: RNA was extracted from ovary tissue or from RIP experiments by Trizol extraction.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "Tdrd6a IP 1", "GSM2087136", null, "tissue:Zebrafish Zygotes|fraction:Tdrd6a IP", "Tdrd6a IP 1", "Reads were mapped to Zv9 using tophat trapnell et al  2009to the ENSEMBLE gene build and further processing of the read counts was performed using Deseq Anders et al  2009 Genome build: zv9 Supplementary files format and content: The mRNA counts.csv contains the DESeq normalized read counts per Ensemble gene as indicated. Headers indicate the sample name.", "Zebrafish Zygotes", null, "mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing.", "Zebrafish were maintained under standard conditions.", "fraction:Tdrd6a IP", "GSM2087136", "GSM2087136: Tdrd6a IP 1; Danio rerio; RIP Seq", "GSM2087136", null, "1", "mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing.", "GEO Accession:GSM2087136", "RIP-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP071849", null, null, "WT_Tdrd6a_IP_1.fastq.gz", "fastq", 1927415052.0, 37792452.0, "GSM2087136 r1", "0:51", "A:498125298;C:444860381;G:468826607;T:515142356;N:460410", 51, null, null, null, 498125298, 444860381, 468826607, 515142356, 460410, "SRX1637106", "SRS1342931", "SRA385813", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.86194, null, 0.09753, null, 0.80146, null, 0.47808, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2016-03-13", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [40962, "SRR3470786", "SRX1738401", "SRS1418771", "SRP074244", "PRJNA320266", "Dietary intake influences fertility and offspring development in zebrafish.", "GSE81007", "Transcriptome Analysis", "We report that increased nutrient availability increases breeding success and egg production. RNA seq analysis revealed that parental diet altered the expression of metabolic genes in the unfertilized eggs. Offspring from the differentially fed parents showed altered survival and energy expenditure as adults. Overall design: RNA from unfertilized eggs post two parental diets.", null, "pubmed:27870856", null, "60mg arm 3", "GSM2140605", null, "source name:Unfertilized eggs|strain:In house AB/Pet shop|tissue:Unfertilized eggs|FISH age:9 mpf|treatment arm:60 mg", "60mg arm 3", "Sequence reads were filtered for quality using trimgalore. Reads were then mapped to the zebrafish genome using tophat v2.0.9  then assembled and merged with cufflinks v2.2.0 and cuffmerge  respectively. Differentially expressed transcripts were determined using cuffdiff v2.2.0. Gene ontology was assessed using BinGO 3.0.3  a plugin for cytoscape v3.3.0. Genome build: Zv9", "Unfertilized eggs", "Zebrafish were fed either 5 mg or 60 mg Artemia each day for eight weeks.", "The eggs were transferred to tube containing RA1 buffer Macherey Nagel  cat. 740955.250 with b mercaptoethanol  and stored at  80 \u00b0C until RNA extraction. The RNA was filtered with the NucleoSpin RNA kit Macherey Nagel  cat. 740955.250 and bound and eluted with columns 17   23 000 nt size range from the RNA clean and concentrator kit Zymo cat. no. R1017. RNA libraries were prepared for sequencing using standard Illumina protocols", "Zebrafish were maintained under standard conditions", "strain:In house AB/Pet shop|tissue:Unfertilized eggs|FISH age:9 mpf|treatment arm:60 mg", "GSM2140605", "GSM2140605: 60mg arm 3; Danio rerio; RNA Seq", "GSM2140605", null, "1", "The eggs were transferred to tube containing RA1 buffer Macherey Nagel  cat. 740955.250 with b mercaptoethanol  and stored at  80 \u00b0C until RNA extraction. The RNA was filtered with the NucleoSpin RNA kit Macherey Nagel  cat. 740955.250 and bound and eluted with columns 17   23 000 nt size range from the RNA clean and concentrator kit Zymo cat. no. R1017. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM2140605", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP074244", null, null, "60mg-arm-3.fastq.gz", "fastq", 2353067800.0, 23530678.0, "GSM2140605 r1", "0:100", "A:550921675;C:559384489;G:553530174;T:689218350;N:13112", 100, null, null, null, 550921675, 559384489, 553530174, 689218350, 13112, "SRX1738401", "SRS1418771", "SRA422860", "GEO", "Chromosome Structure and Development Group, Department of Pathology, University of Otago", 1, 0.95538, null, 0.04454, null, 0.7512, null, 0.62731, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "New Zealand", "2016-05-02", "Multi-stage", "Multi-stage", "Oocyte", "Reproductive System"], [40963, "SRR3470785", "SRX1738399", "SRS1418770", "SRP074244", "PRJNA320266", "Dietary intake influences fertility and offspring development in zebrafish.", "GSE81007", "Transcriptome Analysis", "We report that increased nutrient availability increases breeding success and egg production. RNA seq analysis revealed that parental diet altered the expression of metabolic genes in the unfertilized eggs. Offspring from the differentially fed parents showed altered survival and energy expenditure as adults. Overall design: RNA from unfertilized eggs post two parental diets.", null, "pubmed:27870856", null, "60mg arm 2", "GSM2140604", null, "source name:Unfertilized eggs|strain:In house AB/Pet shop|tissue:Unfertilized eggs|FISH age:9 mpf|treatment arm:60 mg", "60mg arm 2", "Sequence reads were filtered for quality using trimgalore. Reads were then mapped to the zebrafish genome using tophat v2.0.9  then assembled and merged with cufflinks v2.2.0 and cuffmerge  respectively. Differentially expressed transcripts were determined using cuffdiff v2.2.0. Gene ontology was assessed using BinGO 3.0.3  a plugin for cytoscape v3.3.0. Genome build: Zv9", "Unfertilized eggs", "Zebrafish were fed either 5 mg or 60 mg Artemia each day for eight weeks.", "The eggs were transferred to tube containing RA1 buffer Macherey Nagel  cat. 740955.250 with b mercaptoethanol  and stored at  80 \u00b0C until RNA extraction. The RNA was filtered with the NucleoSpin RNA kit Macherey Nagel  cat. 740955.250 and bound and eluted with columns 17   23 000 nt size range from the RNA clean and concentrator kit Zymo cat. no. R1017. RNA libraries were prepared for sequencing using standard Illumina protocols", "Zebrafish were maintained under standard conditions", "strain:In house AB/Pet shop|tissue:Unfertilized eggs|FISH age:9 mpf|treatment arm:60 mg", "GSM2140604", "GSM2140604: 60mg arm 2; Danio rerio; RNA Seq", "GSM2140604", null, "1", "The eggs were transferred to tube containing RA1 buffer Macherey Nagel  cat. 740955.250 with b mercaptoethanol  and stored at  80 \u00b0C until RNA extraction. The RNA was filtered with the NucleoSpin RNA kit Macherey Nagel  cat. 740955.250 and bound and eluted with columns 17   23 000 nt size range from the RNA clean and concentrator kit Zymo cat. no. R1017. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM2140604", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP074244", null, null, "60mg-arm-2.fastq.gz", "fastq", 2552419200.0, 25524192.0, "GSM2140604 r1", "0:100", "A:598028827;C:604381782;G:600136410;T:749858137;N:14044", 100, null, null, null, 598028827, 604381782, 600136410, 749858137, 14044, "SRX1738399", "SRS1418770", "SRA422860", "GEO", "Chromosome Structure and Development Group, Department of Pathology, University of Otago", 1, 0.95953, null, 0.04033, null, 0.75408, null, 0.63549, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "New Zealand", "2016-05-02", "Multi-stage", "Multi-stage", "Oocyte", "Reproductive System"], [40964, "SRR3470784", "SRX1738397", "SRS1418769", "SRP074244", "PRJNA320266", "Dietary intake influences fertility and offspring development in zebrafish.", "GSE81007", "Transcriptome Analysis", "We report that increased nutrient availability increases breeding success and egg production. RNA seq analysis revealed that parental diet altered the expression of metabolic genes in the unfertilized eggs. Offspring from the differentially fed parents showed altered survival and energy expenditure as adults. Overall design: RNA from unfertilized eggs post two parental diets.", null, "pubmed:27870856", null, "60mg arm 1", "GSM2140603", null, "source name:Unfertilized eggs|strain:In house AB/Pet shop|tissue:Unfertilized eggs|FISH age:9 mpf|treatment arm:60 mg", "60mg arm 1", "Sequence reads were filtered for quality using trimgalore. Reads were then mapped to the zebrafish genome using tophat v2.0.9  then assembled and merged with cufflinks v2.2.0 and cuffmerge  respectively. Differentially expressed transcripts were determined using cuffdiff v2.2.0. Gene ontology was assessed using BinGO 3.0.3  a plugin for cytoscape v3.3.0. Genome build: Zv9", "Unfertilized eggs", "Zebrafish were fed either 5 mg or 60 mg Artemia each day for eight weeks.", "The eggs were transferred to tube containing RA1 buffer Macherey Nagel  cat. 740955.250 with b mercaptoethanol  and stored at  80 \u00b0C until RNA extraction. The RNA was filtered with the NucleoSpin RNA kit Macherey Nagel  cat. 740955.250 and bound and eluted with columns 17   23 000 nt size range from the RNA clean and concentrator kit Zymo cat. no. R1017. RNA libraries were prepared for sequencing using standard Illumina protocols", "Zebrafish were maintained under standard conditions", "strain:In house AB/Pet shop|tissue:Unfertilized eggs|FISH age:9 mpf|treatment arm:60 mg", "GSM2140603", "GSM2140603: 60mg arm 1; Danio rerio; RNA Seq", "GSM2140603", null, "1", "The eggs were transferred to tube containing RA1 buffer Macherey Nagel  cat. 740955.250 with b mercaptoethanol  and stored at  80 \u00b0C until RNA extraction. The RNA was filtered with the NucleoSpin RNA kit Macherey Nagel  cat. 740955.250 and bound and eluted with columns 17   23 000 nt size range from the RNA clean and concentrator kit Zymo cat. no. R1017. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM2140603", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP074244", null, null, "60mg-arm-1.fastq.gz", "fastq", 2471843300.0, 24718433.0, "GSM2140603 r1", "0:100", "A:578536744;C:593318438;G:586674975;T:713299111;N:14032", 100, null, null, null, 578536744, 593318438, 586674975, 713299111, 14032, "SRX1738397", "SRS1418769", "SRA422860", "GEO", "Chromosome Structure and Development Group, Department of Pathology, University of Otago", 1, 0.95474, null, 0.04276, null, 0.75625, null, 0.61194, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "New Zealand", "2016-05-02", "Multi-stage", "Multi-stage", "Oocyte", "Reproductive System"], [40965, "SRR3470783", "SRX1738395", "SRS1418767", "SRP074244", "PRJNA320266", "Dietary intake influences fertility and offspring development in zebrafish.", "GSE81007", "Transcriptome Analysis", "We report that increased nutrient availability increases breeding success and egg production. RNA seq analysis revealed that parental diet altered the expression of metabolic genes in the unfertilized eggs. Offspring from the differentially fed parents showed altered survival and energy expenditure as adults. Overall design: RNA from unfertilized eggs post two parental diets.", null, "pubmed:27870856", null, "5mg arm 3", "GSM2140602", null, "source name:Unfertilized eggs|strain:In house AB/Pet shop|tissue:Unfertilized eggs|FISH age:9 mpf|treatment arm:5 mg", "5mg arm 3", "Sequence reads were filtered for quality using trimgalore. Reads were then mapped to the zebrafish genome using tophat v2.0.9  then assembled and merged with cufflinks v2.2.0 and cuffmerge  respectively. Differentially expressed transcripts were determined using cuffdiff v2.2.0. Gene ontology was assessed using BinGO 3.0.3  a plugin for cytoscape v3.3.0. Genome build: Zv9", "Unfertilized eggs", "Zebrafish were fed either 5 mg or 60 mg Artemia each day for eight weeks.", "The eggs were transferred to tube containing RA1 buffer Macherey Nagel  cat. 740955.250 with b mercaptoethanol  and stored at  80 \u00b0C until RNA extraction. The RNA was filtered with the NucleoSpin RNA kit Macherey Nagel  cat. 740955.250 and bound and eluted with columns 17   23 000 nt size range from the RNA clean and concentrator kit Zymo cat. no. R1017. RNA libraries were prepared for sequencing using standard Illumina protocols", "Zebrafish were maintained under standard conditions", "strain:In house AB/Pet shop|tissue:Unfertilized eggs|FISH age:9 mpf|treatment arm:5 mg", "GSM2140602", "GSM2140602: 5mg arm 3; Danio rerio; RNA Seq", "GSM2140602", null, "1", "The eggs were transferred to tube containing RA1 buffer Macherey Nagel  cat. 740955.250 with b mercaptoethanol  and stored at  80 \u00b0C until RNA extraction. The RNA was filtered with the NucleoSpin RNA kit Macherey Nagel  cat. 740955.250 and bound and eluted with columns 17   23 000 nt size range from the RNA clean and concentrator kit Zymo cat. no. R1017. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM2140602", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP074244", null, null, "5mg-arm-3.fastq.gz", "fastq", 2562336500.0, 25623365.0, "GSM2140602 r1", "0:100", "A:599122965;C:614407524;G:605967391;T:742824547;N:14073", 100, null, null, null, 599122965, 614407524, 605967391, 742824547, 14073, "SRX1738395", "SRS1418767", "SRA422860", "GEO", "Chromosome Structure and Development Group, Department of Pathology, University of Otago", 1, 0.95071, null, 0.0461, null, 0.74483, null, 0.61788, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "New Zealand", "2016-05-02", "Multi-stage", "Multi-stage", "Oocyte", "Reproductive System"], [40966, "SRR3470782", "SRX1738393", "SRS1418765", "SRP074244", "PRJNA320266", "Dietary intake influences fertility and offspring development in zebrafish.", "GSE81007", "Transcriptome Analysis", "We report that increased nutrient availability increases breeding success and egg production. RNA seq analysis revealed that parental diet altered the expression of metabolic genes in the unfertilized eggs. Offspring from the differentially fed parents showed altered survival and energy expenditure as adults. Overall design: RNA from unfertilized eggs post two parental diets.", null, "pubmed:27870856", null, "5mg arm 2", "GSM2140601", null, "source name:Unfertilized eggs|strain:In house AB/Pet shop|tissue:Unfertilized eggs|FISH age:9 mpf|treatment arm:5 mg", "5mg arm 2", "Sequence reads were filtered for quality using trimgalore. Reads were then mapped to the zebrafish genome using tophat v2.0.9  then assembled and merged with cufflinks v2.2.0 and cuffmerge  respectively. Differentially expressed transcripts were determined using cuffdiff v2.2.0. Gene ontology was assessed using BinGO 3.0.3  a plugin for cytoscape v3.3.0. Genome build: Zv9", "Unfertilized eggs", "Zebrafish were fed either 5 mg or 60 mg Artemia each day for eight weeks.", "The eggs were transferred to tube containing RA1 buffer Macherey Nagel  cat. 740955.250 with b mercaptoethanol  and stored at  80 \u00b0C until RNA extraction. The RNA was filtered with the NucleoSpin RNA kit Macherey Nagel  cat. 740955.250 and bound and eluted with columns 17   23 000 nt size range from the RNA clean and concentrator kit Zymo cat. no. R1017. RNA libraries were prepared for sequencing using standard Illumina protocols", "Zebrafish were maintained under standard conditions", "strain:In house AB/Pet shop|tissue:Unfertilized eggs|FISH age:9 mpf|treatment arm:5 mg", "GSM2140601", "GSM2140601: 5mg arm 2; Danio rerio; RNA Seq", "GSM2140601", null, "1", "The eggs were transferred to tube containing RA1 buffer Macherey Nagel  cat. 740955.250 with b mercaptoethanol  and stored at  80 \u00b0C until RNA extraction. The RNA was filtered with the NucleoSpin RNA kit Macherey Nagel  cat. 740955.250 and bound and eluted with columns 17   23 000 nt size range from the RNA clean and concentrator kit Zymo cat. no. R1017. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM2140601", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP074244", null, null, "5mg-arm-2.fastq.gz", "fastq", 2841710700.0, 28417107.0, "GSM2140601 r1", "0:100", "A:663485391;C:679416584;G:665850494;T:832942768;N:15463", 100, null, null, null, 663485391, 679416584, 665850494, 832942768, 15463, "SRX1738393", "SRS1418765", "SRA422860", "GEO", "Chromosome Structure and Development Group, Department of Pathology, University of Otago", 1, 0.94998, null, 0.04837, null, 0.75442, null, 0.63571, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "New Zealand", "2016-05-02", "Multi-stage", "Multi-stage", "Oocyte", "Reproductive System"], [40967, "SRR3470781", "SRX1738391", "SRS1418764", "SRP074244", "PRJNA320266", "Dietary intake influences fertility and offspring development in zebrafish.", "GSE81007", "Transcriptome Analysis", "We report that increased nutrient availability increases breeding success and egg production. RNA seq analysis revealed that parental diet altered the expression of metabolic genes in the unfertilized eggs. Offspring from the differentially fed parents showed altered survival and energy expenditure as adults. Overall design: RNA from unfertilized eggs post two parental diets.", null, "pubmed:27870856", null, "5mg arm 1", "GSM2140600", null, "source name:Unfertilized eggs|strain:In house AB/Pet shop|tissue:Unfertilized eggs|FISH age:9 mpf|treatment arm:5 mg", "5mg arm 1", "Sequence reads were filtered for quality using trimgalore. Reads were then mapped to the zebrafish genome using tophat v2.0.9  then assembled and merged with cufflinks v2.2.0 and cuffmerge  respectively. Differentially expressed transcripts were determined using cuffdiff v2.2.0. Gene ontology was assessed using BinGO 3.0.3  a plugin for cytoscape v3.3.0. Genome build: Zv9", "Unfertilized eggs", "Zebrafish were fed either 5 mg or 60 mg Artemia each day for eight weeks.", "The eggs were transferred to tube containing RA1 buffer Macherey Nagel  cat. 740955.250 with b mercaptoethanol  and stored at  80 \u00b0C until RNA extraction. The RNA was filtered with the NucleoSpin RNA kit Macherey Nagel  cat. 740955.250 and bound and eluted with columns 17   23 000 nt size range from the RNA clean and concentrator kit Zymo cat. no. R1017. RNA libraries were prepared for sequencing using standard Illumina protocols", "Zebrafish were maintained under standard conditions", "strain:In house AB/Pet shop|tissue:Unfertilized eggs|FISH age:9 mpf|treatment arm:5 mg", "GSM2140600", "GSM2140600: 5mg arm 1; Danio rerio; RNA Seq", "GSM2140600", null, "1", "The eggs were transferred to tube containing RA1 buffer Macherey Nagel  cat. 740955.250 with b mercaptoethanol  and stored at  80 \u00b0C until RNA extraction. The RNA was filtered with the NucleoSpin RNA kit Macherey Nagel  cat. 740955.250 and bound and eluted with columns 17   23 000 nt size range from the RNA clean and concentrator kit Zymo cat. no. R1017. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM2140600", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP074244", null, null, "5mg-arm-1.fastq.gz", "fastq", 2409548800.0, 24095488.0, "GSM2140600 r1", "0:100", "A:519836883;C:638777587;G:641445656;T:609475335;N:13339", 100, null, null, null, 519836883, 638777587, 641445656, 609475335, 13339, "SRX1738391", "SRS1418764", "SRA422860", "GEO", "Chromosome Structure and Development Group, Department of Pathology, University of Otago", 1, 0.88003, null, 0.04264, null, 0.76138, null, 0.66721, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "New Zealand", "2016-05-02", "Multi-stage", "Multi-stage", "Oocyte", "Reproductive System"], [41847, "SRR5892569", "SRX3058262", "SRS2404198", "SRP100178", "PRJNA375788", "'Placeholder' nucleosomes underlie germline to embryo DNA methylation reprogramming [RNA Seq]", "GSE95031", "Transcriptome Analysis", "The function and retention/reprogramming of epigenetic marks during the germline to embryo transition is a key issue in developmental and cellular biology  with relevance to stem cell programming and trans generational inheritance.  In zebrafish  DNAme patterns are programmed in transcriptionally quiescent early cleavage embryos; paternally inherited patterns are maintained  whereas maternal patterns are reprogrammed to match the paternal pattern. Here we show that a 'placeholder' nucleosome  containing the histone H2A variant H2A.ZFV and H3K4me1  occupies virtually all regions lacking DNAme in both sperm and cleavage embryos \u2013 residing at promoters encoding housekeeping and early embryonic transcription factors.  Upon genome wide transcriptional onset  genes with the Placeholder become either active H3K4me3 marked or silent H3K4me3/K27me3 marked bivalent.  Importantly  functional perturbation causing Placeholder loss confers DNAme acquisition  whereas acquisition/expansion of Placeholder confers DNA hypomethylation and improper gene activation.  Thus  during transcriptionally quiescent stages gamete zygote cleavage  an H2A.ZFV/H3K4me1 containing Placeholder nucleosome deters DNAme  poising parental genes for either gene specific activation or facultative repression. Overall design: Transcript abundance was analyzed for zebrafish sperm  and cleavage stage embryos that were either wild type or mutant for the anp32e gene.", "parent bioproject:PRJNA375781", "pubmed:29456083", null, "Anp32e Null Sperm RNA Seq Rep2", "GSM2730572", null, "tissue:Sperm Stage|developmental stage:Sperm Stage|strain:NA|injection:NA|mutation:Anp32e Null", "Anp32e Null Sperm RNA Seq Rep2", "Reads were aligned to the Zv10 genome using Novoalign v2.8  Novocraft using the following options:  o SAM  r All 50 Sam files were then combined due to high correlation between technical and biological replicates. The Useq Pipeline was utilized   Sam parsed using the SAMTranscriptomeParser  followed by DefinedRegionDifferentialSeq which utilizes DeSeq2 to generate differential gene expression tables and FPKM values. Genome build: Zv10 Supplementary files format and content: RNASeq geneCount minimum10.xlsx: Excel file contains gene count table.", "Sperm Stage", null, "Embryos were lysed using Trizol with the addition of 2% SDS  then homogenized using a 20G needle. Sample were then phenol extracted and the aqueous phase was added to a Qiagen RNA miniElute column for final purification. Illumina TruSeq Stranded RNA kit with Rib Zero Gold", null, "developmental stage:Sperm Stage|strain:NA|injection:NA|mutation:Anp32e Null", "GSM2730572", "GSM2730572: Anp32e Null Sperm RNA Seq Rep2; Danio rerio; RNA Seq", "GSM2730572", null, "1", "Embryos were lysed using Trizol with the addition of 2% SDS  then homogenized using a 20G needle. Sample were then phenol extracted and the aqueous phase was added to a Qiagen RNA miniElute column for final purification. Illumina TruSeq Stranded RNA kit with Rib Zero Gold", "GEO Accession:GSM2730572", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP100178", null, null, "Anp32e_Null_Sperm_RNA-Seq_Rep2.fastq.gz", "fastq", 2612583700.0, 52251674.0, "GSM2730572 r1", "0:50", "A:643932236;C:630114587;G:625850241;T:712599561;N:87075", 50, null, null, null, 643932236, 630114587, 625850241, 712599561, 87075, "SRX3058262", "SRS2404198", "SRA538756", "GEO", "Huntsman Cancer Institute", 1, 0.91107, null, 0.05039, null, 0.76108, null, 0.4698, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2017-08-03", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [41848, "SRR5892568", "SRX3058261", "SRS2404197", "SRP100178", "PRJNA375788", "'Placeholder' nucleosomes underlie germline to embryo DNA methylation reprogramming [RNA Seq]", "GSE95031", "Transcriptome Analysis", "The function and retention/reprogramming of epigenetic marks during the germline to embryo transition is a key issue in developmental and cellular biology  with relevance to stem cell programming and trans generational inheritance.  In zebrafish  DNAme patterns are programmed in transcriptionally quiescent early cleavage embryos; paternally inherited patterns are maintained  whereas maternal patterns are reprogrammed to match the paternal pattern. Here we show that a 'placeholder' nucleosome  containing the histone H2A variant H2A.ZFV and H3K4me1  occupies virtually all regions lacking DNAme in both sperm and cleavage embryos \u2013 residing at promoters encoding housekeeping and early embryonic transcription factors.  Upon genome wide transcriptional onset  genes with the Placeholder become either active H3K4me3 marked or silent H3K4me3/K27me3 marked bivalent.  Importantly  functional perturbation causing Placeholder loss confers DNAme acquisition  whereas acquisition/expansion of Placeholder confers DNA hypomethylation and improper gene activation.  Thus  during transcriptionally quiescent stages gamete zygote cleavage  an H2A.ZFV/H3K4me1 containing Placeholder nucleosome deters DNAme  poising parental genes for either gene specific activation or facultative repression. Overall design: Transcript abundance was analyzed for zebrafish sperm  and cleavage stage embryos that were either wild type or mutant for the anp32e gene.", "parent bioproject:PRJNA375781", "pubmed:29456083", null, "Anp32e Null Sperm RNA Seq Rep1", "GSM2730571", null, "tissue:Sperm Stage|developmental stage:Sperm Stage|strain:NA|injection:NA|mutation:Anp32e Null", "Anp32e Null Sperm RNA Seq Rep1", "Reads were aligned to the Zv10 genome using Novoalign v2.8  Novocraft using the following options:  o SAM  r All 50 Sam files were then combined due to high correlation between technical and biological replicates. The Useq Pipeline was utilized   Sam parsed using the SAMTranscriptomeParser  followed by DefinedRegionDifferentialSeq which utilizes DeSeq2 to generate differential gene expression tables and FPKM values. Genome build: Zv10 Supplementary files format and content: RNASeq geneCount minimum10.xlsx: Excel file contains gene count table.", "Sperm Stage", null, "Embryos were lysed using Trizol with the addition of 2% SDS  then homogenized using a 20G needle. Sample were then phenol extracted and the aqueous phase was added to a Qiagen RNA miniElute column for final purification. Illumina TruSeq Stranded RNA kit with Rib Zero Gold", null, "developmental stage:Sperm Stage|strain:NA|injection:NA|mutation:Anp32e Null", "GSM2730571", "GSM2730571: Anp32e Null Sperm RNA Seq Rep1; Danio rerio; RNA Seq", "GSM2730571", null, "1", "Embryos were lysed using Trizol with the addition of 2% SDS  then homogenized using a 20G needle. Sample were then phenol extracted and the aqueous phase was added to a Qiagen RNA miniElute column for final purification. Illumina TruSeq Stranded RNA kit with Rib Zero Gold", "GEO Accession:GSM2730571", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP100178", null, null, "Anp32e_Null_Sperm_RNA-Seq_Rep1.fastq.gz", "fastq", 3162821050.0, 63256421.0, "GSM2730571 r1", "0:50", "A:756571256;C:759039692;G:777010061;T:870095540;N:104501", 50, null, null, null, 756571256, 759039692, 777010061, 870095540, 104501, "SRX3058261", "SRS2404197", "SRA538756", "GEO", "Huntsman Cancer Institute", 1, 0.91819, null, 0.04312, null, 0.76307, null, 0.45972, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2017-08-03", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [44644, "SRR6268204", "SRX3374372", "SRS2671596", "SRP124609", "PRJNA417597", "Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation", "GSE106677", "Other", "The stability of mRNAs is regulated by signals within their sequences  but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here  we introduce UTR Seq  a combination of massively parallel reporter assays and regression models  to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences  and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds  AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns  and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment  a sample was collected every hour between 1h to 8h  and at 10h. In the second experiment  a single sample was collected every hour between 1h to 10h  and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment  two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A  reporters in two separate experiments. In the first experiment  a sample was collected every hour between 1h to 8h  and at 10h. In the second experiment rep  samples were collected at 1h  2h  3h  4h 3 samples  6h  8h and 10h.", null, "pubmed:29225039", null, "oocyte A+ 7h", "GSM2845358", null, "source name:zebrafish oocyte|developmental stage:7h|tissue:oocyte", "oocyte A+ 7h", "Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5\u2019 terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg  lowest 3.125fg  and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels", "zebrafish oocyte", "Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage.", "Total RNA was isolated using TRIzol Invitrogen  post adding 120fg of mRNA with 5 known 3\u2019UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step  total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3\u2019UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step  resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3\u2019UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors", "Fertilized zebrafish eggs or oocytes were collected at 28C  and kept in culture medium 5.03mM NaCl  0.17mM KCl  0.33mM CaCl2  0.33mM MgSo4  0.1% Methylene blue.  A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage.", "developmental stage:7h|tissue:oocyte", "GSM2845358", "GSM2845358: oocyte A+ 7h; Danio rerio; OTHER", "GSM2845358", null, "1", "Total RNA was isolated using TRIzol Invitrogen  post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step  total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step  resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors", "GEO Accession:GSM2845358", "OTHER", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina MiSeq", null, "SRP124609", null, null, "AR22-SL21.fastq.gz", "fastq", 463495840.0, 2896849.0, "GSM2845358 r1", "0:160 1:0", "A:145685088;C:104925443;G:89232572;T:123650704;N:2033", 160, 0, null, null, 145685088, 104925443, 89232572, 123650704, 2033, "SRX3374372", "SRS2671596", "SRA629220", "GEO", "Broad Institute", 1, 4e-05, null, 1e-05, null, 0.99991, null, 0.5, null, 160, null, "T", null, "under 1.2% mapping rate", "illumina", "miseq", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "United States", "2017-11-08", "Gastrula", "Embryo", "Oocyte", "Reproductive System"], [44645, "SRR6268203", "SRX3374371", "SRS2671594", "SRP124609", "PRJNA417597", "Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation", "GSE106677", "Other", "The stability of mRNAs is regulated by signals within their sequences  but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here  we introduce UTR Seq  a combination of massively parallel reporter assays and regression models  to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences  and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds  AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns  and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment  a sample was collected every hour between 1h to 8h  and at 10h. In the second experiment  a single sample was collected every hour between 1h to 10h  and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment  two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A  reporters in two separate experiments. In the first experiment  a sample was collected every hour between 1h to 8h  and at 10h. In the second experiment rep  samples were collected at 1h  2h  3h  4h 3 samples  6h  8h and 10h.", null, "pubmed:29225039", null, "oocyte A+ 4h", "GSM2845357", null, "source name:zebrafish oocyte|developmental stage:4h|tissue:oocyte", "oocyte A+ 4h", "Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5\u2019 terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg  lowest 3.125fg  and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels", "zebrafish oocyte", "Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage.", "Total RNA was isolated using TRIzol Invitrogen  post adding 120fg of mRNA with 5 known 3\u2019UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step  total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3\u2019UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step  resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3\u2019UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors", "Fertilized zebrafish eggs or oocytes were collected at 28C  and kept in culture medium 5.03mM NaCl  0.17mM KCl  0.33mM CaCl2  0.33mM MgSo4  0.1% Methylene blue.  A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage.", "developmental stage:4h|tissue:oocyte", "GSM2845357", "GSM2845357: oocyte A+ 4h; Danio rerio; OTHER", "GSM2845357", null, "1", "Total RNA was isolated using TRIzol Invitrogen  post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step  total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step  resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors", "GEO Accession:GSM2845357", "OTHER", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina MiSeq", null, "SRP124609", null, null, "AR21-SL41.fastq.gz", "fastq", 474802240.0, 2967514.0, "GSM2845357 r1", "0:160 1:0", "A:145810423;C:111330144;G:93000312;T:124660574;N:787", 160, 0, null, null, 145810423, 111330144, 93000312, 124660574, 787, "SRX3374371", "SRS2671594", "SRA629220", "GEO", "Broad Institute", 1, 2e-05, null, 0.0, null, 0.99997, null, 0.0, null, 160, null, "T", null, "under 1.2% mapping rate", "illumina", "miseq", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "United States", "2017-11-08", "Blastula", "Embryo", "Oocyte", "Reproductive System"], [44646, "SRR6268202", "SRX3374370", "SRS2671595", "SRP124609", "PRJNA417597", "Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation", "GSE106677", "Other", "The stability of mRNAs is regulated by signals within their sequences  but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here  we introduce UTR Seq  a combination of massively parallel reporter assays and regression models  to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences  and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds  AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns  and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment  a sample was collected every hour between 1h to 8h  and at 10h. In the second experiment  a single sample was collected every hour between 1h to 10h  and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment  two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A  reporters in two separate experiments. In the first experiment  a sample was collected every hour between 1h to 8h  and at 10h. In the second experiment rep  samples were collected at 1h  2h  3h  4h 3 samples  6h  8h and 10h.", null, "pubmed:29225039", null, "oocyte A+ 1h", "GSM2845356", null, "source name:zebrafish oocyte|developmental stage:1h|tissue:oocyte", "oocyte A+ 1h", "Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5\u2019 terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg  lowest 3.125fg  and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels", "zebrafish oocyte", "Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage.", "Total RNA was isolated using TRIzol Invitrogen  post adding 120fg of mRNA with 5 known 3\u2019UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step  total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3\u2019UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step  resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3\u2019UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors", "Fertilized zebrafish eggs or oocytes were collected at 28C  and kept in culture medium 5.03mM NaCl  0.17mM KCl  0.33mM CaCl2  0.33mM MgSo4  0.1% Methylene blue.  A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage.", "developmental stage:1h|tissue:oocyte", "GSM2845356", "GSM2845356: oocyte A+ 1h; Danio rerio; OTHER", "GSM2845356", null, "1", "Total RNA was isolated using TRIzol Invitrogen  post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step  total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step  resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors", "GEO Accession:GSM2845356", "OTHER", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina MiSeq", null, "SRP124609", null, null, "AR20.fastq.gz", "fastq", 647004960.0, 4043781.0, "GSM2845356 r1", "0:160 1:0", "A:196358573;C:155899107;G:129095192;T:165649225;N:2863", 160, 0, null, null, 196358573, 155899107, 129095192, 165649225, 2863, "SRX3374370", "SRS2671595", "SRA629220", "GEO", "Broad Institute", 1, 1e-05, null, 0.0, null, 0.99997, null, 0.0, null, 160, null, "T", null, "under 1.2% mapping rate", "illumina", "miseq", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "United States", "2017-11-08", "Cleavage", "Embryo", "Oocyte", "Reproductive System"], [44647, "SRR6268201", "SRX3374369", "SRS2671601", "SRP124609", "PRJNA417597", "Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation", "GSE106677", "Other", "The stability of mRNAs is regulated by signals within their sequences  but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here  we introduce UTR Seq  a combination of massively parallel reporter assays and regression models  to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences  and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds  AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns  and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment  a sample was collected every hour between 1h to 8h  and at 10h. In the second experiment  a single sample was collected every hour between 1h to 10h  and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment  two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A  reporters in two separate experiments. In the first experiment  a sample was collected every hour between 1h to 8h  and at 10h. In the second experiment rep  samples were collected at 1h  2h  3h  4h 3 samples  6h  8h and 10h.", null, "pubmed:29225039", null, "oocyte A  7h", "GSM2845355", null, "source name:zebrafish oocyte|developmental stage:7h|tissue:oocyte", "oocyte A  7h", "Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5\u2019 terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg  lowest 3.125fg  and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels", "zebrafish oocyte", "Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage.", "Total RNA was isolated using TRIzol Invitrogen  post adding 120fg of mRNA with 5 known 3\u2019UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step  total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3\u2019UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step  resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3\u2019UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors", "Fertilized zebrafish eggs or oocytes were collected at 28C  and kept in culture medium 5.03mM NaCl  0.17mM KCl  0.33mM CaCl2  0.33mM MgSo4  0.1% Methylene blue.  A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage.", "developmental stage:7h|tissue:oocyte", "GSM2845355", "GSM2845355: oocyte A  7h; Danio rerio; OTHER", "GSM2845355", null, "1", "Total RNA was isolated using TRIzol Invitrogen  post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step  total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step  resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors", "GEO Accession:GSM2845355", "OTHER", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina MiSeq", null, "SRP124609", null, null, "AR19-SL40.fastq.gz", "fastq", 437084640.0, 2731779.0, "GSM2845355 r1", "0:160 1:0", "A:138575507;C:98512376;G:80808399;T:119186452;N:1906", 160, 0, null, null, 138575507, 98512376, 80808399, 119186452, 1906, "SRX3374369", "SRS2671601", "SRA629220", "GEO", "Broad Institute", 1, 2e-05, null, 0.0, null, 0.99995, null, 1.0, null, 160, null, "T", null, "under 1.2% mapping rate", "illumina", "miseq", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "United States", "2017-11-08", "Gastrula", "Embryo", "Oocyte", "Reproductive System"], [44648, "SRR6268200", "SRX3374368", "SRS2671593", "SRP124609", "PRJNA417597", "Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation", "GSE106677", "Other", "The stability of mRNAs is regulated by signals within their sequences  but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here  we introduce UTR Seq  a combination of massively parallel reporter assays and regression models  to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences  and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds  AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns  and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment  a sample was collected every hour between 1h to 8h  and at 10h. In the second experiment  a single sample was collected every hour between 1h to 10h  and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment  two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A  reporters in two separate experiments. In the first experiment  a sample was collected every hour between 1h to 8h  and at 10h. In the second experiment rep  samples were collected at 1h  2h  3h  4h 3 samples  6h  8h and 10h.", null, "pubmed:29225039", null, "oocyte A  4h", "GSM2845354", null, "source name:zebrafish oocyte|developmental stage:4h|tissue:oocyte", "oocyte A  4h", "Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5\u2019 terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg  lowest 3.125fg  and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels", "zebrafish oocyte", "Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage.", "Total RNA was isolated using TRIzol Invitrogen  post adding 120fg of mRNA with 5 known 3\u2019UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step  total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3\u2019UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step  resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3\u2019UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors", "Fertilized zebrafish eggs or oocytes were collected at 28C  and kept in culture medium 5.03mM NaCl  0.17mM KCl  0.33mM CaCl2  0.33mM MgSo4  0.1% Methylene blue.  A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage.", "developmental stage:4h|tissue:oocyte", "GSM2845354", "GSM2845354: oocyte A  4h; Danio rerio; OTHER", "GSM2845354", null, "1", "Total RNA was isolated using TRIzol Invitrogen  post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step  total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step  resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors", "GEO Accession:GSM2845354", "OTHER", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina MiSeq", null, "SRP124609", null, null, "AR18-SL39.fastq.gz", "fastq", 533958880.0, 3337243.0, "GSM2845354 r1", "0:160 1:0", "A:163118236;C:125487590;G:106580813;T:138769793;N:2448", 160, 0, null, null, 163118236, 125487590, 106580813, 138769793, 2448, "SRX3374368", "SRS2671593", "SRA629220", "GEO", "Broad Institute", 1, 1e-05, null, 0.0, null, 0.99997, null, 0.0, null, 160, null, "T", null, "under 1.2% mapping rate", "illumina", "miseq", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "United States", "2017-11-08", "Blastula", "Embryo", "Oocyte", "Reproductive System"], [44649, "SRR6268199", "SRX3374367", "SRS2671602", "SRP124609", "PRJNA417597", "Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation", "GSE106677", "Other", "The stability of mRNAs is regulated by signals within their sequences  but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here  we introduce UTR Seq  a combination of massively parallel reporter assays and regression models  to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences  and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds  AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns  and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment  a sample was collected every hour between 1h to 8h  and at 10h. In the second experiment  a single sample was collected every hour between 1h to 10h  and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment  two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A  reporters in two separate experiments. In the first experiment  a sample was collected every hour between 1h to 8h  and at 10h. In the second experiment rep  samples were collected at 1h  2h  3h  4h 3 samples  6h  8h and 10h.", null, "pubmed:29225039", null, "oocyte A  1h", "GSM2845353", null, "source name:zebrafish oocyte|developmental stage:1h|tissue:oocyte", "oocyte A  1h", "Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5\u2019 terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg  lowest 3.125fg  and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels", "zebrafish oocyte", "Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage.", "Total RNA was isolated using TRIzol Invitrogen  post adding 120fg of mRNA with 5 known 3\u2019UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step  total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3\u2019UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step  resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3\u2019UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors", "Fertilized zebrafish eggs or oocytes were collected at 28C  and kept in culture medium 5.03mM NaCl  0.17mM KCl  0.33mM CaCl2  0.33mM MgSo4  0.1% Methylene blue.  A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage.", "developmental stage:1h|tissue:oocyte", "GSM2845353", "GSM2845353: oocyte A  1h; Danio rerio; OTHER", "GSM2845353", null, "1", "Total RNA was isolated using TRIzol Invitrogen  post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step  total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step  resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors", "GEO Accession:GSM2845353", "OTHER", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina MiSeq", null, "SRP124609", null, null, "AR17-SL38.fastq.gz", "fastq", 532076160.0, 3325476.0, "GSM2845353 r1", "0:160 1:0", "A:162057480;C:125858627;G:108494717;T:135663057;N:2279", 160, 0, null, null, 162057480, 125858627, 108494717, 135663057, 2279, "SRX3374367", "SRS2671602", "SRA629220", "GEO", "Broad Institute", 1, 2e-05, null, 0.0, null, 0.99995, null, 1.0, null, 160, null, "T", null, "under 1.2% mapping rate", "illumina", "miseq", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "United States", "2017-11-08", "Cleavage", "Embryo", "Oocyte", "Reproductive System"], [44969, "SRR6345658", "SRX3442974", "SRS2733632", "SRP126106", "PRJNA421016", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]", "GSE107682", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "smRNA seq library of late oocytes from tdrd6a hett fish", "GSM2875717", null, "source name:late oocytes from tdrd6a hett fish|tissue:late oocytes|genotype:tdrd6a heterozygous", "smRNA seq library of late oocytes from tdrd6a hett fish", "1. Adapter trimming with cutadapt  O 8  m 26  M 38  a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter   q 20  p 100  Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end  using a custom bash script. 4. UMIs were trimmed with seqtk trimfq  b 4  a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq  L 15\u00a0 6. Mapping was done to Zebrafish  Danio rerio  genome assembly Zv9 with bowtie v0.12.8   tryhard   best   strata   chunkmbs 256  v 1  M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed  bg  split  scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.\u00a0 \u00a0 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE  SINE  LTR and DNA downloaded from the UCSC genome browser repeat masker track  Zv9 using bedtools intersect  a reads  b transposons  wa  wb  bed  f 1.0  nonamecheck to keep both the read and the transposon information. The arguments  s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re  start re  end re  repFamily  repName strand re  and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons  and readlength the length of the read that. Sample is the sample name  and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.\u00a0 Supplementary files format and content: Files ending in .bw are bigwig tracks.", "late oocytes from tdrd6a hett fish", null, "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", null, "tissue:late oocytes|genotype:tdrd6a heterozygous", "GSM2875717", "GSM2875717: smRNA seq library of late oocytes from tdrd6a hett fish; Danio rerio; ncRNA Seq", "GSM2875717", null, "1", "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", "GEO Accession:GSM2875717", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP126106", null, null, "tdrd6a-het_oocytes-late-input.fastq.gz", "fastq", 1884769630.0, 28130890.0, "GSM2875717 r1", "0:67", "A:519051884;C:437635381;G:510738306;T:417295309;N:48750", 67, null, null, null, 519051884, 437635381, 510738306, 417295309, 48750, "SRX3442974", "SRS2733632", "SRA636010", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.17778, null, 0.06655, null, 0.95931, null, 0.91529, null, 67, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "5prime", "size_fractionation", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2017-12-04", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [44970, "SRR6345657", "SRX3442973", "SRS2733634", "SRP126106", "PRJNA421016", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]", "GSE107682", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "smRNA seq library of early oocytes from tdrd6a mut fish", "GSM2875716", null, "source name:early oocytes from tdrd6a mut fish|tissue:early oocytes|genotype:tdrd6a mutant", "smRNA seq library of early oocytes from tdrd6a mut fish", "1. Adapter trimming with cutadapt  O 8  m 26  M 38  a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter   q 20  p 100  Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end  using a custom bash script. 4. UMIs were trimmed with seqtk trimfq  b 4  a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq  L 15\u00a0 6. Mapping was done to Zebrafish  Danio rerio  genome assembly Zv9 with bowtie v0.12.8   tryhard   best   strata   chunkmbs 256  v 1  M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed  bg  split  scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.\u00a0 \u00a0 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE  SINE  LTR and DNA downloaded from the UCSC genome browser repeat masker track  Zv9 using bedtools intersect  a reads  b transposons  wa  wb  bed  f 1.0  nonamecheck to keep both the read and the transposon information. The arguments  s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re  start re  end re  repFamily  repName strand re  and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons  and readlength the length of the read that. Sample is the sample name  and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.\u00a0 Supplementary files format and content: Files ending in .bw are bigwig tracks.", "early oocytes from tdrd6a mut fish", null, "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", null, "tissue:early oocytes|genotype:tdrd6a mutant", "GSM2875716", "GSM2875716: smRNA seq library of early oocytes from tdrd6a mut fish; Danio rerio; ncRNA Seq", "GSM2875716", null, "1", "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", "GEO Accession:GSM2875716", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP126106", null, null, "tdrd6a-mut_oocytes-early-input.fastq.gz", "fastq", 2102216723.0, 31376369.0, "GSM2875716 r1", "0:67", "A:592618102;C:472348913;G:550028898;T:487165955;N:54855", 67, null, null, null, 592618102, 472348913, 550028898, 487165955, 54855, "SRX3442973", "SRS2733634", "SRA636010", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.08293, null, 0.04595, null, 0.96193, null, 0.77321, null, 67, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "5prime", "size_fractionation", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2017-12-04", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [44971, "SRR6345656", "SRX3442972", "SRS2733635", "SRP126106", "PRJNA421016", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]", "GSE107682", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "smRNA seq library of late oocytes from tdrd6a mut fish", "GSM2875715", null, "source name:late oocytes from tdrd6a mut fish|tissue:late oocytes|genotype:tdrd6a mutant", "smRNA seq library of late oocytes from tdrd6a mut fish", "1. Adapter trimming with cutadapt  O 8  m 26  M 38  a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter   q 20  p 100  Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end  using a custom bash script. 4. UMIs were trimmed with seqtk trimfq  b 4  a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq  L 15\u00a0 6. Mapping was done to Zebrafish  Danio rerio  genome assembly Zv9 with bowtie v0.12.8   tryhard   best   strata   chunkmbs 256  v 1  M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed  bg  split  scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.\u00a0 \u00a0 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE  SINE  LTR and DNA downloaded from the UCSC genome browser repeat masker track  Zv9 using bedtools intersect  a reads  b transposons  wa  wb  bed  f 1.0  nonamecheck to keep both the read and the transposon information. The arguments  s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re  start re  end re  repFamily  repName strand re  and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons  and readlength the length of the read that. Sample is the sample name  and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.\u00a0 Supplementary files format and content: Files ending in .bw are bigwig tracks.", "late oocytes from tdrd6a mut fish", null, "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", null, "tissue:late oocytes|genotype:tdrd6a mutant", "GSM2875715", "GSM2875715: smRNA seq library of late oocytes from tdrd6a mut fish; Danio rerio; ncRNA Seq", "GSM2875715", null, "1", "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", "GEO Accession:GSM2875715", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP126106", null, null, "tdrd6a-mut_oocytes-late-input.fastq.gz", "fastq", 2110760295.0, 31503885.0, "GSM2875715 r1", "0:67", "A:582021495;C:486821539;G:582933348;T:458929133;N:54780", 67, null, null, null, 582021495, 486821539, 582933348, 458929133, 54780, "SRX3442972", "SRS2733635", "SRA636010", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.17064, null, 0.06728, null, 0.96173, null, 0.9114, null, 67, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "5prime", "size_fractionation", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2017-12-04", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [44972, "SRR6345655", "SRX3442971", "SRS2733633", "SRP126106", "PRJNA421016", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]", "GSE107682", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "smRNA seq library of early oocytes from tdrd6a het fish", "GSM2875714", null, "source name:early oocytes from tdrd6a het fish|tissue:Early oocytes|genotype:tdrd6a heterozygous", "smRNA seq library of early oocytes from tdrd6a het fish", "1. Adapter trimming with cutadapt  O 8  m 26  M 38  a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter   q 20  p 100  Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end  using a custom bash script. 4. UMIs were trimmed with seqtk trimfq  b 4  a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq  L 15\u00a0 6. Mapping was done to Zebrafish  Danio rerio  genome assembly Zv9 with bowtie v0.12.8   tryhard   best   strata   chunkmbs 256  v 1  M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed  bg  split  scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.\u00a0 \u00a0 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE  SINE  LTR and DNA downloaded from the UCSC genome browser repeat masker track  Zv9 using bedtools intersect  a reads  b transposons  wa  wb  bed  f 1.0  nonamecheck to keep both the read and the transposon information. The arguments  s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re  start re  end re  repFamily  repName strand re  and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons  and readlength the length of the read that. Sample is the sample name  and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.\u00a0 Supplementary files format and content: Files ending in .bw are bigwig tracks.", "early oocytes from tdrd6a het fish", null, "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", null, "tissue:Early oocytes|genotype:tdrd6a heterozygous", "GSM2875714", "GSM2875714: smRNA seq library of early oocytes from tdrd6a het fish; Danio rerio; ncRNA Seq", "GSM2875714", null, "1", "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", "GEO Accession:GSM2875714", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP126106", null, null, "tdrd6a-het_oocytes-early-input.fastq.gz", "fastq", 2243425655.0, 33483965.0, "GSM2875714 r1", "0:67", "A:633468129;C:503239215;G:592089295;T:514571679;N:57337", 67, null, null, null, 633468129, 503239215, 592089295, 514571679, 57337, "SRX3442971", "SRS2733633", "SRA636010", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.06641, null, 0.04254, null, 0.96806, null, 0.58509, null, 67, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "5prime", "size_fractionation", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2017-12-04", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [48337, "SRR7762357", "SRX4617974", "SRS3720953", "SRP149356", "PRJNA473799", "Widespread enhancer dememorization and promoter priming during parental to zygotic transition", "GSE114954", "Other", "The epigenome plays critical roles in controlling gene expression and development. However  how the parental epigenomes transit to the zygotic epigenome in early development remains elusive. Here  we show parental to zygotic transition in zebrafish involves extensive erasure of parental epigenetic memory starting by methylating gametic enhancers. Surprisingly  this occurs even prior to fertilization for sperm. Both parental enhancers lose histone marks by the 4 cell stage  and zygotic enhancers are not activated until around zygotic genome activation ZGA. By contrast  many promoters remain hypomethylated and  unexpectedly  acquire de novo histone acetylation as early as at the 4 cell stage. They then resolve into either activated or repressed promoters upon ZGA. Maternal depletion of histone acetyltransferases results in aberrant ZGA and early embryonic lethality. Finally  such reprogramming is largely driven by maternal factors with zygotic products contributing to embryonic enhancer activation. Thus  these data revealed widespread enhancer dememorization and promoter priming during parental to zygotic transition. Overall design: By employing STAR ChIP seq and RNA seq  we systematically examined the genome wide presence of H3K4me3  H3K27ac  H3K27me3 and H3K36me3 in sperm  oocyte  4 cell  256 cell and dome stage embryos.", null, "pubmed:30444999", null, "oocyte IV RNA seq", "GSM3359500", null, "tissue:oocyte|developmental stage:stage IV|cell type:metaphase I oocyte|strain:Tu", "oocyte IV RNA seq", "RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads.The filtered data were then mapped to the zebrafish reference genome danRer7 by STAR version: STAR 2.5.3a modified with following parameters:   outSAMstrandField intronMotif   outSAMattributes All   outSAMunmapped Within   outSAMattrIHstart 0   outWigStrand Stranded   outFilterMultimapNmax 20   twopassMode Basic. All STAR ChIP seq reads were aligned to the zebrafish reference genome danRer7 using Bowtie2 version 2.2.2 Langmead and Salzberg  2012 with the parameters \u2013t \u2013q \u2013N 1 \u2013L 25. All unmapped reads  non uniquely mapped reads and PCR duplicates were removed. For downstream analysis  the read counts were normalized by computing the numbers of reads per kilobase of bin per million of reads sequenced RPKM. All STEM seq datasets were mapped to the danRer7 reference genome by Bismark Krueger and Andrews  2011. Reads were trimmed with cutadaptor Martin  2011 using parameters:   minimum length 20   pair filter=any. Alignments were performed with the following parameters:  N 1  X 600   score min L 0  0.6. Multi mapped reads and PCR duplicates were removed. bismark methylation extractor was used to calculate the DNA methylation level Genome build: danRer7 Supplementary files format and content: Bigwig for ChIP seq and RNA seq tracks  gene expression table for RNA seq data", "oocyte", "The ovaries of adult female were isolated and transferred into specific buffer 5.4 mM KCl  136.8 mM NaCl  4.2 mM NaHCO3  0.44 mM KH2PO4  0.25 mM Na2HPO4  and 0.5% wt/vol BSA. Then stage I V oocytes were separated from the ovary with tweezers under microscope according to their morphology  and the surrounding follicle cells were detached gently as much as possible.", "Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN  74104 as recommended protocols 5 ug RNA was DNase I Fermentas  Cat # EN0521 treated at 37C for 1 h. RNA was then purified using AMPure beads. Poly A tailed mRNA was collected using DynabeadsTM mRNA purification kit Invitrogen  Cat # 61006. Purified RNA was fragmented with RNA Frag. Buffer NEB  Cat # E6186A at 95C for 5 min. Reaction was stopped and RNA was purified by AMPure beads. First stand cDNA was synthesized with a commercial kit using both oligo dT and random primers Invitrogen  Cat # 18080 051. Second strand cDNA was synthesized with second strand synthesis buffer Invitrogen  Cat # 10812014  MgCl2  DTT  dNTP  dUTP  RNase H Fermentas  Cat # EN0202  E. coli DNA ligase NEB  Cat # M0205S and DNA polymerase I NEB  Cat # M0209S. DNA was purified post 2 hrs incubation on thermomixer at 16C. Synthesized cDNA was subjected to library preparation. DNA was end repaired  adenylated  and ligated to TruSeq sequencing adaptors. Libraries were then treated with UDG AMPErase  Cat # N808 0096 at 37C for 1 hour followed by DNA amplification using Phusion HF DNA polymerase NEB  Cat # M0530L. The amplified DNA was size selected using AMPure Beads for 200 500 bp DNA fragments.", "The wild type Tu female strain were raised as standard protocol.", "developmental stage:stage IV|cell type:metaphase I oocyte|strain:Tu", "GSM3359500", "GSM3359500: oocyte IV RNA seq; Danio rerio; RNA Seq", "GSM3359500", null, "1", "Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN  74104 as recommended protocols 5 ug RNA was DNase I Fermentas  Cat # EN0521 treated at 37C for 1 h. RNA was then purified using AMPure beads. Poly A tailed mRNA was collected using DynabeadsTM mRNA purification kit Invitrogen  Cat # 61006. Purified RNA was fragmented with RNA Frag. Buffer NEB  Cat # E6186A at 95C for 5 min. Reaction was stopped and RNA was purified by AMPure beads. First stand cDNA was synthesized with a commercial kit using both oligo dT and random primers Invitrogen  Cat # 18080 051. Second strand cDNA was synthesized with second strand synthesis buffer Invitrogen  Cat # 10812014  MgCl2  DTT  dNTP  dUTP  RNase H Fermentas  Cat # EN0202  E. coli DNA ligase NEB  Cat # M0205S and DNA polymerase I NEB  Cat # M0209S. DNA was purified post 2 hrs incubation on thermomixer at 16C. Synthesized cDNA was subjected to library preparation. DNA was end repaired  adenylated  and ligated to TruSeq sequencing adaptors. Libraries were then treated with UDG AMPErase  Cat # N808 0096 at 37C for 1 hour followed by DNA amplification using Phusion HF DNA polymerase NEB  Cat # M0530L. The amplified DNA was size selected using AMPure Beads for 200 500 bp DNA fragments.", "GEO Accession:GSM3359500", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 1500", null, "SRP149356", null, null, "oocyte_IV_RNA_seq_r1.fq.gz", "fastq", 636442625.0, 12988625.0, "GSM3359500 r1", "0:49 1:0", "A:159884635;C:154136157;G:161233162;T:161078773;N:109898", 49, 0, null, null, 159884635, 154136157, 161233162, 161078773, 109898, "SRX4617974", "SRS3720953", "SRA712563", "GEO", "Tsinghua University", 1, 0.94159, null, 0.02577, null, 0.79933, null, 0.46881, null, 49, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "trueseq", "bulk", "unknown", "unknown", null, "China", "2018-08-28", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [48338, "SRR7762356", "SRX4617973", "SRS3720954", "SRP149356", "PRJNA473799", "Widespread enhancer dememorization and promoter priming during parental to zygotic transition", "GSE114954", "Other", "The epigenome plays critical roles in controlling gene expression and development. However  how the parental epigenomes transit to the zygotic epigenome in early development remains elusive. Here  we show parental to zygotic transition in zebrafish involves extensive erasure of parental epigenetic memory starting by methylating gametic enhancers. Surprisingly  this occurs even prior to fertilization for sperm. Both parental enhancers lose histone marks by the 4 cell stage  and zygotic enhancers are not activated until around zygotic genome activation ZGA. By contrast  many promoters remain hypomethylated and  unexpectedly  acquire de novo histone acetylation as early as at the 4 cell stage. They then resolve into either activated or repressed promoters upon ZGA. Maternal depletion of histone acetyltransferases results in aberrant ZGA and early embryonic lethality. Finally  such reprogramming is largely driven by maternal factors with zygotic products contributing to embryonic enhancer activation. Thus  these data revealed widespread enhancer dememorization and promoter priming during parental to zygotic transition. Overall design: By employing STAR ChIP seq and RNA seq  we systematically examined the genome wide presence of H3K4me3  H3K27ac  H3K27me3 and H3K36me3 in sperm  oocyte  4 cell  256 cell and dome stage embryos.", null, "pubmed:30444999", null, "oocyte III RNA seq", "GSM3359499", null, "tissue:oocyte|developmental stage:stage III|cell type:prophase I oocyte|strain:Tu", "oocyte III RNA seq", "RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads.The filtered data were then mapped to the zebrafish reference genome danRer7 by STAR version: STAR 2.5.3a modified with following parameters:   outSAMstrandField intronMotif   outSAMattributes All   outSAMunmapped Within   outSAMattrIHstart 0   outWigStrand Stranded   outFilterMultimapNmax 20   twopassMode Basic. All STAR ChIP seq reads were aligned to the zebrafish reference genome danRer7 using Bowtie2 version 2.2.2 Langmead and Salzberg  2012 with the parameters \u2013t \u2013q \u2013N 1 \u2013L 25. All unmapped reads  non uniquely mapped reads and PCR duplicates were removed. For downstream analysis  the read counts were normalized by computing the numbers of reads per kilobase of bin per million of reads sequenced RPKM. All STEM seq datasets were mapped to the danRer7 reference genome by Bismark Krueger and Andrews  2011. Reads were trimmed with cutadaptor Martin  2011 using parameters:   minimum length 20   pair filter=any. Alignments were performed with the following parameters:  N 1  X 600   score min L 0  0.6. Multi mapped reads and PCR duplicates were removed. bismark methylation extractor was used to calculate the DNA methylation level Genome build: danRer7 Supplementary files format and content: Bigwig for ChIP seq and RNA seq tracks  gene expression table for RNA seq data", "oocyte", "The ovaries of adult female were isolated and transferred into specific buffer 5.4 mM KCl  136.8 mM NaCl  4.2 mM NaHCO3  0.44 mM KH2PO4  0.25 mM Na2HPO4  and 0.5% wt/vol BSA. Then stage I V oocytes were separated from the ovary with tweezers under microscope according to their morphology  and the surrounding follicle cells were detached gently as much as possible.", "Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN  74104 as recommended protocols 5 ug RNA was DNase I Fermentas  Cat # EN0521 treated at 37C for 1 h. RNA was then purified using AMPure beads. Poly A tailed mRNA was collected using DynabeadsTM mRNA purification kit Invitrogen  Cat # 61006. Purified RNA was fragmented with RNA Frag. Buffer NEB  Cat # E6186A at 95C for 5 min. Reaction was stopped and RNA was purified by AMPure beads. First stand cDNA was synthesized with a commercial kit using both oligo dT and random primers Invitrogen  Cat # 18080 051. Second strand cDNA was synthesized with second strand synthesis buffer Invitrogen  Cat # 10812014  MgCl2  DTT  dNTP  dUTP  RNase H Fermentas  Cat # EN0202  E. coli DNA ligase NEB  Cat # M0205S and DNA polymerase I NEB  Cat # M0209S. DNA was purified post 2 hrs incubation on thermomixer at 16C. Synthesized cDNA was subjected to library preparation. DNA was end repaired  adenylated  and ligated to TruSeq sequencing adaptors. Libraries were then treated with UDG AMPErase  Cat # N808 0096 at 37C for 1 hour followed by DNA amplification using Phusion HF DNA polymerase NEB  Cat # M0530L. The amplified DNA was size selected using AMPure Beads for 200 500 bp DNA fragments.", "The wild type Tu female strain were raised as standard protocol.", "developmental stage:stage III|cell type:prophase I oocyte|strain:Tu", "GSM3359499", "GSM3359499: oocyte III RNA seq; Danio rerio; RNA Seq", "GSM3359499", null, "1", "Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN  74104 as recommended protocols 5 ug RNA was DNase I Fermentas  Cat # EN0521 treated at 37C for 1 h. RNA was then purified using AMPure beads. Poly A tailed mRNA was collected using DynabeadsTM mRNA purification kit Invitrogen  Cat # 61006. Purified RNA was fragmented with RNA Frag. Buffer NEB  Cat # E6186A at 95C for 5 min. Reaction was stopped and RNA was purified by AMPure beads. First stand cDNA was synthesized with a commercial kit using both oligo dT and random primers Invitrogen  Cat # 18080 051. Second strand cDNA was synthesized with second strand synthesis buffer Invitrogen  Cat # 10812014  MgCl2  DTT  dNTP  dUTP  RNase H Fermentas  Cat # EN0202  E. coli DNA ligase NEB  Cat # M0205S and DNA polymerase I NEB  Cat # M0209S. DNA was purified post 2 hrs incubation on thermomixer at 16C. Synthesized cDNA was subjected to library preparation. DNA was end repaired  adenylated  and ligated to TruSeq sequencing adaptors. Libraries were then treated with UDG AMPErase  Cat # N808 0096 at 37C for 1 hour followed by DNA amplification using Phusion HF DNA polymerase NEB  Cat # M0530L. The amplified DNA was size selected using AMPure Beads for 200 500 bp DNA fragments.", "GEO Accession:GSM3359499", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 1500", null, "SRP149356", null, null, "oocyte_III_RNA_seq_r1.fq.gz", "fastq", 637289296.0, 13005904.0, "GSM3359499 r1", "0:49 1:0", "A:160396576;C:153811544;G:160426381;T:162544723;N:110072", 49, 0, null, null, 160396576, 153811544, 160426381, 162544723, 110072, "SRX4617973", "SRS3720954", "SRA712563", "GEO", "Tsinghua University", 1, 0.93382, null, 0.03044, null, 0.729, null, 0.46965, null, 49, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "trueseq", "bulk", "unknown", "unknown", null, "China", "2018-08-28", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [48339, "SRR7762355", "SRX4617972", "SRS3720944", "SRP149356", "PRJNA473799", "Widespread enhancer dememorization and promoter priming during parental to zygotic transition", "GSE114954", "Other", "The epigenome plays critical roles in controlling gene expression and development. However  how the parental epigenomes transit to the zygotic epigenome in early development remains elusive. Here  we show parental to zygotic transition in zebrafish involves extensive erasure of parental epigenetic memory starting by methylating gametic enhancers. Surprisingly  this occurs even prior to fertilization for sperm. Both parental enhancers lose histone marks by the 4 cell stage  and zygotic enhancers are not activated until around zygotic genome activation ZGA. By contrast  many promoters remain hypomethylated and  unexpectedly  acquire de novo histone acetylation as early as at the 4 cell stage. They then resolve into either activated or repressed promoters upon ZGA. Maternal depletion of histone acetyltransferases results in aberrant ZGA and early embryonic lethality. Finally  such reprogramming is largely driven by maternal factors with zygotic products contributing to embryonic enhancer activation. Thus  these data revealed widespread enhancer dememorization and promoter priming during parental to zygotic transition. Overall design: By employing STAR ChIP seq and RNA seq  we systematically examined the genome wide presence of H3K4me3  H3K27ac  H3K27me3 and H3K36me3 in sperm  oocyte  4 cell  256 cell and dome stage embryos.", null, "pubmed:30444999", null, "oocyte II RNA seq", "GSM3359498", null, "tissue:oocyte|developmental stage:stage II|cell type:S phase oocyte|strain:Tu", "oocyte II RNA seq", "RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads.The filtered data were then mapped to the zebrafish reference genome danRer7 by STAR version: STAR 2.5.3a modified with following parameters:   outSAMstrandField intronMotif   outSAMattributes All   outSAMunmapped Within   outSAMattrIHstart 0   outWigStrand Stranded   outFilterMultimapNmax 20   twopassMode Basic. All STAR ChIP seq reads were aligned to the zebrafish reference genome danRer7 using Bowtie2 version 2.2.2 Langmead and Salzberg  2012 with the parameters \u2013t \u2013q \u2013N 1 \u2013L 25. All unmapped reads  non uniquely mapped reads and PCR duplicates were removed. For downstream analysis  the read counts were normalized by computing the numbers of reads per kilobase of bin per million of reads sequenced RPKM. All STEM seq datasets were mapped to the danRer7 reference genome by Bismark Krueger and Andrews  2011. Reads were trimmed with cutadaptor Martin  2011 using parameters:   minimum length 20   pair filter=any. Alignments were performed with the following parameters:  N 1  X 600   score min L 0  0.6. Multi mapped reads and PCR duplicates were removed. bismark methylation extractor was used to calculate the DNA methylation level Genome build: danRer7 Supplementary files format and content: Bigwig for ChIP seq and RNA seq tracks  gene expression table for RNA seq data", "oocyte", "The ovaries of adult female were isolated and transferred into specific buffer 5.4 mM KCl  136.8 mM NaCl  4.2 mM NaHCO3  0.44 mM KH2PO4  0.25 mM Na2HPO4  and 0.5% wt/vol BSA. Then stage I V oocytes were separated from the ovary with tweezers under microscope according to their morphology  and the surrounding follicle cells were detached gently as much as possible.", "Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN  74104 as recommended protocols 5 ug RNA was DNase I Fermentas  Cat # EN0521 treated at 37C for 1 h. RNA was then purified using AMPure beads. Poly A tailed mRNA was collected using DynabeadsTM mRNA purification kit Invitrogen  Cat # 61006. Purified RNA was fragmented with RNA Frag. Buffer NEB  Cat # E6186A at 95C for 5 min. Reaction was stopped and RNA was purified by AMPure beads. First stand cDNA was synthesized with a commercial kit using both oligo dT and random primers Invitrogen  Cat # 18080 051. Second strand cDNA was synthesized with second strand synthesis buffer Invitrogen  Cat # 10812014  MgCl2  DTT  dNTP  dUTP  RNase H Fermentas  Cat # EN0202  E. coli DNA ligase NEB  Cat # M0205S and DNA polymerase I NEB  Cat # M0209S. DNA was purified post 2 hrs incubation on thermomixer at 16C. Synthesized cDNA was subjected to library preparation. DNA was end repaired  adenylated  and ligated to TruSeq sequencing adaptors. Libraries were then treated with UDG AMPErase  Cat # N808 0096 at 37C for 1 hour followed by DNA amplification using Phusion HF DNA polymerase NEB  Cat # M0530L. The amplified DNA was size selected using AMPure Beads for 200 500 bp DNA fragments.", "The wild type Tu female strain were raised as standard protocol.", "developmental stage:stage II|cell type:S phase oocyte|strain:Tu", "GSM3359498", "GSM3359498: oocyte II RNA seq; Danio rerio; RNA Seq", "GSM3359498", null, "1", "Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN  74104 as recommended protocols 5 ug RNA was DNase I Fermentas  Cat # EN0521 treated at 37C for 1 h. RNA was then purified using AMPure beads. Poly A tailed mRNA was collected using DynabeadsTM mRNA purification kit Invitrogen  Cat # 61006. Purified RNA was fragmented with RNA Frag. Buffer NEB  Cat # E6186A at 95C for 5 min. Reaction was stopped and RNA was purified by AMPure beads. First stand cDNA was synthesized with a commercial kit using both oligo dT and random primers Invitrogen  Cat # 18080 051. Second strand cDNA was synthesized with second strand synthesis buffer Invitrogen  Cat # 10812014  MgCl2  DTT  dNTP  dUTP  RNase H Fermentas  Cat # EN0202  E. coli DNA ligase NEB  Cat # M0205S and DNA polymerase I NEB  Cat # M0209S. DNA was purified post 2 hrs incubation on thermomixer at 16C. Synthesized cDNA was subjected to library preparation. DNA was end repaired  adenylated  and ligated to TruSeq sequencing adaptors. Libraries were then treated with UDG AMPErase  Cat # N808 0096 at 37C for 1 hour followed by DNA amplification using Phusion HF DNA polymerase NEB  Cat # M0530L. The amplified DNA was size selected using AMPure Beads for 200 500 bp DNA fragments.", "GEO Accession:GSM3359498", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 1500", null, "SRP149356", null, null, "oocyte_II_RNA_seq_r1.fq.gz", "fastq", 636518379.0, 12990171.0, "GSM3359498 r1", "0:49 1:0", "A:160017029;C:153897668;G:159821522;T:162670200;N:111960", 49, 0, null, null, 160017029, 153897668, 159821522, 162670200, 111960, "SRX4617972", "SRS3720944", "SRA712563", "GEO", "Tsinghua University", 1, 0.9326, null, 0.0241, null, 0.74073, null, 0.47431, null, 49, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "trueseq", "bulk", "unknown", "unknown", null, "China", "2018-08-28", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [48340, "SRR7762354", "SRX4617971", "SRS3720943", "SRP149356", "PRJNA473799", "Widespread enhancer dememorization and promoter priming during parental to zygotic transition", "GSE114954", "Other", "The epigenome plays critical roles in controlling gene expression and development. However  how the parental epigenomes transit to the zygotic epigenome in early development remains elusive. Here  we show parental to zygotic transition in zebrafish involves extensive erasure of parental epigenetic memory starting by methylating gametic enhancers. Surprisingly  this occurs even prior to fertilization for sperm. Both parental enhancers lose histone marks by the 4 cell stage  and zygotic enhancers are not activated until around zygotic genome activation ZGA. By contrast  many promoters remain hypomethylated and  unexpectedly  acquire de novo histone acetylation as early as at the 4 cell stage. They then resolve into either activated or repressed promoters upon ZGA. Maternal depletion of histone acetyltransferases results in aberrant ZGA and early embryonic lethality. Finally  such reprogramming is largely driven by maternal factors with zygotic products contributing to embryonic enhancer activation. Thus  these data revealed widespread enhancer dememorization and promoter priming during parental to zygotic transition. Overall design: By employing STAR ChIP seq and RNA seq  we systematically examined the genome wide presence of H3K4me3  H3K27ac  H3K27me3 and H3K36me3 in sperm  oocyte  4 cell  256 cell and dome stage embryos.", null, "pubmed:30444999", null, "oocyte I RNA seq", "GSM3359497", null, "tissue:oocyte|developmental stage:stage I|cell type:G1 phase oocyte|strain:Tu", "oocyte I RNA seq", "RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads.The filtered data were then mapped to the zebrafish reference genome danRer7 by STAR version: STAR 2.5.3a modified with following parameters:   outSAMstrandField intronMotif   outSAMattributes All   outSAMunmapped Within   outSAMattrIHstart 0   outWigStrand Stranded   outFilterMultimapNmax 20   twopassMode Basic. All STAR ChIP seq reads were aligned to the zebrafish reference genome danRer7 using Bowtie2 version 2.2.2 Langmead and Salzberg  2012 with the parameters \u2013t \u2013q \u2013N 1 \u2013L 25. All unmapped reads  non uniquely mapped reads and PCR duplicates were removed. For downstream analysis  the read counts were normalized by computing the numbers of reads per kilobase of bin per million of reads sequenced RPKM. All STEM seq datasets were mapped to the danRer7 reference genome by Bismark Krueger and Andrews  2011. Reads were trimmed with cutadaptor Martin  2011 using parameters:   minimum length 20   pair filter=any. Alignments were performed with the following parameters:  N 1  X 600   score min L 0  0.6. Multi mapped reads and PCR duplicates were removed. bismark methylation extractor was used to calculate the DNA methylation level Genome build: danRer7 Supplementary files format and content: Bigwig for ChIP seq and RNA seq tracks  gene expression table for RNA seq data", "oocyte", "The ovaries of adult female were isolated and transferred into specific buffer 5.4 mM KCl  136.8 mM NaCl  4.2 mM NaHCO3  0.44 mM KH2PO4  0.25 mM Na2HPO4  and 0.5% wt/vol BSA. Then stage I V oocytes were separated from the ovary with tweezers under microscope according to their morphology  and the surrounding follicle cells were detached gently as much as possible.", "Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN  74104 as recommended protocols 5 ug RNA was DNase I Fermentas  Cat # EN0521 treated at 37C for 1 h. RNA was then purified using AMPure beads. Poly A tailed mRNA was collected using DynabeadsTM mRNA purification kit Invitrogen  Cat # 61006. Purified RNA was fragmented with RNA Frag. Buffer NEB  Cat # E6186A at 95C for 5 min. Reaction was stopped and RNA was purified by AMPure beads. First stand cDNA was synthesized with a commercial kit using both oligo dT and random primers Invitrogen  Cat # 18080 051. Second strand cDNA was synthesized with second strand synthesis buffer Invitrogen  Cat # 10812014  MgCl2  DTT  dNTP  dUTP  RNase H Fermentas  Cat # EN0202  E. coli DNA ligase NEB  Cat # M0205S and DNA polymerase I NEB  Cat # M0209S. DNA was purified post 2 hrs incubation on thermomixer at 16C. Synthesized cDNA was subjected to library preparation. DNA was end repaired  adenylated  and ligated to TruSeq sequencing adaptors. Libraries were then treated with UDG AMPErase  Cat # N808 0096 at 37C for 1 hour followed by DNA amplification using Phusion HF DNA polymerase NEB  Cat # M0530L. The amplified DNA was size selected using AMPure Beads for 200 500 bp DNA fragments.", "The wild type Tu female strain were raised as standard protocol.", "developmental stage:stage I|cell type:G1 phase oocyte|strain:Tu", "GSM3359497", "GSM3359497: oocyte I RNA seq; Danio rerio; RNA Seq", "GSM3359497", null, "1", "Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN  74104 as recommended protocols 5 ug RNA was DNase I Fermentas  Cat # EN0521 treated at 37C for 1 h. RNA was then purified using AMPure beads. Poly A tailed mRNA was collected using DynabeadsTM mRNA purification kit Invitrogen  Cat # 61006. Purified RNA was fragmented with RNA Frag. Buffer NEB  Cat # E6186A at 95C for 5 min. Reaction was stopped and RNA was purified by AMPure beads. First stand cDNA was synthesized with a commercial kit using both oligo dT and random primers Invitrogen  Cat # 18080 051. Second strand cDNA was synthesized with second strand synthesis buffer Invitrogen  Cat # 10812014  MgCl2  DTT  dNTP  dUTP  RNase H Fermentas  Cat # EN0202  E. coli DNA ligase NEB  Cat # M0205S and DNA polymerase I NEB  Cat # M0209S. DNA was purified post 2 hrs incubation on thermomixer at 16C. Synthesized cDNA was subjected to library preparation. DNA was end repaired  adenylated  and ligated to TruSeq sequencing adaptors. Libraries were then treated with UDG AMPErase  Cat # N808 0096 at 37C for 1 hour followed by DNA amplification using Phusion HF DNA polymerase NEB  Cat # M0530L. The amplified DNA was size selected using AMPure Beads for 200 500 bp DNA fragments.", "GEO Accession:GSM3359497", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 1500", null, "SRP149356", null, null, "oocyte_I_RNA_seq_r1.fq.gz", "fastq", 637062181.0, 13001269.0, "GSM3359497 r1", "0:49 1:0", "A:161520633;C:153547778;G:156542304;T:165341706;N:109760", 49, 0, null, null, 161520633, 153547778, 156542304, 165341706, 109760, "SRX4617971", "SRS3720943", "SRA712563", "GEO", "Tsinghua University", 1, 0.92933, null, 0.02356, null, 0.73683, null, 0.47367, null, 49, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "trueseq", "bulk", "unknown", "unknown", null, "China", "2018-08-28", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58431, "SRR12436831", "SRX8932520", "SRS7188865", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "Ski7 O4 R3 RiboMinus", "GSM4724750", null, "tissue:zebrafish oocyte|genotype:ski7 / |developmental stage:oocyte stage IV V|strain:TLAB", "Ski7 O4 R3 RiboMinus", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:ski7 / |developmental stage:oocyte stage IV V|strain:TLAB", "GSM4724750", "GSM4724750: Ski7 O4 R3 RiboMinus; Danio rerio; RNA Seq", "GSM4724750", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724750", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "Ski7_Ooc_T4_R3_RiboC.fastq", "fastq", 5953499600.0, 59534996.0, "GSM4724750 r1", "0:100", "A:1120262924;C:1886034530;G:1669359412;T:1277719039;N:123695", 100, null, null, null, 1120262924, 1886034530, 1669359412, 1277719039, 123695, "SRX8932520", "SRS7188865", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.98775, null, 0.27616, null, 0.85561, null, 0.86154, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58432, "SRR12436830", "SRX8932519", "SRS7188864", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "Ski7 O4 R2 RiboMinus", "GSM4724749", null, "tissue:zebrafish oocyte|genotype:ski7 / |developmental stage:oocyte stage IV V|strain:TLAB", "Ski7 O4 R2 RiboMinus", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:ski7 / |developmental stage:oocyte stage IV V|strain:TLAB", "GSM4724749", "GSM4724749: Ski7 O4 R2 RiboMinus; Danio rerio; RNA Seq", "GSM4724749", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724749", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "Ski7_Ooc_T4_R2_RiboC.fastq", "fastq", 1483394400.0, 14833944.0, "GSM4724749 r1", "0:100", "A:282286056;C:468342445;G:416192774;T:316541929;N:31196", 100, null, null, null, 282286056, 468342445, 416192774, 316541929, 31196, "SRX8932519", "SRS7188864", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.98708, null, 0.21634, null, 0.84611, null, 0.85636, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58433, "SRR12436829", "SRX8932518", "SRS7188863", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "Ski7 O4 R1 RiboMinus", "GSM4724748", null, "tissue:zebrafish oocyte|genotype:ski7 / |developmental stage:oocyte stage IV V|strain:TLAB", "Ski7 O4 R1 RiboMinus", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:ski7 / |developmental stage:oocyte stage IV V|strain:TLAB", "GSM4724748", "GSM4724748: Ski7 O4 R1 RiboMinus; Danio rerio; RNA Seq", "GSM4724748", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724748", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "Ski7_Ooc_T4_R1_RiboC.fastq", "fastq", 1003006700.0, 10030067.0, "GSM4724748 r1", "0:100", "A:231770113;C:284279432;G:255931584;T:231004482;N:21089", 100, null, null, null, 231770113, 284279432, 255931584, 231004482, 21089, "SRX8932518", "SRS7188863", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.97595, null, 0.1875, null, 0.78833, null, 0.7203, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58434, "SRR12436828", "SRX8932517", "SRS7188862", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "Ski7 O3 R3 RiboMinus", "GSM4724747", null, "tissue:zebrafish oocyte|genotype:ski7 / |developmental stage:oocyte stage III|strain:TLAB", "Ski7 O3 R3 RiboMinus", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:ski7 / |developmental stage:oocyte stage III|strain:TLAB", "GSM4724747", "GSM4724747: Ski7 O3 R3 RiboMinus; Danio rerio; RNA Seq", "GSM4724747", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724747", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "Ski7_Ooc_T3_R3_RiboC.fastq", "fastq", 1590741700.0, 15907417.0, "GSM4724747 r1", "0:100", "A:315819595;C:482378072;G:439500811;T:353009618;N:33604", 100, null, null, null, 315819595, 482378072, 439500811, 353009618, 33604, "SRX8932517", "SRS7188862", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.98036, null, 0.16863, null, 0.80012, null, 0.76997, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58435, "SRR12436827", "SRX8932516", "SRS7188861", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "Ski7 O3 R2 RiboMinus", "GSM4724746", null, "tissue:zebrafish oocyte|genotype:ski7 / |developmental stage:oocyte stage III|strain:TLAB", "Ski7 O3 R2 RiboMinus", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:ski7 / |developmental stage:oocyte stage III|strain:TLAB", "GSM4724746", "GSM4724746: Ski7 O3 R2 RiboMinus; Danio rerio; RNA Seq", "GSM4724746", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724746", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "Ski7_Ooc_T3_R2_RiboC.fastq", "fastq", 1851647100.0, 18516471.0, "GSM4724746 r1", "0:100", "A:397602403;C:536394029;G:491276851;T:426334866;N:38951", 100, null, null, null, 397602403, 536394029, 491276851, 426334866, 38951, "SRX8932516", "SRS7188861", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.96997, null, 0.11852, null, 0.77585, null, 0.66439, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58436, "SRR12436826", "SRX8932515", "SRS7188860", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "GEO accession GSM4724745 is currently private and is scheduled to be released on Mar 17  2023.", "GSM4724745", null, null, "Ski7 O3 R1 RiboMinus", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:ski7 / |developmental stage:oocyte stage III|strain:TLAB", "GSM4724745", "GSM4724745: Ski7 O3 R1 RiboMinus; Danio rerio; RNA Seq", "GSM4724745", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724745", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "Ski7_Ooc_T3_R1_RiboC.fastq", "fastq", 1856733400.0, 18567334.0, "GSM4724745 r1", "0:100", "A:398467671;C:533331652;G:489602590;T:435279283;N:52204", 100, null, null, null, 398467671, 533331652, 489602590, 435279283, 52204, "SRX8932515", "SRS7188860", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.96808, null, 0.14968, null, 0.76806, null, 0.67187, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58437, "SRR12436825", "SRX8932514", "SRS7188859", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "GEO accession GSM4724744 is currently private and is scheduled to be released on Mar 17  2023.", "GSM4724744", null, null, "Ski7 O2 R3 RiboMinus", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:ski7 / |developmental stage:oocyte stage II|strain:TLAB", "GSM4724744", "GSM4724744: Ski7 O2 R3 RiboMinus; Danio rerio; RNA Seq", "GSM4724744", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724744", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "Ski7_Ooc_T2_R3_RiboC.fastq", "fastq", 2638458400.0, 26384584.0, "GSM4724744 r1", "0:100", "A:539473608;C:778770363;G:717407077;T:602751798;N:55554", 100, null, null, null, 539473608, 778770363, 717407077, 602751798, 55554, "SRX8932514", "SRS7188859", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.9783, null, 0.18716, null, 0.79788, null, 0.70432, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58438, "SRR12436824", "SRX8932513", "SRS7188858", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "GEO accession GSM4724743 is currently private and is scheduled to be released on Mar 17  2023.", "GSM4724743", null, null, "Ski7 O2 R2 RiboMinus", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:ski7 / |developmental stage:oocyte stage II|strain:TLAB", "GSM4724743", "GSM4724743: Ski7 O2 R2 RiboMinus; Danio rerio; RNA Seq", "GSM4724743", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724743", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "Ski7_Ooc_T2_R2_RiboC.fastq", "fastq", 2512073400.0, 25120734.0, "GSM4724743 r1", "0:100", "A:616094880;C:635920272;G:606962967;T:653043012;N:52269", 100, null, null, null, 616094880, 635920272, 606962967, 653043012, 52269, "SRX8932513", "SRS7188858", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.95663, null, 0.08667, null, 0.75252, null, 0.52574, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58439, "SRR12436823", "SRX8932512", "SRS7188857", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "Ski7 O2 R1 RiboMinus", "GSM4724742", null, "tissue:zebrafish oocyte|genotype:ski7 / |developmental stage:oocyte stage II|strain:TLAB", "Ski7 O2 R1 RiboMinus", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:ski7 / |developmental stage:oocyte stage II|strain:TLAB", "GSM4724742", "GSM4724742: Ski7 O2 R1 RiboMinus; Danio rerio; RNA Seq", "GSM4724742", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724742", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "Ski7_Ooc_T2_R1_RiboC.fastq", "fastq", 910074400.0, 9100744.0, "GSM4724742 r1", "0:100", "A:221922364;C:228583521;G:219452367;T:240097505;N:18643", 100, null, null, null, 221922364, 228583521, 219452367, 240097505, 18643, "SRX8932512", "SRS7188857", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.95527, null, 0.08947, null, 0.74858, null, 0.51463, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58440, "SRR12436822", "SRX8932511", "SRS7188856", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "GEO accession GSM4724741 is currently private and is scheduled to be released on Mar 17  2023.", "GSM4724741", null, null, "Ski7 O1 R3 RiboMinus", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:ski7 / |developmental stage:oocyte stage I|strain:TLAB", "GSM4724741", "GSM4724741: Ski7 O1 R3 RiboMinus; Danio rerio; RNA Seq", "GSM4724741", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724741", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "Ski7_Ooc_T1_R3_RiboC.fastq", "fastq", 5943811600.0, 59438116.0, "GSM4724741 r1", "0:100", "A:1462644817;C:1467450908;G:1441714266;T:1571912790;N:88819", 100, null, null, null, 1462644817, 1467450908, 1441714266, 1571912790, 88819, "SRX8932511", "SRS7188856", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.95219, null, 0.06874, null, 0.76134, null, 0.48887, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58441, "SRR12436821", "SRX8932510", "SRS7188855", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "Ski7 O1 R2 RiboMinus", "GSM4724740", null, "tissue:zebrafish oocyte|genotype:ski7 / |developmental stage:oocyte stage I|strain:TLAB", "Ski7 O1 R2 RiboMinus", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:ski7 / |developmental stage:oocyte stage I|strain:TLAB", "GSM4724740", "GSM4724740: Ski7 O1 R2 RiboMinus; Danio rerio; RNA Seq", "GSM4724740", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724740", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "Ski7_Ooc_T1_R2_RiboC.fastq", "fastq", 1311657500.0, 13116575.0, "GSM4724740 r1", "0:100", "A:330391016;C:317678365;G:309923830;T:353636331;N:27958", 100, null, null, null, 330391016, 317678365, 309923830, 353636331, 27958, "SRX8932510", "SRS7188855", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.94932, null, 0.06794, null, 0.75668, null, 0.47546, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58442, "SRR12436820", "SRX8932509", "SRS7188854", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "GEO accession GSM4724739 is currently private and is scheduled to be released on Mar 17  2023.", "GSM4724739", null, null, "Ski7 O1 R1 RiboMinus", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:ski7 / |developmental stage:oocyte stage I|strain:TLAB", "GSM4724739", "GSM4724739: Ski7 O1 R1 RiboMinus; Danio rerio; RNA Seq", "GSM4724739", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724739", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "Ski7_Ooc_T1_R1_RiboC.fastq", "fastq", 1075841900.0, 10758419.0, "GSM4724739 r1", "0:100", "A:269155883;C:260373486;G:255757791;T:290531791;N:22949", 100, null, null, null, 269155883, 260373486, 255757791, 290531791, 22949, "SRX8932509", "SRS7188854", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.9501, null, 0.0714, null, 0.75239, null, 0.47851, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58455, "SRR12436807", "SRX8932496", "SRS7188841", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "WT O4 R3 RiboMinus", "GSM4724726", null, "tissue:zebrafish oocyte|genotype:wild type|developmental stage:oocyte stage IV V|strain:TLAB", "WT O4 R3 RiboMinus", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:wild type|developmental stage:oocyte stage IV V|strain:TLAB", "GSM4724726", "GSM4724726: WT O4 R3 RiboMinus; Danio rerio; RNA Seq", "GSM4724726", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724726", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "WT_Ooc_T4_R3_RiboC.fastq", "fastq", 3536883000.0, 35368830.0, "GSM4724726 r1", "0:100", "A:740435414;C:1028707233;G:946006923;T:821659092;N:74338", 100, null, null, null, 740435414, 1028707233, 946006923, 821659092, 74338, "SRX8932496", "SRS7188841", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.96899, null, 0.16966, null, 0.77561, null, 0.70876, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58456, "SRR12436806", "SRX8932495", "SRS7188840", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "WT O4 R2 RiboMinus", "GSM4724725", null, "tissue:zebrafish oocyte|genotype:wild type|developmental stage:oocyte stage IV V|strain:TLAB", "WT O4 R2 RiboMinus", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:wild type|developmental stage:oocyte stage IV V|strain:TLAB", "GSM4724725", "GSM4724725: WT O4 R2 RiboMinus; Danio rerio; RNA Seq", "GSM4724725", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724725", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "WT_Ooc_T4_R2_RiboC.fastq", "fastq", 1735575800.0, 17355758.0, "GSM4724725 r1", "0:100", "A:336997637;C:537535888;G:481185263;T:379820303;N:36709", 100, null, null, null, 336997637, 537535888, 481185263, 379820303, 36709, "SRX8932495", "SRS7188840", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.98261, null, 0.20886, null, 0.81744, null, 0.82191, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58457, "SRR12436805", "SRX8932494", "SRS7188839", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "WT O4 R1 RiboMinus", "GSM4724724", null, "tissue:zebrafish oocyte|genotype:wild type|developmental stage:oocyte stage IV V|strain:TLAB", "WT O4 R1 RiboMinus", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:wild type|developmental stage:oocyte stage IV V|strain:TLAB", "GSM4724724", "GSM4724724: WT O4 R1 RiboMinus; Danio rerio; RNA Seq", "GSM4724724", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724724", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "WT_Ooc_T4_R1_RiboC.fastq", "fastq", 968375900.0, 9683759.0, "GSM4724724 r1", "0:100", "A:205812739;C:278650314;G:254581772;T:229311224;N:19851", 100, null, null, null, 205812739, 278650314, 254581772, 229311224, 19851, "SRX8932494", "SRS7188839", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.97262, null, 0.17599, null, 0.7751, null, 0.69851, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58458, "SRR12436804", "SRX8932493", "SRS7188838", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "WT O3 R3 RiboMinus", "GSM4724723", null, "tissue:zebrafish oocyte|genotype:wild type|developmental stage:oocyte stage III|strain:TLAB", "WT O3 R3 RiboMinus", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:wild type|developmental stage:oocyte stage III|strain:TLAB", "GSM4724723", "GSM4724723: WT O3 R3 RiboMinus; Danio rerio; RNA Seq", "GSM4724723", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724723", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "WT_Ooc_T3_R3_RiboC.fastq", "fastq", 1157950000.0, 11579500.0, "GSM4724723 r1", "0:100", "A:230959551;C:350911015;G:319781869;T:256262721;N:34844", 100, null, null, null, 230959551, 350911015, 319781869, 256262721, 34844, "SRX8932493", "SRS7188838", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.97497, null, 0.1512, null, 0.79788, null, 0.77427, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58459, "SRR12436803", "SRX8932492", "SRS7188837", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "WT O3 R2 RiboMinus", "GSM4724722", null, "tissue:zebrafish oocyte|genotype:wild type|developmental stage:oocyte stage III|strain:TLAB", "WT O3 R2 RiboMinus", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:wild type|developmental stage:oocyte stage III|strain:TLAB", "GSM4724722", "GSM4724722: WT O3 R2 RiboMinus; Danio rerio; RNA Seq", "GSM4724722", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724722", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "WT_Ooc_T3_R2_RiboC.fastq", "fastq", 2139321300.0, 21393213.0, "GSM4724722 r1", "0:100", "A:472163186;C:594579228;G:551625858;T:520908125;N:44903", 100, null, null, null, 472163186, 594579228, 551625858, 520908125, 44903, "SRX8932492", "SRS7188837", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.96602, null, 0.14064, null, 0.76264, null, 0.63001, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58460, "SRR12436802", "SRX8932491", "SRS7188836", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "WT O3 R1 RiboMinus", "GSM4724721", null, "tissue:zebrafish oocyte|genotype:wild type|developmental stage:oocyte stage III|strain:TLAB", "WT O3 R1 RiboMinus", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:wild type|developmental stage:oocyte stage III|strain:TLAB", "GSM4724721", "GSM4724721: WT O3 R1 RiboMinus; Danio rerio; RNA Seq", "GSM4724721", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724721", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "WT_Ooc_T3_R1_RiboC.fastq", "fastq", 2525068300.0, 25250683.0, "GSM4724721 r1", "0:100", "A:565744039;C:693096961;G:646577782;T:619596341;N:53177", 100, null, null, null, 565744039, 693096961, 646577782, 619596341, 53177, "SRX8932491", "SRS7188836", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.95787, null, 0.15893, null, 0.7572, null, 0.62249, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58461, "SRR12436801", "SRX8932490", "SRS7188835", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "WT O2 R3 RiboMinus", "GSM4724720", null, "tissue:zebrafish oocyte|genotype:wild type|developmental stage:oocyte stage II|strain:TLAB", "WT O2 R3 RiboMinus", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:wild type|developmental stage:oocyte stage II|strain:TLAB", "GSM4724720", "GSM4724720: WT O2 R3 RiboMinus; Danio rerio; RNA Seq", "GSM4724720", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724720", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "WT_Ooc_T2_R3_RiboC.fastq", "fastq", 5992563200.0, 59925632.0, "GSM4724720 r1", "0:100", "A:1319977536;C:1660691877;G:1559598039;T:1452225367;N:70381", 100, null, null, null, 1319977536, 1660691877, 1559598039, 1452225367, 70381, "SRX8932490", "SRS7188835", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.96386, null, 0.11958, null, 0.77191, null, 0.6496, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58462, "SRR12436800", "SRX8932489", "SRS7188834", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "WT O2 R2 RiboMinus", "GSM4724719", null, "tissue:zebrafish oocyte|genotype:wild type|developmental stage:oocyte stage II|strain:TLAB", "WT O2 R2 RiboMinus", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:wild type|developmental stage:oocyte stage II|strain:TLAB", "GSM4724719", "GSM4724719: WT O2 R2 RiboMinus; Danio rerio; RNA Seq", "GSM4724719", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724719", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "WT_Ooc_T2_R2_RiboC.fastq", "fastq", 1120112000.0, 11201120.0, "GSM4724719 r1", "0:100", "A:278845536;C:275363946;G:266988736;T:298890271;N:23511", 100, null, null, null, 278845536, 275363946, 266988736, 298890271, 23511, "SRX8932489", "SRS7188834", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.95118, null, 0.0769, null, 0.74968, null, 0.49838, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58463, "SRR12436799", "SRX8932488", "SRS7188833", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "WT O2 R1 RiboMinus", "GSM4724718", null, "tissue:zebrafish oocyte|genotype:wild type|developmental stage:oocyte stage II|strain:TLAB", "WT O2 R1 RiboMinus", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:wild type|developmental stage:oocyte stage II|strain:TLAB", "GSM4724718", "GSM4724718: WT O2 R1 RiboMinus; Danio rerio; RNA Seq", "GSM4724718", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724718", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "WT_Ooc_T2_R1_RiboC.fastq", "fastq", 1161163900.0, 11611639.0, "GSM4724718 r1", "0:100", "A:286378138;C:285298711;G:278971452;T:310491191;N:24408", 100, null, null, null, 286378138, 285298711, 278971452, 310491191, 24408, "SRX8932488", "SRS7188833", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.95348, null, 0.07579, null, 0.75258, null, 0.50375, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58464, "SRR12436798", "SRX8932487", "SRS7188832", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "WT O1 R3 RiboMinus", "GSM4724717", null, "tissue:zebrafish oocyte|genotype:wild type|developmental stage:oocyte stage I|strain:TLAB", "WT O1 R3 RiboMinus", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:wild type|developmental stage:oocyte stage I|strain:TLAB", "GSM4724717", "GSM4724717: WT O1 R3 RiboMinus; Danio rerio; RNA Seq", "GSM4724717", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724717", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "WT_Ooc_T1_R3_RiboC.fastq", "fastq", 4193077700.0, 41930777.0, "GSM4724717 r1", "0:100", "A:1050014991;C:1016496752;G:997881012;T:1128596351;N:88594", 100, null, null, null, 1050014991, 1016496752, 997881012, 1128596351, 88594, "SRX8932487", "SRS7188832", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.94605, null, 0.07574, null, 0.75903, null, 0.46881, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58465, "SRR12436797", "SRX8932486", "SRS7188831", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "WT O1 R2 RiboMinus", "GSM4724716", null, "tissue:zebrafish oocyte|genotype:wild type|developmental stage:oocyte stage I|strain:TLAB", "WT O1 R2 RiboMinus", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:wild type|developmental stage:oocyte stage I|strain:TLAB", "GSM4724716", "GSM4724716: WT O1 R2 RiboMinus; Danio rerio; RNA Seq", "GSM4724716", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724716", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "WT_Ooc_T1_R2_RiboC.fastq", "fastq", 3009030900.0, 30090309.0, "GSM4724716 r1", "0:100", "A:756357371;C:732762366;G:713861976;T:805985486;N:63701", 100, null, null, null, 756357371, 732762366, 713861976, 805985486, 63701, "SRX8932486", "SRS7188831", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.94803, null, 0.06904, null, 0.75286, null, 0.47431, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58466, "SRR12436796", "SRX8932485", "SRS7188830", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "WT O1 R1 RiboMinus", "GSM4724715", null, "tissue:zebrafish oocyte|genotype:wild type|developmental stage:oocyte stage I|strain:TLAB", "WT O1 R1 RiboMinus", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:wild type|developmental stage:oocyte stage I|strain:TLAB", "GSM4724715", "GSM4724715: WT O1 R1 RiboMinus; Danio rerio; RNA Seq", "GSM4724715", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724715", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "WT_Ooc_T1_R1_RiboC.fastq", "fastq", 7969559200.0, 79695592.0, "GSM4724715 r1", "0:100", "A:1987465338;C:1940306877;G:1899602998;T:2142014898;N:169089", 100, null, null, null, 1987465338, 1940306877, 1899602998, 2142014898, 169089, "SRX8932485", "SRS7188830", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.95073, null, 0.07916, null, 0.7545, null, 0.4763, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58488, "SRR12436774", "SRX8932463", "SRS7188808", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "GEO accession GSM4724693 is currently private and is scheduled to be released on Mar 17  2023.", "GSM4724693", null, null, "Ski7 O4 R3 polyA", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:ski7 / |developmental stage:oocyte stage IV V|strain:TLAB", "GSM4724693", "GSM4724693: Ski7 O4 R3 polyA; Danio rerio; RNA Seq", "GSM4724693", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724693", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "Ski7_Ooc_T4_R3_polyA.fastq", "fastq", 1385902100.0, 13859021.0, "GSM4724693 r1", "0:100", "A:355022344;C:325692901;G:325856286;T:379309245;N:21324", 100, null, null, null, 355022344, 325692901, 325856286, 379309245, 21324, "SRX8932463", "SRS7188808", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.95096, null, 0.05314, null, 0.74397, null, 0.48463, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58489, "SRR12436773", "SRX8932462", "SRS7188807", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "GEO accession GSM4724692 is currently private and is scheduled to be released on Mar 17  2023.", "GSM4724692", null, null, "Ski7 O4 R2 polyA", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:ski7 / |developmental stage:oocyte stage IV V|strain:TLAB", "GSM4724692", "GSM4724692: Ski7 O4 R2 polyA; Danio rerio; RNA Seq", "GSM4724692", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724692", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "Ski7_Ooc_T4_R2_polyA.fastq", "fastq", 1645095000.0, 16450950.0, "GSM4724692 r1", "0:100", "A:419155785;C:388799946;G:390627234;T:446460278;N:51757", 100, null, null, null, 419155785, 388799946, 390627234, 446460278, 51757, "SRX8932462", "SRS7188807", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.94503, null, 0.03717, null, 0.74832, null, 0.48156, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58490, "SRR12436772", "SRX8932461", "SRS7188806", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "Ski7 O4 R1 polyA", "GSM4724691", null, "tissue:zebrafish oocyte|genotype:ski7 / |developmental stage:oocyte stage IV V|strain:TLAB", "Ski7 O4 R1 polyA", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:ski7 / |developmental stage:oocyte stage IV V|strain:TLAB", "GSM4724691", "GSM4724691: Ski7 O4 R1 polyA; Danio rerio; RNA Seq", "GSM4724691", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724691", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "Ski7_Ooc_T4_R1_polyA.fastq", "fastq", 1387274300.0, 13872743.0, "GSM4724691 r1", "0:100", "A:350864142;C:326857764;G:329326718;T:380199491;N:26185", 100, null, null, null, 350864142, 326857764, 329326718, 380199491, 26185, "SRX8932461", "SRS7188806", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.94828, null, 0.04032, null, 0.74452, null, 0.47597, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58491, "SRR12436771", "SRX8932460", "SRS7188805", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "GEO accession GSM4724690 is currently private and is scheduled to be released on Mar 17  2023.", "GSM4724690", null, null, "Ski7 O3 R3 polyA", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:ski7 / |developmental stage:oocyte stage III|strain:TLAB", "GSM4724690", "GSM4724690: Ski7 O3 R3 polyA; Danio rerio; RNA Seq", "GSM4724690", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724690", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "Ski7_Ooc_T3_R3_polyA.fastq", "fastq", 1823940300.0, 18239403.0, "GSM4724690 r1", "0:100", "A:465953751;C:430730916;G:432934989;T:494293990;N:26654", 100, null, null, null, 465953751, 430730916, 432934989, 494293990, 26654, "SRX8932460", "SRS7188805", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.94861, null, 0.03314, null, 0.75323, null, 0.47687, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58492, "SRR12436770", "SRX8932459", "SRS7188804", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "Ski7 O3 R2 polyA", "GSM4724689", null, "tissue:zebrafish oocyte|genotype:ski7 / |developmental stage:oocyte stage III|strain:TLAB", "Ski7 O3 R2 polyA", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:ski7 / |developmental stage:oocyte stage III|strain:TLAB", "GSM4724689", "GSM4724689: Ski7 O3 R2 polyA; Danio rerio; RNA Seq", "GSM4724689", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724689", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "Ski7_Ooc_T3_R2_polyA.fastq", "fastq", 2475052000.0, 24750520.0, "GSM4724689 r1", "0:100", "A:519323476;C:717349825;G:662993394;T:575345089;N:40216", 100, null, null, null, 519323476, 717349825, 662993394, 575345089, 40216, "SRX8932459", "SRS7188804", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.97546, null, 0.19558, null, 0.79344, null, 0.70626, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58493, "SRR12436769", "SRX8932458", "SRS7188803", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "GEO accession GSM4724688 is currently private and is scheduled to be released on Mar 17  2023.", "GSM4724688", null, null, "Ski7 O3 R1 polyA", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:ski7 / |developmental stage:oocyte stage III|strain:TLAB", "GSM4724688", "GSM4724688: Ski7 O3 R1 polyA; Danio rerio; RNA Seq", "GSM4724688", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724688", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "Ski7_Ooc_T3_R1_polyA.fastq", "fastq", 1344365700.0, 13443657.0, "GSM4724688 r1", "0:100", "A:358902689;C:317990745;G:310901851;T:356551630;N:18785", 100, null, null, null, 358902689, 317990745, 310901851, 356551630, 18785, "SRX8932458", "SRS7188803", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.94986, null, 0.03467, null, 0.75248, null, 0.48024, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58494, "SRR12436768", "SRX8932457", "SRS7188802", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "GEO accession GSM4724687 is currently private and is scheduled to be released on Mar 17  2023.", "GSM4724687", null, null, "Ski7 O2 R3 polyA", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:ski7 / |developmental stage:oocyte stage II|strain:TLAB", "GSM4724687", "GSM4724687: Ski7 O2 R3 polyA; Danio rerio; RNA Seq", "GSM4724687", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724687", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "Ski7_Ooc_T2_R3_polyA.fastq", "fastq", 5413358400.0, 54133584.0, "GSM4724687 r1", "0:100", "A:1388031358;C:1272641126;G:1285955460;T:1466673696;N:56760", 100, null, null, null, 1388031358, 1272641126, 1285955460, 1466673696, 56760, "SRX8932457", "SRS7188802", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.9472, null, 0.02817, null, 0.76027, null, 0.47983, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58495, "SRR12436767", "SRX8932456", "SRS7188801", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "GEO accession GSM4724686 is currently private and is scheduled to be released on Mar 17  2023.", "GSM4724686", null, null, "Ski7 O2 R2 polyA", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:ski7 / |developmental stage:oocyte stage II|strain:TLAB", "GSM4724686", "GSM4724686: Ski7 O2 R2 polyA; Danio rerio; RNA Seq", "GSM4724686", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724686", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "Ski7_Ooc_T2_R2_polyA.fastq", "fastq", 1338262100.0, 13382621.0, "GSM4724686 r1", "0:100", "A:341009921;C:317021400;G:318286280;T:361902453;N:42046", 100, null, null, null, 341009921, 317021400, 318286280, 361902453, 42046, "SRX8932456", "SRS7188801", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.94175, null, 0.0299, null, 0.75968, null, 0.46945, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58496, "SRR12436766", "SRX8932455", "SRS7188800", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "Ski7 O2 R1 polyA", "GSM4724685", null, "tissue:zebrafish oocyte|genotype:ski7 / |developmental stage:oocyte stage II|strain:TLAB", "Ski7 O2 R1 polyA", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:ski7 / |developmental stage:oocyte stage II|strain:TLAB", "GSM4724685", "GSM4724685: Ski7 O2 R1 polyA; Danio rerio; RNA Seq", "GSM4724685", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724685", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "Ski7_Ooc_T2_R1_polyA.fastq", "fastq", 1713968700.0, 17139687.0, "GSM4724685 r1", "0:100", "A:430560645;C:414355275;G:405736622;T:463293152;N:23006", 100, null, null, null, 430560645, 414355275, 405736622, 463293152, 23006, "SRX8932455", "SRS7188800", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.95423, null, 0.04999, null, 0.74815, null, 0.49685, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58497, "SRR12436765", "SRX8932454", "SRS7188799", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "Ski7 O1 R3 polyA", "GSM4724684", null, "tissue:zebrafish oocyte|genotype:ski7 / |developmental stage:oocyte stage I|strain:TLAB", "Ski7 O1 R3 polyA", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:ski7 / |developmental stage:oocyte stage I|strain:TLAB", "GSM4724684", "GSM4724684: Ski7 O1 R3 polyA; Danio rerio; RNA Seq", "GSM4724684", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724684", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "Ski7_Ooc_T1_R3_polyA.fastq", "fastq", 719298300.0, 7192983.0, "GSM4724684 r1", "0:100", "A:189109969;C:167002756;G:170310269;T:192865064;N:10242", 100, null, null, null, 189109969, 167002756, 170310269, 192865064, 10242, "SRX8932454", "SRS7188799", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.94344, null, 0.02142, null, 0.77053, null, 0.45738, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58498, "SRR12436764", "SRX8932453", "SRS7188798", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "Ski7 O1 R2 polyA", "GSM4724683", null, "tissue:zebrafish oocyte|genotype:ski7 / |developmental stage:oocyte stage I|strain:TLAB", "Ski7 O1 R2 polyA", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:ski7 / |developmental stage:oocyte stage I|strain:TLAB", "GSM4724683", "GSM4724683: Ski7 O1 R2 polyA; Danio rerio; RNA Seq", "GSM4724683", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724683", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "Ski7_Ooc_T1_R2_polyA.fastq", "fastq", 927674100.0, 9276741.0, "GSM4724683 r1", "0:100", "A:238134282;C:219286837;G:219778008;T:250446841;N:28132", 100, null, null, null, 238134282, 219286837, 219778008, 250446841, 28132, "SRX8932453", "SRS7188798", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.93928, null, 0.02483, null, 0.7679, null, 0.4858, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58499, "SRR12436763", "SRX8932452", "SRS7188797", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "GEO accession GSM4724682 is currently private and is scheduled to be released on Mar 17  2023.", "GSM4724682", null, null, "Ski7 O1 R1 polyA", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:ski7 / |developmental stage:oocyte stage I|strain:TLAB", "GSM4724682", "GSM4724682: Ski7 O1 R1 polyA; Danio rerio; RNA Seq", "GSM4724682", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724682", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "Ski7_Ooc_T1_R1_polyA.fastq", "fastq", 913457600.0, 9134576.0, "GSM4724682 r1", "0:100", "A:232865896;C:216322788;G:217434769;T:246805052;N:29095", 100, null, null, null, 232865896, 216322788, 217434769, 246805052, 29095, "SRX8932452", "SRS7188797", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.9417, null, 0.02723, null, 0.76467, null, 0.47013, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58521, "SRR12436741", "SRX8932430", "SRS7188775", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "WT O4 R3 polyA", "GSM4724660", null, "tissue:zebrafish oocyte|genotype:wild type|developmental stage:oocyte stage IV V|strain:TLAB", "WT O4 R3 polyA", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:wild type|developmental stage:oocyte stage IV V|strain:TLAB", "GSM4724660", "GSM4724660: WT O4 R3 polyA; Danio rerio; RNA Seq", "GSM4724660", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724660", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "WT_Ooc_T4_R3_polyA.fastq", "fastq", 1220088000.0, 12200880.0, "GSM4724660 r1", "0:100", "A:307655212;C:288667632;G:290013036;T:333731254;N:20866", 100, null, null, null, 307655212, 288667632, 290013036, 333731254, 20866, "SRX8932430", "SRS7188775", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.95191, null, 0.05118, null, 0.74574, null, 0.47723, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58522, "SRR12436740", "SRX8932429", "SRS7188774", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "WT O4 R2 polyA", "GSM4724659", null, "tissue:zebrafish oocyte|genotype:wild type|developmental stage:oocyte stage IV V|strain:TLAB", "WT O4 R2 polyA", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:wild type|developmental stage:oocyte stage IV V|strain:TLAB", "GSM4724659", "GSM4724659: WT O4 R2 polyA; Danio rerio; RNA Seq", "GSM4724659", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724659", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "WT_Ooc_T4_R2_polyA.fastq", "fastq", 974054000.0, 9740540.0, "GSM4724659 r1", "0:100", "A:245756625;C:231170272;G:232466471;T:264642158;N:18474", 100, null, null, null, 245756625, 231170272, 232466471, 264642158, 18474, "SRX8932429", "SRS7188774", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.95103, null, 0.05355, null, 0.74369, null, 0.49361, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58523, "SRR12436739", "SRX8932428", "SRS7188773", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "WT O4 R1 polyA", "GSM4724658", null, "tissue:zebrafish oocyte|genotype:wild type|developmental stage:oocyte stage IV V|strain:TLAB", "WT O4 R1 polyA", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:wild type|developmental stage:oocyte stage IV V|strain:TLAB", "GSM4724658", "GSM4724658: WT O4 R1 polyA; Danio rerio; RNA Seq", "GSM4724658", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724658", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "WT_Ooc_T4_R1_polyA.fastq", "fastq", 1018516000.0, 10185160.0, "GSM4724658 r1", "0:100", "A:257744919;C:239788292;G:241035439;T:279928882;N:18468", 100, null, null, null, 257744919, 239788292, 241035439, 279928882, 18468, "SRX8932428", "SRS7188773", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.95651, null, 0.0404, null, 0.74769, null, 0.48301, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58524, "SRR12436738", "SRX8932427", "SRS7188772", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "WT O3 R3 polyA", "GSM4724657", null, "tissue:zebrafish oocyte|genotype:wild type|developmental stage:oocyte stage III|strain:TLAB", "WT O3 R3 polyA", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:wild type|developmental stage:oocyte stage III|strain:TLAB", "GSM4724657", "GSM4724657: WT O3 R3 polyA; Danio rerio; RNA Seq", "GSM4724657", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724657", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "WT_Ooc_T3_R3_polyA.fastq", "fastq", 1511221600.0, 15112216.0, "GSM4724657 r1", "0:100", "A:360267325;C:384886383;G:376256561;T:389781340;N:29991", 100, null, null, null, 360267325, 384886383, 376256561, 389781340, 29991, "SRX8932427", "SRS7188772", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.95504, null, 0.09847, null, 0.76378, null, 0.53827, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58525, "SRR12436737", "SRX8932426", "SRS7188771", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "WT O3 R2 polyA", "GSM4724656", null, "tissue:zebrafish oocyte|genotype:wild type|developmental stage:oocyte stage III|strain:TLAB", "WT O3 R2 polyA", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:wild type|developmental stage:oocyte stage III|strain:TLAB", "GSM4724656", "GSM4724656: WT O3 R2 polyA; Danio rerio; RNA Seq", "GSM4724656", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724656", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "WT_Ooc_T3_R2_polyA.fastq", "fastq", 1819237900.0, 18192379.0, "GSM4724656 r1", "0:100", "A:462060132;C:430315975;G:433552644;T:493277344;N:31805", 100, null, null, null, 462060132, 430315975, 433552644, 493277344, 31805, "SRX8932426", "SRS7188771", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.94767, null, 0.03464, null, 0.75148, null, 0.48269, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58526, "SRR12436736", "SRX8932425", "SRS7188770", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "WT O3 R1 polyA", "GSM4724655", null, "tissue:zebrafish oocyte|genotype:wild type|developmental stage:oocyte stage III|strain:TLAB", "WT O3 R1 polyA", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:wild type|developmental stage:oocyte stage III|strain:TLAB", "GSM4724655", "GSM4724655: WT O3 R1 polyA; Danio rerio; RNA Seq", "GSM4724655", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724655", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "WT_Ooc_T3_R1_polyA.fastq", "fastq", 4207117900.0, 42071179.0, "GSM4724655 r1", "0:100", "A:1087102522;C:1013988887;G:993080874;T:1112913159;N:32458", 100, null, null, null, 1087102522, 1013988887, 993080874, 1112913159, 32458, "SRX8932425", "SRS7188770", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.95096, null, 0.04182, null, 0.74882, null, 0.49243, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58527, "SRR12436735", "SRX8932424", "SRS7188769", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "WT O2 R3 polyA", "GSM4724654", null, "tissue:zebrafish oocyte|genotype:wild type|developmental stage:oocyte stage II|strain:TLAB", "WT O2 R3 polyA", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:wild type|developmental stage:oocyte stage II|strain:TLAB", "GSM4724654", "GSM4724654: WT O2 R3 polyA; Danio rerio; RNA Seq", "GSM4724654", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724654", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "WT_Ooc_T2_R3_polyA.fastq", "fastq", 1184155700.0, 11841557.0, "GSM4724654 r1", "0:100", "A:305706119;C:277055741;G:280181420;T:321176860;N:35560", 100, null, null, null, 305706119, 277055741, 280181420, 321176860, 35560, "SRX8932424", "SRS7188769", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.93621, null, 0.02475, null, 0.76155, null, 0.48722, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58528, "SRR12436734", "SRX8932423", "SRS7188768", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "WT O2 R2 polyA", "GSM4724653", null, "tissue:zebrafish oocyte|genotype:wild type|developmental stage:oocyte stage II|strain:TLAB", "WT O2 R2 polyA", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:wild type|developmental stage:oocyte stage II|strain:TLAB", "GSM4724653", "GSM4724653: WT O2 R2 polyA; Danio rerio; RNA Seq", "GSM4724653", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724653", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "WT_Ooc_T2_R2_polyA.fastq", "fastq", 1883194000.0, 18831940.0, "GSM4724653 r1", "0:100", "A:461473532;C:466713142;G:461060681;T:493890140;N:56505", 100, null, null, null, 461473532, 466713142, 461060681, 493890140, 56505, "SRX8932423", "SRS7188768", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.94837, null, 0.07018, null, 0.7612, null, 0.5239, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58529, "SRR12436733", "SRX8932422", "SRS7188767", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "WT O2 R1 polyA", "GSM4724652", null, "tissue:zebrafish oocyte|genotype:wild type|developmental stage:oocyte stage II|strain:TLAB", "WT O2 R1 polyA", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:wild type|developmental stage:oocyte stage II|strain:TLAB", "GSM4724652", "GSM4724652: WT O2 R1 polyA; Danio rerio; RNA Seq", "GSM4724652", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724652", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "WT_Ooc_T2_R1_polyA.fastq", "fastq", 893055500.0, 8930555.0, "GSM4724652 r1", "0:100", "A:228294393;C:211734420;G:210752916;T:242249752;N:24019", 100, null, null, null, 228294393, 211734420, 210752916, 242249752, 24019, "SRX8932422", "SRS7188767", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.94873, null, 0.03454, null, 0.76075, null, 0.49768, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58530, "SRR12436732", "SRX8932421", "SRS7188766", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "WT O1 R3 polyA", "GSM4724651", null, "tissue:zebrafish oocyte|genotype:wild type|developmental stage:oocyte stage I|strain:TLAB", "WT O1 R3 polyA", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:wild type|developmental stage:oocyte stage I|strain:TLAB", "GSM4724651", "GSM4724651: WT O1 R3 polyA; Danio rerio; RNA Seq", "GSM4724651", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724651", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "WT_Ooc_T1_R3_polyA.fastq", "fastq", 1690049000.0, 16900490.0, "GSM4724651 r1", "0:100", "A:433170251;C:397976643;G:403752898;T:455117766;N:31442", 100, null, null, null, 433170251, 397976643, 403752898, 455117766, 31442, "SRX8932421", "SRS7188766", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.93925, null, 0.0267, null, 0.76921, null, 0.47685, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58531, "SRR12436731", "SRX8932420", "SRS7188765", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "WT O1 R2 polyA", "GSM4724650", null, "tissue:zebrafish oocyte|genotype:wild type|developmental stage:oocyte stage I|strain:TLAB", "WT O1 R2 polyA", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:wild type|developmental stage:oocyte stage I|strain:TLAB", "GSM4724650", "GSM4724650: WT O1 R2 polyA; Danio rerio; RNA Seq", "GSM4724650", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724650", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "WT_Ooc_T1_R2_polyA.fastq", "fastq", 1118013500.0, 11180135.0, "GSM4724650 r1", "0:100", "A:287670338;C:261590511;G:265103395;T:303614321;N:34935", 100, null, null, null, 287670338, 261590511, 265103395, 303614321, 34935, "SRX8932420", "SRS7188765", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.93851, null, 0.02215, null, 0.76351, null, 0.47327, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58532, "SRR12436730", "SRX8932419", "SRS7188764", "SRP253077", "PRJNA613025", "Zebrafish Ski7 tunes RNA levels during the oocyte to embryo transition", "GSE147112", "Transcriptome Analysis", "Post transcriptional mechanisms are crucial for the regulation of gene expression. These mechanisms are particularly important during rapid developmental transitions such as the oocyte to embryo transition  which is characterized by dramatic changes to the developmental program in the absence of nuclear transcription. Under these conditions  changes to the RNA content are solely dependent on RNA degradation. Although several mechanisms that promote RNA decay during embryogenesis have been identified  it remains unclear which cellular machineries contribute to remodeling  the maternal transcriptome during the oocyte to embryo transition. Here  we focused on the auxiliary three prime to five prime degradation factor Ski7 in zebrafish as its mRNA peaks during this time frame. Homozygous ski7 mutant fish were viable and developed into morphologically normal adults  yet they had decreased fertility. Consistent with the idea that Ski7 participates in remodeling the transcriptome during the oocyte to embryo transition  transcriptome profiling identified stage specific mRNA targets of Ski7. Genes upregulated in ski7 mutants were generally lowly expressed in wild type  suggesting that Ski7 maintains low transcript levels for this subset of genes. GO enrichment analyses of genes mis regulated in ski7 mutants implicated Ski7 in the regulation of redox processes. This was confirmed experimentally by an increased resistance of ski7 mutant embryos to reductive stress. Overall  our results provide first insights into the physiological role of vertebrate Ski7 as an important post transcriptional regulator during the oocyte to embryo transition. Overall design: Transcriptome profiles of eleven time points of WT and ski7 mutant zebrafish samples during the oocyte to embryo transition. Every time point from each genotype was performed in triplicates.", null, "pubmed:33600438;pubmed:34556579", null, "WT O1 R1 polyA", "GSM4724649", null, "tissue:zebrafish oocyte|genotype:wild type|developmental stage:oocyte stage I|strain:TLAB", "WT O1 R1 polyA", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 92. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification of uniquely mapped reads raw reads was done with HTSeq v0.9.1 Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing raw reads or TPM", "zebrafish oocyte", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:wild type|developmental stage:oocyte stage I|strain:TLAB", "GSM4724649", "GSM4724649: WT O1 R1 polyA; Danio rerio; RNA Seq", "GSM4724649", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. For rRNA depleted samples  RiboCop rRNA depletion kit from LEXOGEN was used. Strand specific  cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM4724649", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP253077", null, null, "WT_Ooc_T1_R1_polyA.fastq", "fastq", 911081300.0, 9110813.0, "GSM4724649 r1", "0:100", "A:233869154;C:213268857;G:216850859;T:247064879;N:27551", 100, null, null, null, 233869154, 213268857, 216850859, 247064879, 27551, "SRX8932419", "SRS7188764", "SRA1055855", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.94808, null, 0.02169, null, 0.76501, null, 0.47032, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2020-08-12", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58547, "SRR13652350", "SRX10049113", "SRS8212340", "SRP253438", "PRJNA613601", "five prime half of specific tRNAs feeds back to promote corresponding tRNA gene transcription in vertebrate embryos [small RNA Seq  ssDRIP seq]", "GSE147253", "Other", "five primetRFls are small tRNA fragments derived from five prime half of mature tRNAs. However  it is unknown whether five primetRFls could feed back to regulate tRNA biogenesis. Here we show that five primetRFlGly/GCC and five primetRFlGlu/CTC function to promote transcription of corresponding tRNA genes and are essential for vertebrate early embryogenesis. During zebrafish embryogenesis  dynamics of five primetRFlGly/GCC and five primetRFlGlu/CTC levels correlates with that of tRNAGly/GCC and tRNAGlu/CTC levels. Morpholino mediated knockdown of five primetRFlGly/GCC or five primetRFlGlu/CTC down regulates tRNAGly/GCC or tRNAGlu/CTC levels respectively  and causes embryonic lethality that is efficiently rescued by co injection of properly refolded corresponding tRNA. In zebrafish embryos  tRNA:DNA and five primetRFl:DNA hybrids commonly exist on the template strand of tRNA genes. Mechanistically  unstable five primetRFl:DNA hybrid may prevent the formation of transcriptionally inhibitory stable tRNA:DNA hybrids on the same tRNA loci so as to facilitate tRNA genes transcription. The uncovered mechanism may be implicated in other physiological and pathological processes. Overall design: For small RNA sequencing   total RNA were extracted respectively from wildtype zebrafish embryos T\u00fcbingen Strain of 6 chosen stages  and then subjected to small RNA library preparation individually. To investigate the distribution and stability of R loop on genome  we performed ssDRIP seq with S9.6 antibody  which specifically recognize RNA:DNA hybrid.  Two replicates from wildtype embryos of 256c  sphere and shield stage were collected to perform ssDRIPseq. RNaseH pre treated genome DNA was used as negative control  which was also performed the standard ssDRIP seq procedure. Genomic DNA extracted from these samples were fragmentated by restriction enzymes  and then immunoprecipitated by S9.6 antibody.The ssDNA strands in RNA:DNA hybrids were purified and subjected to library preparation.", "parent bioproject:PRJNA753013", "pubmed:34797706", null, "Egg ncRNA seq", "GSM5069280", null, "tissue:mature oocyte|strain:Tubingen|developmental stage:Mature Oocyte|treatement:no", "Egg ncRNA seq", "For data processing  reads were quality checked by FastQCVersion 0.11.8  and adaptors were cut off by Cutadapt Version 1.16  and only reads that lay between 18 40 nt were kept. The reads of each sample were first aligned to different database by using Bowtie2  Version 2.3.4.1  count table was generated by featureCounts. Genome build: GRCz11 genome and cDNA   tRNA database GtRNAdb  GRCz11", "mature oocyte", null, "For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube  and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific  15596018. The lysate was centrifuged at 12 000 rpm for 10 min  and the supernatant was collected and mixed with 200 \u03bcl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4\u2103  the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min  followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at  80\u2103 until all samples were collected. Two pretreatment steps were included: First  purified total RNAs were treated with T4 Polynucleotide Kinase NEB  M0201S with ATP for 30 min at 37\u2103  then purified by phenol: chloroform extraction. The aim of this step is removing the 2 3\u2019 cyclic phosphate group from the 3\u2019end of 5\u2019tRFls  and add phosphate group to the 5\u2019end of 3\u2019tRFs. In the second step  total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing:  Small RNA libraries  using 1 \u03bcg RNA each  were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research  then bands of 135 160 bp  about the length of 15 40 nt RNA ligated with both adaptors  were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc  pH 4.5  followed by precipitation by adding 2.5 volumes of ethanol.", null, "strain:Tubingen|developmental stage:Mature Oocyte|treatement:no", "GSM5069280", "GSM5069280: Egg ncRNA seq; Danio rerio; ncRNA Seq", "GSM5069280", null, "1", "For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube  and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific  15596018. The lysate was centrifuged at 12 000 rpm for 10 min  and the supernatant was collected and mixed with 200 \u03bcl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4\u2103  the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min  followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at  80\u2103 until all samples were collected. Two pretreatment steps were included: First  purified total RNAs were treated with T4 Polynucleotide Kinase NEB  M0201S with ATP for 30 min at 37\u2103  then purified by phenol: chloroform extraction. The aim of this step is removing the 2 three prime cyclic phosphate group from the three primeend of five primetRFls  and add phosphate group to the five primeend of three primetRFs. In the second step  total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing:  Small RNA libraries  using 1 \u03bcg RNA each  were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research  then bands of 135 160 bp  about the length of 15 40 nt RNA ligated with both adaptors  were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc  pH 4.5  followed by precipitation by adding 2.5 volumes of ethanol.", "GEO Accession:GSM5069280", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP253438", null, null, "Egg-RNA_seq.fq.gz", "fastq", 4328292000.0, 28855280.0, "GSM5069280 r1", "0:150 1:0", "A:757944111;C:789419055;G:2112325298;T:668359520;N:244016", 150, 0, null, null, 757944111, 789419055, 2112325298, 668359520, 244016, "SRX10049113", "SRS8212340", "SRA1056877", "GEO", "Anming Meng Lab, School of Life Science, Tsinghua University", 1, 0.74704, null, 0.18839, null, 0.83197, null, 0.55802, null, 150, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "5prime", "size_fractionation", "nebnext", "bulk", "unknown", "unknown", null, "China", "2021-02-08", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [59512, "SRR11924307", "SRX8469983", "SRS6770634", "SRP265951", "PRJNA637293", "The shift from early to late types of ribosomes in zebrafish development involves changes at a subset of rRNA 2' O Me sites", "GSE151797", "Other", "A sequencing based profiling method RiboMeth seq for ribose methylations was used to study methylation patterns during Zebrafish Danio rerio development Overall design: All samples were analyzed in biological triplicates  except for adult tail trunk that was in duplicate.", null, "pubmed:32912962", null, "Unf egg 3", "GSM4591051", null, "source name:unfertilized egg|tissue:unfertilized egg|rna fraction:size fractionated 20 40 nt whole cell RNA", "Unf egg 3", "Library strategy: RiboMeth seq Barcode separation using python script Adaptor trimming using Cutadapt v. 2.0 Mapping to rRNA reference sequence using Bowtie2 v. 2.3.4.1 Counting read ends and calculating RiboMeth seq scores using python scripts The output FASTA files from small RNA seq were merged and used as the basis of the SNORD search and rRNA interaction prediction. Initially  SNORDs were identified by running the merged FASTA file through snoScan Schattner et al. 2005 against zebrafish early  and late rRNA reference sequences Locati et al. 2017. Genome build: early and late zebrafish rRNA locati et al. The reference sequences are available in the FASTA file on the series record. Supplementary files format and content: MS Excel file contains five prime and three prime read count and calculated RiboMeth seq score at all positions in the rRNA sequence.", "unfertilized egg", null, "Tissues were homogenized and whole cell RNA was extracted using Qiazol Qiagen according to the manufacturer. RiboMeth seq: 5 10 ug of RNA was partially degraded by alkaline at denaturing temperatures. The size fraction 20 40 nt was purified on gels and linkers added using a system relying on a modified Arabidopsis tRNA ligase joining 2' three prime cyclic phosphate and five prime phosphate ends. The library fragments were then sequenced on the Ion Proton platform. See Birkedal U  Christensen Dalsgaard M  Krogh N  Sabarinathan R  Gorodkin J  Nielsen H. Profiling of ribose methylations in RNA by high throughput sequencing. Angewandte Chemie. 2015;542:451 5 for detailed description", null, "tissue:unfertilized egg|rna fraction:size fractionated 20 40 nt whole cell RNA", "GSM4591051", "GSM4591051: Unf egg 3; Danio rerio; OTHER", "GSM4591051", null, "1", "Tissues were homogenized and whole cell RNA was extracted using Qiazol Qiagen according to the manufacturer. RiboMeth seq: 5 10 ug of RNA was partially degraded by alkaline at denaturing temperatures. The size fraction 20 40 nt was purified on gels and linkers added using a system relying on a modified Arabidopsis tRNA ligase joining 2' three prime cyclic phosphate and five prime phosphate ends. The library fragments were then sequenced on the Ion Proton platform. See Birkedal U  Christensen Dalsgaard M  Krogh N  Sabarinathan R  Gorodkin J  Nielsen H. Profiling of ribose methylations in RNA by high throughput sequencing. Angewandte Chemie. 2015;542:451 5 for detailed description", "GEO Accession:GSM4591051", "OTHER", "TRANSCRIPTOMIC", "other", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP265951", null, "intentional duplicate", "GSE151797_Reference_sequence.fa Unf_egg_3.bam", "bam bam", 149835556.0, 5777340.0, "GSM4591051 r1", "0:25.94", "A:27873539;C:50837956;G:37710769;T:33413292;N:0", 25, null, null, null, 27873539, 50837956, 37710769, 33413292, 0, "SRX8469983", "SRS6770634", "SRA1083099", "GEO", "RNA Group - Prof. Henrik Nielsen, Department of Cellular and Molecular Medicine, University of Copenhagen", 1, 0.74561, null, 0.22616, null, 0.89441, null, 0.76897, null, 34, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "5prime", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "Denmark", "2020-06-04", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [59513, "SRR11924305", "SRX8469982", "SRS6770633", "SRP265951", "PRJNA637293", "The shift from early to late types of ribosomes in zebrafish development involves changes at a subset of rRNA 2' O Me sites", "GSE151797", "Other", "A sequencing based profiling method RiboMeth seq for ribose methylations was used to study methylation patterns during Zebrafish Danio rerio development Overall design: All samples were analyzed in biological triplicates  except for adult tail trunk that was in duplicate.", null, "pubmed:32912962", null, "Unf egg 2", "GSM4591050", null, "source name:unfertilized egg|tissue:unfertilized egg|rna fraction:size fractionated 20 40 nt whole cell RNA", "Unf egg 2", "Library strategy: RiboMeth seq Barcode separation using python script Adaptor trimming using Cutadapt v. 2.0 Mapping to rRNA reference sequence using Bowtie2 v. 2.3.4.1 Counting read ends and calculating RiboMeth seq scores using python scripts The output FASTA files from small RNA seq were merged and used as the basis of the SNORD search and rRNA interaction prediction. Initially  SNORDs were identified by running the merged FASTA file through snoScan Schattner et al. 2005 against zebrafish early  and late rRNA reference sequences Locati et al. 2017. Genome build: early and late zebrafish rRNA locati et al. The reference sequences are available in the FASTA file on the series record. Supplementary files format and content: MS Excel file contains five prime and three prime read count and calculated RiboMeth seq score at all positions in the rRNA sequence.", "unfertilized egg", null, "Tissues were homogenized and whole cell RNA was extracted using Qiazol Qiagen according to the manufacturer. RiboMeth seq: 5 10 ug of RNA was partially degraded by alkaline at denaturing temperatures. The size fraction 20 40 nt was purified on gels and linkers added using a system relying on a modified Arabidopsis tRNA ligase joining 2' three prime cyclic phosphate and five prime phosphate ends. The library fragments were then sequenced on the Ion Proton platform. See Birkedal U  Christensen Dalsgaard M  Krogh N  Sabarinathan R  Gorodkin J  Nielsen H. Profiling of ribose methylations in RNA by high throughput sequencing. Angewandte Chemie. 2015;542:451 5 for detailed description", null, "tissue:unfertilized egg|rna fraction:size fractionated 20 40 nt whole cell RNA", "GSM4591050", "GSM4591050: Unf egg 2; Danio rerio; OTHER", "GSM4591050", null, "1", "Tissues were homogenized and whole cell RNA was extracted using Qiazol Qiagen according to the manufacturer. RiboMeth seq: 5 10 ug of RNA was partially degraded by alkaline at denaturing temperatures. The size fraction 20 40 nt was purified on gels and linkers added using a system relying on a modified Arabidopsis tRNA ligase joining 2' three prime cyclic phosphate and five prime phosphate ends. The library fragments were then sequenced on the Ion Proton platform. See Birkedal U  Christensen Dalsgaard M  Krogh N  Sabarinathan R  Gorodkin J  Nielsen H. Profiling of ribose methylations in RNA by high throughput sequencing. Angewandte Chemie. 2015;542:451 5 for detailed description", "GEO Accession:GSM4591050", "OTHER", "TRANSCRIPTOMIC", "other", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP265951", null, "intentional duplicate", "GSE151797_Reference_sequence.fa Unf_egg_2.bam", "bam bam", 235014832.0, 8915586.0, "GSM4591050 r1", "0:26.36", "A:43825969;C:79775479;G:60531219;T:50882165;N:0", 26, null, null, null, 43825969, 79775479, 60531219, 50882165, 0, "SRX8469982", "SRS6770633", "SRA1083099", "GEO", "RNA Group - Prof. Henrik Nielsen, Department of Cellular and Molecular Medicine, University of Copenhagen", 1, 0.78414, null, 0.23044, null, 0.90352, null, 0.76934, null, 40, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "5prime", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "Denmark", "2020-06-04", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [59514, "SRR11924304", "SRX8469981", "SRS6770632", "SRP265951", "PRJNA637293", "The shift from early to late types of ribosomes in zebrafish development involves changes at a subset of rRNA 2' O Me sites", "GSE151797", "Other", "A sequencing based profiling method RiboMeth seq for ribose methylations was used to study methylation patterns during Zebrafish Danio rerio development Overall design: All samples were analyzed in biological triplicates  except for adult tail trunk that was in duplicate.", null, "pubmed:32912962", null, "Unf egg 1", "GSM4591049", null, "source name:unfertilized egg|tissue:unfertilized egg|rna fraction:size fractionated 20 40 nt whole cell RNA", "Unf egg 1", "Library strategy: RiboMeth seq Barcode separation using python script Adaptor trimming using Cutadapt v. 2.0 Mapping to rRNA reference sequence using Bowtie2 v. 2.3.4.1 Counting read ends and calculating RiboMeth seq scores using python scripts The output FASTA files from small RNA seq were merged and used as the basis of the SNORD search and rRNA interaction prediction. Initially  SNORDs were identified by running the merged FASTA file through snoScan Schattner et al. 2005 against zebrafish early  and late rRNA reference sequences Locati et al. 2017. Genome build: early and late zebrafish rRNA locati et al. The reference sequences are available in the FASTA file on the series record. Supplementary files format and content: MS Excel file contains five prime and three prime read count and calculated RiboMeth seq score at all positions in the rRNA sequence.", "unfertilized egg", null, "Tissues were homogenized and whole cell RNA was extracted using Qiazol Qiagen according to the manufacturer. RiboMeth seq: 5 10 ug of RNA was partially degraded by alkaline at denaturing temperatures. The size fraction 20 40 nt was purified on gels and linkers added using a system relying on a modified Arabidopsis tRNA ligase joining 2' three prime cyclic phosphate and five prime phosphate ends. The library fragments were then sequenced on the Ion Proton platform. See Birkedal U  Christensen Dalsgaard M  Krogh N  Sabarinathan R  Gorodkin J  Nielsen H. Profiling of ribose methylations in RNA by high throughput sequencing. Angewandte Chemie. 2015;542:451 5 for detailed description", null, "tissue:unfertilized egg|rna fraction:size fractionated 20 40 nt whole cell RNA", "GSM4591049", "GSM4591049: Unf egg 1; Danio rerio; OTHER", "GSM4591049", null, "1", "Tissues were homogenized and whole cell RNA was extracted using Qiazol Qiagen according to the manufacturer. RiboMeth seq: 5 10 ug of RNA was partially degraded by alkaline at denaturing temperatures. The size fraction 20 40 nt was purified on gels and linkers added using a system relying on a modified Arabidopsis tRNA ligase joining 2' three prime cyclic phosphate and five prime phosphate ends. The library fragments were then sequenced on the Ion Proton platform. See Birkedal U  Christensen Dalsgaard M  Krogh N  Sabarinathan R  Gorodkin J  Nielsen H. Profiling of ribose methylations in RNA by high throughput sequencing. Angewandte Chemie. 2015;542:451 5 for detailed description", "GEO Accession:GSM4591049", "OTHER", "TRANSCRIPTOMIC", "other", "SINGLE", "ION_TORRENT", "Ion Torrent Proton", null, "SRP265951", null, "intentional duplicate", "GSE151797_Reference_sequence.fa Unf_egg_1.bam", "bam bam", 245529952.0, 9182415.0, "GSM4591049 r1", "0:26.74", "A:46557080;C:80893860;G:66050448;T:52028564;N:0", 26, null, null, null, 46557080, 80893860, 66050448, 52028564, 0, "SRX8469981", "SRS6770632", "SRA1083099", "GEO", "RNA Group - Prof. Henrik Nielsen, Department of Cellular and Molecular Medicine, University of Copenhagen", 1, 0.87423, null, 0.27943, null, 0.91721, null, 0.76816, null, 37, null, "B", null, "usable mapping rate", "ion_torrent", "ion_torrent", "5prime", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "Denmark", "2020-06-04", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [66236, "SRR16195512", "SRX12480000", "SRS10443550", "SRP339965", "PRJNA768450", "Time resolved RNA sequencing reveals distinct post transcriptional regimes during zebrafish embryogenesis", "GSE185283", "Other", "We report the characterization of transcript dynamics during maternal to zygotic transition in Zebrafish MZT using thiol linked alkylation for the metabolic sequencing of RNA SLAMseq. Overall design: Quantification of de novo transcription during MZT", null, "pubmed:36757845", null, "Fertilized oocyte replicate 3 Fertilized oocyte 3", "GSM5610104", null, "tissue:Zebrafish oocytes|cell type:oocyte|strain:TLAB TL X AB|chip antibody:3 prime end sequencing|treatment:Untreated", "Fertilized oocyte replicate 3 Fertilized oocyte 3", "three prime end sequencing data were used to creat custom annotations using three prime GAmES SLAMseq was mapped and counted using SLAMdunk 3.4.1. Reads were alingned to the dr11 genome Additional SNP filtering was performed using samtools pileup TTSLAMseq data were sequentially mapped to rRNA sequences  mitochondrial sequences and then the genome. other RNAseq data were mapped to dr11 using STAR and counted using featureCounts Genome build: dr11 Supplementary files format and content: count files of SLAMseq data were created using custom scripts post SNP filtering Supplementary files format and content: bedgraph files were genererated using deeptools Supplementary files format and content: Count files of TTSLAmseq data were obtained from SLAMdunk", "Zebrafish oocytes", "Zebrafish embryos were injected with 4sU or incubated in 4sU", "QuantSeq three prime end sequencing was used to prepare libraries for SLAMseq as well as oocyte samples. TTSLAMseq libraries were generated using NEBNext\u00ae Ultra II Directional RNA Library Prep Kit for Illumina\u00ae. NEB. Other RNAseq libraries were generated using using NEBNext Ultra Directional RNA Library Prep Kit for Illumina New England Biolabs and indexed with NEBNext Multiplex Oligos for Illumina Dual Index Primer Set I New England Biolabs.", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14 hour light/10 hour dark cycle. TLAB fish were generated by crossing zebrafish AB and the natural variant TL Tupfel Longfin stocks  and used for all experiments.", "cell type:oocyte|strain:TLAB TL X AB|chip antibody:3 prime end sequencing|treatment:Untreated", "GSM5610104", "GSM5610104: Fertilized oocyte replicate 3 Fertilized oocyte 3; Danio rerio; RNA Seq", "GSM5610104", null, "1", "QuantSeq three prime end sequencing was used to prepare libraries for SLAMseq as well as oocyte samples. TTSLAMseq libraries were generated using NEBNext\u00ae Ultra II Directional RNA Library Prep Kit for Illumina\u00ae. NEB. Other RNAseq libraries were generated using using NEBNext Ultra Directional RNA Library Prep Kit for Illumina New England Biolabs and indexed with NEBNext Multiplex Oligos for Illumina Dual Index Primer Set I New England Biolabs.", "GEO Accession:GSM5610104", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP339965", null, null, "WT_Ooc_FER_R3.fastq.gz", "fastq", 1117096200.0, 11170962.0, "GSM5610104 r1", "0:100", "A:382619405;C:202583344;G:250919891;T:280906801;N:66759", 100, null, null, null, 382619405, 202583344, 250919891, 280906801, 66759, "SRX12480000", "SRS10443550", "SRA1305700", "GEO", "Institute of Molecular Biotechnology", 1, 0.64947, null, 0.10219, null, 0.83905, null, 0.60833, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "3prime", "cdna_unspecified", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2021-10-04", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [66237, "SRR16195511", "SRX12479999", "SRS10443549", "SRP339965", "PRJNA768450", "Time resolved RNA sequencing reveals distinct post transcriptional regimes during zebrafish embryogenesis", "GSE185283", "Other", "We report the characterization of transcript dynamics during maternal to zygotic transition in Zebrafish MZT using thiol linked alkylation for the metabolic sequencing of RNA SLAMseq. Overall design: Quantification of de novo transcription during MZT", null, "pubmed:36757845", null, "Fertilized oocyte replicate 2 Fertilized oocyte 2", "GSM5610103", null, "tissue:Zebrafish oocytes|cell type:oocyte|strain:TLAB TL X AB|chip antibody:3 prime end sequencing|treatment:Untreated", "Fertilized oocyte replicate 2 Fertilized oocyte 2", "three prime end sequencing data were used to creat custom annotations using three prime GAmES SLAMseq was mapped and counted using SLAMdunk 3.4.1. Reads were alingned to the dr11 genome Additional SNP filtering was performed using samtools pileup TTSLAMseq data were sequentially mapped to rRNA sequences  mitochondrial sequences and then the genome. other RNAseq data were mapped to dr11 using STAR and counted using featureCounts Genome build: dr11 Supplementary files format and content: count files of SLAMseq data were created using custom scripts post SNP filtering Supplementary files format and content: bedgraph files were genererated using deeptools Supplementary files format and content: Count files of TTSLAmseq data were obtained from SLAMdunk", "Zebrafish oocytes", "Zebrafish embryos were injected with 4sU or incubated in 4sU", "QuantSeq three prime end sequencing was used to prepare libraries for SLAMseq as well as oocyte samples. TTSLAMseq libraries were generated using NEBNext\u00ae Ultra II Directional RNA Library Prep Kit for Illumina\u00ae. NEB. Other RNAseq libraries were generated using using NEBNext Ultra Directional RNA Library Prep Kit for Illumina New England Biolabs and indexed with NEBNext Multiplex Oligos for Illumina Dual Index Primer Set I New England Biolabs.", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14 hour light/10 hour dark cycle. TLAB fish were generated by crossing zebrafish AB and the natural variant TL Tupfel Longfin stocks  and used for all experiments.", "cell type:oocyte|strain:TLAB TL X AB|chip antibody:3 prime end sequencing|treatment:Untreated", "GSM5610103", "GSM5610103: Fertilized oocyte replicate 2 Fertilized oocyte 2; Danio rerio; RNA Seq", "GSM5610103", null, "1", "QuantSeq three prime end sequencing was used to prepare libraries for SLAMseq as well as oocyte samples. TTSLAMseq libraries were generated using NEBNext\u00ae Ultra II Directional RNA Library Prep Kit for Illumina\u00ae. NEB. Other RNAseq libraries were generated using using NEBNext Ultra Directional RNA Library Prep Kit for Illumina New England Biolabs and indexed with NEBNext Multiplex Oligos for Illumina Dual Index Primer Set I New England Biolabs.", "GEO Accession:GSM5610103", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP339965", null, null, "WT_Ooc_FER_R2.fastq.gz", "fastq", 727606300.0, 7276063.0, "GSM5610103 r1", "0:100", "A:255161621;C:130820008;G:159259242;T:182321712;N:43717", 100, null, null, null, 255161621, 130820008, 159259242, 182321712, 43717, "SRX12479999", "SRS10443549", "SRA1305700", "GEO", "Institute of Molecular Biotechnology", 1, 0.60979, null, 0.06401, null, 0.83871, null, 0.58404, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "3prime", "cdna_unspecified", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2021-10-04", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [66238, "SRR16195510", "SRX12479998", "SRS10443548", "SRP339965", "PRJNA768450", "Time resolved RNA sequencing reveals distinct post transcriptional regimes during zebrafish embryogenesis", "GSE185283", "Other", "We report the characterization of transcript dynamics during maternal to zygotic transition in Zebrafish MZT using thiol linked alkylation for the metabolic sequencing of RNA SLAMseq. Overall design: Quantification of de novo transcription during MZT", null, "pubmed:36757845", null, "Fertilized oocyte replicate 1 Fertilized oocyte 1", "GSM5610102", null, "tissue:Zebrafish oocytes|cell type:oocyte|strain:TLAB TL X AB|chip antibody:3 prime end sequencing|treatment:Untreated", "Fertilized oocyte replicate 1 Fertilized oocyte 1", "three prime end sequencing data were used to creat custom annotations using three prime GAmES SLAMseq was mapped and counted using SLAMdunk 3.4.1. Reads were alingned to the dr11 genome Additional SNP filtering was performed using samtools pileup TTSLAMseq data were sequentially mapped to rRNA sequences  mitochondrial sequences and then the genome. other RNAseq data were mapped to dr11 using STAR and counted using featureCounts Genome build: dr11 Supplementary files format and content: count files of SLAMseq data were created using custom scripts post SNP filtering Supplementary files format and content: bedgraph files were genererated using deeptools Supplementary files format and content: Count files of TTSLAmseq data were obtained from SLAMdunk", "Zebrafish oocytes", "Zebrafish embryos were injected with 4sU or incubated in 4sU", "QuantSeq three prime end sequencing was used to prepare libraries for SLAMseq as well as oocyte samples. TTSLAMseq libraries were generated using NEBNext\u00ae Ultra II Directional RNA Library Prep Kit for Illumina\u00ae. NEB. Other RNAseq libraries were generated using using NEBNext Ultra Directional RNA Library Prep Kit for Illumina New England Biolabs and indexed with NEBNext Multiplex Oligos for Illumina Dual Index Primer Set I New England Biolabs.", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14 hour light/10 hour dark cycle. TLAB fish were generated by crossing zebrafish AB and the natural variant TL Tupfel Longfin stocks  and used for all experiments.", "cell type:oocyte|strain:TLAB TL X AB|chip antibody:3 prime end sequencing|treatment:Untreated", "GSM5610102", "GSM5610102: Fertilized oocyte replicate 1 Fertilized oocyte 1; Danio rerio; RNA Seq", "GSM5610102", null, "1", "QuantSeq three prime end sequencing was used to prepare libraries for SLAMseq as well as oocyte samples. TTSLAMseq libraries were generated using NEBNext\u00ae Ultra II Directional RNA Library Prep Kit for Illumina\u00ae. NEB. Other RNAseq libraries were generated using using NEBNext Ultra Directional RNA Library Prep Kit for Illumina New England Biolabs and indexed with NEBNext Multiplex Oligos for Illumina Dual Index Primer Set I New England Biolabs.", "GEO Accession:GSM5610102", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP339965", null, null, "WT_Ooc_FER_R1.fastq.gz", "fastq", 1319550100.0, 13195501.0, "GSM5610102 r1", "0:100", "A:446810012;C:237425862;G:301380045;T:333855325;N:78856", 100, null, null, null, 446810012, 237425862, 301380045, 333855325, 78856, "SRX12479998", "SRS10443548", "SRA1305700", "GEO", "Institute of Molecular Biotechnology", 1, 0.6572, null, 0.10662, null, 0.83575, null, 0.59976, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "3prime", "cdna_unspecified", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2021-10-04", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [69433, "SRR18685191", "SRX14786403", "SRS12545308", "SRP368241", "PRJNA824784", "Divergent composition and transposon silencing activity of small RNAs in mammalian oocytes", "GSE200470", "Other", "We found piRNAs with different lengths represented the predominant small RNA species in oocytes from the 12 explored species  except mouse. We found endo siRNAs resulted from the truncated Dicer isoform were mouse specific  and os piRNAs associating with PIWIL3 in human oocytes are widespread in mammals and are typically with low levels of the 2' three prime O methylation. The sequences of many highly expressed piRNA clusters are fast evolving compared with their syntenic genomic locations  and the TE families distributing in the conserved piRNA clusters are various between species. Overall design: Profiling small RNAs and mRNA in oocytes from 12 animals.", null, "pubmed:38532500", null, "zebrafish oxidation", "GSM6034633", null, "source name:oocyte|tissue:oocyte|Sex:female|Stage:MII|genotype:wild type|treatment:NaIO4 oxidation|geo loc name:missing|collection date:missing", "zebrafish oxidation", "We used cutadapt to clip adaptor and filter low quality reads. Reads failing to match the adaptor or reads with lengths shorter than 17 nt were discarded. Redundant sequences were collapsed as useful reads and mapped to reference sequences by bowite. The useful reads were assigned to known miRNAs  tsRNA tRNA derived small non coding RNA  rsRNA rRNA derived small non coding RNA  small snoRNAs  lncRNA  and mRNA  successively. The reads that could not be mapped to these known small RNAs were used to predict piRNAs and endo siRNAs successively. Sequences that were not annotated with any of the RNA categories above were classified as others. We used trimmomatic to clip adaptor and filter low quality reads. The high quality reads were mapped to reference genomes by STAR. The expressed levels of genes were caculated in TPM transcripts per kilobase of exon model per million mapped reads by StringTie. Assembly: GRCh38  GRCm38 Supplementary files format and content: tab delimited text files include TPM values or raw counts for each Sample", "oocyte", null, "Total RNA from oocytes of different species were extracted with TRIzol Reagent Ambion  USA  respectively. Small RNA library construction. Briefly  the single oocytes were incubated at 72 \u00b0C for 3 min then cooled in ice. post 3\u2032 adapter ligation  the samples were incubated with 5 U of lambda exonuclease and 25 U of 5\u2032 de adenylates. Small RNAs were reverse transcribed post 5\u2032 adapter ligation. Two rounds of amplification were conducted to get the libraries and the libraries were recovered with 6% polyacrylamide gel. mRNA library construction. In brief  single oocytes were incubated at 72 \u00b0C for 3 min and then cooled on ice. For every single oocyte  1 \u03bcl of a 1/500 000 1/50 000 dilution of the ERCC RNA Spike In Mix Invitrogen  4456740 was added. post reverse transcription and PCR pre amplification  cDNAs were purified and 3 ng of purified cDNA was used for a tagmentation reaction with Tn5 transposase.", null, "tissue:oocyte|Sex:female|Stage:MII|genotype:wild type|treatment:NaIO4 oxidation", "GSM6034633", "GSM6034633: zebrafish oxidation; Danio rerio; RNA Seq", "GSM6034633 r1", "GSM6034633", "1", "Total RNA from oocytes of different species were extracted with TRIzol Reagent Ambion  USA  respectively. Small RNA library construction. Briefly  the single oocytes were incubated at 72 \u00b0C for 3 min then cooled in ice. post 3\u2032 adapter ligation  the samples were incubated with 5 U of lambda exonuclease and 25 U of 5\u2032 de adenylates. Small RNAs were reverse transcribed post 5\u2032 adapter ligation. Two rounds of amplification were conducted to get the libraries and the libraries were recovered with 6% polyacrylamide gel. mRNA library construction. In brief  single oocytes were incubated at 72 \u00b0C for 3 min and then cooled on ice. For every single oocyte  1 \u03bcl of a 1/500 000 1/50 000 dilution of the ERCC RNA Spike In Mix Invitrogen  4456740 was added. post reverse transcription and PCR pre amplification  cDNAs were purified and 3 ng of purified cDNA was used for a tagmentation reaction with Tn5 transposase.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP368241", null, null, "ZebrafishO_combined_R1.fastq.gz", "fastq", 729583350.0, 4863889.0, "GSM6034633 r1", "0:150 1:0", "A:107993751;C:106112485;G:397809615;T:117666119;N:1380", 150, 0, null, null, 107993751, 106112485, 397809615, 117666119, 1380, "SRX14786403", "SRS12545308", "SRA1400916", "Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences", "Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences", 1, 0.0, null, 0.0, null, 1.0, null, null, null, 150, null, "T", null, "under 1.2% mapping rate", "illumina", "novaseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "China", "2022-04-08", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [69434, "SRR18685192", "SRX14786402", "SRS12545307", "SRP368241", "PRJNA824784", "Divergent composition and transposon silencing activity of small RNAs in mammalian oocytes", "GSE200470", "Other", "We found piRNAs with different lengths represented the predominant small RNA species in oocytes from the 12 explored species  except mouse. We found endo siRNAs resulted from the truncated Dicer isoform were mouse specific  and os piRNAs associating with PIWIL3 in human oocytes are widespread in mammals and are typically with low levels of the 2' three prime O methylation. The sequences of many highly expressed piRNA clusters are fast evolving compared with their syntenic genomic locations  and the TE families distributing in the conserved piRNA clusters are various between species. Overall design: Profiling small RNAs and mRNA in oocytes from 12 animals.", null, "pubmed:38532500", null, "zebrafish control", "GSM6034632", null, "source name:oocyte|tissue:oocyte|Sex:female|Stage:MII|genotype:wild type|treatment:control|geo loc name:missing|collection date:missing", "zebrafish control", "We used cutadapt to clip adaptor and filter low quality reads. Reads failing to match the adaptor or reads with lengths shorter than 17 nt were discarded. Redundant sequences were collapsed as useful reads and mapped to reference sequences by bowite. The useful reads were assigned to known miRNAs  tsRNA tRNA derived small non coding RNA  rsRNA rRNA derived small non coding RNA  small snoRNAs  lncRNA  and mRNA  successively. The reads that could not be mapped to these known small RNAs were used to predict piRNAs and endo siRNAs successively. Sequences that were not annotated with any of the RNA categories above were classified as others. We used trimmomatic to clip adaptor and filter low quality reads. The high quality reads were mapped to reference genomes by STAR. The expressed levels of genes were caculated in TPM transcripts per kilobase of exon model per million mapped reads by StringTie. Assembly: GRCh38  GRCm38 Supplementary files format and content: tab delimited text files include TPM values or raw counts for each Sample", "oocyte", null, "Total RNA from oocytes of different species were extracted with TRIzol Reagent Ambion  USA  respectively. Small RNA library construction. Briefly  the single oocytes were incubated at 72 \u00b0C for 3 min then cooled in ice. post 3\u2032 adapter ligation  the samples were incubated with 5 U of lambda exonuclease and 25 U of 5\u2032 de adenylates. Small RNAs were reverse transcribed post 5\u2032 adapter ligation. Two rounds of amplification were conducted to get the libraries and the libraries were recovered with 6% polyacrylamide gel. mRNA library construction. In brief  single oocytes were incubated at 72 \u00b0C for 3 min and then cooled on ice. For every single oocyte  1 \u03bcl of a 1/500 000 1/50 000 dilution of the ERCC RNA Spike In Mix Invitrogen  4456740 was added. post reverse transcription and PCR pre amplification  cDNAs were purified and 3 ng of purified cDNA was used for a tagmentation reaction with Tn5 transposase.", null, "tissue:oocyte|Sex:female|Stage:MII|genotype:wild type|treatment:control", "GSM6034632", "GSM6034632: zebrafish control; Danio rerio; RNA Seq", "GSM6034632 r1", "GSM6034632", "1", "Total RNA from oocytes of different species were extracted with TRIzol Reagent Ambion  USA  respectively. Small RNA library construction. Briefly  the single oocytes were incubated at 72 \u00b0C for 3 min then cooled in ice. post 3\u2032 adapter ligation  the samples were incubated with 5 U of lambda exonuclease and 25 U of 5\u2032 de adenylates. Small RNAs were reverse transcribed post 5\u2032 adapter ligation. Two rounds of amplification were conducted to get the libraries and the libraries were recovered with 6% polyacrylamide gel. mRNA library construction. In brief  single oocytes were incubated at 72 \u00b0C for 3 min and then cooled on ice. For every single oocyte  1 \u03bcl of a 1/500 000 1/50 000 dilution of the ERCC RNA Spike In Mix Invitrogen  4456740 was added. post reverse transcription and PCR pre amplification  cDNAs were purified and 3 ng of purified cDNA was used for a tagmentation reaction with Tn5 transposase.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP368241", null, null, "ZebrafishB_combined_R1.fastq.gz", "fastq", 1146821100.0, 7645474.0, "GSM6034632 r1", "0:150 1:0", "A:173086143;C:178233645;G:594358274;T:201140843;N:2195", 150, 0, null, null, 173086143, 178233645, 594358274, 201140843, 2195, "SRX14786402", "SRS12545307", "SRA1400916", "Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences", "Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences", 1, 0.0, null, 0.0, null, 1.0, null, null, null, 150, null, "T", null, "under 1.2% mapping rate", "illumina", "novaseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "China", "2022-04-08", "Zygote", "Embryo", "Oocyte", "Reproductive System"]], "truncated": false, "filtered_table_rows_count": 103, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"experiment.library_layout\" = :p0 and \"tissue_curation\" = :p1 order by rowid limit 101", "params": {"p0": "SINGLE", "p1": "Oocyte"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte", "results": [{"value": "RNA-Seq", "label": "RNA-Seq", "count": 74, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte&experiment.library_strategy=RNA-Seq", "selected": false}, {"value": "OTHER", "label": "OTHER", "count": 11, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte&experiment.library_strategy=OTHER", "selected": false}, {"value": "ncRNA-Seq", "label": "ncRNA-Seq", "count": 7, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte&experiment.library_strategy=ncRNA-Seq", "selected": false}, {"value": "RIP-Seq", "label": "RIP-Seq", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte&experiment.library_strategy=RIP-Seq", "selected": false}, {"value": "miRNA-Seq", "label": "miRNA-Seq", "count": 5, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte&experiment.library_strategy=miRNA-Seq", "selected": false}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 103, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte&experiment.library_source=TRANSCRIPTOMIC", "selected": false}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte", "results": [{"value": "cDNA", "label": "cDNA", "count": 75, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte&experiment.library_selection=cDNA", "selected": false}, {"value": "other", "label": "other", "count": 15, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte&experiment.library_selection=other", "selected": false}, {"value": "size fractionation", "label": "size fractionation", "count": 11, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte&experiment.library_selection=size+fractionation", "selected": false}, {"value": "CAGE", "label": "CAGE", "count": 2, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte&experiment.library_selection=CAGE", "selected": false}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte", "results": [{"value": "SINGLE", "label": "SINGLE", "count": 103, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?tissue_curation=Oocyte", "selected": true}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte", "results": [{"value": "ILLUMINA", "label": "ILLUMINA", "count": 98, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte&experiment.platform=ILLUMINA", "selected": false}, {"value": "ION_TORRENT", "label": "ION_TORRENT", "count": 4, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte&experiment.platform=ION_TORRENT", "selected": false}, {"value": "ABI_SOLID", "label": "ABI_SOLID", "count": 1, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte&experiment.platform=ABI_SOLID", "selected": false}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte", "results": [{"value": "Embryo", "label": "Embryo", "count": 97, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte&devstage_curation_coarse=Embryo", "selected": false}, {"value": "Multi-stage", "label": "Multi-stage", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte&devstage_curation_coarse=Multi-stage", "selected": false}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte", "results": [{"value": "Zygote", "label": "Zygote", "count": 83, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte&devstage_curation=Zygote", "selected": false}, {"value": "Multi-stage", "label": "Multi-stage", "count": 14, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte&devstage_curation=Multi-stage", "selected": false}, {"value": "Blastula", "label": "Blastula", "count": 2, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte&devstage_curation=Blastula", "selected": false}, {"value": "Cleavage", "label": "Cleavage", "count": 2, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte&devstage_curation=Cleavage", "selected": false}, {"value": "Gastrula", "label": "Gastrula", "count": 2, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte&devstage_curation=Gastrula", "selected": false}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte", "results": [{"value": "Reproductive System", "label": "Reproductive System", "count": 103, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte&tissue_curation_coarse=Reproductive+System", "selected": false}], "truncated": false}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte", "results": [{"value": "Oocyte", "label": "Oocyte", "count": 103, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE", "selected": true}], "truncated": false}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte", "results": [{"value": "unknown", "label": "unknown", "count": 85, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte&technology=unknown", "selected": false}, {"value": "generic-scrnaseq-only", "label": "generic-scrnaseq-only", "count": 10, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte&technology=generic-scrnaseq-only", "selected": false}, {"value": "bulk", "label": "bulk", "count": 8, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte&technology=bulk", "selected": false}], "truncated": false}}, "suggested_facets": [], "next": "69434", "next_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Oocyte&_next=69434", "private": false, "allow_execute_sql": true, "query_ms": 151.81492699775845}