{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where experiment.library_layout = \"SINGLE\", technology = \"unknown\" and tissue_curation = \"Embryo Imprecise\"", "rows": [[3015, "ERR1396841", "ERX1468100", "ERS1051448", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph230 dgcr8 C7", "SAMEA3864314", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864314|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:35Z|INSDC status:public|Submitter Id:2a85d100 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dgcr8  allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a85d100 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 2#24", "15616955", "Illumina sequencing of library 15616955  constructed from sample accession ERS1051448 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 2.  This submission includes reads tagged with the sequence ATTCCT.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_2#24.cram", "cram", 252742350.0, 5054847.0, "SC RUN 18732 2#24", "0:50", "A:72444190;C:64568625;G:62796637;T:52911792;N:21106", 50, null, null, null, 72444190, 64568625, 62796637, 52911792, 21106, "ERX1468100", "ERS1051448", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.61824, null, 0.09608, null, 0.8842, null, 0.56978, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [3039, "ERR1396817", "ERX1468076", "ERS1051448", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph230 dgcr8 C7", "SAMEA3864314", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864314|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:35Z|INSDC status:public|Submitter Id:2a85d100 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dgcr8  allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a85d100 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 1#24", "15616955", "Illumina sequencing of library 15616955  constructed from sample accession ERS1051448 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 1.  This submission includes reads tagged with the sequence ATTCCT.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_1#24.cram", "cram", 258624300.0, 5172486.0, "SC RUN 18732 1#24", "0:50", "A:74123846;C:66047722;G:64286422;T:54141623;N:24687", 50, null, null, null, 74123846, 66047722, 64286422, 54141623, 24687, "ERX1468076", "ERS1051448", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.62009, null, 0.09612, null, 0.88434, null, 0.55718, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [8088, "ERR034127", "ERX012653", "ERS032268", "ERP000635", "PRJEB2512", "The Zebrafish transcriptome during early development", "KI-BN-JKE-DRERIO-RNASEQ-2011", "Transcriptome Analysis", "Background: Zebrafish Danio rerio is an important model for the study of early vertebrate development. The transition from fertilized egg to embryo is accompanied by a multitude of changes in gene expression and the transcriptional events that underlie these processes have not been fully characterized. In this study we use RNA Seq to characterize and compare the transcriptome of four early developmental stages in zebrafish on a global scale. Results: An average of 79M total reads were detected from the different stages. Out of the total number of reads 65%   73% reads were successfully mapped to the zebrafish genome and 36%   44% out of those were uniquely mapped. The total number of detected unique gene transcripts was 11187 of which 10096 of these were already present at 1 cell stage. The largest number of common transcripts was observed between 1 cell stage and 16 cell stage. An enrichment of gene transcripts with molecular functions of DNA binding  protein folding and processing as well as metal ion binding was observed with progression of development. To confirm our RNA Seq results  and to further investigate the developmental expression of specific genes  the transcript levels of a subset of genes were analyzed using TaqMan\u00ae array micro fluidic card TLDA. Conclusion: Clustering analysis of the detected transcripts show a majority of gene transcripts being present at steady levels  with a minority of the gene transcripts clustering as increasing or decreasing in expression during development. Developmental stages pre MBT were similar when comparing highly expressed genes  whereas 50% epiboly stage differed from the earlier three stages in highly expressed genes  number of uniquely expressed genes and enrichment of GO molecular functions.", null, null, "RNA extracted from zebrafish embryo at 50% epiboly stage", "zebrafish embryo 50 epiboly", "SAMEA791629", "Department of Biosciences and Nutrition, Karolinska Institutet, Sweden", "ENA first public:2011 06 09|ENA last update:2018 03 08|External Id:SAMEA791629|INSDC center alias:KI BN|INSDC center name:Department of Biosciences and Nutrition  Karolinska Institutet  Sweden|INSDC first public:2011 06 09T11:04:10Z|INSDC last update:2018 03 08T15:26:39Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2011 50epiboly|common name:zebrafish|sample name:KI BN JKE DRERIO RNASEQ 2011 50epiboly|sex:mixed|strain:Tuebingen", null, null, null, null, null, null, null, null, "Transcriptome profiling of early zebrafish development", "KI BN JKE DRERIO RNASEQ 2011 50epiboly", "JKE Drerio rna seq", "Transcriptome profiling of 50% epiboly stages of zebrafish embryos.", "Total RNA was extracted from approximately 150 embryos                     per developmental stage using Trireagent                     Sigma Aldrich. The total RNA was then processed                     further according to the Small RNA Expression Kit                     Applied Biosystems.", null, "RNA-Seq", "TRANSCRIPTOMIC", "RANDOM", "SINGLE", "ABI_SOLID", "AB SOLiD System 3.0", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>50</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "ERP000635", "AB SOLiD System 3.0 sequencing; Transcriptome profiling of early zebrafish development", "ENA FIRST PUBLIC:2011 06 09|ENA LAST UPDATE:2018 11 16", "KI-BN-JKE-DRERIO-RNASEQ-2011-50epiboly.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-2011-50epiboly_QV.qual.gz", "SOLiD_native SOLiD_native", 3929903550.0, 78598071.0, "KI BN JKE DRERIO RNASEQ 2011 50epiboly", "0:50", null, 50, null, null, null, null, null, null, null, null, "ERX012653", "ERS032268", "ERA029959", "KI-BN|Department of Biosciences and Nutrition", "Department of Biosciences and Nutrition, Karolinska Institutet, Sweden", 1, 0.60757, null, 0.09893, null, 0.94899, null, 0.77821, null, 50, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "Sweden", "2011-06-09", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [8089, "ERR034126", "ERX012652", "ERS032267", "ERP000635", "PRJEB2512", "The Zebrafish transcriptome during early development", "KI-BN-JKE-DRERIO-RNASEQ-2011", "Transcriptome Analysis", "Background: Zebrafish Danio rerio is an important model for the study of early vertebrate development. The transition from fertilized egg to embryo is accompanied by a multitude of changes in gene expression and the transcriptional events that underlie these processes have not been fully characterized. In this study we use RNA Seq to characterize and compare the transcriptome of four early developmental stages in zebrafish on a global scale. Results: An average of 79M total reads were detected from the different stages. Out of the total number of reads 65%   73% reads were successfully mapped to the zebrafish genome and 36%   44% out of those were uniquely mapped. The total number of detected unique gene transcripts was 11187 of which 10096 of these were already present at 1 cell stage. The largest number of common transcripts was observed between 1 cell stage and 16 cell stage. An enrichment of gene transcripts with molecular functions of DNA binding  protein folding and processing as well as metal ion binding was observed with progression of development. To confirm our RNA Seq results  and to further investigate the developmental expression of specific genes  the transcript levels of a subset of genes were analyzed using TaqMan\u00ae array micro fluidic card TLDA. Conclusion: Clustering analysis of the detected transcripts show a majority of gene transcripts being present at steady levels  with a minority of the gene transcripts clustering as increasing or decreasing in expression during development. Developmental stages pre MBT were similar when comparing highly expressed genes  whereas 50% epiboly stage differed from the earlier three stages in highly expressed genes  number of uniquely expressed genes and enrichment of GO molecular functions.", null, null, "RNA extracted from zebrafish embryo at 512 cell stage", "zebrafish embryo 512 cell", "SAMEA791632", "Department of Biosciences and Nutrition, Karolinska Institutet, Sweden", "ENA first public:2011 06 09|ENA last update:2018 03 08|External Id:SAMEA791632|INSDC center alias:KI BN|INSDC center name:Department of Biosciences and Nutrition  Karolinska Institutet  Sweden|INSDC first public:2011 06 09T11:04:10Z|INSDC last update:2018 03 08T15:26:39Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2011 512cell|common name:zebrafish|sample name:KI BN JKE DRERIO RNASEQ 2011 512cell|sex:mixed|strain:Tuebingen", null, null, null, null, null, null, null, null, "Transcriptome profiling of early zebrafish development", "KI BN JKE DRERIO RNASEQ 2011 512cell", "JKE Drerio rna seq", "Transcriptome profiling of 512 cell stage of zebrafish embryos.", "Total RNA was extracted from approximately 150 embryos                     per developmental stage using Trireagent                     Sigma Aldrich. The total RNA was then processed                     further according to the Small RNA Expression Kit                     Applied Biosystems.", null, "RNA-Seq", "TRANSCRIPTOMIC", "RANDOM", "SINGLE", "ABI_SOLID", "AB SOLiD System 3.0", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>50</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "ERP000635", "AB SOLiD System 3.0 sequencing; Transcriptome profiling of early zebrafish development", "ENA FIRST PUBLIC:2011 06 09|ENA LAST UPDATE:2018 11 16", "KI-BN-JKE-DRERIO-RNASEQ-2011-512cell.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-2011-512cell_QV.qual.gz", "SOLiD_native SOLiD_native", 3918756250.0, 78375125.0, "KI BN JKE DRERIO RNASEQ 2011 512cell", "0:50", null, 50, null, null, null, null, null, null, null, null, "ERX012652", "ERS032267", "ERA029959", "KI-BN|Department of Biosciences and Nutrition", "Department of Biosciences and Nutrition, Karolinska Institutet, Sweden", 1, 0.63824, null, 0.09111, null, 0.91969, null, 0.73496, null, 50, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "Sweden", "2011-06-09", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [8090, "ERR034125", "ERX012651", "ERS032266", "ERP000635", "PRJEB2512", "The Zebrafish transcriptome during early development", "KI-BN-JKE-DRERIO-RNASEQ-2011", "Transcriptome Analysis", "Background: Zebrafish Danio rerio is an important model for the study of early vertebrate development. The transition from fertilized egg to embryo is accompanied by a multitude of changes in gene expression and the transcriptional events that underlie these processes have not been fully characterized. In this study we use RNA Seq to characterize and compare the transcriptome of four early developmental stages in zebrafish on a global scale. Results: An average of 79M total reads were detected from the different stages. Out of the total number of reads 65%   73% reads were successfully mapped to the zebrafish genome and 36%   44% out of those were uniquely mapped. The total number of detected unique gene transcripts was 11187 of which 10096 of these were already present at 1 cell stage. The largest number of common transcripts was observed between 1 cell stage and 16 cell stage. An enrichment of gene transcripts with molecular functions of DNA binding  protein folding and processing as well as metal ion binding was observed with progression of development. To confirm our RNA Seq results  and to further investigate the developmental expression of specific genes  the transcript levels of a subset of genes were analyzed using TaqMan\u00ae array micro fluidic card TLDA. Conclusion: Clustering analysis of the detected transcripts show a majority of gene transcripts being present at steady levels  with a minority of the gene transcripts clustering as increasing or decreasing in expression during development. Developmental stages pre MBT were similar when comparing highly expressed genes  whereas 50% epiboly stage differed from the earlier three stages in highly expressed genes  number of uniquely expressed genes and enrichment of GO molecular functions.", null, null, "RNA extracted from zebrafish embryo at 16 cell stage", "zebrafish embryo 16 cell", "SAMEA791631", "Department of Biosciences and Nutrition, Karolinska Institutet, Sweden", "ENA first public:2011 06 09|ENA last update:2018 03 08|External Id:SAMEA791631|INSDC center alias:KI BN|INSDC center name:Department of Biosciences and Nutrition  Karolinska Institutet  Sweden|INSDC first public:2011 06 09T11:04:10Z|INSDC last update:2018 03 08T15:26:39Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2011 16cell|common name:zebrafish|sample name:KI BN JKE DRERIO RNASEQ 2011 16cell|sex:mixed|strain:Tuebingen", null, null, null, null, null, null, null, null, "Transcriptome profiling of early zebrafish development", "KI BN JKE DRERIO RNASEQ 2011 16cell", "JKE Drerio rna seq", "Transcriptome profiling of 16 cell stage of zebrafish embryos.", "Total RNA was extracted from approximately 150 embryos                     per developmental stage using Trireagent                     Sigma Aldrich. The total RNA was then processed                     further according to the Small RNA Expression Kit                     Applied Biosystems.", null, "RNA-Seq", "TRANSCRIPTOMIC", "RANDOM", "SINGLE", "ABI_SOLID", "AB SOLiD System 3.0", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>50</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "ERP000635", "AB SOLiD System 3.0 sequencing; Transcriptome profiling of early zebrafish development", "ENA FIRST PUBLIC:2011 06 09|ENA LAST UPDATE:2018 11 16", "KI-BN-JKE-DRERIO-RNASEQ-2011-16cell.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-2011-16cell_QV.qual.gz", "SOLiD_native SOLiD_native", 4256756500.0, 85135130.0, "KI BN JKE DRERIO RNASEQ 2011 16cell", "0:50", null, 50, null, null, null, null, null, null, null, null, "ERX012651", "ERS032266", "ERA029959", "KI-BN|Department of Biosciences and Nutrition", "Department of Biosciences and Nutrition, Karolinska Institutet, Sweden", 1, 0.57946, null, 0.08115, null, 0.91896, null, 0.72164, null, 50, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "Sweden", "2011-06-09", "Cleavage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [8091, "ERR034124", "ERX012650", "ERS032265", "ERP000635", "PRJEB2512", "The Zebrafish transcriptome during early development", "KI-BN-JKE-DRERIO-RNASEQ-2011", "Transcriptome Analysis", "Background: Zebrafish Danio rerio is an important model for the study of early vertebrate development. The transition from fertilized egg to embryo is accompanied by a multitude of changes in gene expression and the transcriptional events that underlie these processes have not been fully characterized. In this study we use RNA Seq to characterize and compare the transcriptome of four early developmental stages in zebrafish on a global scale. Results: An average of 79M total reads were detected from the different stages. Out of the total number of reads 65%   73% reads were successfully mapped to the zebrafish genome and 36%   44% out of those were uniquely mapped. The total number of detected unique gene transcripts was 11187 of which 10096 of these were already present at 1 cell stage. The largest number of common transcripts was observed between 1 cell stage and 16 cell stage. An enrichment of gene transcripts with molecular functions of DNA binding  protein folding and processing as well as metal ion binding was observed with progression of development. To confirm our RNA Seq results  and to further investigate the developmental expression of specific genes  the transcript levels of a subset of genes were analyzed using TaqMan\u00ae array micro fluidic card TLDA. Conclusion: Clustering analysis of the detected transcripts show a majority of gene transcripts being present at steady levels  with a minority of the gene transcripts clustering as increasing or decreasing in expression during development. Developmental stages pre MBT were similar when comparing highly expressed genes  whereas 50% epiboly stage differed from the earlier three stages in highly expressed genes  number of uniquely expressed genes and enrichment of GO molecular functions.", null, null, "RNA extracted from zebrafish embryo at 1 cell stage", "zebrafish embryo 1 cell", "SAMEA791630", "Department of Biosciences and Nutrition, Karolinska Institutet, Sweden", "ENA first public:2011 06 09|ENA last update:2018 03 08|External Id:SAMEA791630|INSDC center alias:KI BN|INSDC center name:Department of Biosciences and Nutrition  Karolinska Institutet  Sweden|INSDC first public:2011 06 09T11:04:10Z|INSDC last update:2018 03 08T15:26:39Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2011 1cell|common name:zebrafish|sample name:KI BN JKE DRERIO RNASEQ 2011 1cell|sex:mixed|strain:Tuebingen", null, null, null, null, null, null, null, null, "Transcriptome profiling of early zebrafish development", "KI BN JKE DRERIO RNASEQ 2011 1cell", "JKE Drerio rna seq", "Transcriptome profiling of 1 cell stage of zebrafish embryos.", "Total RNA was extracted from approximately 150 embryos                 per developmental stage using Trireagent                 Sigma Aldrich. The total RNA was then processed                 further according to the Small RNA Expression Kit                 Applied Biosystems.", null, "RNA-Seq", "TRANSCRIPTOMIC", "RANDOM", "SINGLE", "ABI_SOLID", "AB SOLiD System 3.0", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>50</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "ERP000635", "AB SOLiD System 3.0 sequencing; Transcriptome profiling of early zebrafish development", "ENA FIRST PUBLIC:2011 06 09|ENA LAST UPDATE:2018 11 16", "KI-BN-JKE-DRERIO-RNASEQ-2011-1cell.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-2011-1cell_QV.qual.gz", "SOLiD_native SOLiD_native", 3676380950.0, 73527619.0, "KI BN JKE DRERIO RNASEQ 2011 1cell", "0:50", null, 50, null, null, null, null, null, null, null, null, "ERX012650", "ERS032265", "ERA029959", "KI-BN|Department of Biosciences and Nutrition", "Department of Biosciences and Nutrition, Karolinska Institutet, Sweden", 1, 0.64855, null, 0.08432, null, 0.9052, null, 0.74223, null, 50, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "Sweden", "2011-06-09", "Zygote", "Embryo", "Embryo Imprecise", "All anatomical structures"], [9361, "ERR3011947", "ERX3014407", "ERS2994081", "ERP112907", "PRJEB30451", "Effects of anti androgenic compounds on zebrafish insulin mutants", "E-MTAB-7283", "Transcriptome Analysis", "Aiming to identify insulin independent modulators of glucose homeostasis  we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists.  To investigate how AR antagonism mediates glucose level reduction in ins mutants  we evaluated the effects of antagonist treatment using transcriptomic studies.  RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants.", "ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18", null, "Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled  water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set  Promega to avoid contamination by genomic DNA. 3\u00b5g of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina", "Flutamide 2", "SAMEA5186582", "Max Planck Institute for Heart and Lung Research", "ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186582|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:Flutamide 2|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:Flutamide 2|scientific name:Danio rerio|strain:ins bns102", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants", "E MTAB 7283:Flutamide 2 s", "Flutamide 2 s", "Effects of anti androgenic compounds on zebrafish insulin mutants", "insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water.  10 animals per sample were pooled  water was removed and Trizol was added.  Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf.  Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set  Promega to avoid contamination by genomic DNA. 3\u00b5g of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina", "Experimental Factor: compound:flutamide|Experimental Factor: dose:10", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP112907", "NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants", "ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18", "Teja_Flutamide_2_R1.fastq.gz", "fastq", 1754963940.0, 23552243.0, "E MTAB 7283:Flutamide 2", "0:74.51 1:0", "A:455444321;C:410713896;G:385640226;T:503155736;N:9761", 74, 0, null, null, 455444321, 410713896, 385640226, 503155736, 9761, "ERX3014407", "ERS2994081", "ERA1697296", "European Nucleotide Archive", "European Nucleotide Archive", 1, 0.94351, null, 0.11595, null, 0.67483, null, 0.48762, null, 73, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "poly_a", "trueseq", "bulk", "unknown", "unknown", null, "Unknown", "2018-12-18", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [9362, "ERR3011946", "ERX3014406", "ERS2994080", "ERP112907", "PRJEB30451", "Effects of anti androgenic compounds on zebrafish insulin mutants", "E-MTAB-7283", "Transcriptome Analysis", "Aiming to identify insulin independent modulators of glucose homeostasis  we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists.  To investigate how AR antagonism mediates glucose level reduction in ins mutants  we evaluated the effects of antagonist treatment using transcriptomic studies.  RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants.", "ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18", null, "Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled  water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set  Promega to avoid contamination by genomic DNA. 3\u00b5g of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina", "Flutamide 1", "SAMEA5186581", "Max Planck Institute for Heart and Lung Research", "ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186581|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:Flutamide 1|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:Flutamide 1|scientific name:Danio rerio|strain:ins bns102", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants", "E MTAB 7283:Flutamide 1 s", "Flutamide 1 s", "Effects of anti androgenic compounds on zebrafish insulin mutants", "insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water.  10 animals per sample were pooled  water was removed and Trizol was added.  Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf.  Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set  Promega to avoid contamination by genomic DNA. 3\u00b5g of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina", "Experimental Factor: compound:flutamide|Experimental Factor: dose:10", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP112907", "NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants", "ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18", "Teja_Flutamide_1_R1.fastq.gz", "fastq", 1631102863.0, 21898245.0, "E MTAB 7283:Flutamide 1", "0:74.49 1:0", "A:424378341;C:380806325;G:358128992;T:467779945;N:9260", 74, 0, null, null, 424378341, 380806325, 358128992, 467779945, 9260, "ERX3014406", "ERS2994080", "ERA1697296", "European Nucleotide Archive", "European Nucleotide Archive", 1, 0.94332, null, 0.11797, null, 0.67596, null, 0.48847, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "poly_a", "trueseq", "bulk", "unknown", "unknown", null, "Unknown", "2018-12-18", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [9363, "ERR3011945", "ERX3014405", "ERS2994079", "ERP112907", "PRJEB30451", "Effects of anti androgenic compounds on zebrafish insulin mutants", "E-MTAB-7283", "Transcriptome Analysis", "Aiming to identify insulin independent modulators of glucose homeostasis  we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists.  To investigate how AR antagonism mediates glucose level reduction in ins mutants  we evaluated the effects of antagonist treatment using transcriptomic studies.  RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants.", "ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18", null, "Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled  water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set  Promega to avoid contamination by genomic DNA. 3\u00b5g of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina", "DMSO 2", "SAMEA5186580", "Max Planck Institute for Heart and Lung Research", "ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186580|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:DMSO 2|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:DMSO 2|scientific name:Danio rerio|strain:ins bns102", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants", "E MTAB 7283:DMSO 2 s", "DMSO 2 s", "Effects of anti androgenic compounds on zebrafish insulin mutants", "insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water.  10 animals per sample were pooled  water was removed and Trizol was added.  Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf.  Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set  Promega to avoid contamination by genomic DNA. 3\u00b5g of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina", "Experimental Factor: compound:dimethyl sulfoxide|Experimental Factor: dose:1", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP112907", "NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants", "ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18", "Teja_DMSO_2_R1.fastq.gz", "fastq", 1811573293.0, 24316929.0, "E MTAB 7283:DMSO 2", "0:74.50 1:0", "A:470888315;C:423635861;G:396796840;T:520242179;N:10098", 74, 0, null, null, 470888315, 423635861, 396796840, 520242179, 10098, "ERX3014405", "ERS2994079", "ERA1697296", "European Nucleotide Archive", "European Nucleotide Archive", 1, 0.94219, null, 0.12305, null, 0.67184, null, 0.47704, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "poly_a", "trueseq", "bulk", "unknown", "unknown", null, "Unknown", "2018-12-18", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [9364, "ERR3011944", "ERX3014404", "ERS2994078", "ERP112907", "PRJEB30451", "Effects of anti androgenic compounds on zebrafish insulin mutants", "E-MTAB-7283", "Transcriptome Analysis", "Aiming to identify insulin independent modulators of glucose homeostasis  we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists.  To investigate how AR antagonism mediates glucose level reduction in ins mutants  we evaluated the effects of antagonist treatment using transcriptomic studies.  RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants.", "ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18", null, "Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled  water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set  Promega to avoid contamination by genomic DNA. 3\u00b5g of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina", "DMSO 1", "SAMEA5186579", "Max Planck Institute for Heart and Lung Research", "ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186579|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:DMSO 1|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:DMSO 1|scientific name:Danio rerio|strain:ins bns102", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants", "E MTAB 7283:DMSO 1 s", "DMSO 1 s", "Effects of anti androgenic compounds on zebrafish insulin mutants", "insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water.  10 animals per sample were pooled  water was removed and Trizol was added.  Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf.  Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set  Promega to avoid contamination by genomic DNA. 3\u00b5g of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina", "Experimental Factor: compound:dimethyl sulfoxide|Experimental Factor: dose:1", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP112907", "NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants", "ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18", "Teja_DMSO_1_R1.fastq.gz", "fastq", 1609807409.0, 21611475.0, "E MTAB 7283:DMSO 1", "0:74.49 1:0", "A:420253680;C:374436301;G:352526427;T:462581933;N:9068", 74, 0, null, null, 420253680, 374436301, 352526427, 462581933, 9068, "ERX3014404", "ERS2994078", "ERA1697296", "European Nucleotide Archive", "European Nucleotide Archive", 1, 0.94094, null, 0.12292, null, 0.67006, null, 0.48442, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "poly_a", "trueseq", "bulk", "unknown", "unknown", null, "Unknown", "2018-12-18", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [9365, "ERR3011943", "ERX3014403", "ERS2994077", "ERP112907", "PRJEB30451", "Effects of anti androgenic compounds on zebrafish insulin mutants", "E-MTAB-7283", "Transcriptome Analysis", "Aiming to identify insulin independent modulators of glucose homeostasis  we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists.  To investigate how AR antagonism mediates glucose level reduction in ins mutants  we evaluated the effects of antagonist treatment using transcriptomic studies.  RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants.", "ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18", null, "Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled  water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set  Promega to avoid contamination by genomic DNA. 3\u00b5g of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina", "Cyproter1 2", "SAMEA5186578", "Max Planck Institute for Heart and Lung Research", "ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186578|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:Cyproter1 2|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:Cyproter1 2|scientific name:Danio rerio|strain:ins bns102", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants", "E MTAB 7283:Cyproterone 2 s", "Cyproterone 2 s", "Effects of anti androgenic compounds on zebrafish insulin mutants", "insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water.  10 animals per sample were pooled  water was removed and Trizol was added.  Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf.  Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set  Promega to avoid contamination by genomic DNA. 3\u00b5g of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina", "Experimental Factor: compound:cyproter1|Experimental Factor: dose:10", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP112907", "NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants", "ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18", "Teja_Cyproterone_2_R1.fastq.gz", "fastq", 1823142918.0, 24468337.0, "E MTAB 7283:Cyproterone 2", "0:74.51 1:0", "A:469387174;C:428783310;G:403791044;T:521171021;N:10369", 74, 0, null, null, 469387174, 428783310, 403791044, 521171021, 10369, "ERX3014403", "ERS2994077", "ERA1697296", "European Nucleotide Archive", "European Nucleotide Archive", 1, 0.9432, null, 0.11718, null, 0.67389, null, 0.4768, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "poly_a", "trueseq", "bulk", "unknown", "unknown", null, "Unknown", "2018-12-18", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [9366, "ERR3011942", "ERX3014402", "ERS2994076", "ERP112907", "PRJEB30451", "Effects of anti androgenic compounds on zebrafish insulin mutants", "E-MTAB-7283", "Transcriptome Analysis", "Aiming to identify insulin independent modulators of glucose homeostasis  we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists.  To investigate how AR antagonism mediates glucose level reduction in ins mutants  we evaluated the effects of antagonist treatment using transcriptomic studies.  RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants.", "ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18", null, "Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled  water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set  Promega to avoid contamination by genomic DNA. 3\u00b5g of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina", "Cyproter1 1", "SAMEA5186577", "Max Planck Institute for Heart and Lung Research", "ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186577|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:Cyproter1 1|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:Cyproter1 1|scientific name:Danio rerio|strain:ins bns102", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants", "E MTAB 7283:Cyproterone 1 s", "Cyproterone 1 s", "Effects of anti androgenic compounds on zebrafish insulin mutants", "insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water.  10 animals per sample were pooled  water was removed and Trizol was added.  Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf.  Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set  Promega to avoid contamination by genomic DNA. 3\u00b5g of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina", "Experimental Factor: compound:cyproter1|Experimental Factor: dose:10", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP112907", "NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants", "ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18", "Teja_Cyproterone_1_R1.fastq.gz", "fastq", 1901027130.0, 25512731.0, "E MTAB 7283:Cyproterone 1", "0:74.51 1:0", "A:487302419;C:449208827;G:422183780;T:542321577;N:10527", 74, 0, null, null, 487302419, 449208827, 422183780, 542321577, 10527, "ERX3014402", "ERS2994076", "ERA1697296", "European Nucleotide Archive", "European Nucleotide Archive", 1, 0.94427, null, 0.11318, null, 0.67294, null, 0.47183, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "poly_a", "trueseq", "bulk", "unknown", "unknown", null, "Unknown", "2018-12-18", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [11041, "ERR9995536", "ERX9536682", "ERS12521224", "ERP138294", "PRJEB53494", "Nano3P seq: transcriptome wide analysis of gene expression and tail dynamics using end capture nanopore cDNA sequencing", "94bf5509-4622-4d5f-b7c5-6a14bdfac340", "Other", "RNA polyadenylation plays a central role in RNA maturation  fate  and stability. In response to developmental cues  polyA tail lengths can vary  affecting the translation efficiency and stability of mRNAs. Here  we develop Nanopore three prime end capture sequencing Nano3P seq  a novel method that relies on nanopore cDNA sequencing to simultaneously quantify RNA abundance  tail composition and tail length dynamics at per read resolution. By employing a template switching based sequencing protocol  Nano3P seq can sequence any given RNA molecule from its three prime end  regardless of its polyadenylation status  without xxx need for PCR amplification or ligation of RNA adapters. We demonstrate that Nano3P seq captures a wide diversity of RNA biotypes  providing quantitative estimates of RNA abundance and tail lengths in mRNA  lncRNA  sn/snoRNA  scaRNA  and rRNA molecules. We find that  in addition to mRNA and lncRNA  polyA tails can be identified in 16S mitochondrial rRNA in both mouse and zebrafish models. Moreover  we show that mRNA tail lengths are dynamically regulated during vertebrate embryogenesis at an isoform specific level  correlating with mRNA decay. Finally  we identify non A bases within polyA tails of various lengths and reveal their distribution during vertebrate embryogenesis.  Overall  Nano3P seq is a simple and robust method for accurately estimating transcript levels  tail lengths  and tail composition heterogeneity in individual reads  with minimal library preparation biases  both in the coding and non coding transcriptome.", "ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10", null, "dRNA seq of 4hpf Zebrafish embryos", "Zebrafish dRNA 4hpf", "SAMEA110422854", "CENTER FOR GENOMIC REGULATION (CRG)", "ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10|External Id:SAMEA110422854|INSDC center alias:CENTER FOR GENOMIC REGULATION CRG|INSDC center name:CENTER FOR GENOMIC REGULATION CRG|INSDC first public:2022 10 10T00:21:01Z|INSDC last update:2022 10 10T00:21:01Z|INSDC status:public|Submitter Id:Zebrafish dRNA 4hpf|common name:zebrafish|sample name:Zebrafish dRNA 4hpf", null, null, null, null, null, null, null, null, "MinION sequencing", "ena EXPERIMENT TAB 27 07 2022 11:41:43:673 3", "Zebrafish dRNA 4hpf", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "OXFORD_NANOPORE", "MinION", null, "ERP138294", "MinION sequencing", "ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10|instrument model:PromethION", "PDBN042841_dRNA_4hpf.tar.gz", "nanopore", 772304625.0, 897768.0, "ena RUN TAB 27 07 2022 11:41:43:690 4", "0:860.25", "A:224977035;C:165273397;G:156659356;T:225394837;N:0", 860, null, null, null, 224977035, 165273397, 156659356, 225394837, 0, "ERX9536682", "ERS12521224", "ERA16500713", "CENTER FOR GENOMIC REGULATION (CRG)|European Nucleotide Archive", "CENTER FOR GENOMIC REGULATION (CRG)", null, null, null, null, null, null, null, null, null, null, null, null, null, null, "ont", "ont", "3prime", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Spain", "2022-10-10", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15070, "ERR12476466", "ERX11852287", "ERS17743541", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1219 from a cross with a starved father", "1219 Starved", "1219S", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:193 277029", "1219S", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1219S_S12_L003_R1_001.fastq.gz", "fastq", 97592891.0, 1298822.0, "ena RUN TAB 15 01 2024 21:42:36:193 277030", "0:75.14", "A:34708924;C:19086989;G:21325291;T:22442527;N:29160", 75, null, null, null, 34708924, 19086989, 21325291, 22442527, 29160, "ERX11852287", "ERS17743541", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15071, "ERR12476447", "ERX11852268", "ERS17743536", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1203 from a cross with a fed father", "1203 Fed", "1203F", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:179 276991", "1203F", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1203F_S5_L004_R1_001.fastq.gz", "fastq", 92134036.0, 1226106.0, "ena RUN TAB 15 01 2024 21:42:36:179 276992", "0:75.14", "A:33032252;C:17497320;G:19713134;T:21873197;N:18133", 75, null, null, null, 33032252, 17497320, 19713134, 21873197, 18133, "ERX11852268", "ERS17743536", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15072, "ERR12476437", "ERX11852258", "ERS17743534", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1118 from a cross with a fed father", "1118 Fed", "1118F", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:172 276971", "1118F", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1118F_S9_L002_R1_001.fastq.gz", "fastq", 98606332.0, 1311676.0, "ena RUN TAB 15 01 2024 21:42:36:172 276972", "0:75.18", "A:35097475;C:19013865;G:21072825;T:23400976;N:21191", 75, null, null, null, 35097475, 19013865, 21072825, 23400976, 21191, "ERX11852258", "ERS17743534", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15073, "ERR12476468", "ERX11852289", "ERS17743542", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1242 from a cross with a fed father", "1242D Fed", "1242FD", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:194 277033", "1242FD", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1242FD_S13_L001_R1_001.fastq.gz", "fastq", 89342488.0, 1186885.0, "ena RUN TAB 15 01 2024 21:42:36:194 277034", "0:75.27", "A:31174342;C:17129181;G:18704493;T:22323017;N:11455", 75, null, null, null, 31174342, 17129181, 18704493, 22323017, 11455, "ERX11852289", "ERS17743542", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15074, "ERR12476438", "ERX11852259", "ERS17743534", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1118 from a cross with a fed father", "1118 Fed", "1118F", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:173 276973", "1118F", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1118F_S9_L003_R1_001.fastq.gz", "fastq", 98443412.0, 1309747.0, "ena RUN TAB 15 01 2024 21:42:36:173 276974", "0:75.16", "A:35171021;C:18991511;G:20974950;T:23280285;N:25645", 75, null, null, null, 35171021, 18991511, 20974950, 23280285, 25645, "ERX11852259", "ERS17743534", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15075, "ERR12476442", "ERX11852263", "ERS17743535", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1118 from a cross with a starved father", "1118 Starved", "1118S", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:176 276981", "1118S", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1118S_S10_L003_R1_001.fastq.gz", "fastq", 98865255.0, 1315357.0, "ena RUN TAB 15 01 2024 21:42:36:176 276982", "0:75.16", "A:34981471;C:19126822;G:21304286;T:23427226;N:25450", 75, null, null, null, 34981471, 19126822, 21304286, 23427226, 25450, "ERX11852263", "ERS17743535", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15076, "ERR12476467", "ERX11852288", "ERS17743541", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1219 from a cross with a starved father", "1219 Starved", "1219S", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:193 277031", "1219S", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1219S_S12_L004_R1_001.fastq.gz", "fastq", 88230016.0, 1174256.0, "ena RUN TAB 15 01 2024 21:42:36:194 277032", "0:75.14", "A:31409300;C:17203675;G:19284478;T:20309174;N:23389", 75, null, null, null, 31409300, 17203675, 19284478, 20309174, 23389, "ERX11852288", "ERS17743541", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15077, "ERR12476470", "ERX11852291", "ERS17743542", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1242 from a cross with a fed father", "1242D Fed", "1242FD", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:195 277037", "1242FD", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1242FD_S13_L003_R1_001.fastq.gz", "fastq", 93375090.0, 1240903.0, "ena RUN TAB 15 01 2024 21:42:36:196 277038", "0:75.25", "A:32510114;C:17950920;G:19575617;T:23324862;N:13577", 75, null, null, null, 32510114, 17950920, 19575617, 23324862, 13577, "ERX11852291", "ERS17743542", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15078, "ERR12476436", "ERX11852257", "ERS17743534", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1118 from a cross with a fed father", "1118 Fed", "1118F", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:171 276969", "1118F", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1118F_S9_L001_R1_001.fastq.gz", "fastq", 94258948.0, 1253428.0, "ena RUN TAB 15 01 2024 21:42:36:171 276970", "0:75.20", "A:33713614;C:18157124;G:20086205;T:22277451;N:24554", 75, null, null, null, 33713614, 18157124, 20086205, 22277451, 24554, "ERX11852257", "ERS17743534", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15079, "ERR12476452", "ERX11852273", "ERS17743538", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1210 from a cross with a fed father", "1210 Fed", "1210F", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:183 277001", "1210F", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1210F_S7_L001_R1_001.fastq.gz", "fastq", 96414625.0, 1283672.0, "ena RUN TAB 15 01 2024 21:42:36:183 277002", "0:75.11", "A:35605799;C:18366729;G:20807908;T:21594044;N:40145", 75, null, null, null, 35605799, 18366729, 20807908, 21594044, 40145, "ERX11852273", "ERS17743538", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15080, "ERR12476475", "ERX11852296", "ERS17743544", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1242 from a cross with a fed father", "1242E Fed", "1242FE", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:199 277047", "1242FE", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1242FE_S15_L004_R1_001.fastq.gz", "fastq", 99581325.0, 1325945.0, "ena RUN TAB 15 01 2024 21:42:36:199 277048", "0:75.10", "A:36802442;C:18868511;G:20958294;T:22926783;N:25295", 75, null, null, null, 36802442, 18868511, 20958294, 22926783, 25295, "ERX11852296", "ERS17743544", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15081, "ERR12476478", "ERX11852299", "ERS17743543", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1242 from a cross with a starved father", "1242D Starved", "1242SD", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:201 277053", "1242SD", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1242SD_S14_L003_R1_001.fastq.gz", "fastq", 95457398.0, 1268859.0, "ena RUN TAB 15 01 2024 21:42:36:202 277054", "0:75.23", "A:33339157;C:18598733;G:20350072;T:23148005;N:21431", 75, null, null, null, 33339157, 18598733, 20350072, 23148005, 21431, "ERX11852299", "ERS17743543", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15082, "ERR12476473", "ERX11852294", "ERS17743544", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1242 from a cross with a fed father", "1242E Fed", "1242FE", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:198 277043", "1242FE", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1242FE_S15_L002_R1_001.fastq.gz", "fastq", 111191327.0, 1479982.0, "ena RUN TAB 15 01 2024 21:42:36:198 277044", "0:75.13", "A:40873794;C:21118758;G:23508088;T:25663516;N:27171", 75, null, null, null, 40873794, 21118758, 23508088, 25663516, 27171, "ERX11852294", "ERS17743544", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15083, "ERR12476472", "ERX11852293", "ERS17743544", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1242 from a cross with a fed father", "1242E Fed", "1242FE", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:197 277041", "1242FE", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1242FE_S15_L001_R1_001.fastq.gz", "fastq", 105936834.0, 1409443.0, "ena RUN TAB 15 01 2024 21:42:36:197 277042", "0:75.16", "A:39084749;C:20103850;G:22336806;T:24384711;N:26718", 75, null, null, null, 39084749, 20103850, 22336806, 24384711, 26718, "ERX11852293", "ERS17743544", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15084, "ERR12476455", "ERX11852276", "ERS17743538", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1210 from a cross with a fed father", "1210 Fed", "1210F", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:185 277007", "1210F", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1210F_S7_L004_R1_001.fastq.gz", "fastq", 91003627.0, 1212716.0, "ena RUN TAB 15 01 2024 21:42:36:185 277008", "0:75.04", "A:33677348;C:17299066;G:19585548;T:20403064;N:38601", 75, null, null, null, 33677348, 17299066, 19585548, 20403064, 38601, "ERX11852276", "ERS17743538", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15085, "ERR12476450", "ERX11852271", "ERS17743537", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1203 from a cross with a starved father", "1203 Starved", "1203S", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:181 276997", "1203S", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1203S_S6_L003_R1_001.fastq.gz", "fastq", 93998632.0, 1251284.0, "ena RUN TAB 15 01 2024 21:42:36:182 276998", "0:75.12", "A:33959433;C:18143368;G:20041026;T:21824242;N:30563", 75, null, null, null, 33959433, 18143368, 20041026, 21824242, 30563, "ERX11852271", "ERS17743537", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15086, "ERR12476446", "ERX11852267", "ERS17743536", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1203 from a cross with a fed father", "1203 Fed", "1203F", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:178 276989", "1203F", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1203F_S5_L003_R1_001.fastq.gz", "fastq", 102209965.0, 1360067.0, "ena RUN TAB 15 01 2024 21:42:36:179 276990", "0:75.15", "A:36554629;C:19466103;G:21890238;T:24276196;N:22799", 75, null, null, null, 36554629, 19466103, 21890238, 24276196, 22799, "ERX11852267", "ERS17743536", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15087, "ERR12476458", "ERX11852279", "ERS17743539", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1210 from a cross with a starved father", "1210 Starved", "1210S", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:187 277013", "1210S", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1210S_S8_L003_R1_001.fastq.gz", "fastq", 109602092.0, 1466517.0, "ena RUN TAB 15 01 2024 21:42:36:187 277014", "0:74.74", "A:42677564;C:20838229;G:24413347;T:21498031;N:174921", 74, null, null, null, 42677564, 20838229, 24413347, 21498031, 174921, "ERX11852279", "ERS17743539", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15088, "ERR12476453", "ERX11852274", "ERS17743538", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1210 from a cross with a fed father", "1210 Fed", "1210F", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:183 277003", "1210F", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1210F_S7_L002_R1_001.fastq.gz", "fastq", 100538748.0, 1339248.0, "ena RUN TAB 15 01 2024 21:42:36:184 277004", "0:75.07", "A:36966184;C:19156780;G:21758079;T:22618911;N:38794", 75, null, null, null, 36966184, 19156780, 21758079, 22618911, 38794, "ERX11852274", "ERS17743538", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15089, "ERR12476460", "ERX11852281", "ERS17743540", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1219 from a cross with a fed father", "1219 Fed", "1219F", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:188 277017", "1219F", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1219F_S11_L001_R1_001.fastq.gz", "fastq", 102219114.0, 1358650.0, "ena RUN TAB 15 01 2024 21:42:36:189 277018", "0:75.24", "A:35886099;C:19931420;G:22057068;T:24325918;N:18609", 75, null, null, null, 35886099, 19931420, 22057068, 24325918, 18609, "ERX11852281", "ERS17743540", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15090, "ERR12476451", "ERX11852272", "ERS17743537", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1203 from a cross with a starved father", "1203 Starved", "1203S", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:182 276999", "1203S", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1203S_S6_L004_R1_001.fastq.gz", "fastq", 84880221.0, 1129985.0, "ena RUN TAB 15 01 2024 21:42:36:182 277000", "0:75.12", "A:30708531;C:16338743;G:18094345;T:19712906;N:25696", 75, null, null, null, 30708531, 16338743, 18094345, 19712906, 25696, "ERX11852272", "ERS17743537", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15091, "ERR12476441", "ERX11852262", "ERS17743535", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1118 from a cross with a starved father", "1118 Starved", "1118S", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:175 276979", "1118S", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1118S_S10_L002_R1_001.fastq.gz", "fastq", 99340604.0, 1321436.0, "ena RUN TAB 15 01 2024 21:42:36:175 276980", "0:75.18", "A:34996267;C:19218610;G:21486623;T:23616635;N:22469", 75, null, null, null, 34996267, 19218610, 21486623, 23616635, 22469, "ERX11852262", "ERS17743535", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15092, "ERR12476440", "ERX11852261", "ERS17743535", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1118 from a cross with a starved father", "1118 Starved", "1118S", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:174 276977", "1118S", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1118S_S10_L001_R1_001.fastq.gz", "fastq", 94655454.0, 1258724.0, "ena RUN TAB 15 01 2024 21:42:36:175 276978", "0:75.20", "A:33514914;C:18282513;G:20410100;T:22427564;N:20363", 75, null, null, null, 33514914, 18282513, 20410100, 22427564, 20363, "ERX11852261", "ERS17743535", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15093, "ERR12476469", "ERX11852290", "ERS17743542", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1242 from a cross with a fed father", "1242D Fed", "1242FD", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:195 277035", "1242FD", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1242FD_S13_L002_R1_001.fastq.gz", "fastq", 93346527.0, 1240308.0, "ena RUN TAB 15 01 2024 21:42:36:195 277036", "0:75.26", "A:32401771;C:17929540;G:19597511;T:23408465;N:9240", 75, null, null, null, 32401771, 17929540, 19597511, 23408465, 9240, "ERX11852290", "ERS17743542", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15094, "ERR12476462", "ERX11852283", "ERS17743540", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1219 from a cross with a fed father", "1219 Fed", "1219F", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:190 277021", "1219F", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1219F_S11_L003_R1_001.fastq.gz", "fastq", 106745726.0, 1419461.0, "ena RUN TAB 15 01 2024 21:42:36:190 277022", "0:75.20", "A:37396946;C:20851140;G:23075114;T:25400364;N:22162", 75, null, null, null, 37396946, 20851140, 23075114, 25400364, 22162, "ERX11852283", "ERS17743540", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15095, "ERR12476479", "ERX11852300", "ERS17743543", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1242 from a cross with a starved father", "1242D Starved", "1242SD", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:202 277055", "1242SD", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1242SD_S14_L004_R1_001.fastq.gz", "fastq", 85586412.0, 1137781.0, "ena RUN TAB 15 01 2024 21:42:36:202 277056", "0:75.22", "A:29963542;C:16621745;G:18219345;T:20761941;N:19839", 75, null, null, null, 29963542, 16621745, 18219345, 20761941, 19839, "ERX11852300", "ERS17743543", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15096, "ERR12476444", "ERX11852265", "ERS17743536", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1203 from a cross with a fed father", "1203 Fed", "1203F", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:177 276985", "1203F", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1203F_S5_L001_R1_001.fastq.gz", "fastq", 97624173.0, 1298240.0, "ena RUN TAB 15 01 2024 21:42:36:177 276986", "0:75.20", "A:34935070;C:18569640;G:20912883;T:23188491;N:18089", 75, null, null, null, 34935070, 18569640, 20912883, 23188491, 18089, "ERX11852265", "ERS17743536", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15097, "ERR12476471", "ERX11852292", "ERS17743542", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1242 from a cross with a fed father", "1242D Fed", "1242FD", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:196 277039", "1242FD", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1242FD_S13_L004_R1_001.fastq.gz", "fastq", 83383881.0, 1108207.0, "ena RUN TAB 15 01 2024 21:42:36:196 277040", "0:75.24", "A:29091135;C:15949002;G:17455499;T:20878004;N:10241", 75, null, null, null, 29091135, 15949002, 17455499, 20878004, 10241, "ERX11852292", "ERS17743542", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15098, "ERR12476439", "ERX11852260", "ERS17743534", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1118 from a cross with a fed father", "1118 Fed", "1118F", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:174 276975", "1118F", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1118F_S9_L004_R1_001.fastq.gz", "fastq", 88439160.0, 1176751.0, "ena RUN TAB 15 01 2024 21:42:36:174 276976", "0:75.16", "A:31652556;C:16996499;G:18832233;T:20937970;N:19902", 75, null, null, null, 31652556, 16996499, 18832233, 20937970, 19902, "ERX11852260", "ERS17743534", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15099, "ERR12476449", "ERX11852270", "ERS17743537", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1203 from a cross with a starved father", "1203 Starved", "1203S", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:181 276995", "1203S", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1203S_S6_L002_R1_001.fastq.gz", "fastq", 94525103.0, 1257985.0, "ena RUN TAB 15 01 2024 21:42:36:181 276996", "0:75.14", "A:34035341;C:18242921;G:20233155;T:21988512;N:25174", 75, null, null, null, 34035341, 18242921, 20233155, 21988512, 25174, "ERX11852270", "ERS17743537", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15100, "ERR12476465", "ERX11852286", "ERS17743541", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1219 from a cross with a starved father", "1219 Starved", "1219S", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:192 277027", "1219S", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1219S_S12_L002_R1_001.fastq.gz", "fastq", 97087536.0, 1291846.0, "ena RUN TAB 15 01 2024 21:42:36:192 277028", "0:75.15", "A:34386434;C:18969192;G:21277103;T:22430566;N:24241", 75, null, null, null, 34386434, 18969192, 21277103, 22430566, 24241, "ERX11852286", "ERS17743541", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15101, "ERR12476482", "ERX11852303", "ERS17743545", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1242 from a cross with a starved father", "1242E Starved", "1242SE", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:204 277061", "1242SE", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1242SE_S16_L003_R1_001.fastq.gz", "fastq", 119572581.0, 1595036.0, "ena RUN TAB 15 01 2024 21:42:36:204 277062", "0:74.97", "A:45069577;C:22967641;G:25483351;T:25959672;N:92340", 74, null, null, null, 45069577, 22967641, 25483351, 25959672, 92340, "ERX11852303", "ERS17743545", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15102, "ERR12476459", "ERX11852280", "ERS17743539", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1210 from a cross with a starved father", "1210 Starved", "1210S", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:188 277015", "1210S", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1210S_S8_L004_R1_001.fastq.gz", "fastq", 100688924.0, 1347280.0, "ena RUN TAB 15 01 2024 21:42:36:188 277016", "0:74.73", "A:39242841;C:19105480;G:22424580;T:19763164;N:152859", 74, null, null, null, 39242841, 19105480, 22424580, 19763164, 152859, "ERX11852280", "ERS17743539", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15103, "ERR12476481", "ERX11852302", "ERS17743545", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1242 from a cross with a starved father", "1242E Starved", "1242SE", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:203 277059", "1242SE", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1242SE_S16_L002_R1_001.fastq.gz", "fastq", 119860507.0, 1598259.0, "ena RUN TAB 15 01 2024 21:42:36:204 277060", "0:74.99", "A:44981934;C:23018661;G:25670723;T:26114916;N:74273", 74, null, null, null, 44981934, 23018661, 25670723, 26114916, 74273, "ERX11852302", "ERS17743545", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15104, "ERR12476483", "ERX11852304", "ERS17743545", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1242 from a cross with a starved father", "1242E Starved", "1242SE", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:205 277063", "1242SE", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1242SE_S16_L004_R1_001.fastq.gz", "fastq", 108782281.0, 1451206.0, "ena RUN TAB 15 01 2024 21:42:36:205 277064", "0:74.96", "A:41041986;C:20859560;G:23168159;T:23635345;N:77231", 74, null, null, null, 41041986, 20859560, 23168159, 23635345, 77231, "ERX11852304", "ERS17743545", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15105, "ERR12476448", "ERX11852269", "ERS17743537", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1203 from a cross with a starved father", "1203 Starved", "1203S", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:180 276993", "1203S", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1203S_S6_L001_R1_001.fastq.gz", "fastq", 89917861.0, 1196172.0, "ena RUN TAB 15 01 2024 21:42:36:180 276994", "0:75.17", "A:32511634;C:17340472;G:19179480;T:20857531;N:28744", 75, null, null, null, 32511634, 17340472, 19179480, 20857531, 28744, "ERX11852269", "ERS17743537", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15106, "ERR12476457", "ERX11852278", "ERS17743539", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1210 from a cross with a starved father", "1210 Starved", "1210S", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:186 277011", "1210S", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1210S_S8_L002_R1_001.fastq.gz", "fastq", 110304194.0, 1474848.0, "ena RUN TAB 15 01 2024 21:42:36:187 277012", "0:74.79", "A:42702966;C:20952577;G:24773042;T:21724801;N:150808", 74, null, null, null, 42702966, 20952577, 24773042, 21724801, 150808, "ERX11852278", "ERS17743539", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15107, "ERR12476456", "ERX11852277", "ERS17743539", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1210 from a cross with a starved father", "1210 Starved", "1210S", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:185 277009", "1210S", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1210S_S8_L001_R1_001.fastq.gz", "fastq", 106074722.0, 1417003.0, "ena RUN TAB 15 01 2024 21:42:36:186 277010", "0:74.86", "A:41208838;C:20151614;G:23770531;T:20792595;N:151144", 74, null, null, null, 41208838, 20151614, 23770531, 20792595, 151144, "ERX11852277", "ERS17743539", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15108, "ERR12476461", "ERX11852282", "ERS17743540", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1219 from a cross with a fed father", "1219 Fed", "1219F", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:189 277019", "1219F", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1219F_S11_L002_R1_001.fastq.gz", "fastq", 106799888.0, 1420026.0, "ena RUN TAB 15 01 2024 21:42:36:189 277020", "0:75.21", "A:37294667;C:20842952;G:23154298;T:25488653;N:19318", 75, null, null, null, 37294667, 20842952, 23154298, 25488653, 19318, "ERX11852282", "ERS17743540", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15109, "ERR12476480", "ERX11852301", "ERS17743545", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1242 from a cross with a starved father", "1242E Starved", "1242SE", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:203 277057", "1242SE", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1242SE_S16_L001_R1_001.fastq.gz", "fastq", 115150299.0, 1534621.0, "ena RUN TAB 15 01 2024 21:42:36:203 277058", "0:75.04", "A:43393516;C:22116575;G:24607338;T:24954423;N:78447", 75, null, null, null, 43393516, 22116575, 24607338, 24954423, 78447, "ERX11852301", "ERS17743545", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15110, "ERR12476464", "ERX11852285", "ERS17743541", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1219 from a cross with a starved father", "1219 Starved", "1219S", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:191 277025", "1219S", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1219S_S12_L001_R1_001.fastq.gz", "fastq", 93625807.0, 1245248.0, "ena RUN TAB 15 01 2024 21:42:36:192 277026", "0:75.19", "A:33311180;C:18278250;G:20453262;T:21557661;N:25454", 75, null, null, null, 33311180, 18278250, 20453262, 21557661, 25454, "ERX11852285", "ERS17743541", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15111, "ERR12476474", "ERX11852295", "ERS17743544", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1242 from a cross with a fed father", "1242E Fed", "1242FE", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:198 277045", "1242FE", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1242FE_S15_L003_R1_001.fastq.gz", "fastq", 110591461.0, 1472278.0, "ena RUN TAB 15 01 2024 21:42:36:199 277046", "0:75.12", "A:40767831;C:21026089;G:23298123;T:25470025;N:29393", 75, null, null, null, 40767831, 21026089, 23298123, 25470025, 29393, "ERX11852295", "ERS17743544", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15112, "ERR12476454", "ERX11852275", "ERS17743538", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1210 from a cross with a fed father", "1210 Fed", "1210F", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:184 277005", "1210F", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1210F_S7_L003_R1_001.fastq.gz", "fastq", 100467804.0, 1338769.0, "ena RUN TAB 15 01 2024 21:42:36:184 277006", "0:75.04", "A:37096238;C:19156191;G:21628367;T:22539758;N:47250", 75, null, null, null, 37096238, 19156191, 21628367, 22539758, 47250, "ERX11852275", "ERS17743538", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15113, "ERR12476477", "ERX11852298", "ERS17743543", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1242 from a cross with a starved father", "1242D Starved", "1242SD", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:200 277051", "1242SD", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1242SD_S14_L002_R1_001.fastq.gz", "fastq", 95483395.0, 1269021.0, "ena RUN TAB 15 01 2024 21:42:36:201 277052", "0:75.24", "A:33251808;C:18599068;G:20397415;T:23215065;N:20039", 75, null, null, null, 33251808, 18599068, 20397415, 23215065, 20039, "ERX11852298", "ERS17743543", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15114, "ERR12476443", "ERX11852264", "ERS17743535", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1118 from a cross with a starved father", "1118 Starved", "1118S", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:176 276983", "1118S", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1118S_S10_L004_R1_001.fastq.gz", "fastq", 88773312.0, 1181250.0, "ena RUN TAB 15 01 2024 21:42:36:177 276984", "0:75.15", "A:31460448;C:17120679;G:19117608;T:21054486;N:20091", 75, null, null, null, 31460448, 17120679, 19117608, 21054486, 20091, "ERX11852264", "ERS17743535", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15115, "ERR12476476", "ERX11852297", "ERS17743543", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1242 from a cross with a starved father", "1242D Starved", "1242SD", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:200 277049", "1242SD", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1242SD_S14_L001_R1_001.fastq.gz", "fastq", 91072875.0, 1210121.0, "ena RUN TAB 15 01 2024 21:42:36:200 277050", "0:75.26", "A:31859074;C:17724212;G:19393637;T:22075784;N:20168", 75, null, null, null, 31859074, 17724212, 19393637, 22075784, 20168, "ERX11852297", "ERS17743543", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15116, "ERR12476463", "ERX11852284", "ERS17743540", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1219 from a cross with a fed father", "1219 Fed", "1219F", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:190 277023", "1219F", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1219F_S11_L004_R1_001.fastq.gz", "fastq", 96315015.0, 1280935.0, "ena RUN TAB 15 01 2024 21:42:36:191 277024", "0:75.19", "A:33841468;C:18744196;G:20803688;T:22906396;N:19267", 75, null, null, null, 33841468, 18744196, 20803688, 22906396, 19267, "ERX11852284", "ERS17743540", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [15117, "ERR12476445", "ERX11852266", "ERS17743536", "ERP156655", "PRJEB71869", "Effects of paternal starvation in the offspring development of zebrafish", "33b9d14c-4211-4249-aede-f0f021d197e6", "Other", "Dietary restriction in the form of fasting is a putative key to a healthier and longer life  but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter  and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected  we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant  directed and potentially adaptive response transmitted by the father  independently from the offspring's nutritional state  which was defined by the mother.", "ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15", null, "24 hpf embryo collected at 1203 from a cross with a fed father", "1203 Fed", "1203F", null, "organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing", "ena EXPERIMENT TAB 15 01 2024 21:42:36:178 276987", "1203F", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP156655", "NextSeq 500 sequencing", "ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22", "1203F_S5_L002_R1_001.fastq.gz", "fastq", 102458617.0, 1363028.0, "ena RUN TAB 15 01 2024 21:42:36:178 276988", "0:75.17", "A:36510957;C:19511996;G:22025384;T:24392965;N:17315", 75, null, null, null, 36510957, 19511996, 22025384, 24392965, 17315, "ERX11852266", "ERS17743536", "ERA27788968", "University of Birmingham|European Nucleotide Archive", "University of Birmingham", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2024-01-15", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [25277, "SRR30160454", "SRX25627658", "SRS22272474", "SRP457111", "PRJNA1009808", "Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq]", "GSE241754", "Transcriptome Analysis", "Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points  namelyat the 256 cell 2.5 hpf  1000 cell 3 hpf  sphere 4 hpf  shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis  polysome profiling  ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.", "parent bioproject:PRJNA1009800", "pubmed:39402326", null, "WT bud 10 hpf charged tRNA seqrep 3", "GSM8441306", null, "tissue:10 hpf embryos|cell type:10 hpf embryos|geo loc name:missing|collection date:missing", "WT bud 10 hpf charged tRNA seqrep 3", "Read demultiplexing and adapter trimming performed with cutadapt v3.5  where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained  and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5\u2019 RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters:   species Drer   cluster id 0.93   threads 40   min cov 0.001   deconv cov ratio 0.4   max mismatches 0.075   remap   remap mismatches 0.075    max multi 10 max multi 6   remap   remap mismatches 0.075   crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions", "10 hpf embryos", null, "Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and  subjected to oxidation and beta elimination Behrens and Nedialkova  2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova  2022 and sequenced on an Illumina NovaSeq 6000 platform.", null, "cell type:10 hpf embryos", "GSM8441306", "GSM8441306: WT bud 10 hpf charged tRNA seqrep 3; Danio rerio; ncRNA Seq", "GSM8441306 r1", "GSM8441306", "1", "Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and  subjected to oxidation and beta elimination Behrens and Nedialkova  2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova  2022 and sequenced on an Illumina NovaSeq 6000 platform.", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP457111", null, null, "10hpf_aa_rep3.fastq.gz", "fastq", 193965330.0, 3367323.0, "GSM8441306 r1", "0:57.60", "A:36799299;C:55100074;G:53758955;T:48306966;N:36", 57, null, null, null, 36799299, 55100074, 53758955, 48306966, 36, "SRX25627658", "SRS22272474", "SRA1941998", "Max Planck Institute of Biochemistry", "Max Planck Institute of Biochemistry", 1, 0.34405, null, 0.05049, null, 0.89471, null, 0.46469, null, 88, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2024-08-05", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [25278, "SRR30160455", "SRX25627657", "SRS22272473", "SRP457111", "PRJNA1009808", "Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq]", "GSE241754", "Transcriptome Analysis", "Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points  namelyat the 256 cell 2.5 hpf  1000 cell 3 hpf  sphere 4 hpf  shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis  polysome profiling  ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.", "parent bioproject:PRJNA1009800", "pubmed:39402326", null, "WT bud 10 hpf charged tRNA seqrep 2", "GSM8441305", null, "tissue:10 hpf embryos|cell type:10 hpf embryos|geo loc name:missing|collection date:missing", "WT bud 10 hpf charged tRNA seqrep 2", "Read demultiplexing and adapter trimming performed with cutadapt v3.5  where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained  and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5\u2019 RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters:   species Drer   cluster id 0.93   threads 40   min cov 0.001   deconv cov ratio 0.4   max mismatches 0.075   remap   remap mismatches 0.075    max multi 10 max multi 6   remap   remap mismatches 0.075   crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions", "10 hpf embryos", null, "Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and  subjected to oxidation and beta elimination Behrens and Nedialkova  2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova  2022 and sequenced on an Illumina NovaSeq 6000 platform.", null, "cell type:10 hpf embryos", "GSM8441305", "GSM8441305: WT bud 10 hpf charged tRNA seqrep 2; Danio rerio; ncRNA Seq", "GSM8441305 r1", "GSM8441305", "1", "Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and  subjected to oxidation and beta elimination Behrens and Nedialkova  2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova  2022 and sequenced on an Illumina NovaSeq 6000 platform.", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP457111", null, null, "10hpf_aa_rep2.fastq.gz", "fastq", 138524715.0, 2369009.0, "GSM8441305 r1", "0:58.47", "A:26396279;C:39139297;G:38459048;T:34530060;N:31", 58, null, null, null, 26396279, 39139297, 38459048, 34530060, 31, "SRX25627657", "SRS22272473", "SRA1941998", "Max Planck Institute of Biochemistry", "Max Planck Institute of Biochemistry", 1, 0.35458, null, 0.05179, null, 0.89424, null, 0.46401, null, 74, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2024-08-05", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [25279, "SRR30160456", "SRX25627656", "SRS22272472", "SRP457111", "PRJNA1009808", "Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq]", "GSE241754", "Transcriptome Analysis", "Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points  namelyat the 256 cell 2.5 hpf  1000 cell 3 hpf  sphere 4 hpf  shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis  polysome profiling  ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.", "parent bioproject:PRJNA1009800", "pubmed:39402326", null, "WT bud 10 hpf charged tRNA seqrep 1", "GSM8441304", null, "tissue:10 hpf embryos|cell type:10 hpf embryos|geo loc name:missing|collection date:missing", "WT bud 10 hpf charged tRNA seqrep 1", "Read demultiplexing and adapter trimming performed with cutadapt v3.5  where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained  and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5\u2019 RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters:   species Drer   cluster id 0.93   threads 40   min cov 0.001   deconv cov ratio 0.4   max mismatches 0.075   remap   remap mismatches 0.075    max multi 10 max multi 6   remap   remap mismatches 0.075   crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions", "10 hpf embryos", null, "Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and  subjected to oxidation and beta elimination Behrens and Nedialkova  2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova  2022 and sequenced on an Illumina NovaSeq 6000 platform.", null, "cell type:10 hpf embryos", "GSM8441304", "GSM8441304: WT bud 10 hpf charged tRNA seqrep 1; Danio rerio; ncRNA Seq", "GSM8441304 r1", "GSM8441304", "1", "Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and  subjected to oxidation and beta elimination Behrens and Nedialkova  2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova  2022 and sequenced on an Illumina NovaSeq 6000 platform.", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP457111", null, null, "10hpf_aa_rep1.fastq.gz", "fastq", 54473618.0, 946419.0, "GSM8441304 r1", "0:57.56", "A:10345022;C:15413782;G:15135500;T:13579304;N:10", 57, null, null, null, 10345022, 15413782, 15135500, 13579304, 10, "SRX25627656", "SRS22272472", "SRA1941998", "Max Planck Institute of Biochemistry", "Max Planck Institute of Biochemistry", 1, 0.36103, null, 0.0515, null, 0.89227, null, 0.4748, null, 81, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2024-08-05", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [25280, "SRR30160457", "SRX25627655", "SRS22272471", "SRP457111", "PRJNA1009808", "Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq]", "GSE241754", "Transcriptome Analysis", "Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points  namelyat the 256 cell 2.5 hpf  1000 cell 3 hpf  sphere 4 hpf  shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis  polysome profiling  ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.", "parent bioproject:PRJNA1009800", "pubmed:39402326", null, "WT sphere 4 hpf charged tRNA seqrep 3", "GSM8441303", null, "tissue:4 hpf embryos|cell type:4 hpf embryos|geo loc name:missing|collection date:missing", "WT sphere 4 hpf charged tRNA seqrep 3", "Read demultiplexing and adapter trimming performed with cutadapt v3.5  where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained  and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5\u2019 RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters:   species Drer   cluster id 0.93   threads 40   min cov 0.001   deconv cov ratio 0.4   max mismatches 0.075   remap   remap mismatches 0.075    max multi 10 max multi 6   remap   remap mismatches 0.075   crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions", "4 hpf embryos", null, "Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and  subjected to oxidation and beta elimination Behrens and Nedialkova  2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova  2022 and sequenced on an Illumina NovaSeq 6000 platform.", null, "cell type:4 hpf embryos", "GSM8441303", "GSM8441303: WT sphere 4 hpf charged tRNA seqrep 3; Danio rerio; ncRNA Seq", "GSM8441303 r1", "GSM8441303", "1", "Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and  subjected to oxidation and beta elimination Behrens and Nedialkova  2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova  2022 and sequenced on an Illumina NovaSeq 6000 platform.", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP457111", null, null, "4hpf_aa_rep3.fastq.gz", "fastq", 100810543.0, 1747597.0, "GSM8441303 r1", "0:57.69", "A:20466558;C:28054923;G:26849246;T:25439798;N:18", 57, null, null, null, 20466558, 28054923, 26849246, 25439798, 18, "SRX25627655", "SRS22272471", "SRA1941998", "Max Planck Institute of Biochemistry", "Max Planck Institute of Biochemistry", 1, 0.36374, null, 0.06294, null, 0.87316, null, 0.54642, null, 39, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2024-08-05", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [25281, "SRR30160458", "SRX25627654", "SRS22272470", "SRP457111", "PRJNA1009808", "Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq]", "GSE241754", "Transcriptome Analysis", "Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points  namelyat the 256 cell 2.5 hpf  1000 cell 3 hpf  sphere 4 hpf  shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis  polysome profiling  ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.", "parent bioproject:PRJNA1009800", "pubmed:39402326", null, "WT sphere 4 hpf charged tRNA seqrep 2", "GSM8441302", null, "tissue:4 hpf embryos|cell type:4 hpf embryos|geo loc name:missing|collection date:missing", "WT sphere 4 hpf charged tRNA seqrep 2", "Read demultiplexing and adapter trimming performed with cutadapt v3.5  where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained  and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5\u2019 RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters:   species Drer   cluster id 0.93   threads 40   min cov 0.001   deconv cov ratio 0.4   max mismatches 0.075   remap   remap mismatches 0.075    max multi 10 max multi 6   remap   remap mismatches 0.075   crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions", "4 hpf embryos", null, "Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and  subjected to oxidation and beta elimination Behrens and Nedialkova  2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova  2022 and sequenced on an Illumina NovaSeq 6000 platform.", null, "cell type:4 hpf embryos", "GSM8441302", "GSM8441302: WT sphere 4 hpf charged tRNA seqrep 2; Danio rerio; ncRNA Seq", "GSM8441302 r1", "GSM8441302", "1", "Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and  subjected to oxidation and beta elimination Behrens and Nedialkova  2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova  2022 and sequenced on an Illumina NovaSeq 6000 platform.", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP457111", null, null, "4hpf_aa_rep2.fastq.gz", "fastq", 121662759.0, 2046536.0, "GSM8441302 r1", "0:59.45", "A:24519095;C:33689156;G:32726095;T:30728382;N:31", 59, null, null, null, 24519095, 33689156, 32726095, 30728382, 31, "SRX25627654", "SRS22272470", "SRA1941998", "Max Planck Institute of Biochemistry", "Max Planck Institute of Biochemistry", 1, 0.3726, null, 0.06263, null, 0.87136, null, 0.55584, null, 31, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2024-08-05", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [25282, "SRR30160459", "SRX25627653", "SRS22272469", "SRP457111", "PRJNA1009808", "Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq]", "GSE241754", "Transcriptome Analysis", "Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points  namelyat the 256 cell 2.5 hpf  1000 cell 3 hpf  sphere 4 hpf  shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis  polysome profiling  ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.", "parent bioproject:PRJNA1009800", "pubmed:39402326", null, "WT sphere 4 hpf charged tRNA seqrep 1", "GSM8441301", null, "tissue:4 hpf embryos|cell type:4 hpf embryos|geo loc name:missing|collection date:missing", "WT sphere 4 hpf charged tRNA seqrep 1", "Read demultiplexing and adapter trimming performed with cutadapt v3.5  where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained  and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5\u2019 RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters:   species Drer   cluster id 0.93   threads 40   min cov 0.001   deconv cov ratio 0.4   max mismatches 0.075   remap   remap mismatches 0.075    max multi 10 max multi 6   remap   remap mismatches 0.075   crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions", "4 hpf embryos", null, "Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and  subjected to oxidation and beta elimination Behrens and Nedialkova  2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova  2022 and sequenced on an Illumina NovaSeq 6000 platform.", null, "cell type:4 hpf embryos", "GSM8441301", "GSM8441301: WT sphere 4 hpf charged tRNA seqrep 1; Danio rerio; ncRNA Seq", "GSM8441301 r1", "GSM8441301", "1", "Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and  subjected to oxidation and beta elimination Behrens and Nedialkova  2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova  2022 and sequenced on an Illumina NovaSeq 6000 platform.", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP457111", null, null, "4hpf_aa_rep1.fastq.gz", "fastq", 124990980.0, 2116213.0, "GSM8441301 r1", "0:59.06", "A:25487542;C:34621140;G:33284460;T:31597816;N:22", 59, null, null, null, 25487542, 34621140, 33284460, 31597816, 22, "SRX25627653", "SRS22272469", "SRA1941998", "Max Planck Institute of Biochemistry", "Max Planck Institute of Biochemistry", 1, 0.36013, null, 0.05967, null, 0.87387, null, 0.55002, null, 44, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2024-08-05", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [26499, "SRR26031755", "SRX21749012", "SRS18856550", "SRP459729", "PRJNA1015262", "Rtf1 dependent transcriptional pausing regulates cardiogenesis", "PRJNA1015262", "Other", "During heart development  an evolutionarily conserved network of cardiac transcription factors collaborate to define the precise timing and location of cardiac progenitor specification. Accumulating evidence suggests that cardiac progenitor specification is subject to transcriptional control beyond the level of transcription initiation. The PAF1C component Rtf1 is a multifunctional transcription regulatory protein that modulates pausing and elongation of RNA Pol II  as well as histone epigenetic modifications. By transient knockdown and CRISPR mutagenesis  we found that Rtf1 is essential for cardiogenesis and that without xxx activity  cardiac progenitors arrest in an immature state. This role in early cardiogenesis was evolutionarily conserved between fish and mammals. We also found that Rtf1's Plus3 domain  which confers interaction with the pausing/elongation factor Spt5  was required for Rtf1's ability to support cardiac progenitor formation  while other regions of the protein were dispensable. We examined the occupancy of RNA Pol II at cardiac genes in rtf1 morphants using ChIP seq and found that Pol II signals at the TSS of genes was reduced  suggesting a reduction in transcriptional pausing. Intriguingly  pharmacological or morpholino antisense reduction of pause release in rtf1 morphants and mutants restored the formation of cardiac cells and improved Pol II occupancy at the TSS of key cardiac genes. Our findings highlight the crucial role that transcriptional pausing plays in promoting normal levels of gene expression in a cardiac developmental context.", null, null, null, null, "RNAseq hand2FACS rtf1MO 3", null, "strain:TgBAChand2:EGFPpd24|dev stage:10 12 somite stage|collection date:2020 07 14|geo loc name:USA:California Los Angeles|sex:n/a|tissue:hand2:GFP positive cells|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA seq of hand2:GFP positive cells from 10 12 somite stage zebrafish embryos", "M3", "MO3", "NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina from 5 10 ng input RNA", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 3000", null, "SRP459729", null, null, "RNAseq_hand2FACS_rtf1MO_3.fastq", "fastq", 793876754.0, 15197870.0, "RNAseq hand2FACS rtf1MO 3.fastq", "0:52.24", "A:208793415;C:174763420;G:174630814;T:235479388;N:209717", 52, null, null, null, 208793415, 174763420, 174630814, 235479388, 209717, "SRX21749012", "SRS18856550", "SRA1709841", "University of California, Los Angeles|Molecular, Cell, and Developmental Biology", "University of California, Los Angeles", 1, 0.88868, null, 0.1097, null, 0.77644, null, 0.51136, null, 53, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "United States", "2023-09-11", "Segmentation", "Embryo", "Embryo Imprecise", "All anatomical structures"], [26500, "SRR26031756", "SRX21749011", "SRS18856545", "SRP459729", "PRJNA1015262", "Rtf1 dependent transcriptional pausing regulates cardiogenesis", "PRJNA1015262", "Other", "During heart development  an evolutionarily conserved network of cardiac transcription factors collaborate to define the precise timing and location of cardiac progenitor specification. Accumulating evidence suggests that cardiac progenitor specification is subject to transcriptional control beyond the level of transcription initiation. The PAF1C component Rtf1 is a multifunctional transcription regulatory protein that modulates pausing and elongation of RNA Pol II  as well as histone epigenetic modifications. By transient knockdown and CRISPR mutagenesis  we found that Rtf1 is essential for cardiogenesis and that without xxx activity  cardiac progenitors arrest in an immature state. This role in early cardiogenesis was evolutionarily conserved between fish and mammals. We also found that Rtf1's Plus3 domain  which confers interaction with the pausing/elongation factor Spt5  was required for Rtf1's ability to support cardiac progenitor formation  while other regions of the protein were dispensable. We examined the occupancy of RNA Pol II at cardiac genes in rtf1 morphants using ChIP seq and found that Pol II signals at the TSS of genes was reduced  suggesting a reduction in transcriptional pausing. Intriguingly  pharmacological or morpholino antisense reduction of pause release in rtf1 morphants and mutants restored the formation of cardiac cells and improved Pol II occupancy at the TSS of key cardiac genes. Our findings highlight the crucial role that transcriptional pausing plays in promoting normal levels of gene expression in a cardiac developmental context.", null, null, null, null, "RNAseq hand2FACS rtf1MO 2", null, "strain:TgBAChand2:EGFPpd24|dev stage:10 12 somite stage|collection date:2020 07 07|geo loc name:USA:California Los Angeles|sex:n/a|tissue:hand2:GFP positive cells|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA seq of hand2:GFP positive cells from 10 12 somite stage zebrafish embryos", "M2", "MO2", "NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina from 5 10 ng input RNA", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 3000", null, "SRP459729", null, null, "RNAseq_hand2FACS_rtf1MO_2.fastq", "fastq", 864787205.0, 16568310.0, "RNAseq hand2FACS rtf1MO 2.fastq", "0:52.20", "A:227648729;C:189720880;G:190025417;T:257026454;N:365725", 52, null, null, null, 227648729, 189720880, 190025417, 257026454, 365725, "SRX21749011", "SRS18856545", "SRA1709841", "University of California, Los Angeles|Molecular, Cell, and Developmental Biology", "University of California, Los Angeles", 1, 0.87433, null, 0.10781, null, 0.77366, null, 0.50792, null, 53, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "United States", "2023-09-11", "Segmentation", "Embryo", "Embryo Imprecise", "All anatomical structures"], [26501, "SRR26031757", "SRX21749010", "SRS18856549", "SRP459729", "PRJNA1015262", "Rtf1 dependent transcriptional pausing regulates cardiogenesis", "PRJNA1015262", "Other", "During heart development  an evolutionarily conserved network of cardiac transcription factors collaborate to define the precise timing and location of cardiac progenitor specification. Accumulating evidence suggests that cardiac progenitor specification is subject to transcriptional control beyond the level of transcription initiation. The PAF1C component Rtf1 is a multifunctional transcription regulatory protein that modulates pausing and elongation of RNA Pol II  as well as histone epigenetic modifications. By transient knockdown and CRISPR mutagenesis  we found that Rtf1 is essential for cardiogenesis and that without xxx activity  cardiac progenitors arrest in an immature state. This role in early cardiogenesis was evolutionarily conserved between fish and mammals. We also found that Rtf1's Plus3 domain  which confers interaction with the pausing/elongation factor Spt5  was required for Rtf1's ability to support cardiac progenitor formation  while other regions of the protein were dispensable. We examined the occupancy of RNA Pol II at cardiac genes in rtf1 morphants using ChIP seq and found that Pol II signals at the TSS of genes was reduced  suggesting a reduction in transcriptional pausing. Intriguingly  pharmacological or morpholino antisense reduction of pause release in rtf1 morphants and mutants restored the formation of cardiac cells and improved Pol II occupancy at the TSS of key cardiac genes. Our findings highlight the crucial role that transcriptional pausing plays in promoting normal levels of gene expression in a cardiac developmental context.", null, null, null, null, "RNAseq hand2FACS rtf1MO 1", null, "strain:TgBAChand2:EGFPpd24|dev stage:10 12 somite stage|collection date:2020 03 04|geo loc name:USA:California Los Angeles|sex:n/a|tissue:hand2:GFP positive cells|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA seq of hand2:GFP positive cells from 10 12 somite stage zebrafish embryos", "M1", "MO1", "NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina from 5 10 ng input RNA", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 3000", null, "SRP459729", null, null, "RNAseq_hand2FACS_rtf1MO_1.fastq", "fastq", 821983134.0, 15737564.0, "RNAseq hand2FACS rtf1MO 1.fastq", "0:52.23", "A:216610704;C:179969953;G:180145537;T:245093230;N:163710", 52, null, null, null, 216610704, 179969953, 180145537, 245093230, 163710, "SRX21749010", "SRS18856549", "SRA1709841", "University of California, Los Angeles|Molecular, Cell, and Developmental Biology", "University of California, Los Angeles", 1, 0.88099, null, 0.09837, null, 0.78007, null, 0.50262, null, 53, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "United States", "2023-09-11", "Segmentation", "Embryo", "Embryo Imprecise", "All anatomical structures"], [26502, "SRR26031758", "SRX21749009", "SRS18856546", "SRP459729", "PRJNA1015262", "Rtf1 dependent transcriptional pausing regulates cardiogenesis", "PRJNA1015262", "Other", "During heart development  an evolutionarily conserved network of cardiac transcription factors collaborate to define the precise timing and location of cardiac progenitor specification. Accumulating evidence suggests that cardiac progenitor specification is subject to transcriptional control beyond the level of transcription initiation. The PAF1C component Rtf1 is a multifunctional transcription regulatory protein that modulates pausing and elongation of RNA Pol II  as well as histone epigenetic modifications. By transient knockdown and CRISPR mutagenesis  we found that Rtf1 is essential for cardiogenesis and that without xxx activity  cardiac progenitors arrest in an immature state. This role in early cardiogenesis was evolutionarily conserved between fish and mammals. We also found that Rtf1's Plus3 domain  which confers interaction with the pausing/elongation factor Spt5  was required for Rtf1's ability to support cardiac progenitor formation  while other regions of the protein were dispensable. We examined the occupancy of RNA Pol II at cardiac genes in rtf1 morphants using ChIP seq and found that Pol II signals at the TSS of genes was reduced  suggesting a reduction in transcriptional pausing. Intriguingly  pharmacological or morpholino antisense reduction of pause release in rtf1 morphants and mutants restored the formation of cardiac cells and improved Pol II occupancy at the TSS of key cardiac genes. Our findings highlight the crucial role that transcriptional pausing plays in promoting normal levels of gene expression in a cardiac developmental context.", null, null, null, null, "RNAseq hand2FACS control 3", null, "strain:TgBAChand2:EGFPpd24|dev stage:10 12 somite stage|collection date:2020 02 26|geo loc name:USA:California Los Angeles|sex:n/a|tissue:hand2:GFP positive cells|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA seq of hand2:GFP positive cells from 10 12 somite stage zebrafish embryos", "C3", "CTL3", "NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina from 5 10 ng input RNA", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 3000", null, "SRP459729", null, null, "RNAseq_hand2FACS_control_3.fastq", "fastq", 880285441.0, 16931477.0, "RNAseq hand2FACS control 3.fastq", "0:51.99", "A:233959122;C:192477087;G:190893530;T:262700285;N:255417", 51, null, null, null, 233959122, 192477087, 190893530, 262700285, 255417, "SRX21749009", "SRS18856546", "SRA1709841", "University of California, Los Angeles|Molecular, Cell, and Developmental Biology", "University of California, Los Angeles", 1, 0.90285, null, 0.10232, null, 0.76982, null, 0.50837, null, 53, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "United States", "2023-09-11", "Segmentation", "Embryo", "Embryo Imprecise", "All anatomical structures"], [26503, "SRR26031759", "SRX21749008", "SRS18856548", "SRP459729", "PRJNA1015262", "Rtf1 dependent transcriptional pausing regulates cardiogenesis", "PRJNA1015262", "Other", "During heart development  an evolutionarily conserved network of cardiac transcription factors collaborate to define the precise timing and location of cardiac progenitor specification. Accumulating evidence suggests that cardiac progenitor specification is subject to transcriptional control beyond the level of transcription initiation. The PAF1C component Rtf1 is a multifunctional transcription regulatory protein that modulates pausing and elongation of RNA Pol II  as well as histone epigenetic modifications. By transient knockdown and CRISPR mutagenesis  we found that Rtf1 is essential for cardiogenesis and that without xxx activity  cardiac progenitors arrest in an immature state. This role in early cardiogenesis was evolutionarily conserved between fish and mammals. We also found that Rtf1's Plus3 domain  which confers interaction with the pausing/elongation factor Spt5  was required for Rtf1's ability to support cardiac progenitor formation  while other regions of the protein were dispensable. We examined the occupancy of RNA Pol II at cardiac genes in rtf1 morphants using ChIP seq and found that Pol II signals at the TSS of genes was reduced  suggesting a reduction in transcriptional pausing. Intriguingly  pharmacological or morpholino antisense reduction of pause release in rtf1 morphants and mutants restored the formation of cardiac cells and improved Pol II occupancy at the TSS of key cardiac genes. Our findings highlight the crucial role that transcriptional pausing plays in promoting normal levels of gene expression in a cardiac developmental context.", null, null, null, null, "RNAseq hand2FACS control 2", null, "strain:TgBAChand2:EGFPpd24|dev stage:10 12 somite stage|collection date:2019 12 19|geo loc name:USA:California Los Angeles|sex:n/a|tissue:hand2:GFP positive cells|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA seq of hand2:GFP positive cells from 10 12 somite stage zebrafish embryos", "C2", "CTL2", "NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina from 5 10 ng input RNA", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 3000", null, "SRP459729", null, null, "RNAseq_hand2FACS_control_2.fastq", "fastq", 317458963.0, 6417814.0, "RNAseq hand2FACS control 2.fastq", "0:49.47", "A:83925064;C:70621123;G:68872886;T:93923129;N:116761", 49, null, null, null, 83925064, 70621123, 68872886, 93923129, 116761, "SRX21749008", "SRS18856548", "SRA1709841", "University of California, Los Angeles|Molecular, Cell, and Developmental Biology", "University of California, Los Angeles", 1, 0.85587, null, 0.08493, null, 0.75558, null, 0.51678, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "United States", "2023-09-11", "Segmentation", "Embryo", "Embryo Imprecise", "All anatomical structures"], [26504, "SRR26031760", "SRX21749007", "SRS18856543", "SRP459729", "PRJNA1015262", "Rtf1 dependent transcriptional pausing regulates cardiogenesis", "PRJNA1015262", "Other", "During heart development  an evolutionarily conserved network of cardiac transcription factors collaborate to define the precise timing and location of cardiac progenitor specification. Accumulating evidence suggests that cardiac progenitor specification is subject to transcriptional control beyond the level of transcription initiation. The PAF1C component Rtf1 is a multifunctional transcription regulatory protein that modulates pausing and elongation of RNA Pol II  as well as histone epigenetic modifications. By transient knockdown and CRISPR mutagenesis  we found that Rtf1 is essential for cardiogenesis and that without xxx activity  cardiac progenitors arrest in an immature state. This role in early cardiogenesis was evolutionarily conserved between fish and mammals. We also found that Rtf1's Plus3 domain  which confers interaction with the pausing/elongation factor Spt5  was required for Rtf1's ability to support cardiac progenitor formation  while other regions of the protein were dispensable. We examined the occupancy of RNA Pol II at cardiac genes in rtf1 morphants using ChIP seq and found that Pol II signals at the TSS of genes was reduced  suggesting a reduction in transcriptional pausing. Intriguingly  pharmacological or morpholino antisense reduction of pause release in rtf1 morphants and mutants restored the formation of cardiac cells and improved Pol II occupancy at the TSS of key cardiac genes. Our findings highlight the crucial role that transcriptional pausing plays in promoting normal levels of gene expression in a cardiac developmental context.", null, null, null, null, "RNAseq hand2FACS control 1", null, "strain:TgBAChand2:EGFPpd24|dev stage:10 12 somite stage|collection date:2019 11 29|geo loc name:USA:California Los Angeles|sex:n/a|tissue:hand2:GFP positive cells|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA seq of hand2:GFP positive cells from 10 12 somite stage zebrafish embryos", "C1", "CTL1", "NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina from 5 10 ng input RNA", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina HiSeq 3000", null, "SRP459729", null, null, "RNAseq_hand2FACS_control_1.fastq", "fastq", 448273888.0, 9055865.0, "RNAseq hand2FACS control 1.fastq", "0:49.50", "A:119317727;C:99863109;G:96352533;T:132659621;N:80898", 49, null, null, null, 119317727, 99863109, 96352533, 132659621, 80898, "SRX21749007", "SRS18856543", "SRA1709841", "University of California, Los Angeles|Molecular, Cell, and Developmental Biology", "University of California, Los Angeles", 1, 0.88622, null, 0.09573, null, 0.76086, null, 0.42689, null, 49, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "United States", "2023-09-11", "Segmentation", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28538, "SRR26395012", "SRX22100922", "SRS19166048", "SRP466518", "PRJNA1028258", "Zygotic activation of transposable elements during zebrafish early embryogenesis", "PRJNA1028258", "Other", "Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus  transcript  and allele over zebrafish early embryonic development. Moreover  we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish  where extensive variation exists among TE families  subfamilies  loci  transcripts and alleles with respect to evolutionary age.", null, "pubmed:40246845", null, null, "50% epiboly Iso seq", null, "strain:AB x India|age:5.3 hpf|dev stage:50% epiboly|collection date:2021 01|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:LR 10|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "PacBio Iso seq of zebrafish: 50% epiboly", "DR 010", "DR 010", "Total RNA was isolated from each developmental stages of zebrafish embryos using TRIzolTM Reagent Invitrogen. RNA purity and concentration were assessed with the NanoPhotometer spectrophotometer IMPLEN  CA  USA and the Qubit RNA Assay Kit in the Qubit 3.0 Fluorometer Life Technologies  CA  USA. The RNA integrity number RIN was determined using the RNA Nano 6000 Assay Kit and Agilent Bioanalyzer 2100 system Agilent Technologies  CA  USA. RNA samples with a RIN  8 were used to synthesize cDNA with SMARTerPCR cDNA Synthesis Kit Takara Bio USA  Inc.  Mountain View  CA  USA. PCR amplification was performed using a KAPA HiFi PCR Kit Kapa Biosystems  Wilmington  MA  USA with the optimized number of cycles. Size selection of PCR products cDNA for each sample was applied using the BluePippin System: <3 kb and >3 kb. Subsequently  two cDNA libraries <3 kb  >3 kb were prepared using a SMRTbell Template Prep Kit 1.0 Pacific Biosciences  Menlo Park  CA  USA and sequenced on the PacBio sequel II platform.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "PACBIO_SMRT", "Sequel II", null, "SRP466518", null, null, "50epiboly.ccs.fq.gz", "fastq", 6994871304.0, 1739615.0, "50epiboly.ccs.fq.gz", "0:4020.93", "A:1886646970;C:1618863911;G:1609321304;T:1880039119;N:0", 4020, null, null, null, 1886646970, 1618863911, 1609321304, 1880039119, 0, "SRX22100922", "SRS19166048", "SRA1731898", "University of Michigan|Computational Medicine and Bioinformatics", "University of Michigan", 1, 0.2059, null, 0.00164, null, 0.92101, null, 0.06119, null, 3367, null, "T", null, "long read", "pacbio", "pacbio_modern", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-16", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28539, "SRR26395013", "SRX22100921", "SRS19166047", "SRP466518", "PRJNA1028258", "Zygotic activation of transposable elements during zebrafish early embryogenesis", "PRJNA1028258", "Other", "Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus  transcript  and allele over zebrafish early embryonic development. Moreover  we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish  where extensive variation exists among TE families  subfamilies  loci  transcripts and alleles with respect to evolutionary age.", null, "pubmed:40246845", null, null, "zfs:0000015 Iso seq", null, "strain:AB x India|age:4.7 hpf|dev stage:zfs:0000015|collection date:2021 01|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:LR 9|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "PacBio Iso seq of zebrafish: zfs:0000015", "DR 009", "DR 009", "Total RNA was isolated from each developmental stages of zebrafish embryos using TRIzolTM Reagent Invitrogen. RNA purity and concentration were assessed with the NanoPhotometer spectrophotometer IMPLEN  CA  USA and the Qubit RNA Assay Kit in the Qubit 3.0 Fluorometer Life Technologies  CA  USA. The RNA integrity number RIN was determined using the RNA Nano 6000 Assay Kit and Agilent Bioanalyzer 2100 system Agilent Technologies  CA  USA. RNA samples with a RIN  8 were used to synthesize cDNA with SMARTerPCR cDNA Synthesis Kit Takara Bio USA  Inc.  Mountain View  CA  USA. PCR amplification was performed using a KAPA HiFi PCR Kit Kapa Biosystems  Wilmington  MA  USA with the optimized number of cycles. Size selection of PCR products cDNA for each sample was applied using the BluePippin System: <3 kb and >3 kb. Subsequently  two cDNA libraries <3 kb  >3 kb were prepared using a SMRTbell Template Prep Kit 1.0 Pacific Biosciences  Menlo Park  CA  USA and sequenced on the PacBio sequel II platform.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "PACBIO_SMRT", "Sequel II", null, "SRP466518", null, null, "30epiboly.ccs.fq.gz", "fastq", 5233736965.0, 1358516.0, "zfs:0000015.ccs.fq.gz", "0:3852.54", "A:1425421240;C:1199630062;G:1191034759;T:1417650904;N:0", 3852, null, null, null, 1425421240, 1199630062, 1191034759, 1417650904, 0, "SRX22100921", "SRS19166047", "SRA1731898", "University of Michigan|Computational Medicine and Bioinformatics", "University of Michigan", 1, 0.40862, null, 0.00581, null, 0.86123, null, 0.47684, null, 3440, null, "T", null, "long read", "pacbio", "pacbio_modern", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-16", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28540, "SRR26395014", "SRX22100920", "SRS19166046", "SRP466518", "PRJNA1028258", "Zygotic activation of transposable elements during zebrafish early embryogenesis", "PRJNA1028258", "Other", "Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus  transcript  and allele over zebrafish early embryonic development. Moreover  we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish  where extensive variation exists among TE families  subfamilies  loci  transcripts and alleles with respect to evolutionary age.", null, "pubmed:40246845", null, null, "dome Iso seq", null, "strain:AB x India|age:4.3 hpf|dev stage:dome|collection date:2021 01|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:LR 8|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "PacBio Iso seq of zebrafish: dome", "DR 008", "DR 008", "Total RNA was isolated from each developmental stages of zebrafish embryos using TRIzolTM Reagent Invitrogen. RNA purity and concentration were assessed with the NanoPhotometer spectrophotometer IMPLEN  CA  USA and the Qubit RNA Assay Kit in the Qubit 3.0 Fluorometer Life Technologies  CA  USA. The RNA integrity number RIN was determined using the RNA Nano 6000 Assay Kit and Agilent Bioanalyzer 2100 system Agilent Technologies  CA  USA. RNA samples with a RIN  8 were used to synthesize cDNA with SMARTerPCR cDNA Synthesis Kit Takara Bio USA  Inc.  Mountain View  CA  USA. PCR amplification was performed using a KAPA HiFi PCR Kit Kapa Biosystems  Wilmington  MA  USA with the optimized number of cycles. Size selection of PCR products cDNA for each sample was applied using the BluePippin System: <3 kb and >3 kb. Subsequently  two cDNA libraries <3 kb  >3 kb were prepared using a SMRTbell Template Prep Kit 1.0 Pacific Biosciences  Menlo Park  CA  USA and sequenced on the PacBio sequel II platform.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "PACBIO_SMRT", "Sequel II", null, "SRP466518", null, null, "dome.ccs.fq.gz", "fastq", 6426069602.0, 1667809.0, "dome.ccs.fq.gz", "0:3853.00", "A:1735630855;C:1486999783;G:1476424228;T:1727014736;N:0", 3853, null, null, null, 1735630855, 1486999783, 1476424228, 1727014736, 0, "SRX22100920", "SRS19166046", "SRA1731898", "University of Michigan|Computational Medicine and Bioinformatics", "University of Michigan", 1, 0.20197, null, 0.00145, null, 0.91388, null, 0.06247, null, 6938, null, "T", null, "long read", "pacbio", "pacbio_modern", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-16", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28541, "SRR26395015", "SRX22100919", "SRS19166045", "SRP466518", "PRJNA1028258", "Zygotic activation of transposable elements during zebrafish early embryogenesis", "PRJNA1028258", "Other", "Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus  transcript  and allele over zebrafish early embryonic development. Moreover  we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish  where extensive variation exists among TE families  subfamilies  loci  transcripts and alleles with respect to evolutionary age.", null, "pubmed:40246845", null, null, "sphere Iso seq", null, "strain:AB x India|age:4 hpf|dev stage:sphere|collection date:2021 01|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:LR 7|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "PacBio Iso seq of zebrafish: sphere", "DR 007", "DR 007", "Total RNA was isolated from each developmental stages of zebrafish embryos using TRIzolTM Reagent Invitrogen. RNA purity and concentration were assessed with the NanoPhotometer spectrophotometer IMPLEN  CA  USA and the Qubit RNA Assay Kit in the Qubit 3.0 Fluorometer Life Technologies  CA  USA. The RNA integrity number RIN was determined using the RNA Nano 6000 Assay Kit and Agilent Bioanalyzer 2100 system Agilent Technologies  CA  USA. RNA samples with a RIN  8 were used to synthesize cDNA with SMARTerPCR cDNA Synthesis Kit Takara Bio USA  Inc.  Mountain View  CA  USA. PCR amplification was performed using a KAPA HiFi PCR Kit Kapa Biosystems  Wilmington  MA  USA with the optimized number of cycles. Size selection of PCR products cDNA for each sample was applied using the BluePippin System: <3 kb and >3 kb. Subsequently  two cDNA libraries <3 kb  >3 kb were prepared using a SMRTbell Template Prep Kit 1.0 Pacific Biosciences  Menlo Park  CA  USA and sequenced on the PacBio sequel II platform.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "PACBIO_SMRT", "Sequel II", null, "SRP466518", null, null, "sphere.ccs.fq.gz", "fastq", 7456522395.0, 2030744.0, "sphere.ccs.fq.gz", "0:3671.82", "A:2009379061;C:1725915606;G:1718055774;T:2003171954;N:0", 3671, null, null, null, 2009379061, 1725915606, 1718055774, 2003171954, 0, "SRX22100919", "SRS19166045", "SRA1731898", "University of Michigan|Computational Medicine and Bioinformatics", "University of Michigan", 1, 0.41317, null, 0.00317, null, 0.85504, null, 0.46671, null, 5517, null, "T", null, "long read", "pacbio", "pacbio_modern", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-16", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28543, "SRR26395017", "SRX22100916", "SRS19166042", "SRP466518", "PRJNA1028258", "Zygotic activation of transposable elements during zebrafish early embryogenesis", "PRJNA1028258", "Other", "Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus  transcript  and allele over zebrafish early embryonic development. Moreover  we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish  where extensive variation exists among TE families  subfamilies  loci  transcripts and alleles with respect to evolutionary age.", null, "pubmed:40246845", null, null, "oblong Iso seq", null, "strain:AB x India|age:3.7 hpf|dev stage:oblong|collection date:2021 01|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:LR 6|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "PacBio Iso seq of zebrafish: oblong", "DR 006", "DR 006", "Total RNA was isolated from each developmental stages of zebrafish embryos using TRIzolTM Reagent Invitrogen. RNA purity and concentration were assessed with the NanoPhotometer spectrophotometer IMPLEN  CA  USA and the Qubit RNA Assay Kit in the Qubit 3.0 Fluorometer Life Technologies  CA  USA. The RNA integrity number RIN was determined using the RNA Nano 6000 Assay Kit and Agilent Bioanalyzer 2100 system Agilent Technologies  CA  USA. RNA samples with a RIN  8 were used to synthesize cDNA with SMARTerPCR cDNA Synthesis Kit Takara Bio USA  Inc.  Mountain View  CA  USA. PCR amplification was performed using a KAPA HiFi PCR Kit Kapa Biosystems  Wilmington  MA  USA with the optimized number of cycles. Size selection of PCR products cDNA for each sample was applied using the BluePippin System: <3 kb and >3 kb. Subsequently  two cDNA libraries <3 kb  >3 kb were prepared using a SMRTbell Template Prep Kit 1.0 Pacific Biosciences  Menlo Park  CA  USA and sequenced on the PacBio sequel II platform.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "PACBIO_SMRT", "Sequel II", null, "SRP466518", null, null, "oblong.ccs.fq.gz", "fastq", 5138806264.0, 1450821.0, "oblong.ccs.fq.gz", "0:3542.00", "A:1387179645;C:1186984765;G:1181776562;T:1382865292;N:0", 3542, null, null, null, 1387179645, 1186984765, 1181776562, 1382865292, 0, "SRX22100916", "SRS19166042", "SRA1731898", "University of Michigan|Computational Medicine and Bioinformatics", "University of Michigan", 1, 0.41494, null, 0.0019, null, 0.85267, null, 0.45513, null, 8789, null, "T", null, "long read", "pacbio", "pacbio_modern", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-16", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28554, "SRR26395028", "SRX22100905", "SRS19166031", "SRP466518", "PRJNA1028258", "Zygotic activation of transposable elements during zebrafish early embryogenesis", "PRJNA1028258", "Other", "Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus  transcript  and allele over zebrafish early embryonic development. Moreover  we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish  where extensive variation exists among TE families  subfamilies  loci  transcripts and alleles with respect to evolutionary age.", null, "pubmed:40246845", null, null, "high Iso seq", null, "strain:AB x India|age:3.3 hpf|dev stage:high|collection date:2021 01|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:LR 5|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "PacBio Iso seq of zebrafish: high", "DR 005", "DR 005", "Total RNA was isolated from each developmental stages of zebrafish embryos using TRIzolTM Reagent Invitrogen. RNA purity and concentration were assessed with the NanoPhotometer spectrophotometer IMPLEN  CA  USA and the Qubit RNA Assay Kit in the Qubit 3.0 Fluorometer Life Technologies  CA  USA. The RNA integrity number RIN was determined using the RNA Nano 6000 Assay Kit and Agilent Bioanalyzer 2100 system Agilent Technologies  CA  USA. RNA samples with a RIN  8 were used to synthesize cDNA with SMARTerPCR cDNA Synthesis Kit Takara Bio USA  Inc.  Mountain View  CA  USA. PCR amplification was performed using a KAPA HiFi PCR Kit Kapa Biosystems  Wilmington  MA  USA with the optimized number of cycles. Size selection of PCR products cDNA for each sample was applied using the BluePippin System: <3 kb and >3 kb. Subsequently  two cDNA libraries <3 kb  >3 kb were prepared using a SMRTbell Template Prep Kit 1.0 Pacific Biosciences  Menlo Park  CA  USA and sequenced on the PacBio sequel II platform.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "PACBIO_SMRT", "Sequel II", null, "SRP466518", null, null, "high.ccs.fq.gz", "fastq", 6811221417.0, 1785766.0, "high.ccs.fq.gz", "0:3814.17", "A:1820349159;C:1592171013;G:1583702800;T:1814998445;N:0", 3814, null, null, null, 1820349159, 1592171013, 1583702800, 1814998445, 0, "SRX22100905", "SRS19166031", "SRA1731898", "University of Michigan|Computational Medicine and Bioinformatics", "University of Michigan", 1, 0.42981, null, 0.00073, null, 0.86182, null, 0.47846, null, 4404, null, "T", null, "long read", "pacbio", "pacbio_modern", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-16", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28565, "SRR26395039", "SRX22100894", "SRS19166020", "SRP466518", "PRJNA1028258", "Zygotic activation of transposable elements during zebrafish early embryogenesis", "PRJNA1028258", "Other", "Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus  transcript  and allele over zebrafish early embryonic development. Moreover  we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish  where extensive variation exists among TE families  subfamilies  loci  transcripts and alleles with respect to evolutionary age.", null, "pubmed:40246845", null, null, "1k cell Iso seq", null, "strain:AB x India|age:3 hpf|dev stage:1k cell|collection date:2021 01|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:LR 4|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "PacBio Iso seq of zebrafish: 1k cell", "DR 004", "DR 004", "Total RNA was isolated from each developmental stages of zebrafish embryos using TRIzolTM Reagent Invitrogen. RNA purity and concentration were assessed with the NanoPhotometer spectrophotometer IMPLEN  CA  USA and the Qubit RNA Assay Kit in the Qubit 3.0 Fluorometer Life Technologies  CA  USA. The RNA integrity number RIN was determined using the RNA Nano 6000 Assay Kit and Agilent Bioanalyzer 2100 system Agilent Technologies  CA  USA. RNA samples with a RIN  8 were used to synthesize cDNA with SMARTerPCR cDNA Synthesis Kit Takara Bio USA  Inc.  Mountain View  CA  USA. PCR amplification was performed using a KAPA HiFi PCR Kit Kapa Biosystems  Wilmington  MA  USA with the optimized number of cycles. Size selection of PCR products cDNA for each sample was applied using the BluePippin System: <3 kb and >3 kb. Subsequently  two cDNA libraries <3 kb  >3 kb were prepared using a SMRTbell Template Prep Kit 1.0 Pacific Biosciences  Menlo Park  CA  USA and sequenced on the PacBio sequel II platform.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "PACBIO_SMRT", "Sequel II", null, "SRP466518", null, null, "1k.ccs.fq.gz", "fastq", 8036121763.0, 2087907.0, "1k.ccs.fq.gz", "0:3848.89", "A:2152838341;C:1873567602;G:1863627936;T:2146087884;N:0", 3848, null, null, null, 2152838341, 1873567602, 1863627936, 2146087884, 0, "SRX22100894", "SRS19166020", "SRA1731898", "University of Michigan|Computational Medicine and Bioinformatics", "University of Michigan", 1, 0.43117, null, 0.00077, null, 0.86352, null, 0.48891, null, 2071, null, "T", null, "long read", "pacbio", "pacbio_modern", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-16", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28576, "SRR26395050", "SRX22100883", "SRS19166009", "SRP466518", "PRJNA1028258", "Zygotic activation of transposable elements during zebrafish early embryogenesis", "PRJNA1028258", "Other", "Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus  transcript  and allele over zebrafish early embryonic development. Moreover  we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish  where extensive variation exists among TE families  subfamilies  loci  transcripts and alleles with respect to evolutionary age.", null, "pubmed:40246845", null, null, "64 cell Iso seq", null, "strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:LR 3|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "PacBio Iso seq of zebrafish: 64 cell", "DR 003", "DR 003", "Total RNA was isolated from each developmental stages of zebrafish embryos using TRIzolTM Reagent Invitrogen. RNA purity and concentration were assessed with the NanoPhotometer spectrophotometer IMPLEN  CA  USA and the Qubit RNA Assay Kit in the Qubit 3.0 Fluorometer Life Technologies  CA  USA. The RNA integrity number RIN was determined using the RNA Nano 6000 Assay Kit and Agilent Bioanalyzer 2100 system Agilent Technologies  CA  USA. RNA samples with a RIN  8 were used to synthesize cDNA with SMARTerPCR cDNA Synthesis Kit Takara Bio USA  Inc.  Mountain View  CA  USA. PCR amplification was performed using a KAPA HiFi PCR Kit Kapa Biosystems  Wilmington  MA  USA with the optimized number of cycles. Size selection of PCR products cDNA for each sample was applied using the BluePippin System: <3 kb and >3 kb. Subsequently  two cDNA libraries <3 kb  >3 kb were prepared using a SMRTbell Template Prep Kit 1.0 Pacific Biosciences  Menlo Park  CA  USA and sequenced on the PacBio sequel II platform.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "PACBIO_SMRT", "Sequel", null, "SRP466518", null, null, "cell64_1.ccs.fq.gz cell64_2.ccs.fq.gz", "fastq fastq", 2829660788.0, 1238867.0, "cell64 1.ccs.fq.gz", "0:2284.07", "A:765802910;C:646754322;G:668768985;T:748334571;N:0", 2284, null, null, null, 765802910, 646754322, 668768985, 748334571, 0, "SRX22100883", "SRS19166009", "SRA1731898", "University of Michigan|Computational Medicine and Bioinformatics", "University of Michigan", 1, 0.37504, null, 0.00108, null, 0.91149, null, 0.48939, null, 1913, null, "T", null, "long read", "pacbio", "pacbio_modern", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-16", "Cleavage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28586, "SRR26395062", "SRX22100872", "SRS19165998", "SRP466518", "PRJNA1028258", "Zygotic activation of transposable elements during zebrafish early embryogenesis", "PRJNA1028258", "Other", "Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus  transcript  and allele over zebrafish early embryonic development. Moreover  we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish  where extensive variation exists among TE families  subfamilies  loci  transcripts and alleles with respect to evolutionary age.", null, "pubmed:40246845", null, null, "Shield Iso seq", null, "strain:AB x India|age:6 hpf|dev stage:shield|collection date:2021 01|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:LR 11|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "PacBio Iso seq of zebrafish: shield", "DR 011", "DR 011", "Total RNA was isolated from each developmental stages of zebrafish embryos using TRIzolTM Reagent Invitrogen. RNA purity and concentration were assessed with the NanoPhotometer spectrophotometer IMPLEN  CA  USA and the Qubit RNA Assay Kit in the Qubit 3.0 Fluorometer Life Technologies  CA  USA. The RNA integrity number RIN was determined using the RNA Nano 6000 Assay Kit and Agilent Bioanalyzer 2100 system Agilent Technologies  CA  USA. RNA samples with a RIN  8 were used to synthesize cDNA with SMARTerPCR cDNA Synthesis Kit Takara Bio USA  Inc.  Mountain View  CA  USA. PCR amplification was performed using a KAPA HiFi PCR Kit Kapa Biosystems  Wilmington  MA  USA with the optimized number of cycles. Size selection of PCR products cDNA for each sample was applied using the BluePippin System: <3 kb and >3 kb. Subsequently  two cDNA libraries <3 kb  >3 kb were prepared using a SMRTbell Template Prep Kit 1.0 Pacific Biosciences  Menlo Park  CA  USA and sequenced on the PacBio sequel II platform.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "PACBIO_SMRT", "Sequel II", null, "SRP466518", null, null, "shield.ccs.fq.gz", "fastq", 7256029471.0, 1854553.0, "shield.ccs.fq.gz", "0:3912.55", "A:1984833012;C:1651523494;G:1642156033;T:1977516932;N:0", 3912, null, null, null, 1984833012, 1651523494, 1642156033, 1977516932, 0, "SRX22100872", "SRS19165998", "SRA1731898", "University of Michigan|Computational Medicine and Bioinformatics", "University of Michigan", 1, 0.2041, null, 0.00298, null, 0.91837, null, 0.08263, null, 2962, null, "T", null, "long read", "pacbio", "pacbio_modern", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-16", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28587, "SRR26395063", "SRX22100871", "SRS19165997", "SRP466518", "PRJNA1028258", "Zygotic activation of transposable elements during zebrafish early embryogenesis", "PRJNA1028258", "Other", "Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus  transcript  and allele over zebrafish early embryonic development. Moreover  we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish  where extensive variation exists among TE families  subfamilies  loci  transcripts and alleles with respect to evolutionary age.", null, "pubmed:40246845", null, null, "1 cell Iso seq", null, "strain:AB x India|age:0.5 hpf|dev stage:1cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:LR 2|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "PacBio Iso seq of zebrafish: 1 cell", "DR 002", "DR 002", "Total RNA was isolated from each developmental stages of zebrafish embryos using TRIzolTM Reagent Invitrogen. RNA purity and concentration were assessed with the NanoPhotometer spectrophotometer IMPLEN  CA  USA and the Qubit RNA Assay Kit in the Qubit 3.0 Fluorometer Life Technologies  CA  USA. The RNA integrity number RIN was determined using the RNA Nano 6000 Assay Kit and Agilent Bioanalyzer 2100 system Agilent Technologies  CA  USA. RNA samples with a RIN  8 were used to synthesize cDNA with SMARTerPCR cDNA Synthesis Kit Takara Bio USA  Inc.  Mountain View  CA  USA. PCR amplification was performed using a KAPA HiFi PCR Kit Kapa Biosystems  Wilmington  MA  USA with the optimized number of cycles. Size selection of PCR products cDNA for each sample was applied using the BluePippin System: <3 kb and >3 kb. Subsequently  two cDNA libraries <3 kb  >3 kb were prepared using a SMRTbell Template Prep Kit 1.0 Pacific Biosciences  Menlo Park  CA  USA and sequenced on the PacBio sequel II platform.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "PACBIO_SMRT", "Sequel", null, "SRP466518", null, null, "cell1_1.ccs.fq.gz cell1_2.ccs.fq.gz", "fastq fastq", 2076576705.0, 1053386.0, "cell1 1.ccs.fq.gz", "0:1971.34", "A:560055059;C:479061015;G:485136981;T:552323650;N:0", 1971, null, null, null, 560055059, 479061015, 485136981, 552323650, 0, "SRX22100871", "SRS19165997", "SRA1731898", "University of Michigan|Computational Medicine and Bioinformatics", "University of Michigan", 1, 0.44892, null, 0.00258, null, 0.90114, null, 0.50832, null, 32, null, "B", null, "usable mapping rate", "pacbio", "pacbio_modern", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-16", "Zygote", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28588, "SRR26395064", "SRX22100870", "SRS19165996", "SRP466518", "PRJNA1028258", "Zygotic activation of transposable elements during zebrafish early embryogenesis", "PRJNA1028258", "Other", "Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus  transcript  and allele over zebrafish early embryonic development. Moreover  we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish  where extensive variation exists among TE families  subfamilies  loci  transcripts and alleles with respect to evolutionary age.", null, "pubmed:40246845", null, null, "fertilized egg Iso seq", null, "strain:AB x India|age:0 hpf|dev stage:fertilized egg|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:LR 1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "PacBio Iso seq of zebrafish: fertilized egg", "DR 001", "DR 001", "Total RNA was isolated from each developmental stages of zebrafish embryos using TRIzolTM Reagent Invitrogen. RNA purity and concentration were assessed with the NanoPhotometer spectrophotometer IMPLEN  CA  USA and the Qubit RNA Assay Kit in the Qubit 3.0 Fluorometer Life Technologies  CA  USA. The RNA integrity number RIN was determined using the RNA Nano 6000 Assay Kit and Agilent Bioanalyzer 2100 system Agilent Technologies  CA  USA. RNA samples with a RIN  8 were used to synthesize cDNA with SMARTerPCR cDNA Synthesis Kit Takara Bio USA  Inc.  Mountain View  CA  USA. PCR amplification was performed using a KAPA HiFi PCR Kit Kapa Biosystems  Wilmington  MA  USA with the optimized number of cycles. Size selection of PCR products cDNA for each sample was applied using the BluePippin System: <3 kb and >3 kb. Subsequently  two cDNA libraries <3 kb  >3 kb were prepared using a SMRTbell Template Prep Kit 1.0 Pacific Biosciences  Menlo Park  CA  USA and sequenced on the PacBio sequel II platform.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "PACBIO_SMRT", "Sequel", null, "SRP466518", null, null, "cell0_1.ccs.fq.gz cell0_2.ccs.fq.gz cell0_3.ccs.fq.gz", "fastq fastq fastq", 3550605210.0, 2083545.0, "cell0 1.ccs.fq.gz", "0:1704.12", "A:990393181;C:795168216;G:861389798;T:903654015;N:0", 1704, null, null, null, 990393181, 795168216, 861389798, 903654015, 0, "SRX22100870", "SRS19165996", "SRA1731898", "University of Michigan|Computational Medicine and Bioinformatics", "University of Michigan", 1, 0.33296, null, 0.00275, null, 0.95548, null, 0.552, null, 1155, null, "T", null, "long read", "pacbio", "pacbio_modern", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United States", "2023-10-16", "Zygote", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28906, "SRR26845640", "SRX22541146", "SRS19550731", "SRP472251", "PRJNA1040920", "Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data]", "GSE247930", "Other", "Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs  it has been challenging to study their expression dynamics separately. Results: By employing Slam seq  a nascent mRNA labeling transcriptomic approach  in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes  emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories  finding that most de novo transcriptional events are stable throughout this period. Additionally  by blocking microRNA430 function  a key post transcriptional regulator during zebrafish embryogenesis  we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis  fine tuning zygotic gene expression  which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels.  Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP  plus 20\u00b5M of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time  shield stage 6 hours post injection. Total RNA was extracted  and kept away from direct light   alkylated  used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.", "parent bioproject:PRJNA1040928", null, null, "zebrafish shield 20\u00b5M lnamir430 50mM s4u r6", "GSM7903226", null, "source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20\u00b5M lna against miR 430 seed and 50mM s4UTP injection|geo loc name:missing|collection date:missing", "zebrafish shield 20\u00b5M lnamir430 50mM s4u r6", "Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values  <.csv>; Total raw read and labeled read counts for all experiments and samples  including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts  or ERCC IDs spike ins;  Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;", "Embryos at shield stage", "Embryos were injected with 1000pL of 50mM s4 UTP plus 20\u00b5M of either locked nucleic acid against miR 430 seed or a mismatch oligo.", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", "Zebrafish embryos were collected from natural breeding  with random mating parents  embryos were kept at 28.5 C in 0.5x Embryo Media.", "tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20\u00b5M lna against miR 430 seed and 50mM s4UTP injection", "GSM7903226", "GSM7903226: zebrafish shield 20\u00b5M lnamir430 50mM s4u r6; Danio rerio; RNA Seq", "GSM7903226 r1", "GSM7903226", "1", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP472251", null, "loader:fastq load.py", "shield_LNA430_6.fastq.gz", "fastq", 7432626966.0, 73590366.0, "GSM7903226 r1", "0:101", "A:2650382519;C:1367541457;G:1415587402;T:1999115588;N:0", 101, null, null, null, 2650382519, 1367541457, 1415587402, 1999115588, 0, "SRX22541146", "SRS19550731", "SRA1751929", "Bazzini Lab, Stowers Institute for Medical Research", "Bazzini Lab, Stowers Institute for Medical Research", 1, 0.66888, null, 0.17305, null, 0.83465, null, 0.69037, null, 101, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "3prime", "small_rna", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2023-11-15", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28907, "SRR26845641", "SRX22541145", "SRS19550730", "SRP472251", "PRJNA1040920", "Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data]", "GSE247930", "Other", "Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs  it has been challenging to study their expression dynamics separately. Results: By employing Slam seq  a nascent mRNA labeling transcriptomic approach  in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes  emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories  finding that most de novo transcriptional events are stable throughout this period. Additionally  by blocking microRNA430 function  a key post transcriptional regulator during zebrafish embryogenesis  we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis  fine tuning zygotic gene expression  which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels.  Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP  plus 20\u00b5M of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time  shield stage 6 hours post injection. Total RNA was extracted  and kept away from direct light   alkylated  used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.", "parent bioproject:PRJNA1040928", null, null, "zebrafish shield 20\u00b5M lnamir430 50mM s4u r5", "GSM7903225", null, "source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20\u00b5M lna against miR 430 seed and 50mM s4UTP injection|geo loc name:missing|collection date:missing", "zebrafish shield 20\u00b5M lnamir430 50mM s4u r5", "Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values  <.csv>; Total raw read and labeled read counts for all experiments and samples  including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts  or ERCC IDs spike ins;  Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;", "Embryos at shield stage", "Embryos were injected with 1000pL of 50mM s4 UTP plus 20\u00b5M of either locked nucleic acid against miR 430 seed or a mismatch oligo.", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", "Zebrafish embryos were collected from natural breeding  with random mating parents  embryos were kept at 28.5 C in 0.5x Embryo Media.", "tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20\u00b5M lna against miR 430 seed and 50mM s4UTP injection", "GSM7903225", "GSM7903225: zebrafish shield 20\u00b5M lnamir430 50mM s4u r5; Danio rerio; RNA Seq", "GSM7903225 r1", "GSM7903225", "1", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP472251", null, "loader:fastq load.py", "shield_LNA430_5.fastq.gz", "fastq", 5517442847.0, 54628147.0, "GSM7903225 r1", "0:101", "A:1830971596;C:1020448830;G:1068982055;T:1597040366;N:0", 101, null, null, null, 1830971596, 1020448830, 1068982055, 1597040366, 0, "SRX22541145", "SRS19550730", "SRA1751929", "Bazzini Lab, Stowers Institute for Medical Research", "Bazzini Lab, Stowers Institute for Medical Research", 1, 0.7123, null, 0.14169, null, 0.81785, null, 0.61343, null, 101, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "3prime", "small_rna", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2023-11-15", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28908, "SRR26845642", "SRX22541144", "SRS19550729", "SRP472251", "PRJNA1040920", "Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data]", "GSE247930", "Other", "Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs  it has been challenging to study their expression dynamics separately. Results: By employing Slam seq  a nascent mRNA labeling transcriptomic approach  in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes  emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories  finding that most de novo transcriptional events are stable throughout this period. Additionally  by blocking microRNA430 function  a key post transcriptional regulator during zebrafish embryogenesis  we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis  fine tuning zygotic gene expression  which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels.  Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP  plus 20\u00b5M of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time  shield stage 6 hours post injection. Total RNA was extracted  and kept away from direct light   alkylated  used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.", "parent bioproject:PRJNA1040928", null, null, "zebrafish shield 20\u00b5M lnamir430 50mM s4u r4", "GSM7903224", null, "source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20\u00b5M lna against miR 430 seed and 50mM s4UTP injection|geo loc name:missing|collection date:missing", "zebrafish shield 20\u00b5M lnamir430 50mM s4u r4", "Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values  <.csv>; Total raw read and labeled read counts for all experiments and samples  including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts  or ERCC IDs spike ins;  Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;", "Embryos at shield stage", "Embryos were injected with 1000pL of 50mM s4 UTP plus 20\u00b5M of either locked nucleic acid against miR 430 seed or a mismatch oligo.", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", "Zebrafish embryos were collected from natural breeding  with random mating parents  embryos were kept at 28.5 C in 0.5x Embryo Media.", "tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20\u00b5M lna against miR 430 seed and 50mM s4UTP injection", "GSM7903224", "GSM7903224: zebrafish shield 20\u00b5M lnamir430 50mM s4u r4; Danio rerio; RNA Seq", "GSM7903224 r1", "GSM7903224", "1", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP472251", null, "loader:fastq load.py", "shield_LNA430_4.fastq.gz", "fastq", 7633894514.0, 75583114.0, "GSM7903224 r1", "0:101", "A:2522715535;C:1462363691;G:1540381861;T:2108433427;N:0", 101, null, null, null, 2522715535, 1462363691, 1540381861, 2108433427, 0, "SRX22541144", "SRS19550729", "SRA1751929", "Bazzini Lab, Stowers Institute for Medical Research", "Bazzini Lab, Stowers Institute for Medical Research", 1, 0.71858, null, 0.20656, null, 0.83522, null, 0.6748, null, 101, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "3prime", "small_rna", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2023-11-15", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28909, "SRR26845643", "SRX22541143", "SRS19550728", "SRP472251", "PRJNA1040920", "Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data]", "GSE247930", "Other", "Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs  it has been challenging to study their expression dynamics separately. Results: By employing Slam seq  a nascent mRNA labeling transcriptomic approach  in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes  emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories  finding that most de novo transcriptional events are stable throughout this period. Additionally  by blocking microRNA430 function  a key post transcriptional regulator during zebrafish embryogenesis  we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis  fine tuning zygotic gene expression  which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels.  Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP  plus 20\u00b5M of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time  shield stage 6 hours post injection. Total RNA was extracted  and kept away from direct light   alkylated  used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.", "parent bioproject:PRJNA1040928", null, null, "zebrafish shield 20\u00b5M lnamir430 50mM s4u r3", "GSM7903223", null, "source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20\u00b5M lna against miR 430 seed and 50mM s4UTP injection|geo loc name:missing|collection date:missing", "zebrafish shield 20\u00b5M lnamir430 50mM s4u r3", "Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values  <.csv>; Total raw read and labeled read counts for all experiments and samples  including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts  or ERCC IDs spike ins;  Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;", "Embryos at shield stage", "Embryos were injected with 1000pL of 50mM s4 UTP plus 20\u00b5M of either locked nucleic acid against miR 430 seed or a mismatch oligo.", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", "Zebrafish embryos were collected from natural breeding  with random mating parents  embryos were kept at 28.5 C in 0.5x Embryo Media.", "tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20\u00b5M lna against miR 430 seed and 50mM s4UTP injection", "GSM7903223", "GSM7903223: zebrafish shield 20\u00b5M lnamir430 50mM s4u r3; Danio rerio; RNA Seq", "GSM7903223 r1", "GSM7903223", "1", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP472251", null, "loader:fastq load.py", "shield_LNA430_3.fastq.gz", "fastq", 6740922911.0, 66741811.0, "GSM7903223 r1", "0:101", "A:2320670868;C:1251436299;G:1316606507;T:1852209237;N:0", 101, null, null, null, 2320670868, 1251436299, 1316606507, 1852209237, 0, "SRX22541143", "SRS19550728", "SRA1751929", "Bazzini Lab, Stowers Institute for Medical Research", "Bazzini Lab, Stowers Institute for Medical Research", 1, 0.69597, null, 0.18028, null, 0.8341, null, 0.68324, null, 101, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "3prime", "small_rna", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2023-11-15", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28910, "SRR26845644", "SRX22541142", "SRS19550727", "SRP472251", "PRJNA1040920", "Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data]", "GSE247930", "Other", "Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs  it has been challenging to study their expression dynamics separately. Results: By employing Slam seq  a nascent mRNA labeling transcriptomic approach  in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes  emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories  finding that most de novo transcriptional events are stable throughout this period. Additionally  by blocking microRNA430 function  a key post transcriptional regulator during zebrafish embryogenesis  we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis  fine tuning zygotic gene expression  which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels.  Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP  plus 20\u00b5M of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time  shield stage 6 hours post injection. Total RNA was extracted  and kept away from direct light   alkylated  used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.", "parent bioproject:PRJNA1040928", null, null, "zebrafish shield 20\u00b5M lnamir430 50mM s4u r2", "GSM7903222", null, "source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20\u00b5M lna against miR 430 seed and 50mM s4UTP injection|geo loc name:missing|collection date:missing", "zebrafish shield 20\u00b5M lnamir430 50mM s4u r2", "Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values  <.csv>; Total raw read and labeled read counts for all experiments and samples  including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts  or ERCC IDs spike ins;  Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;", "Embryos at shield stage", "Embryos were injected with 1000pL of 50mM s4 UTP plus 20\u00b5M of either locked nucleic acid against miR 430 seed or a mismatch oligo.", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", "Zebrafish embryos were collected from natural breeding  with random mating parents  embryos were kept at 28.5 C in 0.5x Embryo Media.", "tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20\u00b5M lna against miR 430 seed and 50mM s4UTP injection", "GSM7903222", "GSM7903222: zebrafish shield 20\u00b5M lnamir430 50mM s4u r2; Danio rerio; RNA Seq", "GSM7903222 r1", "GSM7903222", "1", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP472251", null, "loader:fastq load.py", "shield_LNA430_2.fastq.gz", "fastq", 4965369272.0, 49162072.0, "GSM7903222 r1", "0:101", "A:1663212628;C:946084438;G:1026397565;T:1326957174;N:2717467", 101, null, null, null, 1663212628, 946084438, 1026397565, 1326957174, 2717467, "SRX22541142", "SRS19550727", "SRA1751929", "Bazzini Lab, Stowers Institute for Medical Research", "Bazzini Lab, Stowers Institute for Medical Research", 1, 0.67731, null, 0.17959, null, 0.84758, null, 0.35494, null, 101, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "3prime", "small_rna", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2023-11-15", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28911, "SRR26845645", "SRX22541141", "SRS19550724", "SRP472251", "PRJNA1040920", "Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data]", "GSE247930", "Other", "Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs  it has been challenging to study their expression dynamics separately. Results: By employing Slam seq  a nascent mRNA labeling transcriptomic approach  in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes  emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories  finding that most de novo transcriptional events are stable throughout this period. Additionally  by blocking microRNA430 function  a key post transcriptional regulator during zebrafish embryogenesis  we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis  fine tuning zygotic gene expression  which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels.  Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP  plus 20\u00b5M of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time  shield stage 6 hours post injection. Total RNA was extracted  and kept away from direct light   alkylated  used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.", "parent bioproject:PRJNA1040928", null, null, "zebrafish shield 20\u00b5M lnamir430 50mM s4u r1", "GSM7903221", null, "source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20\u00b5M lna against miR 430 seed and 50mM s4UTP injection|geo loc name:missing|collection date:missing", "zebrafish shield 20\u00b5M lnamir430 50mM s4u r1", "Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values  <.csv>; Total raw read and labeled read counts for all experiments and samples  including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts  or ERCC IDs spike ins;  Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;", "Embryos at shield stage", "Embryos were injected with 1000pL of 50mM s4 UTP plus 20\u00b5M of either locked nucleic acid against miR 430 seed or a mismatch oligo.", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", "Zebrafish embryos were collected from natural breeding  with random mating parents  embryos were kept at 28.5 C in 0.5x Embryo Media.", "tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20\u00b5M lna against miR 430 seed and 50mM s4UTP injection", "GSM7903221", "GSM7903221: zebrafish shield 20\u00b5M lnamir430 50mM s4u r1; Danio rerio; RNA Seq", "GSM7903221 r1", "GSM7903221", "1", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP472251", null, "loader:fastq load.py", "shield_LNA430_1.fastq.gz", "fastq", 4180419189.0, 41390289.0, "GSM7903221 r1", "0:101", "A:1388136145;C:781877911;G:841117776;T:1166988154;N:2299203", 101, null, null, null, 1388136145, 781877911, 841117776, 1166988154, 2299203, "SRX22541141", "SRS19550724", "SRA1751929", "Bazzini Lab, Stowers Institute for Medical Research", "Bazzini Lab, Stowers Institute for Medical Research", 1, 0.7194, null, 0.16361, null, 0.8326, null, 0.36766, null, 101, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "3prime", "small_rna", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2023-11-15", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28912, "SRR26845646", "SRX22541140", "SRS19550726", "SRP472251", "PRJNA1040920", "Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data]", "GSE247930", "Other", "Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs  it has been challenging to study their expression dynamics separately. Results: By employing Slam seq  a nascent mRNA labeling transcriptomic approach  in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes  emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories  finding that most de novo transcriptional events are stable throughout this period. Additionally  by blocking microRNA430 function  a key post transcriptional regulator during zebrafish embryogenesis  we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis  fine tuning zygotic gene expression  which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels.  Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP  plus 20\u00b5M of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time  shield stage 6 hours post injection. Total RNA was extracted  and kept away from direct light   alkylated  used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.", "parent bioproject:PRJNA1040928", null, null, "zebrafish shield 20\u00b5M lnacontrol 50mM s4u r6", "GSM7903220", null, "source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20\u00b5M lnacontrol and 50mM s4UTP injection|geo loc name:missing|collection date:missing", "zebrafish shield 20\u00b5M lnacontrol 50mM s4u r6", "Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values  <.csv>; Total raw read and labeled read counts for all experiments and samples  including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts  or ERCC IDs spike ins;  Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;", "Embryos at shield stage", "Embryos were injected with 1000pL of 50mM s4 UTP plus 20\u00b5M of either locked nucleic acid against miR 430 seed or a mismatch oligo.", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", "Zebrafish embryos were collected from natural breeding  with random mating parents  embryos were kept at 28.5 C in 0.5x Embryo Media.", "tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20\u00b5M lnacontrol and 50mM s4UTP injection", "GSM7903220", "GSM7903220: zebrafish shield 20\u00b5M lnacontrol 50mM s4u r6; Danio rerio; RNA Seq", "GSM7903220 r1", "GSM7903220", "1", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP472251", null, "loader:fastq load.py", "shield_LNA_Mis_6.fastq.gz", "fastq", 3528723355.0, 34937855.0, "GSM7903220 r1", "0:101", "A:1169270874;C:664348337;G:701284585;T:993819559;N:0", 101, null, null, null, 1169270874, 664348337, 701284585, 993819559, 0, "SRX22541140", "SRS19550726", "SRA1751929", "Bazzini Lab, Stowers Institute for Medical Research", "Bazzini Lab, Stowers Institute for Medical Research", 1, 0.73609, null, 0.18234, null, 0.82789, null, 0.67273, null, 101, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "3prime", "small_rna", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2023-11-15", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28913, "SRR26845647", "SRX22541139", "SRS19550725", "SRP472251", "PRJNA1040920", "Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data]", "GSE247930", "Other", "Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs  it has been challenging to study their expression dynamics separately. Results: By employing Slam seq  a nascent mRNA labeling transcriptomic approach  in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes  emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories  finding that most de novo transcriptional events are stable throughout this period. Additionally  by blocking microRNA430 function  a key post transcriptional regulator during zebrafish embryogenesis  we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis  fine tuning zygotic gene expression  which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels.  Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP  plus 20\u00b5M of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time  shield stage 6 hours post injection. Total RNA was extracted  and kept away from direct light   alkylated  used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.", "parent bioproject:PRJNA1040928", null, null, "zebrafish shield 20\u00b5M lnacontrol 50mM s4u r5", "GSM7903219", null, "source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20\u00b5M lnacontrol and 50mM s4UTP injection|geo loc name:missing|collection date:missing", "zebrafish shield 20\u00b5M lnacontrol 50mM s4u r5", "Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values  <.csv>; Total raw read and labeled read counts for all experiments and samples  including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts  or ERCC IDs spike ins;  Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;", "Embryos at shield stage", "Embryos were injected with 1000pL of 50mM s4 UTP plus 20\u00b5M of either locked nucleic acid against miR 430 seed or a mismatch oligo.", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", "Zebrafish embryos were collected from natural breeding  with random mating parents  embryos were kept at 28.5 C in 0.5x Embryo Media.", "tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20\u00b5M lnacontrol and 50mM s4UTP injection", "GSM7903219", "GSM7903219: zebrafish shield 20\u00b5M lnacontrol 50mM s4u r5; Danio rerio; RNA Seq", "GSM7903219 r1", "GSM7903219", "1", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP472251", null, "loader:fastq load.py", "shield_LNA_Mis_5.fastq.gz", "fastq", 6194543716.0, 61332116.0, "GSM7903219 r1", "0:101", "A:2097813326;C:1118975109;G:1172439642;T:1805315639;N:0", 101, null, null, null, 2097813326, 1118975109, 1172439642, 1805315639, 0, "SRX22541139", "SRS19550725", "SRA1751929", "Bazzini Lab, Stowers Institute for Medical Research", "Bazzini Lab, Stowers Institute for Medical Research", 1, 0.68662, null, 0.14858, null, 0.81931, null, 0.58494, null, 101, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "3prime", "small_rna", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2023-11-15", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28914, "SRR26845648", "SRX22541138", "SRS19550721", "SRP472251", "PRJNA1040920", "Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data]", "GSE247930", "Other", "Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs  it has been challenging to study their expression dynamics separately. Results: By employing Slam seq  a nascent mRNA labeling transcriptomic approach  in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes  emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories  finding that most de novo transcriptional events are stable throughout this period. Additionally  by blocking microRNA430 function  a key post transcriptional regulator during zebrafish embryogenesis  we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis  fine tuning zygotic gene expression  which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels.  Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP  plus 20\u00b5M of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time  shield stage 6 hours post injection. Total RNA was extracted  and kept away from direct light   alkylated  used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.", "parent bioproject:PRJNA1040928", null, null, "zebrafish shield 20\u00b5M lnacontrol 50mM s4u r4", "GSM7903218", null, "source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20\u00b5M lnacontrol and 50mM s4UTP injection|geo loc name:missing|collection date:missing", "zebrafish shield 20\u00b5M lnacontrol 50mM s4u r4", "Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values  <.csv>; Total raw read and labeled read counts for all experiments and samples  including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts  or ERCC IDs spike ins;  Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;", "Embryos at shield stage", "Embryos were injected with 1000pL of 50mM s4 UTP plus 20\u00b5M of either locked nucleic acid against miR 430 seed or a mismatch oligo.", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", "Zebrafish embryos were collected from natural breeding  with random mating parents  embryos were kept at 28.5 C in 0.5x Embryo Media.", "tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20\u00b5M lnacontrol and 50mM s4UTP injection", "GSM7903218", "GSM7903218: zebrafish shield 20\u00b5M lnacontrol 50mM s4u r4; Danio rerio; RNA Seq", "GSM7903218 r1", "GSM7903218", "1", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP472251", null, "loader:fastq load.py", "shield_LNA_Mis_4.fastq.gz", "fastq", 7267022619.0, 71950719.0, "GSM7903218 r1", "0:101", "A:2506840526;C:1345281143;G:1405742068;T:2009158882;N:0", 101, null, null, null, 2506840526, 1345281143, 1405742068, 2009158882, 0, "SRX22541138", "SRS19550721", "SRA1751929", "Bazzini Lab, Stowers Institute for Medical Research", "Bazzini Lab, Stowers Institute for Medical Research", 1, 0.66968, null, 0.17594, null, 0.83151, null, 0.65157, null, 101, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "3prime", "small_rna", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2023-11-15", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28915, "SRR26845649", "SRX22541137", "SRS19550722", "SRP472251", "PRJNA1040920", "Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data]", "GSE247930", "Other", "Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs  it has been challenging to study their expression dynamics separately. Results: By employing Slam seq  a nascent mRNA labeling transcriptomic approach  in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes  emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories  finding that most de novo transcriptional events are stable throughout this period. Additionally  by blocking microRNA430 function  a key post transcriptional regulator during zebrafish embryogenesis  we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis  fine tuning zygotic gene expression  which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels.  Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP  plus 20\u00b5M of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time  shield stage 6 hours post injection. Total RNA was extracted  and kept away from direct light   alkylated  used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.", "parent bioproject:PRJNA1040928", null, null, "zebrafish shield 20\u00b5M lnacontrol 50mM s4u r3", "GSM7903217", null, "source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20\u00b5M lnacontrol and 50mM s4UTP injection|geo loc name:missing|collection date:missing", "zebrafish shield 20\u00b5M lnacontrol 50mM s4u r3", "Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values  <.csv>; Total raw read and labeled read counts for all experiments and samples  including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts  or ERCC IDs spike ins;  Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;", "Embryos at shield stage", "Embryos were injected with 1000pL of 50mM s4 UTP plus 20\u00b5M of either locked nucleic acid against miR 430 seed or a mismatch oligo.", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", "Zebrafish embryos were collected from natural breeding  with random mating parents  embryos were kept at 28.5 C in 0.5x Embryo Media.", "tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20\u00b5M lnacontrol and 50mM s4UTP injection", "GSM7903217", "GSM7903217: zebrafish shield 20\u00b5M lnacontrol 50mM s4u r3; Danio rerio; RNA Seq", "GSM7903217 r1", "GSM7903217", "1", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP472251", null, "loader:fastq load.py", "shield_LNA_Mis_3.fastq.gz", "fastq", 5967073536.0, 59079936.0, "GSM7903217 r1", "0:101", "A:2104721652;C:1097559356;G:1127515791;T:1637276737;N:0", 101, null, null, null, 2104721652, 1097559356, 1127515791, 1637276737, 0, "SRX22541137", "SRS19550722", "SRA1751929", "Bazzini Lab, Stowers Institute for Medical Research", "Bazzini Lab, Stowers Institute for Medical Research", 1, 0.63706, null, 0.16097, null, 0.83461, null, 0.66484, null, 101, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "3prime", "small_rna", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2023-11-15", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28916, "SRR26845650", "SRX22541136", "SRS19550723", "SRP472251", "PRJNA1040920", "Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data]", "GSE247930", "Other", "Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs  it has been challenging to study their expression dynamics separately. Results: By employing Slam seq  a nascent mRNA labeling transcriptomic approach  in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes  emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories  finding that most de novo transcriptional events are stable throughout this period. Additionally  by blocking microRNA430 function  a key post transcriptional regulator during zebrafish embryogenesis  we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis  fine tuning zygotic gene expression  which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels.  Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP  plus 20\u00b5M of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time  shield stage 6 hours post injection. Total RNA was extracted  and kept away from direct light   alkylated  used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.", "parent bioproject:PRJNA1040928", null, null, "zebrafish shield 20\u00b5M lnacontrol 50mM s4u r2", "GSM7903216", null, "source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20\u00b5M lnacontrol and 50mM s4UTP injection|geo loc name:missing|collection date:missing", "zebrafish shield 20\u00b5M lnacontrol 50mM s4u r2", "Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values  <.csv>; Total raw read and labeled read counts for all experiments and samples  including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts  or ERCC IDs spike ins;  Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;", "Embryos at shield stage", "Embryos were injected with 1000pL of 50mM s4 UTP plus 20\u00b5M of either locked nucleic acid against miR 430 seed or a mismatch oligo.", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", "Zebrafish embryos were collected from natural breeding  with random mating parents  embryos were kept at 28.5 C in 0.5x Embryo Media.", "tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20\u00b5M lnacontrol and 50mM s4UTP injection", "GSM7903216", "GSM7903216: zebrafish shield 20\u00b5M lnacontrol 50mM s4u r2; Danio rerio; RNA Seq", "GSM7903216 r1", "GSM7903216", "1", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP472251", null, "loader:fastq load.py", "shield_LNA_Mis_2.fastq.gz", "fastq", 3643975465.0, 36078965.0, "GSM7903216 r1", "0:101", "A:1169767894;C:685310134;G:753541931;T:1033295416;N:2060090", 101, null, null, null, 1169767894, 685310134, 753541931, 1033295416, 2060090, "SRX22541136", "SRS19550723", "SRA1751929", "Bazzini Lab, Stowers Institute for Medical Research", "Bazzini Lab, Stowers Institute for Medical Research", 1, 0.7292, null, 0.18508, null, 0.83424, null, 0.62718, null, 101, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "3prime", "small_rna", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2023-11-15", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28917, "SRR26845651", "SRX22541135", "SRS19550720", "SRP472251", "PRJNA1040920", "Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data]", "GSE247930", "Other", "Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs  it has been challenging to study their expression dynamics separately. Results: By employing Slam seq  a nascent mRNA labeling transcriptomic approach  in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes  emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories  finding that most de novo transcriptional events are stable throughout this period. Additionally  by blocking microRNA430 function  a key post transcriptional regulator during zebrafish embryogenesis  we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis  fine tuning zygotic gene expression  which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels.  Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP  plus 20\u00b5M of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time  shield stage 6 hours post injection. Total RNA was extracted  and kept away from direct light   alkylated  used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.", "parent bioproject:PRJNA1040928", null, null, "zebrafish shield 20\u00b5M lnacontrol 50mM s4u r1", "GSM7903215", null, "source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20\u00b5M lnacontrol and 50mM s4UTP injection|geo loc name:missing|collection date:missing", "zebrafish shield 20\u00b5M lnacontrol 50mM s4u r1", "Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values  <.csv>; Total raw read and labeled read counts for all experiments and samples  including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts  or ERCC IDs spike ins;  Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;", "Embryos at shield stage", "Embryos were injected with 1000pL of 50mM s4 UTP plus 20\u00b5M of either locked nucleic acid against miR 430 seed or a mismatch oligo.", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", "Zebrafish embryos were collected from natural breeding  with random mating parents  embryos were kept at 28.5 C in 0.5x Embryo Media.", "tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20\u00b5M lnacontrol and 50mM s4UTP injection", "GSM7903215", "GSM7903215: zebrafish shield 20\u00b5M lnacontrol 50mM s4u r1; Danio rerio; RNA Seq", "GSM7903215 r1", "GSM7903215", "1", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP472251", null, "loader:fastq load.py", "shield_LNA_Mis_1.fastq.gz", "fastq", 4881473117.0, 48331417.0, "GSM7903215 r1", "0:101", "A:1562562452;C:901372607;G:981986460;T:1432839789;N:2711809", 101, null, null, null, 1562562452, 901372607, 981986460, 1432839789, 2711809, "SRX22541135", "SRS19550720", "SRA1751929", "Bazzini Lab, Stowers Institute for Medical Research", "Bazzini Lab, Stowers Institute for Medical Research", 1, 0.72355, null, 0.15423, null, 0.82262, null, 0.58105, null, 101, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "3prime", "small_rna", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2023-11-15", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28918, "SRR26845652", "SRX22541168", "SRS19550753", "SRP472252", "PRJNA1040929", "Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data]", "GSE247933", "Other", "Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs  it has been challenging to study their expression dynamics separately. Results: By employing Slam seq  a nascent mRNA labeling transcriptomic approach  in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes  emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories  finding that most de novo transcriptional events are stable throughout this period. Additionally  by blocking microRNA430 function  a key post transcriptional regulator during zebrafish embryogenesis  we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis  fine tuning zygotic gene expression  which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels.  Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted  and kept away from direct light   alkylated  used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.", "parent bioproject:PRJNA1040928", null, null, "zebrafish 8hour wt 75mM s4u r3", "GSM7903274", null, "tissue:Embryos at 8 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing", "zebrafish 8hour wt 75mM s4u r3", "Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values  <.csv>; Total raw read and labeled read counts for all experiments and samples  including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts  or ERCC IDs spike ins;  Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;", "Embryos at 8 hpf", "Embryos were injected with 1000pL of 75mM s4 UTP.", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", "Zebrafish embryos were collected from natural breeding  with random mating parents  embryos were kept at 28.5 C in 0.5x Embryo Media.", "tissue:Embryos|Stage:8 hpf of [AB TU]x[TL TLF]", "GSM7903274", "GSM7903274: zebrafish 8hour wt 75mM s4u r3; Danio rerio; RNA Seq", "GSM7903274 r1", "GSM7903274", "1", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP472252", null, "loader:fastq load.py", "s8h_4.fastq.gz", "fastq", 5796273345.0, 57388845.0, "GSM7903274 r1", "0:101", "A:1987532805;C:1079193337;G:1164388405;T:1561938100;N:3220698", 101, null, null, null, 1987532805, 1079193337, 1164388405, 1561938100, 3220698, "SRX22541168", "SRS19550753", "SRA1751928", "Bazzini Lab, Stowers Institute for Medical Research", "Bazzini Lab, Stowers Institute for Medical Research", 1, 0.64204, null, 0.18985, null, 0.84348, null, 0.60294, null, 101, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "3prime", "small_rna", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2023-11-15", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28919, "SRR26845653", "SRX22541167", "SRS19550752", "SRP472252", "PRJNA1040929", "Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data]", "GSE247933", "Other", "Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs  it has been challenging to study their expression dynamics separately. Results: By employing Slam seq  a nascent mRNA labeling transcriptomic approach  in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes  emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories  finding that most de novo transcriptional events are stable throughout this period. Additionally  by blocking microRNA430 function  a key post transcriptional regulator during zebrafish embryogenesis  we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis  fine tuning zygotic gene expression  which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels.  Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted  and kept away from direct light   alkylated  used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.", "parent bioproject:PRJNA1040928", null, null, "zebrafish 8hour wt 75mM s4u r2", "GSM7903273", null, "tissue:Embryos at 8 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing", "zebrafish 8hour wt 75mM s4u r2", "Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values  <.csv>; Total raw read and labeled read counts for all experiments and samples  including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts  or ERCC IDs spike ins;  Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;", "Embryos at 8 hpf", "Embryos were injected with 1000pL of 75mM s4 UTP.", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", "Zebrafish embryos were collected from natural breeding  with random mating parents  embryos were kept at 28.5 C in 0.5x Embryo Media.", "tissue:Embryos|Stage:8 hpf of [AB TU]x[TL TLF]", "GSM7903273", "GSM7903273: zebrafish 8hour wt 75mM s4u r2; Danio rerio; RNA Seq", "GSM7903273 r1", "GSM7903273", "1", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP472252", null, "loader:fastq load.py", "s8h_2.fastq.gz", "fastq", 4897372941.0, 48488841.0, "GSM7903273 r1", "0:101", "A:1699755610;C:929418233;G:1005848571;T:1259595469;N:2755058", 101, null, null, null, 1699755610, 929418233, 1005848571, 1259595469, 2755058, "SRX22541167", "SRS19550752", "SRA1751928", "Bazzini Lab, Stowers Institute for Medical Research", "Bazzini Lab, Stowers Institute for Medical Research", 1, 0.62249, null, 0.23058, null, 0.85782, null, 0.62172, null, 101, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "3prime", "small_rna", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2023-11-15", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28920, "SRR26845654", "SRX22541166", "SRS19550750", "SRP472252", "PRJNA1040929", "Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data]", "GSE247933", "Other", "Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs  it has been challenging to study their expression dynamics separately. Results: By employing Slam seq  a nascent mRNA labeling transcriptomic approach  in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes  emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories  finding that most de novo transcriptional events are stable throughout this period. Additionally  by blocking microRNA430 function  a key post transcriptional regulator during zebrafish embryogenesis  we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis  fine tuning zygotic gene expression  which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels.  Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted  and kept away from direct light   alkylated  used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.", "parent bioproject:PRJNA1040928", null, null, "zebrafish 8hour wt 75mM s4u r1", "GSM7903272", null, "tissue:Embryos at 8 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing", "zebrafish 8hour wt 75mM s4u r1", "Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values  <.csv>; Total raw read and labeled read counts for all experiments and samples  including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts  or ERCC IDs spike ins;  Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;", "Embryos at 8 hpf", "Embryos were injected with 1000pL of 75mM s4 UTP.", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", "Zebrafish embryos were collected from natural breeding  with random mating parents  embryos were kept at 28.5 C in 0.5x Embryo Media.", "tissue:Embryos|Stage:8 hpf of [AB TU]x[TL TLF]", "GSM7903272", "GSM7903272: zebrafish 8hour wt 75mM s4u r1; Danio rerio; RNA Seq", "GSM7903272 r1", "GSM7903272", "1", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP472252", null, "loader:fastq load.py", "s8h_1.fastq.gz", "fastq", 4081964490.0, 40415490.0, "GSM7903272 r1", "0:101", "A:1381746632;C:779891737;G:836779689;T:1081260235;N:2286197", 101, null, null, null, 1381746632, 779891737, 836779689, 1081260235, 2286197, "SRX22541166", "SRS19550750", "SRA1751928", "Bazzini Lab, Stowers Institute for Medical Research", "Bazzini Lab, Stowers Institute for Medical Research", 1, 0.63669, null, 0.23628, null, 0.8578, null, 0.61689, null, 101, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "3prime", "small_rna", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2023-11-15", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [28921, "SRR26845655", "SRX22541165", "SRS19550751", "SRP472252", "PRJNA1040929", "Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data]", "GSE247933", "Other", "Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs  it has been challenging to study their expression dynamics separately. Results: By employing Slam seq  a nascent mRNA labeling transcriptomic approach  in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes  emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories  finding that most de novo transcriptional events are stable throughout this period. Additionally  by blocking microRNA430 function  a key post transcriptional regulator during zebrafish embryogenesis  we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis  fine tuning zygotic gene expression  which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels.  Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted  and kept away from direct light   alkylated  used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.", "parent bioproject:PRJNA1040928", null, null, "zebrafish 7hour wt 75mM s4u r3", "GSM7903271", null, "tissue:Embryos at 7 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing", "zebrafish 7hour wt 75mM s4u r3", "Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values  <.csv>; Total raw read and labeled read counts for all experiments and samples  including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts  or ERCC IDs spike ins;  Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;", "Embryos at 7 hpf", "Embryos were injected with 1000pL of 75mM s4 UTP.", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", "Zebrafish embryos were collected from natural breeding  with random mating parents  embryos were kept at 28.5 C in 0.5x Embryo Media.", "tissue:Embryos|Stage:7 hpf of [AB TU]x[TL TLF]", "GSM7903271", "GSM7903271: zebrafish 7hour wt 75mM s4u r3; Danio rerio; RNA Seq", "GSM7903271 r1", "GSM7903271", "1", "Trizol\u2122 QuantSeq 3\u2032 mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD  Lexogen GmbH  cat. no. 144.96", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP472252", null, "loader:fastq load.py", "s7h_4.fastq.gz", "fastq", 4851172511.0, 48031411.0, "GSM7903271 r1", "0:101", "A:1617620537;C:932157064;G:983796569;T:1314884644;N:2713697", 101, null, null, null, 1617620537, 932157064, 983796569, 1314884644, 2713697, "SRX22541165", "SRS19550751", "SRA1751928", "Bazzini Lab, Stowers Institute for Medical Research", "Bazzini Lab, Stowers Institute for Medical Research", 1, 0.63288, null, 0.17507, null, 0.84122, null, 0.6377, null, 101, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "3prime", "small_rna", "lexogen", "bulk", "unknown", "unknown", null, "United States", "2023-11-15", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"]], "truncated": false, "filtered_table_rows_count": 2722, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"experiment.library_layout\" = :p0 and \"technology\" = :p1 and \"tissue_curation\" = :p2 order by rowid limit 101", "params": {"p0": "SINGLE", "p1": "unknown", "p2": "Embryo Imprecise"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise", "results": [{"value": "RNA-Seq", "label": "RNA-Seq", "count": 2153, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&experiment.library_strategy=RNA-Seq", "selected": false}, {"value": "OTHER", "label": "OTHER", "count": 271, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&experiment.library_strategy=OTHER", "selected": false}, {"value": "AMPLICON", "label": "AMPLICON", "count": 199, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&experiment.library_strategy=AMPLICON", "selected": false}, {"value": "miRNA-Seq", "label": "miRNA-Seq", "count": 45, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&experiment.library_strategy=miRNA-Seq", "selected": false}, {"value": "RIP-Seq", "label": "RIP-Seq", "count": 22, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&experiment.library_strategy=RIP-Seq", "selected": false}, {"value": "FL-cDNA", "label": "FL-cDNA", "count": 21, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&experiment.library_strategy=FL-cDNA", "selected": false}, {"value": "ncRNA-Seq", "label": "ncRNA-Seq", "count": 11, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&experiment.library_strategy=ncRNA-Seq", "selected": false}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 2722, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&experiment.library_source=TRANSCRIPTOMIC", "selected": false}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise", "results": [{"value": "cDNA", "label": "cDNA", "count": 1489, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&experiment.library_selection=cDNA", "selected": false}, {"value": "PCR", "label": "PCR", "count": 369, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&experiment.library_selection=PCR", "selected": false}, {"value": "unspecified", "label": "unspecified", "count": 298, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&experiment.library_selection=unspecified", "selected": false}, {"value": "Oligo-dT", "label": "Oligo-dT", "count": 265, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&experiment.library_selection=Oligo-dT", "selected": false}, {"value": "other", "label": "other", "count": 118, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&experiment.library_selection=other", "selected": false}, {"value": "size fractionation", "label": "size fractionation", "count": 75, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&experiment.library_selection=size+fractionation", "selected": false}, {"value": "CAGE", "label": "CAGE", "count": 38, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&experiment.library_selection=CAGE", "selected": false}, {"value": "RANDOM", "label": "RANDOM", "count": 26, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&experiment.library_selection=RANDOM", "selected": false}, {"value": "RT-PCR", "label": "RT-PCR", "count": 20, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&experiment.library_selection=RT-PCR", "selected": false}, {"value": "RANDOM PCR", "label": "RANDOM PCR", "count": 16, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&experiment.library_selection=RANDOM+PCR", "selected": false}], "truncated": true}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise", "results": [{"value": "SINGLE", "label": "SINGLE", "count": 2722, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?technology=unknown&tissue_curation=Embryo+Imprecise", "selected": true}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise", "results": [{"value": "ILLUMINA", "label": "ILLUMINA", "count": 2242, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&experiment.platform=ILLUMINA", "selected": false}, {"value": "ION_TORRENT", "label": "ION_TORRENT", "count": 399, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&experiment.platform=ION_TORRENT", "selected": false}, {"value": "PACBIO_SMRT", "label": "PACBIO_SMRT", "count": 34, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&experiment.platform=PACBIO_SMRT", "selected": false}, {"value": "ABI_SOLID", "label": "ABI_SOLID", "count": 31, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&experiment.platform=ABI_SOLID", "selected": false}, {"value": "BGISEQ", "label": "BGISEQ", "count": 9, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&experiment.platform=BGISEQ", "selected": false}, {"value": "COMPLETE_GENOMICS", "label": "COMPLETE_GENOMICS", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&experiment.platform=COMPLETE_GENOMICS", "selected": false}, {"value": "OXFORD_NANOPORE", "label": "OXFORD_NANOPORE", "count": 1, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&experiment.platform=OXFORD_NANOPORE", "selected": false}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise", "results": [{"value": "Embryo", "label": "Embryo", "count": 2194, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&devstage_curation_coarse=Embryo", "selected": false}, {"value": "Larval", "label": "Larval", "count": 398, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&devstage_curation_coarse=Larval", "selected": false}, {"value": "Multi-stage", "label": "Multi-stage", "count": 94, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&devstage_curation_coarse=Multi-stage", "selected": false}, {"value": "Adult", "label": "Adult", "count": 30, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&devstage_curation_coarse=Adult", "selected": false}, {"value": "Juvenile", "label": "Juvenile", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&devstage_curation_coarse=Juvenile", "selected": false}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise", "results": [{"value": "Pharyngula", "label": "Pharyngula", "count": 655, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&devstage_curation=Pharyngula", "selected": false}, {"value": "Larval", "label": "Larval", "count": 398, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&devstage_curation=Larval", "selected": false}, {"value": "Blastula", "label": "Blastula", "count": 332, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&devstage_curation=Blastula", "selected": false}, {"value": "Gastrula", "label": "Gastrula", "count": 284, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&devstage_curation=Gastrula", "selected": false}, {"value": "Hatching", "label": "Hatching", "count": 267, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&devstage_curation=Hatching", "selected": false}, {"value": "Multi-stage", "label": "Multi-stage", "count": 256, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&devstage_curation=Multi-stage", "selected": false}, {"value": "Undetermined", "label": "Undetermined", "count": 193, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&devstage_curation=Undetermined", "selected": false}, {"value": "Cleavage", "label": "Cleavage", "count": 161, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&devstage_curation=Cleavage", "selected": false}, {"value": "Segmentation", "label": "Segmentation", "count": 103, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&devstage_curation=Segmentation", "selected": false}, {"value": "Zygote", "label": "Zygote", "count": 37, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&devstage_curation=Zygote", "selected": false}], "truncated": true}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise", "results": [{"value": "All anatomical structures", "label": "All anatomical structures", "count": 2722, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&tissue_curation_coarse=All+anatomical+structures", "selected": false}], "truncated": false}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise", "results": [{"value": "Embryo Imprecise", "label": "Embryo Imprecise", "count": 2722, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown", "selected": true}], "truncated": false}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise", "results": [{"value": "unknown", "label": "unknown", "count": 2722, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Embryo+Imprecise", "selected": true}], "truncated": false}}, "suggested_facets": [], "next": "28921", "next_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=unknown&tissue_curation=Embryo+Imprecise&_next=28921", "private": false, "allow_execute_sql": true, "query_ms": 115.27738600125303}