{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where experiment.library_layout = \"SINGLE\", technology = \"generic-scrnaseq-only\" and tissue_curation_coarse = \"Reproductive System\"", "rows": [[40701, "SRR3231363", "SRX1637111", "SRS1342926", "SRP071849", "PRJNA315400", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [RIP Seq]", "GSE79161", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: RNA was extracted from ovary tissue or from RIP experiments by Trizol extraction.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "Input 3", "GSM2087141", null, "tissue:Zebrafish Zygotes|fraction:Input", "Input 3", "Reads were mapped to Zv9 using tophat trapnell et al  2009to the ENSEMBLE gene build and further processing of the read counts was performed using Deseq Anders et al  2009 Genome build: zv9 Supplementary files format and content: The mRNA counts.csv contains the DESeq normalized read counts per Ensemble gene as indicated. Headers indicate the sample name.", "Zebrafish Zygotes", null, "mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing.", "Zebrafish were maintained under standard conditions.", "fraction:Input", "GSM2087141", "GSM2087141: Input 3; Danio rerio; RIP Seq", "GSM2087141", null, "1", "mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing.", "GEO Accession:GSM2087141", "RIP-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP071849", null, null, "WT_Input_3.fastq.gz", "fastq", 1902296226.0, 37299926.0, "GSM2087141 r1", "0:51", "A:466290166;C:465344039;G:486942278;T:483240280;N:479463", 51, null, null, null, 466290166, 465344039, 486942278, 483240280, 479463, "SRX1637111", "SRS1342926", "SRA385813", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.85793, null, 0.14814, null, 0.79941, null, 0.55214, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2016-03-13", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [40702, "SRR3231362", "SRX1637110", "SRS1342927", "SRP071849", "PRJNA315400", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [RIP Seq]", "GSE79161", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: RNA was extracted from ovary tissue or from RIP experiments by Trizol extraction.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "Input 2", "GSM2087140", null, "tissue:Zebrafish Zygotes|fraction:Input", "Input 2", "Reads were mapped to Zv9 using tophat trapnell et al  2009to the ENSEMBLE gene build and further processing of the read counts was performed using Deseq Anders et al  2009 Genome build: zv9 Supplementary files format and content: The mRNA counts.csv contains the DESeq normalized read counts per Ensemble gene as indicated. Headers indicate the sample name.", "Zebrafish Zygotes", null, "mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing.", "Zebrafish were maintained under standard conditions.", "fraction:Input", "GSM2087140", "GSM2087140: Input 2; Danio rerio; RIP Seq", "GSM2087140", null, "1", "mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing.", "GEO Accession:GSM2087140", "RIP-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP071849", null, null, "WT_Input_2.fastq.gz", "fastq", 1540737999.0, 30210549.0, "GSM2087140 r1", "0:51", "A:380481772;C:379741192;G:395453141;T:384675313;N:386581", 51, null, null, null, 380481772, 379741192, 395453141, 384675313, 386581, "SRX1637110", "SRS1342927", "SRA385813", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.8787, null, 0.14935, null, 0.79202, null, 0.54381, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2016-03-13", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [40703, "SRR3231361", "SRX1637109", "SRS1342928", "SRP071849", "PRJNA315400", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [RIP Seq]", "GSE79161", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: RNA was extracted from ovary tissue or from RIP experiments by Trizol extraction.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "Input 1", "GSM2087139", null, "tissue:Zebrafish Zygotes|fraction:Input", "Input 1", "Reads were mapped to Zv9 using tophat trapnell et al  2009to the ENSEMBLE gene build and further processing of the read counts was performed using Deseq Anders et al  2009 Genome build: zv9 Supplementary files format and content: The mRNA counts.csv contains the DESeq normalized read counts per Ensemble gene as indicated. Headers indicate the sample name.", "Zebrafish Zygotes", null, "mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing.", "Zebrafish were maintained under standard conditions.", "fraction:Input", "GSM2087139", "GSM2087139: Input 1; Danio rerio; RIP Seq", "GSM2087139", null, "1", "mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing.", "GEO Accession:GSM2087139", "RIP-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP071849", null, null, "WT_Input_1.fastq.gz", "fastq", 1109818905.0, 21761155.0, "GSM2087139 r1", null, null, null, null, null, null, null, null, null, null, null, "SRX1637109", "SRS1342928", "SRA385813", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.87467, null, 0.18794, null, 0.79411, null, 0.63378, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2016-03-13", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [40704, "SRR3231360", "SRX1637108", "SRS1342929", "SRP071849", "PRJNA315400", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [RIP Seq]", "GSE79161", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: RNA was extracted from ovary tissue or from RIP experiments by Trizol extraction.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "Tdrd6a IP 3", "GSM2087138", null, "tissue:Zebrafish Zygotes|fraction:Tdrd6a IP", "Tdrd6a IP 3", "Reads were mapped to Zv9 using tophat trapnell et al  2009to the ENSEMBLE gene build and further processing of the read counts was performed using Deseq Anders et al  2009 Genome build: zv9 Supplementary files format and content: The mRNA counts.csv contains the DESeq normalized read counts per Ensemble gene as indicated. Headers indicate the sample name.", "Zebrafish Zygotes", null, "mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing.", "Zebrafish were maintained under standard conditions.", "fraction:Tdrd6a IP", "GSM2087138", "GSM2087138: Tdrd6a IP 3; Danio rerio; RIP Seq", "GSM2087138", null, "1", "mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing.", "GEO Accession:GSM2087138", "RIP-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP071849", null, null, "WT_Tdrd6a_IP_3.fastq.gz", "fastq", 843641439.0, 16541989.0, "GSM2087138 r1", "0:51", "A:216465581;C:196892096;G:207722567;T:222361382;N:199813", 51, null, null, null, 216465581, 196892096, 207722567, 222361382, 199813, "SRX1637108", "SRS1342929", "SRA385813", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.84615, null, 0.08957, null, 0.78768, null, 0.50612, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2016-03-13", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [40705, "SRR3231359", "SRX1637107", "SRS1342930", "SRP071849", "PRJNA315400", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [RIP Seq]", "GSE79161", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: RNA was extracted from ovary tissue or from RIP experiments by Trizol extraction.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "Tdrd6a IP 2", "GSM2087137", null, "tissue:Zebrafish Zygotes|fraction:Tdrd6a IP", "Tdrd6a IP 2", "Reads were mapped to Zv9 using tophat trapnell et al  2009to the ENSEMBLE gene build and further processing of the read counts was performed using Deseq Anders et al  2009 Genome build: zv9 Supplementary files format and content: The mRNA counts.csv contains the DESeq normalized read counts per Ensemble gene as indicated. Headers indicate the sample name.", "Zebrafish Zygotes", null, "mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing.", "Zebrafish were maintained under standard conditions.", "fraction:Tdrd6a IP", "GSM2087137", "GSM2087137: Tdrd6a IP 2; Danio rerio; RIP Seq", "GSM2087137", null, "1", "mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing.", "GEO Accession:GSM2087137", "RIP-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP071849", null, null, "WT_Tdrd6a_IP_2.fastq.gz", "fastq", 391198050.0, 7670550.0, "GSM2087137 r1", "0:51", "A:99015594;C:91525929;G:97155710;T:103371571;N:129246", 51, null, null, null, 99015594, 91525929, 97155710, 103371571, 129246, "SRX1637107", "SRS1342930", "SRA385813", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.85778, null, 0.12015, null, 0.80515, null, 0.47541, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2016-03-13", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [40706, "SRR3231358", "SRX1637106", "SRS1342931", "SRP071849", "PRJNA315400", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [RIP Seq]", "GSE79161", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: RNA was extracted from ovary tissue or from RIP experiments by Trizol extraction.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "Tdrd6a IP 1", "GSM2087136", null, "tissue:Zebrafish Zygotes|fraction:Tdrd6a IP", "Tdrd6a IP 1", "Reads were mapped to Zv9 using tophat trapnell et al  2009to the ENSEMBLE gene build and further processing of the read counts was performed using Deseq Anders et al  2009 Genome build: zv9 Supplementary files format and content: The mRNA counts.csv contains the DESeq normalized read counts per Ensemble gene as indicated. Headers indicate the sample name.", "Zebrafish Zygotes", null, "mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing.", "Zebrafish were maintained under standard conditions.", "fraction:Tdrd6a IP", "GSM2087136", "GSM2087136: Tdrd6a IP 1; Danio rerio; RIP Seq", "GSM2087136", null, "1", "mRNA was extracted from zygotes or by RIP experiments followed by Trizol extraction The RNA was extracted using chloroform and precipitated with iso propanol. Ovation RNA seq System V2 NuGEN library preperation kit was used and the library was sequenced on an Illumina HISEQ using 50bp single end sequencing.", "GEO Accession:GSM2087136", "RIP-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP071849", null, null, "WT_Tdrd6a_IP_1.fastq.gz", "fastq", 1927415052.0, 37792452.0, "GSM2087136 r1", "0:51", "A:498125298;C:444860381;G:468826607;T:515142356;N:460410", 51, null, null, null, 498125298, 444860381, 468826607, 515142356, 460410, "SRX1637106", "SRS1342931", "SRA385813", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.86194, null, 0.09753, null, 0.80146, null, 0.47808, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2016-03-13", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [44967, "SRR6345660", "SRX3442976", "SRS2733636", "SRP126106", "PRJNA421016", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]", "GSE107682", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "smRNA seq library of ovary from tdrd6a mut fish", "GSM2875719", null, "source name:Ovary from tdrd6a mut fish|tissue:whole ovary|genotype:tdrd6a mutant", "smRNA seq library of ovary from tdrd6a mut fish", "1. Adapter trimming with cutadapt  O 8  m 26  M 38  a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter   q 20  p 100  Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end  using a custom bash script. 4. UMIs were trimmed with seqtk trimfq  b 4  a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq  L 15\u00a0 6. Mapping was done to Zebrafish  Danio rerio  genome assembly Zv9 with bowtie v0.12.8   tryhard   best   strata   chunkmbs 256  v 1  M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed  bg  split  scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.\u00a0 \u00a0 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE  SINE  LTR and DNA downloaded from the UCSC genome browser repeat masker track  Zv9 using bedtools intersect  a reads  b transposons  wa  wb  bed  f 1.0  nonamecheck to keep both the read and the transposon information. The arguments  s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re  start re  end re  repFamily  repName strand re  and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons  and readlength the length of the read that. Sample is the sample name  and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.\u00a0 Supplementary files format and content: Files ending in .bw are bigwig tracks.", "Ovary from tdrd6a mut fish", null, "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", null, "tissue:whole ovary|genotype:tdrd6a mutant", "GSM2875719", "GSM2875719: smRNA seq library of ovary from tdrd6a mut fish; Danio rerio; ncRNA Seq", "GSM2875719", null, "1", "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", "GEO Accession:GSM2875719", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP126106", null, null, "Tdrd6a-mut-ovary-input-Adult.fastq.gz", "fastq", 817885062.0, 16036962.0, "GSM2875719 r1", "0:51", "A:212456064;C:163491733;G:233627239;T:208262707;N:47319", 51, null, null, null, 212456064, 163491733, 233627239, 208262707, 47319, "SRX3442976", "SRS2733636", "SRA636010", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.46308, null, 0.13668, null, 0.83587, null, 0.79104, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "5prime", "size_fractionation", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2017-12-04", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [44968, "SRR6345659", "SRX3442975", "SRS2733637", "SRP126106", "PRJNA421016", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]", "GSE107682", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "smRNA seq library of ovary from tdrd6a het fish", "GSM2875718", null, "source name:Ovary from tdrd6a het fish|tissue:whole ovary|genotype:tdrd6a heterozygous", "smRNA seq library of ovary from tdrd6a het fish", "1. Adapter trimming with cutadapt  O 8  m 26  M 38  a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter   q 20  p 100  Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end  using a custom bash script. 4. UMIs were trimmed with seqtk trimfq  b 4  a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq  L 15\u00a0 6. Mapping was done to Zebrafish  Danio rerio  genome assembly Zv9 with bowtie v0.12.8   tryhard   best   strata   chunkmbs 256  v 1  M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed  bg  split  scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.\u00a0 \u00a0 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE  SINE  LTR and DNA downloaded from the UCSC genome browser repeat masker track  Zv9 using bedtools intersect  a reads  b transposons  wa  wb  bed  f 1.0  nonamecheck to keep both the read and the transposon information. The arguments  s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re  start re  end re  repFamily  repName strand re  and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons  and readlength the length of the read that. Sample is the sample name  and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.\u00a0 Supplementary files format and content: Files ending in .bw are bigwig tracks.", "Ovary from tdrd6a het fish", null, "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", null, "tissue:whole ovary|genotype:tdrd6a heterozygous", "GSM2875718", "GSM2875718: smRNA seq library of ovary from tdrd6a het fish; Danio rerio; ncRNA Seq", "GSM2875718", null, "1", "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", "GEO Accession:GSM2875718", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP126106", null, null, "Tdrd6a-het-ovary-input-Adult.fastq.gz", "fastq", 1452353571.0, 28477521.0, "GSM2875718 r1", "0:51", "A:397993735;C:284194126;G:396142390;T:373939235;N:84085", 51, null, null, null, 397993735, 284194126, 396142390, 373939235, 84085, "SRX3442975", "SRS2733637", "SRA636010", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.3869, null, 0.1369, null, 0.86397, null, 0.77165, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "5prime", "size_fractionation", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2017-12-04", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [44969, "SRR6345658", "SRX3442974", "SRS2733632", "SRP126106", "PRJNA421016", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]", "GSE107682", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "smRNA seq library of late oocytes from tdrd6a hett fish", "GSM2875717", null, "source name:late oocytes from tdrd6a hett fish|tissue:late oocytes|genotype:tdrd6a heterozygous", "smRNA seq library of late oocytes from tdrd6a hett fish", "1. Adapter trimming with cutadapt  O 8  m 26  M 38  a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter   q 20  p 100  Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end  using a custom bash script. 4. UMIs were trimmed with seqtk trimfq  b 4  a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq  L 15\u00a0 6. Mapping was done to Zebrafish  Danio rerio  genome assembly Zv9 with bowtie v0.12.8   tryhard   best   strata   chunkmbs 256  v 1  M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed  bg  split  scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.\u00a0 \u00a0 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE  SINE  LTR and DNA downloaded from the UCSC genome browser repeat masker track  Zv9 using bedtools intersect  a reads  b transposons  wa  wb  bed  f 1.0  nonamecheck to keep both the read and the transposon information. The arguments  s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re  start re  end re  repFamily  repName strand re  and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons  and readlength the length of the read that. Sample is the sample name  and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.\u00a0 Supplementary files format and content: Files ending in .bw are bigwig tracks.", "late oocytes from tdrd6a hett fish", null, "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", null, "tissue:late oocytes|genotype:tdrd6a heterozygous", "GSM2875717", "GSM2875717: smRNA seq library of late oocytes from tdrd6a hett fish; Danio rerio; ncRNA Seq", "GSM2875717", null, "1", "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", "GEO Accession:GSM2875717", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP126106", null, null, "tdrd6a-het_oocytes-late-input.fastq.gz", "fastq", 1884769630.0, 28130890.0, "GSM2875717 r1", "0:67", "A:519051884;C:437635381;G:510738306;T:417295309;N:48750", 67, null, null, null, 519051884, 437635381, 510738306, 417295309, 48750, "SRX3442974", "SRS2733632", "SRA636010", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.17778, null, 0.06655, null, 0.95931, null, 0.91529, null, 67, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "5prime", "size_fractionation", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2017-12-04", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [44970, "SRR6345657", "SRX3442973", "SRS2733634", "SRP126106", "PRJNA421016", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]", "GSE107682", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "smRNA seq library of early oocytes from tdrd6a mut fish", "GSM2875716", null, "source name:early oocytes from tdrd6a mut fish|tissue:early oocytes|genotype:tdrd6a mutant", "smRNA seq library of early oocytes from tdrd6a mut fish", "1. Adapter trimming with cutadapt  O 8  m 26  M 38  a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter   q 20  p 100  Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end  using a custom bash script. 4. UMIs were trimmed with seqtk trimfq  b 4  a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq  L 15\u00a0 6. Mapping was done to Zebrafish  Danio rerio  genome assembly Zv9 with bowtie v0.12.8   tryhard   best   strata   chunkmbs 256  v 1  M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed  bg  split  scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.\u00a0 \u00a0 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE  SINE  LTR and DNA downloaded from the UCSC genome browser repeat masker track  Zv9 using bedtools intersect  a reads  b transposons  wa  wb  bed  f 1.0  nonamecheck to keep both the read and the transposon information. The arguments  s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re  start re  end re  repFamily  repName strand re  and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons  and readlength the length of the read that. Sample is the sample name  and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.\u00a0 Supplementary files format and content: Files ending in .bw are bigwig tracks.", "early oocytes from tdrd6a mut fish", null, "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", null, "tissue:early oocytes|genotype:tdrd6a mutant", "GSM2875716", "GSM2875716: smRNA seq library of early oocytes from tdrd6a mut fish; Danio rerio; ncRNA Seq", "GSM2875716", null, "1", "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", "GEO Accession:GSM2875716", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP126106", null, null, "tdrd6a-mut_oocytes-early-input.fastq.gz", "fastq", 2102216723.0, 31376369.0, "GSM2875716 r1", "0:67", "A:592618102;C:472348913;G:550028898;T:487165955;N:54855", 67, null, null, null, 592618102, 472348913, 550028898, 487165955, 54855, "SRX3442973", "SRS2733634", "SRA636010", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.08293, null, 0.04595, null, 0.96193, null, 0.77321, null, 67, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "5prime", "size_fractionation", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2017-12-04", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [44971, "SRR6345656", "SRX3442972", "SRS2733635", "SRP126106", "PRJNA421016", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]", "GSE107682", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "smRNA seq library of late oocytes from tdrd6a mut fish", "GSM2875715", null, "source name:late oocytes from tdrd6a mut fish|tissue:late oocytes|genotype:tdrd6a mutant", "smRNA seq library of late oocytes from tdrd6a mut fish", "1. Adapter trimming with cutadapt  O 8  m 26  M 38  a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter   q 20  p 100  Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end  using a custom bash script. 4. UMIs were trimmed with seqtk trimfq  b 4  a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq  L 15\u00a0 6. Mapping was done to Zebrafish  Danio rerio  genome assembly Zv9 with bowtie v0.12.8   tryhard   best   strata   chunkmbs 256  v 1  M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed  bg  split  scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.\u00a0 \u00a0 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE  SINE  LTR and DNA downloaded from the UCSC genome browser repeat masker track  Zv9 using bedtools intersect  a reads  b transposons  wa  wb  bed  f 1.0  nonamecheck to keep both the read and the transposon information. The arguments  s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re  start re  end re  repFamily  repName strand re  and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons  and readlength the length of the read that. Sample is the sample name  and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.\u00a0 Supplementary files format and content: Files ending in .bw are bigwig tracks.", "late oocytes from tdrd6a mut fish", null, "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", null, "tissue:late oocytes|genotype:tdrd6a mutant", "GSM2875715", "GSM2875715: smRNA seq library of late oocytes from tdrd6a mut fish; Danio rerio; ncRNA Seq", "GSM2875715", null, "1", "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", "GEO Accession:GSM2875715", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP126106", null, null, "tdrd6a-mut_oocytes-late-input.fastq.gz", "fastq", 2110760295.0, 31503885.0, "GSM2875715 r1", "0:67", "A:582021495;C:486821539;G:582933348;T:458929133;N:54780", 67, null, null, null, 582021495, 486821539, 582933348, 458929133, 54780, "SRX3442972", "SRS2733635", "SRA636010", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.17064, null, 0.06728, null, 0.96173, null, 0.9114, null, 67, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "5prime", "size_fractionation", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2017-12-04", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [44972, "SRR6345655", "SRX3442971", "SRS2733633", "SRP126106", "PRJNA421016", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]", "GSE107682", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "smRNA seq library of early oocytes from tdrd6a het fish", "GSM2875714", null, "source name:early oocytes from tdrd6a het fish|tissue:Early oocytes|genotype:tdrd6a heterozygous", "smRNA seq library of early oocytes from tdrd6a het fish", "1. Adapter trimming with cutadapt  O 8  m 26  M 38  a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter   q 20  p 100  Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end  using a custom bash script. 4. UMIs were trimmed with seqtk trimfq  b 4  a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq  L 15\u00a0 6. Mapping was done to Zebrafish  Danio rerio  genome assembly Zv9 with bowtie v0.12.8   tryhard   best   strata   chunkmbs 256  v 1  M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed  bg  split  scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.\u00a0 \u00a0 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE  SINE  LTR and DNA downloaded from the UCSC genome browser repeat masker track  Zv9 using bedtools intersect  a reads  b transposons  wa  wb  bed  f 1.0  nonamecheck to keep both the read and the transposon information. The arguments  s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re  start re  end re  repFamily  repName strand re  and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons  and readlength the length of the read that. Sample is the sample name  and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.\u00a0 Supplementary files format and content: Files ending in .bw are bigwig tracks.", "early oocytes from tdrd6a het fish", null, "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", null, "tissue:Early oocytes|genotype:tdrd6a heterozygous", "GSM2875714", "GSM2875714: smRNA seq library of early oocytes from tdrd6a het fish; Danio rerio; ncRNA Seq", "GSM2875714", null, "1", "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", "GEO Accession:GSM2875714", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP126106", null, null, "tdrd6a-het_oocytes-early-input.fastq.gz", "fastq", 2243425655.0, 33483965.0, "GSM2875714 r1", "0:67", "A:633468129;C:503239215;G:592089295;T:514571679;N:57337", 67, null, null, null, 633468129, 503239215, 592089295, 514571679, 57337, "SRX3442971", "SRS2733633", "SRA636010", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.06641, null, 0.04254, null, 0.96806, null, 0.58509, null, 67, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "5prime", "size_fractionation", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2017-12-04", "Zygote", "Embryo", "Oocyte", "Reproductive System"]], "truncated": false, "filtered_table_rows_count": 12, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"experiment.library_layout\" = :p0 and \"technology\" = :p1 and \"tissue_curation_coarse\" = :p2 order by rowid limit 101", "params": {"p0": "SINGLE", "p1": "generic-scrnaseq-only", "p2": "Reproductive System"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=generic-scrnaseq-only&tissue_curation_coarse=Reproductive+System", "results": [{"value": "RIP-Seq", "label": "RIP-Seq", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=generic-scrnaseq-only&tissue_curation_coarse=Reproductive+System&experiment.library_strategy=RIP-Seq", "selected": false}, {"value": "ncRNA-Seq", "label": "ncRNA-Seq", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=generic-scrnaseq-only&tissue_curation_coarse=Reproductive+System&experiment.library_strategy=ncRNA-Seq", "selected": false}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=generic-scrnaseq-only&tissue_curation_coarse=Reproductive+System", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 12, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=generic-scrnaseq-only&tissue_curation_coarse=Reproductive+System&experiment.library_source=TRANSCRIPTOMIC", "selected": false}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=generic-scrnaseq-only&tissue_curation_coarse=Reproductive+System", "results": [{"value": "other", "label": "other", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=generic-scrnaseq-only&tissue_curation_coarse=Reproductive+System&experiment.library_selection=other", "selected": false}, {"value": "size fractionation", "label": "size fractionation", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=generic-scrnaseq-only&tissue_curation_coarse=Reproductive+System&experiment.library_selection=size+fractionation", "selected": false}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=generic-scrnaseq-only&tissue_curation_coarse=Reproductive+System", "results": [{"value": "SINGLE", "label": "SINGLE", "count": 12, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?technology=generic-scrnaseq-only&tissue_curation_coarse=Reproductive+System", "selected": true}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=generic-scrnaseq-only&tissue_curation_coarse=Reproductive+System", "results": [{"value": "ILLUMINA", "label": "ILLUMINA", "count": 12, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=generic-scrnaseq-only&tissue_curation_coarse=Reproductive+System&experiment.platform=ILLUMINA", "selected": false}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=generic-scrnaseq-only&tissue_curation_coarse=Reproductive+System", "results": [{"value": "Embryo", "label": "Embryo", "count": 10, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=generic-scrnaseq-only&tissue_curation_coarse=Reproductive+System&devstage_curation_coarse=Embryo", "selected": false}, {"value": "Undetermined", "label": "Undetermined", "count": 2, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=generic-scrnaseq-only&tissue_curation_coarse=Reproductive+System&devstage_curation_coarse=Undetermined", "selected": false}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=generic-scrnaseq-only&tissue_curation_coarse=Reproductive+System", "results": [{"value": "Zygote", "label": "Zygote", "count": 10, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=generic-scrnaseq-only&tissue_curation_coarse=Reproductive+System&devstage_curation=Zygote", "selected": false}, {"value": "Undetermined", "label": "Undetermined", "count": 2, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=generic-scrnaseq-only&tissue_curation_coarse=Reproductive+System&devstage_curation=Undetermined", "selected": false}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=generic-scrnaseq-only&tissue_curation_coarse=Reproductive+System", "results": [{"value": "Reproductive System", "label": "Reproductive System", "count": 12, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=generic-scrnaseq-only", "selected": true}], "truncated": false}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=generic-scrnaseq-only&tissue_curation_coarse=Reproductive+System", "results": [{"value": "Oocyte", "label": "Oocyte", "count": 10, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=generic-scrnaseq-only&tissue_curation_coarse=Reproductive+System&tissue_curation=Oocyte", "selected": false}, {"value": "Gonad", "label": "Gonad", "count": 2, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=generic-scrnaseq-only&tissue_curation_coarse=Reproductive+System&tissue_curation=Gonad", "selected": false}], "truncated": false}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=generic-scrnaseq-only&tissue_curation_coarse=Reproductive+System", "results": [{"value": "generic-scrnaseq-only", "label": "generic-scrnaseq-only", "count": 12, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation_coarse=Reproductive+System", "selected": true}], "truncated": false}}, "suggested_facets": [], "next": null, "next_url": null, "private": false, "allow_execute_sql": true, "query_ms": 69.44979599211365}