{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where experiment.library_layout = \"SINGLE\", technology = \"bulk\" and tissue_curation = \"Heart\"", "rows": [[25196, "SRR25685540", "SRX21410747", "SRS18649229", "SRP455779", "PRJNA1006658", "Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]", "GSE241157", "Transcriptome Analysis", "The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish  amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species  the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study  we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish  but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a  we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition  a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically  Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3  7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.", "parent bioproject:PRJNA1006653", "pubmed:39747457", null, "Hmga1a overexpression sample 4", "GSM7717538", null, "source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing", "Hmga1a overexpression sample 4", "FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count  samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR  differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts", "adult heart", "zebrafish were treated with tamoxifen to induce Hmga1a overexpression", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen", "GSM7717538", "GSM7717538: Hmga1a overexpression sample 4; Danio rerio; RNA Seq", "GSM7717538 r1", "GSM7717538", "1", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP455779", null, null, "HUB-PN-b004_HHHK2BGXN_S1_L001_OE4_cbc.fastq.gz", "fastq", 373009260.0, 6216821.0, "GSM7717538 r1", "0:60", "A:154344754;C:67291339;G:55785796;T:95519920;N:67451", 60, null, null, null, 154344754, 67291339, 55785796, 95519920, 67451, "SRX21410747", "SRS18649229", "SRA1695358", "Jeroen Bakkers, Hubrecht Institute", "Jeroen Bakkers, Hubrecht Institute", 1, 0.89552, null, 0.06993, null, 0.9276, null, 0.58138, null, 60, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "Netherlands", "2023-08-18", "Adult", "Adult", "Heart", "Cardiovascular System"], [25197, "SRR25685541", "SRX21410747", "SRS18649229", "SRP455779", "PRJNA1006658", "Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]", "GSE241157", "Transcriptome Analysis", "The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish  amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species  the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study  we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish  but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a  we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition  a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically  Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3  7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.", "parent bioproject:PRJNA1006653", "pubmed:39747457", null, "Hmga1a overexpression sample 4", "GSM7717538", null, "source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing", "Hmga1a overexpression sample 4", "FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count  samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR  differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts", "adult heart", "zebrafish were treated with tamoxifen to induce Hmga1a overexpression", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen", "GSM7717538", "GSM7717538: Hmga1a overexpression sample 4; Danio rerio; RNA Seq", "GSM7717538 r1", "GSM7717538", "1", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP455779", null, null, "HUB-PN-b004_HHHK2BGXN_S1_L002_OE4_cbc.fastq.gz", "fastq", 362301060.0, 6038351.0, "GSM7717538 r2", "0:60", "A:106180158;C:75387781;G:73886850;T:106761396;N:84875", 60, null, null, null, 106180158, 75387781, 73886850, 106761396, 84875, "SRX21410747", "SRS18649229", "SRA1695358", "Jeroen Bakkers, Hubrecht Institute", "Jeroen Bakkers, Hubrecht Institute", 1, 0.89159, null, 0.06701, null, 0.87081, null, 0.62237, null, 60, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "Netherlands", "2023-08-18", "Adult", "Adult", "Heart", "Cardiovascular System"], [25198, "SRR25685542", "SRX21410747", "SRS18649229", "SRP455779", "PRJNA1006658", "Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]", "GSE241157", "Transcriptome Analysis", "The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish  amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species  the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study  we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish  but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a  we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition  a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically  Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3  7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.", "parent bioproject:PRJNA1006653", "pubmed:39747457", null, "Hmga1a overexpression sample 4", "GSM7717538", null, "source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing", "Hmga1a overexpression sample 4", "FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count  samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR  differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts", "adult heart", "zebrafish were treated with tamoxifen to induce Hmga1a overexpression", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen", "GSM7717538", "GSM7717538: Hmga1a overexpression sample 4; Danio rerio; RNA Seq", "GSM7717538 r1", "GSM7717538", "1", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP455779", null, null, "HUB-PN-b004_HHHK2BGXN_S1_L003_OE4_cbc.fastq.gz", "fastq", 384538200.0, 6408970.0, "GSM7717538 r3", "0:60", "A:113163070;C:80510291;G:76775008;T:114062728;N:27103", 60, null, null, null, 113163070, 80510291, 76775008, 114062728, 27103, "SRX21410747", "SRS18649229", "SRA1695358", "Jeroen Bakkers, Hubrecht Institute", "Jeroen Bakkers, Hubrecht Institute", 1, 0.90032, null, 0.06985, null, 0.87008, null, 0.61631, null, 60, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "Netherlands", "2023-08-18", "Adult", "Adult", "Heart", "Cardiovascular System"], [25199, "SRR25685543", "SRX21410747", "SRS18649229", "SRP455779", "PRJNA1006658", "Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]", "GSE241157", "Transcriptome Analysis", "The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish  amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species  the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study  we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish  but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a  we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition  a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically  Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3  7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.", "parent bioproject:PRJNA1006653", "pubmed:39747457", null, "Hmga1a overexpression sample 4", "GSM7717538", null, "source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing", "Hmga1a overexpression sample 4", "FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count  samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR  differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts", "adult heart", "zebrafish were treated with tamoxifen to induce Hmga1a overexpression", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen", "GSM7717538", "GSM7717538: Hmga1a overexpression sample 4; Danio rerio; RNA Seq", "GSM7717538 r1", "GSM7717538", "1", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP455779", null, null, "HUB-PN-b004_HHHK2BGXN_S1_L004_OE4_cbc.fastq.gz", "fastq", 369674700.0, 6161245.0, "GSM7717538 r4", "0:60", "A:108130666;C:76988468;G:75491768;T:109027980;N:35818", 60, null, null, null, 108130666, 76988468, 75491768, 109027980, 35818, "SRX21410747", "SRS18649229", "SRA1695358", "Jeroen Bakkers, Hubrecht Institute", "Jeroen Bakkers, Hubrecht Institute", 1, 0.89622, null, 0.06895, null, 0.86854, null, 0.61464, null, 60, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "Netherlands", "2023-08-18", "Adult", "Adult", "Heart", "Cardiovascular System"], [25200, "SRR25685544", "SRX21410746", "SRS18649228", "SRP455779", "PRJNA1006658", "Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]", "GSE241157", "Transcriptome Analysis", "The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish  amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species  the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study  we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish  but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a  we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition  a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically  Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3  7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.", "parent bioproject:PRJNA1006653", "pubmed:39747457", null, "Hmga1a overexpression sample 3", "GSM7717537", null, "source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing", "Hmga1a overexpression sample 3", "FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count  samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR  differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts", "adult heart", "zebrafish were treated with tamoxifen to induce Hmga1a overexpression", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen", "GSM7717537", "GSM7717537: Hmga1a overexpression sample 3; Danio rerio; RNA Seq", "GSM7717537 r1", "GSM7717537", "1", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP455779", null, null, "HUB-PN-b004_HHHK2BGXN_S1_L001_OE3_cbc.fastq.gz", "fastq", 172977180.0, 2882953.0, "GSM7717537 r1", "0:60", "A:75387211;C:31808233;G:24071421;T:41679068;N:31247", 60, null, null, null, 75387211, 31808233, 24071421, 41679068, 31247, "SRX21410746", "SRS18649228", "SRA1695358", "Jeroen Bakkers, Hubrecht Institute", "Jeroen Bakkers, Hubrecht Institute", 1, 0.88458, null, 0.06987, null, 0.92788, null, 0.58263, null, 60, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "Netherlands", "2023-08-18", "Adult", "Adult", "Heart", "Cardiovascular System"], [25201, "SRR25685545", "SRX21410746", "SRS18649228", "SRP455779", "PRJNA1006658", "Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]", "GSE241157", "Transcriptome Analysis", "The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish  amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species  the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study  we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish  but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a  we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition  a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically  Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3  7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.", "parent bioproject:PRJNA1006653", "pubmed:39747457", null, "Hmga1a overexpression sample 3", "GSM7717537", null, "source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing", "Hmga1a overexpression sample 3", "FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count  samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR  differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts", "adult heart", "zebrafish were treated with tamoxifen to induce Hmga1a overexpression", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen", "GSM7717537", "GSM7717537: Hmga1a overexpression sample 3; Danio rerio; RNA Seq", "GSM7717537 r1", "GSM7717537", "1", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP455779", null, null, "HUB-PN-b004_HHHK2BGXN_S1_L002_OE3_cbc.fastq.gz", "fastq", 168370020.0, 2806167.0, "GSM7717537 r2", "0:60", "A:49447288;C:35622124;G:34182575;T:49078813;N:39220", 60, null, null, null, 49447288, 35622124, 34182575, 49078813, 39220, "SRX21410746", "SRS18649228", "SRA1695358", "Jeroen Bakkers, Hubrecht Institute", "Jeroen Bakkers, Hubrecht Institute", 1, 0.88366, null, 0.06639, null, 0.87519, null, 0.43134, null, 60, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "Netherlands", "2023-08-18", "Adult", "Adult", "Heart", "Cardiovascular System"], [25202, "SRR25685546", "SRX21410746", "SRS18649228", "SRP455779", "PRJNA1006658", "Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]", "GSE241157", "Transcriptome Analysis", "The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish  amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species  the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study  we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish  but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a  we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition  a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically  Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3  7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.", "parent bioproject:PRJNA1006653", "pubmed:39747457", null, "Hmga1a overexpression sample 3", "GSM7717537", null, "source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing", "Hmga1a overexpression sample 3", "FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count  samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR  differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts", "adult heart", "zebrafish were treated with tamoxifen to induce Hmga1a overexpression", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen", "GSM7717537", "GSM7717537: Hmga1a overexpression sample 3; Danio rerio; RNA Seq", "GSM7717537 r1", "GSM7717537", "1", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP455779", null, null, "HUB-PN-b004_HHHK2BGXN_S1_L003_OE3_cbc.fastq.gz", "fastq", 177341340.0, 2955689.0, "GSM7717537 r3", "0:60", "A:52304623;C:37759158;G:35264433;T:52000964;N:12162", 60, null, null, null, 52304623, 37759158, 35264433, 52000964, 12162, "SRX21410746", "SRS18649228", "SRA1695358", "Jeroen Bakkers, Hubrecht Institute", "Jeroen Bakkers, Hubrecht Institute", 1, 0.8907, null, 0.06795, null, 0.87405, null, 0.57596, null, 60, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "Netherlands", "2023-08-18", "Adult", "Adult", "Heart", "Cardiovascular System"], [25203, "SRR25685547", "SRX21410746", "SRS18649228", "SRP455779", "PRJNA1006658", "Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]", "GSE241157", "Transcriptome Analysis", "The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish  amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species  the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study  we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish  but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a  we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition  a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically  Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3  7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.", "parent bioproject:PRJNA1006653", "pubmed:39747457", null, "Hmga1a overexpression sample 3", "GSM7717537", null, "source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing", "Hmga1a overexpression sample 3", "FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count  samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR  differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts", "adult heart", "zebrafish were treated with tamoxifen to induce Hmga1a overexpression", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen", "GSM7717537", "GSM7717537: Hmga1a overexpression sample 3; Danio rerio; RNA Seq", "GSM7717537 r1", "GSM7717537", "1", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP455779", null, null, "HUB-PN-b004_HHHK2BGXN_S1_L004_OE3_cbc.fastq.gz", "fastq", 172482600.0, 2874710.0, "GSM7717537 r4", "0:60", "A:50610545;C:36521080;G:35043934;T:50291237;N:15804", 60, null, null, null, 50610545, 36521080, 35043934, 50291237, 15804, "SRX21410746", "SRS18649228", "SRA1695358", "Jeroen Bakkers, Hubrecht Institute", "Jeroen Bakkers, Hubrecht Institute", 1, 0.88558, null, 0.06686, null, 0.87373, null, 0.57425, null, 60, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "Netherlands", "2023-08-18", "Adult", "Adult", "Heart", "Cardiovascular System"], [25204, "SRR25685548", "SRX21410745", "SRS18649227", "SRP455779", "PRJNA1006658", "Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]", "GSE241157", "Transcriptome Analysis", "The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish  amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species  the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study  we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish  but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a  we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition  a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically  Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3  7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.", "parent bioproject:PRJNA1006653", "pubmed:39747457", null, "Hmga1a overexpression sample 2", "GSM7717536", null, "source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing", "Hmga1a overexpression sample 2", "FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count  samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR  differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts", "adult heart", "zebrafish were treated with tamoxifen to induce Hmga1a overexpression", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen", "GSM7717536", "GSM7717536: Hmga1a overexpression sample 2; Danio rerio; RNA Seq", "GSM7717536 r1", "GSM7717536", "1", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP455779", null, null, "HUB-PN-b004_HHHK2BGXN_S1_L001_OE2_cbc.fastq.gz", "fastq", 420273960.0, 7004566.0, "GSM7717536 r1", "0:60", "A:172608345;C:77102289;G:65053968;T:105434207;N:75151", 60, null, null, null, 172608345, 77102289, 65053968, 105434207, 75151, "SRX21410745", "SRS18649227", "SRA1695358", "Jeroen Bakkers, Hubrecht Institute", "Jeroen Bakkers, Hubrecht Institute", 1, 0.90654, null, 0.06306, null, 0.92904, null, 0.38886, null, 60, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "Netherlands", "2023-08-18", "Adult", "Adult", "Heart", "Cardiovascular System"], [25205, "SRR25685549", "SRX21410745", "SRS18649227", "SRP455779", "PRJNA1006658", "Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]", "GSE241157", "Transcriptome Analysis", "The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish  amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species  the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study  we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish  but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a  we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition  a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically  Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3  7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.", "parent bioproject:PRJNA1006653", "pubmed:39747457", null, "Hmga1a overexpression sample 2", "GSM7717536", null, "source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing", "Hmga1a overexpression sample 2", "FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count  samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR  differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts", "adult heart", "zebrafish were treated with tamoxifen to induce Hmga1a overexpression", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen", "GSM7717536", "GSM7717536: Hmga1a overexpression sample 2; Danio rerio; RNA Seq", "GSM7717536 r1", "GSM7717536", "1", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP455779", null, null, "HUB-PN-b004_HHHK2BGXN_S1_L002_OE2_cbc.fastq.gz", "fastq", 408658800.0, 6810980.0, "GSM7717536 r2", "0:60", "A:118741152;C:85204554;G:86928543;T:117687807;N:96744", 60, null, null, null, 118741152, 85204554, 86928543, 117687807, 96744, "SRX21410745", "SRS18649227", "SRA1695358", "Jeroen Bakkers, Hubrecht Institute", "Jeroen Bakkers, Hubrecht Institute", 1, 0.90277, null, 0.06298, null, 0.87302, null, 0.66727, null, 60, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "Netherlands", "2023-08-18", "Adult", "Adult", "Heart", "Cardiovascular System"], [25206, "SRR25685550", "SRX21410745", "SRS18649227", "SRP455779", "PRJNA1006658", "Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]", "GSE241157", "Transcriptome Analysis", "The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish  amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species  the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study  we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish  but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a  we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition  a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically  Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3  7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.", "parent bioproject:PRJNA1006653", "pubmed:39747457", null, "Hmga1a overexpression sample 2", "GSM7717536", null, "source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing", "Hmga1a overexpression sample 2", "FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count  samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR  differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts", "adult heart", "zebrafish were treated with tamoxifen to induce Hmga1a overexpression", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen", "GSM7717536", "GSM7717536: Hmga1a overexpression sample 2; Danio rerio; RNA Seq", "GSM7717536 r1", "GSM7717536", "1", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP455779", null, null, "HUB-PN-b004_HHHK2BGXN_S1_L003_OE2_cbc.fastq.gz", "fastq", 433893360.0, 7231556.0, "GSM7717536 r3", "0:60", "A:126666020;C:91068379;G:90449908;T:125677088;N:31965", 60, null, null, null, 126666020, 91068379, 90449908, 125677088, 31965, "SRX21410745", "SRS18649227", "SRA1695358", "Jeroen Bakkers, Hubrecht Institute", "Jeroen Bakkers, Hubrecht Institute", 1, 0.90833, null, 0.06364, null, 0.87351, null, 0.66644, null, 60, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "Netherlands", "2023-08-18", "Adult", "Adult", "Heart", "Cardiovascular System"], [25207, "SRR25685551", "SRX21410745", "SRS18649227", "SRP455779", "PRJNA1006658", "Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]", "GSE241157", "Transcriptome Analysis", "The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish  amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species  the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study  we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish  but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a  we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition  a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically  Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3  7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.", "parent bioproject:PRJNA1006653", "pubmed:39747457", null, "Hmga1a overexpression sample 2", "GSM7717536", null, "source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing", "Hmga1a overexpression sample 2", "FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count  samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR  differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts", "adult heart", "zebrafish were treated with tamoxifen to induce Hmga1a overexpression", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen", "GSM7717536", "GSM7717536: Hmga1a overexpression sample 2; Danio rerio; RNA Seq", "GSM7717536 r1", "GSM7717536", "1", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP455779", null, null, "HUB-PN-b004_HHHK2BGXN_S1_L004_OE2_cbc.fastq.gz", "fastq", 418311900.0, 6971865.0, "GSM7717536 r4", "0:60", "A:121375806;C:87324728;G:89011817;T:120559021;N:40528", 60, null, null, null, 121375806, 87324728, 89011817, 120559021, 40528, "SRX21410745", "SRS18649227", "SRA1695358", "Jeroen Bakkers, Hubrecht Institute", "Jeroen Bakkers, Hubrecht Institute", 1, 0.90583, null, 0.06349, null, 0.87156, null, 0.36876, null, 60, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "Netherlands", "2023-08-18", "Adult", "Adult", "Heart", "Cardiovascular System"], [25208, "SRR25685552", "SRX21410744", "SRS18649226", "SRP455779", "PRJNA1006658", "Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]", "GSE241157", "Transcriptome Analysis", "The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish  amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species  the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study  we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish  but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a  we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition  a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically  Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3  7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.", "parent bioproject:PRJNA1006653", "pubmed:39747457", null, "Hmga1a overexpression sample 1", "GSM7717535", null, "source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing", "Hmga1a overexpression sample 1", "FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count  samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR  differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts", "adult heart", "zebrafish were treated with tamoxifen to induce Hmga1a overexpression", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen", "GSM7717535", "GSM7717535: Hmga1a overexpression sample 1; Danio rerio; RNA Seq", "GSM7717535 r1", "GSM7717535", "1", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP455779", null, null, "HUB-PN-b004_HHHK2BGXN_S1_L001_OE1_cbc.fastq.gz", "fastq", 219019680.0, 3650328.0, "GSM7717535 r1", "0:60", "A:89205341;C:39777204;G:33514473;T:56486057;N:36605", 60, null, null, null, 89205341, 39777204, 33514473, 56486057, 36605, "SRX21410744", "SRS18649226", "SRA1695358", "Jeroen Bakkers, Hubrecht Institute", "Jeroen Bakkers, Hubrecht Institute", 1, 0.89316, null, 0.08503, null, 0.92125, null, 0.51486, null, 60, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "Netherlands", "2023-08-18", "Adult", "Adult", "Heart", "Cardiovascular System"], [25209, "SRR25685553", "SRX21410744", "SRS18649226", "SRP455779", "PRJNA1006658", "Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]", "GSE241157", "Transcriptome Analysis", "The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish  amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species  the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study  we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish  but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a  we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition  a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically  Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3  7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.", "parent bioproject:PRJNA1006653", "pubmed:39747457", null, "Hmga1a overexpression sample 1", "GSM7717535", null, "source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing", "Hmga1a overexpression sample 1", "FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count  samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR  differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts", "adult heart", "zebrafish were treated with tamoxifen to induce Hmga1a overexpression", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen", "GSM7717535", "GSM7717535: Hmga1a overexpression sample 1; Danio rerio; RNA Seq", "GSM7717535 r1", "GSM7717535", "1", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP455779", null, null, "HUB-PN-b004_HHHK2BGXN_S1_L002_OE1_cbc.fastq.gz", "fastq", 213035040.0, 3550584.0, "GSM7717535 r2", "0:60", "A:60747442;C:44096249;G:44275929;T:63866231;N:49189", 60, null, null, null, 60747442, 44096249, 44275929, 63866231, 49189, "SRX21410744", "SRS18649226", "SRA1695358", "Jeroen Bakkers, Hubrecht Institute", "Jeroen Bakkers, Hubrecht Institute", 1, 0.89017, null, 0.08631, null, 0.86543, null, 0.52632, null, 60, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "Netherlands", "2023-08-18", "Adult", "Adult", "Heart", "Cardiovascular System"], [25210, "SRR25685554", "SRX21410744", "SRS18649226", "SRP455779", "PRJNA1006658", "Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]", "GSE241157", "Transcriptome Analysis", "The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish  amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species  the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study  we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish  but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a  we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition  a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically  Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3  7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.", "parent bioproject:PRJNA1006653", "pubmed:39747457", null, "Hmga1a overexpression sample 1", "GSM7717535", null, "source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing", "Hmga1a overexpression sample 1", "FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count  samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR  differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts", "adult heart", "zebrafish were treated with tamoxifen to induce Hmga1a overexpression", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen", "GSM7717535", "GSM7717535: Hmga1a overexpression sample 1; Danio rerio; RNA Seq", "GSM7717535 r1", "GSM7717535", "1", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP455779", null, null, "HUB-PN-b004_HHHK2BGXN_S1_L003_OE1_cbc.fastq.gz", "fastq", 226019460.0, 3766991.0, "GSM7717535 r3", "0:60", "A:64732665;C:47081812;G:46018051;T:68171208;N:15724", 60, null, null, null, 64732665, 47081812, 46018051, 68171208, 15724, "SRX21410744", "SRS18649226", "SRA1695358", "Jeroen Bakkers, Hubrecht Institute", "Jeroen Bakkers, Hubrecht Institute", 1, 0.89632, null, 0.08716, null, 0.86661, null, 0.54361, null, 60, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "Netherlands", "2023-08-18", "Adult", "Adult", "Heart", "Cardiovascular System"], [25211, "SRR25685555", "SRX21410744", "SRS18649226", "SRP455779", "PRJNA1006658", "Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]", "GSE241157", "Transcriptome Analysis", "The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish  amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species  the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study  we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish  but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a  we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition  a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically  Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3  7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.", "parent bioproject:PRJNA1006653", "pubmed:39747457", null, "Hmga1a overexpression sample 1", "GSM7717535", null, "source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing", "Hmga1a overexpression sample 1", "FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count  samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR  differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts", "adult heart", "zebrafish were treated with tamoxifen to induce Hmga1a overexpression", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:Hmga1a overexpression|cell type:cardiomyocytes|treatment:14 days post tamoxifen", "GSM7717535", "GSM7717535: Hmga1a overexpression sample 1; Danio rerio; RNA Seq", "GSM7717535 r1", "GSM7717535", "1", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP455779", null, null, "HUB-PN-b004_HHHK2BGXN_S1_L004_OE1_cbc.fastq.gz", "fastq", 217742460.0, 3629041.0, "GSM7717535 r4", "0:60", "A:61973072;C:45113665;G:45294805;T:65339336;N:21582", 60, null, null, null, 61973072, 45113665, 45294805, 65339336, 21582, "SRX21410744", "SRS18649226", "SRA1695358", "Jeroen Bakkers, Hubrecht Institute", "Jeroen Bakkers, Hubrecht Institute", 1, 0.89237, null, 0.08517, null, 0.86454, null, 0.54639, null, 60, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "Netherlands", "2023-08-18", "Adult", "Adult", "Heart", "Cardiovascular System"], [25212, "SRR25685556", "SRX21410743", "SRS18649225", "SRP455779", "PRJNA1006658", "Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]", "GSE241157", "Transcriptome Analysis", "The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish  amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species  the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study  we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish  but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a  we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition  a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically  Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3  7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.", "parent bioproject:PRJNA1006653", "pubmed:39747457", null, "control sample 4", "GSM7717534", null, "source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing", "control sample 4", "FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count  samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR  differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts", "adult heart", "zebrafish were treated with tamoxifen to induce Hmga1a overexpression", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen", "GSM7717534", "GSM7717534: control sample 4; Danio rerio; RNA Seq", "GSM7717534 r1", "GSM7717534", "1", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP455779", null, null, "HUB-PN-b004_HHHK2BGXN_S1_L001_Ctrl4_cbc.fastq.gz", "fastq", 242809260.0, 4046821.0, "GSM7717534 r1", "0:60", "A:101286554;C:44368173;G:36112695;T:60997635;N:44203", 60, null, null, null, 101286554, 44368173, 36112695, 60997635, 44203, "SRX21410743", "SRS18649225", "SRA1695358", "Jeroen Bakkers, Hubrecht Institute", "Jeroen Bakkers, Hubrecht Institute", 1, 0.87519, null, 0.14838, null, 0.9362, null, 0.79824, null, 60, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "Netherlands", "2023-08-18", "Adult", "Adult", "Heart", "Cardiovascular System"], [25213, "SRR25685557", "SRX21410743", "SRS18649225", "SRP455779", "PRJNA1006658", "Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]", "GSE241157", "Transcriptome Analysis", "The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish  amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species  the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study  we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish  but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a  we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition  a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically  Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3  7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.", "parent bioproject:PRJNA1006653", "pubmed:39747457", null, "control sample 4", "GSM7717534", null, "source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing", "control sample 4", "FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count  samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR  differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts", "adult heart", "zebrafish were treated with tamoxifen to induce Hmga1a overexpression", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen", "GSM7717534", "GSM7717534: control sample 4; Danio rerio; RNA Seq", "GSM7717534 r1", "GSM7717534", "1", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP455779", null, null, "HUB-PN-b004_HHHK2BGXN_S1_L002_Ctrl4_cbc.fastq.gz", "fastq", 235587720.0, 3926462.0, "GSM7717534 r2", "0:60", "A:71954218;C:50127333;G:45371371;T:68077780;N:57018", 60, null, null, null, 71954218, 50127333, 45371371, 68077780, 57018, "SRX21410743", "SRS18649225", "SRA1695358", "Jeroen Bakkers, Hubrecht Institute", "Jeroen Bakkers, Hubrecht Institute", 1, 0.8759, null, 0.14468, null, 0.88075, null, 0.74532, null, 60, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "Netherlands", "2023-08-18", "Adult", "Adult", "Heart", "Cardiovascular System"], [25214, "SRR25685558", "SRX21410743", "SRS18649225", "SRP455779", "PRJNA1006658", "Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]", "GSE241157", "Transcriptome Analysis", "The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish  amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species  the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study  we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish  but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a  we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition  a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically  Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3  7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.", "parent bioproject:PRJNA1006653", "pubmed:39747457", null, "control sample 4", "GSM7717534", null, "source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing", "control sample 4", "FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count  samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR  differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts", "adult heart", "zebrafish were treated with tamoxifen to induce Hmga1a overexpression", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen", "GSM7717534", "GSM7717534: control sample 4; Danio rerio; RNA Seq", "GSM7717534 r1", "GSM7717534", "1", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP455779", null, null, "HUB-PN-b004_HHHK2BGXN_S1_L003_Ctrl4_cbc.fastq.gz", "fastq", 248320680.0, 4138678.0, "GSM7717534 r3", "0:60", "A:76188968;C:53138643;G:46699955;T:72274599;N:18515", 60, null, null, null, 76188968, 53138643, 46699955, 72274599, 18515, "SRX21410743", "SRS18649225", "SRA1695358", "Jeroen Bakkers, Hubrecht Institute", "Jeroen Bakkers, Hubrecht Institute", 1, 0.88396, null, 0.1471, null, 0.87864, null, 0.74275, null, 60, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "Netherlands", "2023-08-18", "Adult", "Adult", "Heart", "Cardiovascular System"], [25215, "SRR25685559", "SRX21410743", "SRS18649225", "SRP455779", "PRJNA1006658", "Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]", "GSE241157", "Transcriptome Analysis", "The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish  amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species  the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study  we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish  but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a  we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition  a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically  Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3  7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.", "parent bioproject:PRJNA1006653", "pubmed:39747457", null, "control sample 4", "GSM7717534", null, "source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing", "control sample 4", "FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count  samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR  differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts", "adult heart", "zebrafish were treated with tamoxifen to induce Hmga1a overexpression", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen", "GSM7717534", "GSM7717534: control sample 4; Danio rerio; RNA Seq", "GSM7717534 r1", "GSM7717534", "1", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP455779", null, null, "HUB-PN-b004_HHHK2BGXN_S1_L004_Ctrl4_cbc.fastq.gz", "fastq", 239678820.0, 3994647.0, "GSM7717534 r4", "0:60", "A:73122694;C:51017089;G:46184519;T:69330703;N:23815", 60, null, null, null, 73122694, 51017089, 46184519, 69330703, 23815, "SRX21410743", "SRS18649225", "SRA1695358", "Jeroen Bakkers, Hubrecht Institute", "Jeroen Bakkers, Hubrecht Institute", 1, 0.88113, null, 0.14666, null, 0.88045, null, 0.79921, null, 60, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "Netherlands", "2023-08-18", "Adult", "Adult", "Heart", "Cardiovascular System"], [25216, "SRR25685560", "SRX21410742", "SRS18649224", "SRP455779", "PRJNA1006658", "Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]", "GSE241157", "Transcriptome Analysis", "The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish  amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species  the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study  we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish  but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a  we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition  a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically  Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3  7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.", "parent bioproject:PRJNA1006653", "pubmed:39747457", null, "control sample 3", "GSM7717533", null, "source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing", "control sample 3", "FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count  samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR  differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts", "adult heart", "zebrafish were treated with tamoxifen to induce Hmga1a overexpression", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen", "GSM7717533", "GSM7717533: control sample 3; Danio rerio; RNA Seq", "GSM7717533 r1", "GSM7717533", "1", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP455779", null, null, "HUB-PN-b004_HHHK2BGXN_S1_L001_Ctrl3_cbc.fastq.gz", "fastq", 164862000.0, 2747700.0, "GSM7717533 r1", "0:60", "A:67317722;C:30175032;G:25320195;T:42019155;N:29896", 60, null, null, null, 67317722, 30175032, 25320195, 42019155, 29896, "SRX21410742", "SRS18649224", "SRA1695358", "Jeroen Bakkers, Hubrecht Institute", "Jeroen Bakkers, Hubrecht Institute", 1, 0.8874, null, 0.16231, null, 0.93513, null, 0.45903, null, 60, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "Netherlands", "2023-08-18", "Adult", "Adult", "Heart", "Cardiovascular System"], [25217, "SRR25685561", "SRX21410742", "SRS18649224", "SRP455779", "PRJNA1006658", "Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]", "GSE241157", "Transcriptome Analysis", "The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish  amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species  the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study  we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish  but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a  we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition  a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically  Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3  7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.", "parent bioproject:PRJNA1006653", "pubmed:39747457", null, "control sample 3", "GSM7717533", null, "source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing", "control sample 3", "FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count  samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR  differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts", "adult heart", "zebrafish were treated with tamoxifen to induce Hmga1a overexpression", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen", "GSM7717533", "GSM7717533: control sample 3; Danio rerio; RNA Seq", "GSM7717533 r1", "GSM7717533", "1", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP455779", null, null, "HUB-PN-b004_HHHK2BGXN_S1_L002_Ctrl3_cbc.fastq.gz", "fastq", 159878880.0, 2664648.0, "GSM7717533 r2", "0:60", "A:48277840;C:33800190;G:31556276;T:46206979;N:37595", 60, null, null, null, 48277840, 33800190, 31556276, 46206979, 37595, "SRX21410742", "SRS18649224", "SRA1695358", "Jeroen Bakkers, Hubrecht Institute", "Jeroen Bakkers, Hubrecht Institute", 1, 0.8874, null, 0.15941, null, 0.88038, null, 0.79589, null, 60, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "Netherlands", "2023-08-18", "Adult", "Adult", "Heart", "Cardiovascular System"], [25218, "SRR25685562", "SRX21410742", "SRS18649224", "SRP455779", "PRJNA1006658", "Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]", "GSE241157", "Transcriptome Analysis", "The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish  amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species  the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study  we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish  but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a  we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition  a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically  Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3  7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.", "parent bioproject:PRJNA1006653", "pubmed:39747457", null, "control sample 3", "GSM7717533", null, "source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing", "control sample 3", "FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count  samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR  differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts", "adult heart", "zebrafish were treated with tamoxifen to induce Hmga1a overexpression", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen", "GSM7717533", "GSM7717533: control sample 3; Danio rerio; RNA Seq", "GSM7717533 r1", "GSM7717533", "1", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP455779", null, null, "HUB-PN-b004_HHHK2BGXN_S1_L003_Ctrl3_cbc.fastq.gz", "fastq", 169506240.0, 2825104.0, "GSM7717533 r3", "0:60", "A:51435401;C:36027782;G:32684721;T:49346338;N:11998", 60, null, null, null, 51435401, 36027782, 32684721, 49346338, 11998, "SRX21410742", "SRS18649224", "SRA1695358", "Jeroen Bakkers, Hubrecht Institute", "Jeroen Bakkers, Hubrecht Institute", 1, 0.89554, null, 0.16117, null, 0.87947, null, 0.795, null, 60, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "Netherlands", "2023-08-18", "Adult", "Adult", "Heart", "Cardiovascular System"], [25219, "SRR25685563", "SRX21410742", "SRS18649224", "SRP455779", "PRJNA1006658", "Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]", "GSE241157", "Transcriptome Analysis", "The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish  amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species  the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study  we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish  but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a  we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition  a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically  Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3  7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.", "parent bioproject:PRJNA1006653", "pubmed:39747457", null, "control sample 3", "GSM7717533", null, "source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing", "control sample 3", "FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count  samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR  differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts", "adult heart", "zebrafish were treated with tamoxifen to induce Hmga1a overexpression", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen", "GSM7717533", "GSM7717533: control sample 3; Danio rerio; RNA Seq", "GSM7717533 r1", "GSM7717533", "1", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP455779", null, null, "HUB-PN-b004_HHHK2BGXN_S1_L004_Ctrl3_cbc.fastq.gz", "fastq", 163347840.0, 2722464.0, "GSM7717533 r4", "0:60", "A:49253957;C:34538564;G:32268358;T:47272095;N:14866", 60, null, null, null, 49253957, 34538564, 32268358, 47272095, 14866, "SRX21410742", "SRS18649224", "SRA1695358", "Jeroen Bakkers, Hubrecht Institute", "Jeroen Bakkers, Hubrecht Institute", 1, 0.89252, null, 0.15956, null, 0.8784, null, 0.79732, null, 60, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "Netherlands", "2023-08-18", "Adult", "Adult", "Heart", "Cardiovascular System"], [25220, "SRR25685564", "SRX21410741", "SRS18649223", "SRP455779", "PRJNA1006658", "Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]", "GSE241157", "Transcriptome Analysis", "The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish  amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species  the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study  we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish  but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a  we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition  a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically  Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3  7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.", "parent bioproject:PRJNA1006653", "pubmed:39747457", null, "control sample 2", "GSM7717532", null, "source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing", "control sample 2", "FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count  samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR  differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts", "adult heart", "zebrafish were treated with tamoxifen to induce Hmga1a overexpression", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen", "GSM7717532", "GSM7717532: control sample 2; Danio rerio; RNA Seq", "GSM7717532 r1", "GSM7717532", "1", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP455779", null, null, "HUB-PN-b004_HHHK2BGXN_S1_L001_Ctrl2_cbc.fastq.gz", "fastq", 19885560.0, 331426.0, "GSM7717532 r1", "0:60", "A:8615440;C:3592607;G:2886695;T:4787767;N:3051", 60, null, null, null, 8615440, 3592607, 2886695, 4787767, 3051, "SRX21410741", "SRS18649223", "SRA1695358", "Jeroen Bakkers, Hubrecht Institute", "Jeroen Bakkers, Hubrecht Institute", 1, 0.84848, null, 0.13671, null, 0.96136, null, 0.84253, null, 60, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "Netherlands", "2023-08-18", "Adult", "Adult", "Heart", "Cardiovascular System"], [25221, "SRR25685565", "SRX21410741", "SRS18649223", "SRP455779", "PRJNA1006658", "Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]", "GSE241157", "Transcriptome Analysis", "The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish  amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species  the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study  we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish  but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a  we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition  a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically  Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3  7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.", "parent bioproject:PRJNA1006653", "pubmed:39747457", null, "control sample 2", "GSM7717532", null, "source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing", "control sample 2", "FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count  samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR  differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts", "adult heart", "zebrafish were treated with tamoxifen to induce Hmga1a overexpression", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen", "GSM7717532", "GSM7717532: control sample 2; Danio rerio; RNA Seq", "GSM7717532 r1", "GSM7717532", "1", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP455779", null, null, "HUB-PN-b004_HHHK2BGXN_S1_L002_Ctrl2_cbc.fastq.gz", "fastq", 19226760.0, 320446.0, "GSM7717532 r2", "0:60", "A:5898378;C:4022375;G:3854218;T:5447181;N:4608", 60, null, null, null, 5898378, 4022375, 3854218, 5447181, 4608, "SRX21410741", "SRS18649223", "SRA1695358", "Jeroen Bakkers, Hubrecht Institute", "Jeroen Bakkers, Hubrecht Institute", 1, 0.84542, null, 0.13731, null, 0.94004, null, 0.38758, null, 60, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "Netherlands", "2023-08-18", "Adult", "Adult", "Heart", "Cardiovascular System"], [25222, "SRR25685566", "SRX21410741", "SRS18649223", "SRP455779", "PRJNA1006658", "Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]", "GSE241157", "Transcriptome Analysis", "The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish  amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species  the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study  we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish  but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a  we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition  a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically  Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3  7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.", "parent bioproject:PRJNA1006653", "pubmed:39747457", null, "control sample 2", "GSM7717532", null, "source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing", "control sample 2", "FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count  samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR  differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts", "adult heart", "zebrafish were treated with tamoxifen to induce Hmga1a overexpression", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen", "GSM7717532", "GSM7717532: control sample 2; Danio rerio; RNA Seq", "GSM7717532 r1", "GSM7717532", "1", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP455779", null, null, "HUB-PN-b004_HHHK2BGXN_S1_L003_Ctrl2_cbc.fastq.gz", "fastq", 20360520.0, 339342.0, "GSM7717532 r3", "0:60", "A:6273552;C:4289098;G:3982791;T:5813710;N:1369", 60, null, null, null, 6273552, 4289098, 3982791, 5813710, 1369, "SRX21410741", "SRS18649223", "SRA1695358", "Jeroen Bakkers, Hubrecht Institute", "Jeroen Bakkers, Hubrecht Institute", 1, 0.85213, null, 0.13819, null, 0.93929, null, 0.83913, null, 60, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "Netherlands", "2023-08-18", "Adult", "Adult", "Heart", "Cardiovascular System"], [25223, "SRR25685567", "SRX21410741", "SRS18649223", "SRP455779", "PRJNA1006658", "Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]", "GSE241157", "Transcriptome Analysis", "The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish  amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species  the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study  we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish  but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a  we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition  a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically  Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3  7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.", "parent bioproject:PRJNA1006653", "pubmed:39747457", null, "control sample 2", "GSM7717532", null, "source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing", "control sample 2", "FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count  samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR  differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts", "adult heart", "zebrafish were treated with tamoxifen to induce Hmga1a overexpression", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen", "GSM7717532", "GSM7717532: control sample 2; Danio rerio; RNA Seq", "GSM7717532 r1", "GSM7717532", "1", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP455779", null, null, "HUB-PN-b004_HHHK2BGXN_S1_L004_Ctrl2_cbc.fastq.gz", "fastq", 19742340.0, 329039.0, "GSM7717532 r4", "0:60", "A:6042722;C:4140425;G:3955209;T:5601961;N:2023", 60, null, null, null, 6042722, 4140425, 3955209, 5601961, 2023, "SRX21410741", "SRS18649223", "SRA1695358", "Jeroen Bakkers, Hubrecht Institute", "Jeroen Bakkers, Hubrecht Institute", 1, 0.84722, null, 0.13682, null, 0.93933, null, 0.83301, null, 60, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "Netherlands", "2023-08-18", "Adult", "Adult", "Heart", "Cardiovascular System"], [25224, "SRR25685568", "SRX21410740", "SRS18649222", "SRP455779", "PRJNA1006658", "Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]", "GSE241157", "Transcriptome Analysis", "The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish  amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species  the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study  we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish  but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a  we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition  a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically  Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3  7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.", "parent bioproject:PRJNA1006653", "pubmed:39747457", null, "control sample 1", "GSM7717531", null, "source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing", "control sample 1", "FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count  samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR  differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts", "adult heart", "zebrafish were treated with tamoxifen to induce Hmga1a overexpression", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen", "GSM7717531", "GSM7717531: control sample 1; Danio rerio; RNA Seq", "GSM7717531 r1", "GSM7717531", "1", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP455779", null, null, "HUB-PN-b004_HHHK2BGXN_S1_L001_Ctrl1_cbc.fastq.gz", "fastq", 296163420.0, 4936057.0, "GSM7717531 r1", "0:60", "A:121966307;C:53233433;G:44972413;T:75936522;N:54745", 60, null, null, null, 121966307, 53233433, 44972413, 75936522, 54745, "SRX21410740", "SRS18649222", "SRA1695358", "Jeroen Bakkers, Hubrecht Institute", "Jeroen Bakkers, Hubrecht Institute", 1, 0.88546, null, 0.17055, null, 0.92681, null, 0.76028, null, 60, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "Netherlands", "2023-08-18", "Adult", "Adult", "Heart", "Cardiovascular System"], [25225, "SRR25685569", "SRX21410740", "SRS18649222", "SRP455779", "PRJNA1006658", "Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]", "GSE241157", "Transcriptome Analysis", "The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish  amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species  the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study  we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish  but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a  we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition  a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically  Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3  7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.", "parent bioproject:PRJNA1006653", "pubmed:39747457", null, "control sample 1", "GSM7717531", null, "source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing", "control sample 1", "FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count  samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR  differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts", "adult heart", "zebrafish were treated with tamoxifen to induce Hmga1a overexpression", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen", "GSM7717531", "GSM7717531: control sample 1; Danio rerio; RNA Seq", "GSM7717531 r1", "GSM7717531", "1", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP455779", null, null, "HUB-PN-b004_HHHK2BGXN_S1_L002_Ctrl1_cbc.fastq.gz", "fastq", 287707980.0, 4795133.0, "GSM7717531 r2", "0:60", "A:87738683;C:59468794;G:56448494;T:83984130;N:67879", 60, null, null, null, 87738683, 59468794, 56448494, 83984130, 67879, "SRX21410740", "SRS18649222", "SRA1695358", "Jeroen Bakkers, Hubrecht Institute", "Jeroen Bakkers, Hubrecht Institute", 1, 0.88284, null, 0.16626, null, 0.86561, null, 0.74308, null, 60, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "Netherlands", "2023-08-18", "Adult", "Adult", "Heart", "Cardiovascular System"], [25226, "SRR25685570", "SRX21410740", "SRS18649222", "SRP455779", "PRJNA1006658", "Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]", "GSE241157", "Transcriptome Analysis", "The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish  amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species  the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study  we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish  but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a  we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition  a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically  Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3  7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.", "parent bioproject:PRJNA1006653", "pubmed:39747457", null, "control sample 1", "GSM7717531", null, "source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing", "control sample 1", "FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count  samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR  differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts", "adult heart", "zebrafish were treated with tamoxifen to induce Hmga1a overexpression", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen", "GSM7717531", "GSM7717531: control sample 1; Danio rerio; RNA Seq", "GSM7717531 r1", "GSM7717531", "1", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP455779", null, null, "HUB-PN-b004_HHHK2BGXN_S1_L003_Ctrl1_cbc.fastq.gz", "fastq", 303833460.0, 5063891.0, "GSM7717531 r3", "0:60", "A:93092013;C:63221167;G:58235370;T:89262119;N:22791", 60, null, null, null, 93092013, 63221167, 58235370, 89262119, 22791, "SRX21410740", "SRS18649222", "SRA1695358", "Jeroen Bakkers, Hubrecht Institute", "Jeroen Bakkers, Hubrecht Institute", 1, 0.89102, null, 0.16657, null, 0.86336, null, 0.75396, null, 60, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "Netherlands", "2023-08-18", "Adult", "Adult", "Heart", "Cardiovascular System"], [25227, "SRR25685571", "SRX21410740", "SRS18649222", "SRP455779", "PRJNA1006658", "Interspecies comparison reveals Hmga1 as driver of cardiac regeneration [bulk RNAseq Hmga1a OE]", "GSE241157", "Transcriptome Analysis", "The prospect of repairing the heart post a myocardial infarction by promoting cardiomyocyte proliferation has gained momentum from studies showing the heart's regenerative ability in fish  amphibians and neonatal mammals. Despite evidence of varying cardiomyocyte proliferation rates among species  the molecular mechanisms driving cardiomyocyte cell cycle re entry remain insufficiently understood. In this study  we employed spatial transcriptomics and identified high mobility group AT hook 1a Hmga1a as being upregulated in cardiomyocytes of the injury border zone in zebrafish  but not in mice. Through knock out and cardiomyocyte specific overexpression of hmga1a  we found that Hmga1a was required for zebrafish heart regeneration and sufficient to drive cardiomyocyte proliferation. In addition  a single injection of Hmga1 virus in injured mouse hearts resulted in increased border zone cardiomyocyte proliferation and improved heart function. Mechanistically  Hmga1 expression reduced repressive H3K27me3 histone modifications from developmentally regulated genes and induced a border zone like transcriptional program in adult cardiomyocytes. Our study demonstrates the value of interspecies comparisons by identifying Hmga1 as a critical driver of heart regeneration and highlights Hmga1 as a promising therapeutic candidate to improve cardiac xxx post injury. Overall design: TOMOseq was performed on mouse and zebrafish hearts at 3  7 and 14 xxx post injury for the interspecies comparison. single cell RNA sequencing was performed on wildtype versus hmga1a mutant zebrafish cardiomyocytes 7 days post cryoinjury to assess differences during heart regeneration. Bulk RNA sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect in an uninjured heart. bulk sortChIC sequencing was performed on control versus Hmga1a overexpression cardiomyocytes to assess the effect of Hmga1a on the chromatin.", "parent bioproject:PRJNA1006653", "pubmed:39747457", null, "control sample 1", "GSM7717531", null, "source name:adult heart|tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen|geo loc name:missing|collection date:missing", "control sample 1", "FASTQ files were mapped with the STARandGO pipeline https://github.com/anna alemany/VASAseq/blob/main/mapping/map star.sh against the danRer11 ENSEMBL genome with the zebrafish Lawson V4.3.2 annotation. Normalization and downstream analysis were performed in R. Due to low read count  samples control 2 and overexpression 1 were excluded from analysis. Using the R package EdgeR  differentially expressed genes were obtained FC < 1 or >1 and Pval<0.05. Gene lists were subjected to GO analysis using the online tool DAVID. Assembly: danrer11 Supplementary files format and content: excel file containing edgeR results and GO analysis results Supplementary files format and content: count table spliced transcriptcounts", "adult heart", "zebrafish were treated with tamoxifen to induce Hmga1a overexpression", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "tissue:adult heart|genotype 1:cmlc2:dsred|genotype 2:control|cell type:cardiomyocytes|treatment:14 days post tamoxifen", "GSM7717531", "GSM7717531: control sample 1; Danio rerio; RNA Seq", "GSM7717531 r1", "GSM7717531", "1", "Unfixed ventricles were dissociated by Collagenase and TrypLE Express treatment to prepare single cell solutions.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP455779", null, null, "HUB-PN-b004_HHHK2BGXN_S1_L004_Ctrl1_cbc.fastq.gz", "fastq", 293865840.0, 4897764.0, "GSM7717531 r4", "0:60", "A:89531768;C:60796725;G:57688758;T:85819485;N:29104", 60, null, null, null, 89531768, 60796725, 57688758, 85819485, 29104, "SRX21410740", "SRS18649222", "SRA1695358", "Jeroen Bakkers, Hubrecht Institute", "Jeroen Bakkers, Hubrecht Institute", 1, 0.88911, null, 0.16498, null, 0.86145, null, 0.75653, null, 60, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "unknown", "sc_generic", "bulk", "bulk", null, "Netherlands", "2023-08-18", "Adult", "Adult", "Heart", "Cardiovascular System"], [31502, "SRR28411462", "SRX24015869", "SRS20810998", "SRP497025", "PRJNA1090509", "The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139", "GSE262169", "Transcriptome Analysis", "The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration  but many questions remain about its exact role.  Here we show that MyD88  a key component of the innate immune response  controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration.  We find in cryoinjured myd88 /  ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population.  Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 /  endocardium and increased myofibroblasts and scarring.  Notably  endothelial specific overexpression of myd88 reverses these neutrophil  fibrotic  and scarring phenotypes.  Mechanistically  we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway  and using loss  and gain of function tools show that it controls neutrophil recruitment.  Altogether  these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 /  untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing", "parent bioproject:PRJNA1090894", "pubmed:39271818", null, "injured tissue  myd88+/+  24 hpci 2", "GSM8159071", null, "source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment:cardiac cryoinjury|geo loc name:missing|collection date:missing", "injured tissue  myd88+/+  24 hpci 2", "Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al.  STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format  multi mapping  ribosomal  or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al.  Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5  multiple testing adjusted p value < 0.05  and  0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al.  featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts", "cardiac ventricles", "untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction", "RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set  Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture\u2019s protocol Vazyme.", null, "tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment:cardiac cryoinjury", "GSM8159071", "GSM8159071: injured tissue  myd88+/+  24 hpci 2; Danio rerio; RNA Seq", "GSM8159071 r1", "GSM8159071", "1", "RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set  Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP497025", null, "loader:fastq load.py", "Pinelopi_WT2_24h_pci_R1.fastq.gz", "fastq", 2454645976.0, 33159360.0, "GSM8159071 r1", "0:74.03", "A:660213492;C:527347733;G:572126573;T:694765347;N:192831", 74, null, null, null, 660213492, 527347733, 572126573, 694765347, 192831, "SRX24015869", "SRS20810998", "SRA1830778", "MPI for heart and lung research", "MPI for heart and lung research", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "Germany", "2024-03-21", "Undetermined", "Undetermined", "Heart", "Cardiovascular System"], [31503, "SRR28411463", "SRX24015868", "SRS20810997", "SRP497025", "PRJNA1090509", "The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139", "GSE262169", "Transcriptome Analysis", "The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration  but many questions remain about its exact role.  Here we show that MyD88  a key component of the innate immune response  controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration.  We find in cryoinjured myd88 /  ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population.  Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 /  endocardium and increased myofibroblasts and scarring.  Notably  endothelial specific overexpression of myd88 reverses these neutrophil  fibrotic  and scarring phenotypes.  Mechanistically  we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway  and using loss  and gain of function tools show that it controls neutrophil recruitment.  Altogether  these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 /  untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing", "parent bioproject:PRJNA1090894", "pubmed:39271818", null, "injured tissue  myd88+/+  1 hpci 2", "GSM8159070", null, "source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment:cardiac cryoinjury|geo loc name:missing|collection date:missing", "injured tissue  myd88+/+  1 hpci 2", "Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al.  STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format  multi mapping  ribosomal  or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al.  Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5  multiple testing adjusted p value < 0.05  and  0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al.  featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts", "cardiac ventricles", "untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction", "RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set  Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture\u2019s protocol Vazyme.", null, "tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment:cardiac cryoinjury", "GSM8159070", "GSM8159070: injured tissue  myd88+/+  1 hpci 2; Danio rerio; RNA Seq", "GSM8159070 r1", "GSM8159070", "1", "RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set  Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP497025", null, "loader:fastq load.py", "Pinelopi_WT2_1h_pci_R1.fastq.gz", "fastq", 2674654542.0, 36003719.0, "GSM8159070 r1", "0:74.29", "A:713621237;C:556223861;G:630990745;T:773686189;N:132510", 74, null, null, null, 713621237, 556223861, 630990745, 773686189, 132510, "SRX24015868", "SRS20810997", "SRA1830778", "MPI for heart and lung research", "MPI for heart and lung research", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "Germany", "2024-03-21", "Undetermined", "Undetermined", "Heart", "Cardiovascular System"], [31504, "SRR28411464", "SRX24015867", "SRS20810996", "SRP497025", "PRJNA1090509", "The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139", "GSE262169", "Transcriptome Analysis", "The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration  but many questions remain about its exact role.  Here we show that MyD88  a key component of the innate immune response  controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration.  We find in cryoinjured myd88 /  ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population.  Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 /  endocardium and increased myofibroblasts and scarring.  Notably  endothelial specific overexpression of myd88 reverses these neutrophil  fibrotic  and scarring phenotypes.  Mechanistically  we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway  and using loss  and gain of function tools show that it controls neutrophil recruitment.  Altogether  these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 /  untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing", "parent bioproject:PRJNA1090894", "pubmed:39271818", null, "ventricle  myd88+/+  untouched 2", "GSM8159069", null, "source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment: |geo loc name:missing|collection date:missing", "ventricle  myd88+/+  untouched 2", "Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al.  STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format  multi mapping  ribosomal  or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al.  Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5  multiple testing adjusted p value < 0.05  and  0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al.  featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts", "cardiac ventricles", "untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction", "RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set  Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture\u2019s protocol Vazyme.", null, "tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment: ", "GSM8159069", "GSM8159069: ventricle  myd88+/+  untouched 2; Danio rerio; RNA Seq", "GSM8159069 r1", "GSM8159069", "1", "RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set  Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP497025", null, "loader:fastq load.py", "Pinelopi_WT2_0h_pci_R1.fastq.gz", "fastq", 2092632406.0, 28163739.0, "GSM8159069 r1", "0:74.30", "A:560190602;C:446185315;G:485011548;T:601082958;N:161983", 74, null, null, null, 560190602, 446185315, 485011548, 601082958, 161983, "SRX24015867", "SRS20810996", "SRA1830778", "MPI for heart and lung research", "MPI for heart and lung research", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "Germany", "2024-03-21", "Undetermined", "Undetermined", "Heart", "Cardiovascular System"], [31505, "SRR28411465", "SRX24015866", "SRS20810995", "SRP497025", "PRJNA1090509", "The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139", "GSE262169", "Transcriptome Analysis", "The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration  but many questions remain about its exact role.  Here we show that MyD88  a key component of the innate immune response  controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration.  We find in cryoinjured myd88 /  ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population.  Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 /  endocardium and increased myofibroblasts and scarring.  Notably  endothelial specific overexpression of myd88 reverses these neutrophil  fibrotic  and scarring phenotypes.  Mechanistically  we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway  and using loss  and gain of function tools show that it controls neutrophil recruitment.  Altogether  these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 /  untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing", "parent bioproject:PRJNA1090894", "pubmed:39271818", null, "injured tissue  myd88+/+  24 hpci 1", "GSM8159068", null, "source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment:cardiac cryoinjury|geo loc name:missing|collection date:missing", "injured tissue  myd88+/+  24 hpci 1", "Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al.  STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format  multi mapping  ribosomal  or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al.  Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5  multiple testing adjusted p value < 0.05  and  0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al.  featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts", "cardiac ventricles", "untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction", "RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set  Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture\u2019s protocol Vazyme.", null, "tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment:cardiac cryoinjury", "GSM8159068", "GSM8159068: injured tissue  myd88+/+  24 hpci 1; Danio rerio; RNA Seq", "GSM8159068 r1", "GSM8159068", "1", "RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set  Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP497025", null, "loader:fastq load.py", "Pinelopi_WT1_24h_pci_R1.fastq.gz", "fastq", 1060148110.0, 14341826.0, "GSM8159068 r1", "0:73.92", "A:290655996;C:222128471;G:247491826;T:299784598;N:87219", 73, null, null, null, 290655996, 222128471, 247491826, 299784598, 87219, "SRX24015866", "SRS20810995", "SRA1830778", "MPI for heart and lung research", "MPI for heart and lung research", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "Germany", "2024-03-21", "Undetermined", "Undetermined", "Heart", "Cardiovascular System"], [31506, "SRR28411466", "SRX24015865", "SRS20810994", "SRP497025", "PRJNA1090509", "The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139", "GSE262169", "Transcriptome Analysis", "The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration  but many questions remain about its exact role.  Here we show that MyD88  a key component of the innate immune response  controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration.  We find in cryoinjured myd88 /  ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population.  Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 /  endocardium and increased myofibroblasts and scarring.  Notably  endothelial specific overexpression of myd88 reverses these neutrophil  fibrotic  and scarring phenotypes.  Mechanistically  we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway  and using loss  and gain of function tools show that it controls neutrophil recruitment.  Altogether  these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 /  untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing", "parent bioproject:PRJNA1090894", "pubmed:39271818", null, "injured tissue  myd88+/+  1 hpci 1", "GSM8159067", null, "source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment:cardiac cryoinjury|geo loc name:missing|collection date:missing", "injured tissue  myd88+/+  1 hpci 1", "Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al.  STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format  multi mapping  ribosomal  or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al.  Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5  multiple testing adjusted p value < 0.05  and  0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al.  featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts", "cardiac ventricles", "untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction", "RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set  Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture\u2019s protocol Vazyme.", null, "tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment:cardiac cryoinjury", "GSM8159067", "GSM8159067: injured tissue  myd88+/+  1 hpci 1; Danio rerio; RNA Seq", "GSM8159067 r1", "GSM8159067", "1", "RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set  Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP497025", null, "loader:fastq load.py", "Pinelopi_WT1_1h_pci_R1.fastq.gz", "fastq", 2594786024.0, 34913792.0, "GSM8159067 r1", "0:74.32", "A:689702458;C:551265040;G:603307580;T:750425733;N:85213", 74, null, null, null, 689702458, 551265040, 603307580, 750425733, 85213, "SRX24015865", "SRS20810994", "SRA1830778", "MPI for heart and lung research", "MPI for heart and lung research", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "Germany", "2024-03-21", "Undetermined", "Undetermined", "Heart", "Cardiovascular System"], [31507, "SRR28411467", "SRX24015864", "SRS20810993", "SRP497025", "PRJNA1090509", "The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139", "GSE262169", "Transcriptome Analysis", "The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration  but many questions remain about its exact role.  Here we show that MyD88  a key component of the innate immune response  controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration.  We find in cryoinjured myd88 /  ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population.  Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 /  endocardium and increased myofibroblasts and scarring.  Notably  endothelial specific overexpression of myd88 reverses these neutrophil  fibrotic  and scarring phenotypes.  Mechanistically  we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway  and using loss  and gain of function tools show that it controls neutrophil recruitment.  Altogether  these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 /  untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing", "parent bioproject:PRJNA1090894", "pubmed:39271818", null, "ventricle  myd88+/+  untouched 1", "GSM8159066", null, "source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment: |geo loc name:missing|collection date:missing", "ventricle  myd88+/+  untouched 1", "Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al.  STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format  multi mapping  ribosomal  or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al.  Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5  multiple testing adjusted p value < 0.05  and  0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al.  featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts", "cardiac ventricles", "untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction", "RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set  Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture\u2019s protocol Vazyme.", null, "tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment: ", "GSM8159066", "GSM8159066: ventricle  myd88+/+  untouched 1; Danio rerio; RNA Seq", "GSM8159066 r1", "GSM8159066", "1", "RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set  Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP497025", null, "loader:fastq load.py", "Pinelopi_WT1_0h_pci_R1.fastq.gz", "fastq", 2123516005.0, 28595227.0, "GSM8159066 r1", "0:74.26", "A:562046544;C:458761205;G:496224794;T:606313940;N:169522", 74, null, null, null, 562046544, 458761205, 496224794, 606313940, 169522, "SRX24015864", "SRS20810993", "SRA1830778", "MPI for heart and lung research", "MPI for heart and lung research", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "Germany", "2024-03-21", "Undetermined", "Undetermined", "Heart", "Cardiovascular System"], [31508, "SRR28411468", "SRX24015863", "SRS20810992", "SRP497025", "PRJNA1090509", "The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139", "GSE262169", "Transcriptome Analysis", "The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration  but many questions remain about its exact role.  Here we show that MyD88  a key component of the innate immune response  controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration.  We find in cryoinjured myd88 /  ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population.  Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 /  endocardium and increased myofibroblasts and scarring.  Notably  endothelial specific overexpression of myd88 reverses these neutrophil  fibrotic  and scarring phenotypes.  Mechanistically  we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway  and using loss  and gain of function tools show that it controls neutrophil recruitment.  Altogether  these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 /  untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing", "parent bioproject:PRJNA1090894", "pubmed:39271818", null, "injured tissue  myd88 /   24 hpci 2", "GSM8159065", null, "source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment:cardiac cryoinjury|geo loc name:missing|collection date:missing", "injured tissue  myd88 /   24 hpci 2", "Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al.  STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format  multi mapping  ribosomal  or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al.  Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5  multiple testing adjusted p value < 0.05  and  0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al.  featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts", "cardiac ventricles", "untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction", "RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set  Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture\u2019s protocol Vazyme.", null, "tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment:cardiac cryoinjury", "GSM8159065", "GSM8159065: injured tissue  myd88 /   24 hpci 2; Danio rerio; RNA Seq", "GSM8159065 r1", "GSM8159065", "1", "RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set  Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP497025", null, "loader:fastq load.py", "Pinelopi_Homo2_24h_pci_R1.fastq.gz", "fastq", 2509143345.0, 33915175.0, "GSM8159065 r1", "0:73.98", "A:669128241;C:547606289;G:587771598;T:704439682;N:197535", 73, null, null, null, 669128241, 547606289, 587771598, 704439682, 197535, "SRX24015863", "SRS20810992", "SRA1830778", "MPI for heart and lung research", "MPI for heart and lung research", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "Germany", "2024-03-21", "Undetermined", "Undetermined", "Heart", "Cardiovascular System"], [31509, "SRR28411469", "SRX24015862", "SRS20810991", "SRP497025", "PRJNA1090509", "The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139", "GSE262169", "Transcriptome Analysis", "The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration  but many questions remain about its exact role.  Here we show that MyD88  a key component of the innate immune response  controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration.  We find in cryoinjured myd88 /  ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population.  Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 /  endocardium and increased myofibroblasts and scarring.  Notably  endothelial specific overexpression of myd88 reverses these neutrophil  fibrotic  and scarring phenotypes.  Mechanistically  we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway  and using loss  and gain of function tools show that it controls neutrophil recruitment.  Altogether  these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 /  untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing", "parent bioproject:PRJNA1090894", "pubmed:39271818", null, "injured tissue  myd88 /   1 hpci 2", "GSM8159064", null, "source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment:cardiac cryoinjury|geo loc name:missing|collection date:missing", "injured tissue  myd88 /   1 hpci 2", "Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al.  STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format  multi mapping  ribosomal  or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al.  Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5  multiple testing adjusted p value < 0.05  and  0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al.  featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts", "cardiac ventricles", "untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction", "RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set  Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture\u2019s protocol Vazyme.", null, "tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment:cardiac cryoinjury", "GSM8159064", "GSM8159064: injured tissue  myd88 /   1 hpci 2; Danio rerio; RNA Seq", "GSM8159064 r1", "GSM8159064", "1", "RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set  Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP497025", null, "loader:fastq load.py", "Pinelopi_Homo2_1h_pci_R1.fastq.gz", "fastq", 2584847185.0, 34784917.0, "GSM8159064 r1", "0:74.31", "A:690941775;C:542509296;G:605002938;T:746301098;N:92078", 74, null, null, null, 690941775, 542509296, 605002938, 746301098, 92078, "SRX24015862", "SRS20810991", "SRA1830778", "MPI for heart and lung research", "MPI for heart and lung research", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "Germany", "2024-03-21", "Undetermined", "Undetermined", "Heart", "Cardiovascular System"], [31510, "SRR28411470", "SRX24015861", "SRS20810990", "SRP497025", "PRJNA1090509", "The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139", "GSE262169", "Transcriptome Analysis", "The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration  but many questions remain about its exact role.  Here we show that MyD88  a key component of the innate immune response  controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration.  We find in cryoinjured myd88 /  ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population.  Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 /  endocardium and increased myofibroblasts and scarring.  Notably  endothelial specific overexpression of myd88 reverses these neutrophil  fibrotic  and scarring phenotypes.  Mechanistically  we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway  and using loss  and gain of function tools show that it controls neutrophil recruitment.  Altogether  these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 /  untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing", "parent bioproject:PRJNA1090894", "pubmed:39271818", null, "ventricle  myd88 /   untouched 2", "GSM8159063", null, "source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment: |geo loc name:missing|collection date:missing", "ventricle  myd88 /   untouched 2", "Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al.  STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format  multi mapping  ribosomal  or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al.  Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5  multiple testing adjusted p value < 0.05  and  0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al.  featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts", "cardiac ventricles", "untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction", "RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set  Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture\u2019s protocol Vazyme.", null, "tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment: ", "GSM8159063", "GSM8159063: ventricle  myd88 /   untouched 2; Danio rerio; RNA Seq", "GSM8159063 r1", "GSM8159063", "1", "RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set  Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP497025", null, "loader:fastq load.py", "Pinelopi_Homo2_0h_pci_R1.fastq.gz", "fastq", 2178164776.0, 29313471.0, "GSM8159063 r1", "0:74.31", "A:588370831;C:457110464;G:507924919;T:624586577;N:171985", 74, null, null, null, 588370831, 457110464, 507924919, 624586577, 171985, "SRX24015861", "SRS20810990", "SRA1830778", "MPI for heart and lung research", "MPI for heart and lung research", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "Germany", "2024-03-21", "Undetermined", "Undetermined", "Heart", "Cardiovascular System"], [31511, "SRR28411471", "SRX24015860", "SRS20810989", "SRP497025", "PRJNA1090509", "The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139", "GSE262169", "Transcriptome Analysis", "The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration  but many questions remain about its exact role.  Here we show that MyD88  a key component of the innate immune response  controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration.  We find in cryoinjured myd88 /  ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population.  Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 /  endocardium and increased myofibroblasts and scarring.  Notably  endothelial specific overexpression of myd88 reverses these neutrophil  fibrotic  and scarring phenotypes.  Mechanistically  we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway  and using loss  and gain of function tools show that it controls neutrophil recruitment.  Altogether  these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 /  untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing", "parent bioproject:PRJNA1090894", "pubmed:39271818", null, "injured tissue  myd88 /   24 hpci 1", "GSM8159062", null, "source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment:cardiac cryoinjury|geo loc name:missing|collection date:missing", "injured tissue  myd88 /   24 hpci 1", "Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al.  STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format  multi mapping  ribosomal  or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al.  Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5  multiple testing adjusted p value < 0.05  and  0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al.  featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts", "cardiac ventricles", "untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction", "RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set  Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture\u2019s protocol Vazyme.", null, "tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment:cardiac cryoinjury", "GSM8159062", "GSM8159062: injured tissue  myd88 /   24 hpci 1; Danio rerio; RNA Seq", "GSM8159062 r1", "GSM8159062", "1", "RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set  Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP497025", null, "loader:fastq load.py", "Pinelopi_Homo1_24h_pci_R1.fastq.gz", "fastq", 2323298254.0, 31332951.0, "GSM8159062 r1", "0:74.15", "A:621931320;C:501998000;G:541224122;T:657957821;N:186991", 74, null, null, null, 621931320, 501998000, 541224122, 657957821, 186991, "SRX24015860", "SRS20810989", "SRA1830778", "MPI for heart and lung research", "MPI for heart and lung research", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "Germany", "2024-03-21", "Undetermined", "Undetermined", "Heart", "Cardiovascular System"], [31512, "SRR28411472", "SRX24015859", "SRS20810988", "SRP497025", "PRJNA1090509", "The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139", "GSE262169", "Transcriptome Analysis", "The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration  but many questions remain about its exact role.  Here we show that MyD88  a key component of the innate immune response  controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration.  We find in cryoinjured myd88 /  ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population.  Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 /  endocardium and increased myofibroblasts and scarring.  Notably  endothelial specific overexpression of myd88 reverses these neutrophil  fibrotic  and scarring phenotypes.  Mechanistically  we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway  and using loss  and gain of function tools show that it controls neutrophil recruitment.  Altogether  these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 /  untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing", "parent bioproject:PRJNA1090894", "pubmed:39271818", null, "injured tissue  myd88 /   1 hpci 1", "GSM8159061", null, "source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment:cardiac cryoinjury|geo loc name:missing|collection date:missing", "injured tissue  myd88 /   1 hpci 1", "Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al.  STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format  multi mapping  ribosomal  or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al.  Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5  multiple testing adjusted p value < 0.05  and  0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al.  featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts", "cardiac ventricles", "untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction", "RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set  Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture\u2019s protocol Vazyme.", null, "tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment:cardiac cryoinjury", "GSM8159061", "GSM8159061: injured tissue  myd88 /   1 hpci 1; Danio rerio; RNA Seq", "GSM8159061 r1", "GSM8159061", "1", "RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set  Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP497025", null, "loader:fastq load.py", "Pinelopi_Homo1_1h_pci_R1.fastq.gz", "fastq", 2585736865.0, 34790236.0, "GSM8159061 r1", "0:74.32", "A:679380332;C:554919862;G:604907160;T:746451941;N:77570", 74, null, null, null, 679380332, 554919862, 604907160, 746451941, 77570, "SRX24015859", "SRS20810988", "SRA1830778", "MPI for heart and lung research", "MPI for heart and lung research", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "Germany", "2024-03-21", "Undetermined", "Undetermined", "Heart", "Cardiovascular System"], [31513, "SRR28411473", "SRX24015858", "SRS20810987", "SRP497025", "PRJNA1090509", "The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst139", "GSE262169", "Transcriptome Analysis", "The innate immune response is triggered xxx post injury and its spatiotemporal dynamics are critical for regeneration  but many questions remain about its exact role.  Here we show that MyD88  a key component of the innate immune response  controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration.  We find in cryoinjured myd88 /  ventricles a significant reduction in neutrophil and macrophage numbers as well as the expansion of a collagen rich endocardial population.  Further analyses reveal compromised PI3K/AKT pathway activation in the myd88 /  endocardium and increased myofibroblasts and scarring.  Notably  endothelial specific overexpression of myd88 reverses these neutrophil  fibrotic  and scarring phenotypes.  Mechanistically  we identify the endocardial derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway  and using loss  and gain of function tools show that it controls neutrophil recruitment.  Altogether  these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration. Overall design: RNA was isolated from myd88+/+ and myd88 /  untouched ventricles and cryoinjured tissues at 1 and 24 hours post cryoinjury hpci and analyzed using bulk RNA sequencing", "parent bioproject:PRJNA1090894", "pubmed:39271818", null, "ventricle  myd88 /   untouched 1", "GSM8159060", null, "source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment: |geo loc name:missing|collection date:missing", "ventricle  myd88 /   untouched 1", "Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 99 with STAR 2.7.3a Dobin et al.  STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 2.21.7 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format  multi mapping  ribosomal  or mitochondrial reads. The raw count matrix was normalized with DESeq2 version 1.26.0 Love et al.  Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2. Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count > 5  multiple testing adjusted p value < 0.05  and  0.585 < log2FC > 0.585. Gene counts were established with featureCounts 1.6.5 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al.  featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The Ensemble annotation was enriched with UniProt data Activities at the Universal Protein Resource UniProt. Assembly: DanRer11 Supplementary files format and content: library normilzed counts", "cardiac ventricles", "untouched ventricles or cardiac cryoinjury at 1 or 24 hours prior to heart extraction", "RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set  Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture\u2019s protocol Vazyme.", null, "tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment: ", "GSM8159060", "GSM8159060: ventricle  myd88 /   untouched 1; Danio rerio; RNA Seq", "GSM8159060 r1", "GSM8159060", "1", "RNA was isolated from 3 pooled ventricles or 3 pooled injured tissues per sample using the miRNeasy micro Kit Qiagen combined with on column DNase digestion RNase free DNase set  Qiagen to avoid contamination by genomic DNA. 400ng of total RNA was used as input for VAHTS Stranded mRNA seq Library preparation V6 following manufacture's protocol Vazyme.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 2000", null, "SRP497025", null, "loader:fastq load.py", "Pinelopi_Homo1_0h_pci_R1.fastq.gz", "fastq", 2321007700.0, 31228476.0, "GSM8159060 r1", "0:74.32", "A:623574024;C:490503071;G:538918126;T:667825381;N:187098", 74, null, null, null, 623574024, 490503071, 538918126, 667825381, 187098, "SRX24015858", "SRS20810987", "SRA1830778", "MPI for heart and lung research", "MPI for heart and lung research", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "nextseq_v2", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "Germany", "2024-03-21", "Undetermined", "Undetermined", "Heart", "Cardiovascular System"], [36641, "SRR700539", "SRX233125", "SRS393099", "SRP018538", "PRJNA189226", "Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos", "GSE44233", "Transcriptome Analysis", "The Gata4 transcription factor is essential for normal heart development  but the molecular basis for its function remain poorly understood.  We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos.  Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited.  Three replicate control samples and three replicate Gata4 morphant samples were analyzed.", null, "pubmed:23850773", null, "Seq15", "GSM1081113", null, "tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant", "Seq15", "Basecalls  demultiplexing  and filtering of reads was  performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb  version: development 20110921150240 with the following parameters: Ambiguity threshold = 1  Max Number Gap Opens = 1  Max Number Gap Extensions =  1. Differential expression was generated with the DESEQ package with native goby support using gobyweb  version: development 20110921150240 with the following parameters: q value threshold = 1.0  weight adjustment = none  Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1  a log2 fold change > 1 for WT/G4  and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb  version: development20110921150240.  Additional supplementary .xlsx file containing RPKM  counts  and statistical values was exported from gobyweb and processed in excel.", "sorted cardiomyocytes", "Embryos were injected with morpholino before the 4 cell stage of development.  2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo.  At 24 hpf  batches of approximately 200 embryos were pooled into 1.5 ml tube.  Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube  trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS  0.8mM CaCl2  50U/ml penicillin  and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies  and stored at  80C until RNA isolation.", "RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase  the solution was transferred to an RNeasy minElute column Qiagen.  On column DNase digestion  subsequent washing  and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries.  Libraries were prepared for RNA sequencing using the mRNA Seq seq1  seq5  and seq11 or TruSeq Kit seq13  seq14  and seq15 according to the Illumina's recommended protocol.", "Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes.  25 ml of E3 buffer was used per 50 60 embryos in each dish.", "developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant", "GSM1081113", "GSM1081113: Seq15; Danio rerio; RNA Seq", "GSM1081113 1", null, "1", null, "GEO Accession:GSM1081113", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP018538", null, null, null, null, 1505008521.0, 29509971.0, "GSM1081113 r1", "0:51", "A:394410844;C:370013758;G:356489603;T:384055071;N:39245", 51, null, null, null, 394410844, 370013758, 356489603, 384055071, 39245, "SRX233125", "SRS393099", "SRA066447", "GEO", "Todd Evans Lab, Cell and Developmental Biology, Weill Cornell", 1, 0.9123, null, 0.07373, null, 0.71346, null, 0.47555, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2013-02-11", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [36642, "SRR700538", "SRX233124", "SRS393098", "SRP018538", "PRJNA189226", "Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos", "GSE44233", "Transcriptome Analysis", "The Gata4 transcription factor is essential for normal heart development  but the molecular basis for its function remain poorly understood.  We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos.  Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited.  Three replicate control samples and three replicate Gata4 morphant samples were analyzed.", null, "pubmed:23850773", null, "Seq14", "GSM1081112", null, "tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant", "Seq14", "Basecalls  demultiplexing  and filtering of reads was  performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb  version: development 20110921150240 with the following parameters: Ambiguity threshold = 1  Max Number Gap Opens = 1  Max Number Gap Extensions =  1. Differential expression was generated with the DESEQ package with native goby support using gobyweb  version: development 20110921150240 with the following parameters: q value threshold = 1.0  weight adjustment = none  Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1  a log2 fold change > 1 for WT/G4  and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb  version: development20110921150240.  Additional supplementary .xlsx file containing RPKM  counts  and statistical values was exported from gobyweb and processed in excel.", "sorted cardiomyocytes", "Embryos were injected with morpholino before the 4 cell stage of development.  2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo.  At 24 hpf  batches of approximately 200 embryos were pooled into 1.5 ml tube.  Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube  trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS  0.8mM CaCl2  50U/ml penicillin  and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies  and stored at  80C until RNA isolation.", "RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase  the solution was transferred to an RNeasy minElute column Qiagen.  On column DNase digestion  subsequent washing  and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries.  Libraries were prepared for RNA sequencing using the mRNA Seq seq1  seq5  and seq11 or TruSeq Kit seq13  seq14  and seq15 according to the Illumina's recommended protocol.", "Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes.  25 ml of E3 buffer was used per 50 60 embryos in each dish.", "developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant", "GSM1081112", "GSM1081112: Seq14; Danio rerio; RNA Seq", "GSM1081112 1", null, "1", null, "GEO Accession:GSM1081112", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP018538", null, null, "seq14.txt.gz", "fastq", 3144425502.0, 61655402.0, "GSM1081112 r1", "0:51", "A:825172912;C:756354008;G:742919584;T:819897573;N:81425", 51, null, null, null, 825172912, 756354008, 742919584, 819897573, 81425, "SRX233124", "SRS393098", "SRA066447", "GEO", "Todd Evans Lab, Cell and Developmental Biology, Weill Cornell", 1, 0.93659, null, 0.0806, null, 0.73716, null, 0.47614, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2013-02-11", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [36643, "SRR700537", "SRX233123", "SRS393097", "SRP018538", "PRJNA189226", "Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos", "GSE44233", "Transcriptome Analysis", "The Gata4 transcription factor is essential for normal heart development  but the molecular basis for its function remain poorly understood.  We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos.  Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited.  Three replicate control samples and three replicate Gata4 morphant samples were analyzed.", null, "pubmed:23850773", null, "Seq11", "GSM1081111", null, "tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant", "Seq11", "Basecalls  demultiplexing  and filtering of reads was  performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb  version: development 20110921150240 with the following parameters: Ambiguity threshold = 1  Max Number Gap Opens = 1  Max Number Gap Extensions =  1. Differential expression was generated with the DESEQ package with native goby support using gobyweb  version: development 20110921150240 with the following parameters: q value threshold = 1.0  weight adjustment = none  Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1  a log2 fold change > 1 for WT/G4  and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb  version: development20110921150240.  Additional supplementary .xlsx file containing RPKM  counts  and statistical values was exported from gobyweb and processed in excel.", "sorted cardiomyocytes", "Embryos were injected with morpholino before the 4 cell stage of development.  2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo.  At 24 hpf  batches of approximately 200 embryos were pooled into 1.5 ml tube.  Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube  trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS  0.8mM CaCl2  50U/ml penicillin  and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies  and stored at  80C until RNA isolation.", "RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase  the solution was transferred to an RNeasy minElute column Qiagen.  On column DNase digestion  subsequent washing  and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries.  Libraries were prepared for RNA sequencing using the mRNA Seq seq1  seq5  and seq11 or TruSeq Kit seq13  seq14  and seq15 according to the Illumina's recommended protocol.", "Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes.  25 ml of E3 buffer was used per 50 60 embryos in each dish.", "developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant", "GSM1081111", "GSM1081111: Seq11; Danio rerio; RNA Seq", "GSM1081111 1", null, "1", null, "GEO Accession:GSM1081111", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer II", null, "SRP018538", null, null, null, null, 1364181264.0, 37893924.0, "GSM1081111 r1", "0:36", "A:362442341;C:297159061;G:406723961;T:297355968;N:499933", 36, null, null, null, 362442341, 297159061, 406723961, 297355968, 499933, "SRX233123", "SRS393097", "SRA066447", "GEO", "Todd Evans Lab, Cell and Developmental Biology, Weill Cornell", 1, 0.67174, null, 0.07612, null, 0.74416, null, 0.48016, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "full_length", "random_priming", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2013-02-11", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [36644, "SRR700536", "SRX233122", "SRS393096", "SRP018538", "PRJNA189226", "Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos", "GSE44233", "Transcriptome Analysis", "The Gata4 transcription factor is essential for normal heart development  but the molecular basis for its function remain poorly understood.  We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos.  Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited.  Three replicate control samples and three replicate Gata4 morphant samples were analyzed.", null, "pubmed:23850773", null, "Seq13", "GSM1081110", null, "tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype", "Seq13", "Basecalls  demultiplexing  and filtering of reads was  performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb  version: development 20110921150240 with the following parameters: Ambiguity threshold = 1  Max Number Gap Opens = 1  Max Number Gap Extensions =  1. Differential expression was generated with the DESEQ package with native goby support using gobyweb  version: development 20110921150240 with the following parameters: q value threshold = 1.0  weight adjustment = none  Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1  a log2 fold change > 1 for WT/G4  and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb  version: development20110921150240.  Additional supplementary .xlsx file containing RPKM  counts  and statistical values was exported from gobyweb and processed in excel.", "sorted cardiomyocytes", "Embryos were injected with morpholino before the 4 cell stage of development.  2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo.  At 24 hpf  batches of approximately 200 embryos were pooled into 1.5 ml tube.  Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube  trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS  0.8mM CaCl2  50U/ml penicillin  and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies  and stored at  80C until RNA isolation.", "RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase  the solution was transferred to an RNeasy minElute column Qiagen.  On column DNase digestion  subsequent washing  and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries.  Libraries were prepared for RNA sequencing using the mRNA Seq seq1  seq5  and seq11 or TruSeq Kit seq13  seq14  and seq15 according to the Illumina's recommended protocol.", "Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes.  25 ml of E3 buffer was used per 50 60 embryos in each dish.", "developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype", "GSM1081110", "GSM1081110: Seq13; Danio rerio; RNA Seq", "GSM1081110 1", null, "1", null, "GEO Accession:GSM1081110", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP018538", null, null, "seq13.txt.gz", "fastq", 1693675269.0, 33209319.0, "GSM1081110 r1", "0:51", "A:443719209;C:411369010;G:404182982;T:434361031;N:43037", 51, null, null, null, 443719209, 411369010, 404182982, 434361031, 43037, "SRX233122", "SRS393096", "SRA066447", "GEO", "Todd Evans Lab, Cell and Developmental Biology, Weill Cornell", 1, 0.91781, null, 0.08107, null, 0.74976, null, 0.46528, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2013-02-11", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [36645, "SRR700535", "SRX233121", "SRS393095", "SRP018538", "PRJNA189226", "Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos", "GSE44233", "Transcriptome Analysis", "The Gata4 transcription factor is essential for normal heart development  but the molecular basis for its function remain poorly understood.  We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos.  Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited.  Three replicate control samples and three replicate Gata4 morphant samples were analyzed.", null, "pubmed:23850773", null, "Seq5", "GSM1081109", null, "tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype", "Seq5", "Basecalls  demultiplexing  and filtering of reads was  performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb  version: development 20110921150240 with the following parameters: Ambiguity threshold = 1  Max Number Gap Opens = 1  Max Number Gap Extensions =  1. Differential expression was generated with the DESEQ package with native goby support using gobyweb  version: development 20110921150240 with the following parameters: q value threshold = 1.0  weight adjustment = none  Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1  a log2 fold change > 1 for WT/G4  and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb  version: development20110921150240.  Additional supplementary .xlsx file containing RPKM  counts  and statistical values was exported from gobyweb and processed in excel.", "sorted cardiomyocytes", "Embryos were injected with morpholino before the 4 cell stage of development.  2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo.  At 24 hpf  batches of approximately 200 embryos were pooled into 1.5 ml tube.  Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube  trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS  0.8mM CaCl2  50U/ml penicillin  and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies  and stored at  80C until RNA isolation.", "RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase  the solution was transferred to an RNeasy minElute column Qiagen.  On column DNase digestion  subsequent washing  and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries.  Libraries were prepared for RNA sequencing using the mRNA Seq seq1  seq5  and seq11 or TruSeq Kit seq13  seq14  and seq15 according to the Illumina's recommended protocol.", "Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes.  25 ml of E3 buffer was used per 50 60 embryos in each dish.", "developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype", "GSM1081109", "GSM1081109: Seq5; Danio rerio; RNA Seq", "GSM1081109 1", null, "1", null, "GEO Accession:GSM1081109", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer II", null, "SRP018538", null, null, "seq5.txt.gz", "fastq", 1245644280.0, 34601230.0, "GSM1081109 r1", "0:36", "A:334131135;C:287707996;G:288492153;T:334895459;N:417537", 36, null, null, null, 334131135, 287707996, 288492153, 334895459, 417537, "SRX233121", "SRS393095", "SRA066447", "GEO", "Todd Evans Lab, Cell and Developmental Biology, Weill Cornell", 1, 0.89495, null, 0.1058, null, 0.74247, null, 0.46422, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "full_length", "random_priming", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2013-02-11", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [36646, "SRR700534", "SRX233120", "SRS393094", "SRP018538", "PRJNA189226", "Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos", "GSE44233", "Transcriptome Analysis", "The Gata4 transcription factor is essential for normal heart development  but the molecular basis for its function remain poorly understood.  We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos.  Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited.  Three replicate control samples and three replicate Gata4 morphant samples were analyzed.", null, "pubmed:23850773", null, "Seq1", "GSM1081108", null, "tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype", "Seq1", "Basecalls  demultiplexing  and filtering of reads was  performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb  version: development 20110921150240 with the following parameters: Ambiguity threshold = 1  Max Number Gap Opens = 1  Max Number Gap Extensions =  1. Differential expression was generated with the DESEQ package with native goby support using gobyweb  version: development 20110921150240 with the following parameters: q value threshold = 1.0  weight adjustment = none  Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1  a log2 fold change > 1 for WT/G4  and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb  version: development20110921150240.  Additional supplementary .xlsx file containing RPKM  counts  and statistical values was exported from gobyweb and processed in excel.", "sorted cardiomyocytes", "Embryos were injected with morpholino before the 4 cell stage of development.  2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo.  At 24 hpf  batches of approximately 200 embryos were pooled into 1.5 ml tube.  Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube  trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS  0.8mM CaCl2  50U/ml penicillin  and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies  and stored at  80C until RNA isolation.", "RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase  the solution was transferred to an RNeasy minElute column Qiagen.  On column DNase digestion  subsequent washing  and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries.  Libraries were prepared for RNA sequencing using the mRNA Seq seq1  seq5  and seq11 or TruSeq Kit seq13  seq14  and seq15 according to the Illumina's recommended protocol.", "Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes.  25 ml of E3 buffer was used per 50 60 embryos in each dish.", "developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype", "GSM1081108", "GSM1081108: Seq1; Danio rerio; RNA Seq", "GSM1081108 1", null, "1", null, "GEO Accession:GSM1081108", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer II", null, "SRP018538", null, null, "seq1.txt.gz", "fastq", 929284704.0, 25813464.0, "GSM1081108 r1", "0:36", "A:244730361;C:220466820;G:213037296;T:250386569;N:663658", 36, null, null, null, 244730361, 220466820, 213037296, 250386569, 663658, "SRX233120", "SRS393094", "SRA066447", "GEO", "Todd Evans Lab, Cell and Developmental Biology, Weill Cornell", 1, 0.87436, null, 0.11629, null, 0.73302, null, 0.46999, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "full_length", "random_priming", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2013-02-11", "Pharyngula", "Embryo", "Heart", "Cardiovascular System"], [37134, "SRR997335", "SRX355601", "SRS483796", "SRP030036", "PRJNA219641", "Comparative transcriptome profiling of the injured zebrafish and mouse hearts identifies miRNA dependent repair pathways", "GSE51018", "Transcriptome Analysis", "The mammalian heart has poor regenerative capacity following injury. In contrast  certain lower vertebrates such as zebrafish retain a robust capacity for regeneration into adult life. Here we use an integrated approach to identify evolutionary conserved regenerative miRNA dependant regulatory circuits in the heart. We identified novel miRNA dependant networks involved in critical biological pathways  which are differentially utilized between the infarcted mouse heart and the regenerating zebrafish heart. Overall design: 2 conditions  4 biological replicates per condition", "parent bioproject:PRJNA219631", "pubmed:26857418", null, "Heart  Control  rep4", "GSM1234963", null, "source name:Heart  Control|tissue:heart", "Heart  Control  rep4", "Base calling was with Illumina GAP Pipeline Software v1.70 Sequence reads were processed to remove the adaptor sequences and reformatted to FASTA files using the FASTX Toolkit Sequences were aligned to mouse mature microRNA sequences from miRBase Version 17 and non coding RNA sequences Rfam Version 10 using MEGABLAST with a word size of 8 nucleotides. The criteria for counting a sequence match were if the % query was >=90% of the target sequence and if there were <= 2 mismatches over the alignment. The % query was calculated as a/q x p where a= alignment length  q= query length and p= percent identity over aligned region. The matches against miRBase were parsed and the top matches based on % query were selected. If a sequence had more than one top match against different database sequences  it was excluded from the subsequent analysis. Matches to Rfam were only taken into account for sequences not matching miRBase. Genome build: miRBase17 Supplementary files format and content: Raw count data for microRNAs were normalized to the relative size of each library using R/Bioconductor package DESeq  estimateSizeFactors function. Count data are provided in tab delimited format", "Heart  Control", null, "Total RNA was isolated using Trizol Invitrogen. RNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 BioanalyzerRNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 Bioanalyzer. Libraries of small RNAs for sequencing were prepared using the DGE Small RNA Sample Kit  Alternative v1.5 Protocol Illumina; San Diego  California according to the protocol supplied with the reagents Protocol Rev. A  published February 2009 and using 1ug of total RNA. One lane of each library was sequenced on the Genome Analyzer IIx Illumina using the 36 Cycle Sequencing Kit v5 and v4 flowcell and cluster reagents Catalog FC 104 5020 and GD 300 1001", null, "tissue:heart", "GSM1234963", "GSM1234963: Heart  Control  rep4; Danio rerio; RNA Seq", "GSM1234963", null, "1", "Total RNA was isolated using Trizol Invitrogen. RNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 BioanalyzerRNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 Bioanalyzer. Libraries of small RNAs for sequencing were prepared using the DGE Small RNA Sample Kit  Alternative v1.5 Protocol Illumina; San Diego  California according to the protocol supplied with the reagents Protocol Rev. A  published February 2009 and using 1ug of total RNA. One lane of each library was sequenced on the Genome Analyzer IIx Illumina using the 36 Cycle Sequencing Kit v5 and v4 flowcell and cluster reagents Catalog FC 104 5020 and GD 300 1001", "GEO Accession:GSM1234963", "RNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer II", null, "SRP030036", null, null, "C3PO_0053_s_7_sequence.txt.gz", "fastq", 1111882122.0, 28509798.0, "GSM1234963 r1", "0:39", "A:239964076;C:229590501;G:337557042;T:303257677;N:1512826", 39, null, null, null, 239964076, 229590501, 337557042, 303257677, 1512826, "SRX355601", "SRS483796", "SRA101779", "GEO", "Vital-IT, SIB Swiss Institute of Bioinformatics", 1, 0.11195, null, 0.03776, null, 0.98871, null, 0.16576, null, 39, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "bulk", "bulk", null, "Switzerland", "2013-09-19", "Undetermined", "Undetermined", "Heart", "Cardiovascular System"], [37135, "SRR997334", "SRX355600", "SRS483795", "SRP030036", "PRJNA219641", "Comparative transcriptome profiling of the injured zebrafish and mouse hearts identifies miRNA dependent repair pathways", "GSE51018", "Transcriptome Analysis", "The mammalian heart has poor regenerative capacity following injury. In contrast  certain lower vertebrates such as zebrafish retain a robust capacity for regeneration into adult life. Here we use an integrated approach to identify evolutionary conserved regenerative miRNA dependant regulatory circuits in the heart. We identified novel miRNA dependant networks involved in critical biological pathways  which are differentially utilized between the infarcted mouse heart and the regenerating zebrafish heart. Overall design: 2 conditions  4 biological replicates per condition", "parent bioproject:PRJNA219631", "pubmed:26857418", null, "Heart  Control  rep3", "GSM1234962", null, "source name:Heart  Control|tissue:heart", "Heart  Control  rep3", "Base calling was with Illumina GAP Pipeline Software v1.70 Sequence reads were processed to remove the adaptor sequences and reformatted to FASTA files using the FASTX Toolkit Sequences were aligned to mouse mature microRNA sequences from miRBase Version 17 and non coding RNA sequences Rfam Version 10 using MEGABLAST with a word size of 8 nucleotides. The criteria for counting a sequence match were if the % query was >=90% of the target sequence and if there were <= 2 mismatches over the alignment. The % query was calculated as a/q x p where a= alignment length  q= query length and p= percent identity over aligned region. The matches against miRBase were parsed and the top matches based on % query were selected. If a sequence had more than one top match against different database sequences  it was excluded from the subsequent analysis. Matches to Rfam were only taken into account for sequences not matching miRBase. Genome build: miRBase17 Supplementary files format and content: Raw count data for microRNAs were normalized to the relative size of each library using R/Bioconductor package DESeq  estimateSizeFactors function. Count data are provided in tab delimited format", "Heart  Control", null, "Total RNA was isolated using Trizol Invitrogen. RNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 BioanalyzerRNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 Bioanalyzer. Libraries of small RNAs for sequencing were prepared using the DGE Small RNA Sample Kit  Alternative v1.5 Protocol Illumina; San Diego  California according to the protocol supplied with the reagents Protocol Rev. A  published February 2009 and using 1ug of total RNA. One lane of each library was sequenced on the Genome Analyzer IIx Illumina using the 36 Cycle Sequencing Kit v5 and v4 flowcell and cluster reagents Catalog FC 104 5020 and GD 300 1001", null, "tissue:heart", "GSM1234962", "GSM1234962: Heart  Control  rep3; Danio rerio; RNA Seq", "GSM1234962", null, "1", "Total RNA was isolated using Trizol Invitrogen. RNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 BioanalyzerRNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 Bioanalyzer. Libraries of small RNAs for sequencing were prepared using the DGE Small RNA Sample Kit  Alternative v1.5 Protocol Illumina; San Diego  California according to the protocol supplied with the reagents Protocol Rev. A  published February 2009 and using 1ug of total RNA. One lane of each library was sequenced on the Genome Analyzer IIx Illumina using the 36 Cycle Sequencing Kit v5 and v4 flowcell and cluster reagents Catalog FC 104 5020 and GD 300 1001", "GEO Accession:GSM1234962", "RNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer II", null, "SRP030036", null, null, "C3PO_0053_s_6_sequence.txt.gz", "fastq", 1221305046.0, 31315514.0, "GSM1234962 r1", "0:39", "A:263520584;C:251263128;G:372262308;T:332218529;N:2040497", 39, null, null, null, 263520584, 251263128, 372262308, 332218529, 2040497, "SRX355600", "SRS483795", "SRA101779", "GEO", "Vital-IT, SIB Swiss Institute of Bioinformatics", 1, 0.11552, null, 0.03865, null, 0.98679, null, 0.1927, null, 39, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "bulk", "bulk", null, "Switzerland", "2013-09-19", "Undetermined", "Undetermined", "Heart", "Cardiovascular System"], [37136, "SRR997333", "SRX355599", "SRS483794", "SRP030036", "PRJNA219641", "Comparative transcriptome profiling of the injured zebrafish and mouse hearts identifies miRNA dependent repair pathways", "GSE51018", "Transcriptome Analysis", "The mammalian heart has poor regenerative capacity following injury. In contrast  certain lower vertebrates such as zebrafish retain a robust capacity for regeneration into adult life. Here we use an integrated approach to identify evolutionary conserved regenerative miRNA dependant regulatory circuits in the heart. We identified novel miRNA dependant networks involved in critical biological pathways  which are differentially utilized between the infarcted mouse heart and the regenerating zebrafish heart. Overall design: 2 conditions  4 biological replicates per condition", "parent bioproject:PRJNA219631", "pubmed:26857418", null, "Heart  Control  rep2", "GSM1234961", null, "source name:Heart  Control|tissue:heart", "Heart  Control  rep2", "Base calling was with Illumina GAP Pipeline Software v1.70 Sequence reads were processed to remove the adaptor sequences and reformatted to FASTA files using the FASTX Toolkit Sequences were aligned to mouse mature microRNA sequences from miRBase Version 17 and non coding RNA sequences Rfam Version 10 using MEGABLAST with a word size of 8 nucleotides. The criteria for counting a sequence match were if the % query was >=90% of the target sequence and if there were <= 2 mismatches over the alignment. The % query was calculated as a/q x p where a= alignment length  q= query length and p= percent identity over aligned region. The matches against miRBase were parsed and the top matches based on % query were selected. If a sequence had more than one top match against different database sequences  it was excluded from the subsequent analysis. Matches to Rfam were only taken into account for sequences not matching miRBase. Genome build: miRBase17 Supplementary files format and content: Raw count data for microRNAs were normalized to the relative size of each library using R/Bioconductor package DESeq  estimateSizeFactors function. Count data are provided in tab delimited format", "Heart  Control", null, "Total RNA was isolated using Trizol Invitrogen. RNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 BioanalyzerRNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 Bioanalyzer. Libraries of small RNAs for sequencing were prepared using the DGE Small RNA Sample Kit  Alternative v1.5 Protocol Illumina; San Diego  California according to the protocol supplied with the reagents Protocol Rev. A  published February 2009 and using 1ug of total RNA. One lane of each library was sequenced on the Genome Analyzer IIx Illumina using the 36 Cycle Sequencing Kit v5 and v4 flowcell and cluster reagents Catalog FC 104 5020 and GD 300 1001", null, "tissue:heart", "GSM1234961", "GSM1234961: Heart  Control  rep2; Danio rerio; RNA Seq", "GSM1234961", null, "1", "Total RNA was isolated using Trizol Invitrogen. RNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 BioanalyzerRNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 Bioanalyzer. Libraries of small RNAs for sequencing were prepared using the DGE Small RNA Sample Kit  Alternative v1.5 Protocol Illumina; San Diego  California according to the protocol supplied with the reagents Protocol Rev. A  published February 2009 and using 1ug of total RNA. One lane of each library was sequenced on the Genome Analyzer IIx Illumina using the 36 Cycle Sequencing Kit v5 and v4 flowcell and cluster reagents Catalog FC 104 5020 and GD 300 1001", "GEO Accession:GSM1234961", "RNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer II", null, "SRP030036", null, null, "R2D2_0122_s_7_sequence.txt.gz", "fastq", 1462542939.0, 37501101.0, "GSM1234961 r1", "0:39", "A:313173840;C:298865755;G:440814004;T:409066990;N:622350", 39, null, null, null, 313173840, 298865755, 440814004, 409066990, 622350, "SRX355599", "SRS483794", "SRA101779", "GEO", "Vital-IT, SIB Swiss Institute of Bioinformatics", 1, 0.01745, null, 0.00554, null, 0.99101, null, 0.42928, null, 39, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "bulk", "bulk", null, "Switzerland", "2013-09-19", "Undetermined", "Undetermined", "Heart", "Cardiovascular System"], [37137, "SRR997332", "SRX355598", "SRS483793", "SRP030036", "PRJNA219641", "Comparative transcriptome profiling of the injured zebrafish and mouse hearts identifies miRNA dependent repair pathways", "GSE51018", "Transcriptome Analysis", "The mammalian heart has poor regenerative capacity following injury. In contrast  certain lower vertebrates such as zebrafish retain a robust capacity for regeneration into adult life. Here we use an integrated approach to identify evolutionary conserved regenerative miRNA dependant regulatory circuits in the heart. We identified novel miRNA dependant networks involved in critical biological pathways  which are differentially utilized between the infarcted mouse heart and the regenerating zebrafish heart. Overall design: 2 conditions  4 biological replicates per condition", "parent bioproject:PRJNA219631", "pubmed:26857418", null, "Heart  Control  rep1", "GSM1234960", null, "source name:Heart  Control|tissue:heart", "Heart  Control  rep1", "Base calling was with Illumina GAP Pipeline Software v1.70 Sequence reads were processed to remove the adaptor sequences and reformatted to FASTA files using the FASTX Toolkit Sequences were aligned to mouse mature microRNA sequences from miRBase Version 17 and non coding RNA sequences Rfam Version 10 using MEGABLAST with a word size of 8 nucleotides. The criteria for counting a sequence match were if the % query was >=90% of the target sequence and if there were <= 2 mismatches over the alignment. The % query was calculated as a/q x p where a= alignment length  q= query length and p= percent identity over aligned region. The matches against miRBase were parsed and the top matches based on % query were selected. If a sequence had more than one top match against different database sequences  it was excluded from the subsequent analysis. Matches to Rfam were only taken into account for sequences not matching miRBase. Genome build: miRBase17 Supplementary files format and content: Raw count data for microRNAs were normalized to the relative size of each library using R/Bioconductor package DESeq  estimateSizeFactors function. Count data are provided in tab delimited format", "Heart  Control", null, "Total RNA was isolated using Trizol Invitrogen. RNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 BioanalyzerRNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 Bioanalyzer. Libraries of small RNAs for sequencing were prepared using the DGE Small RNA Sample Kit  Alternative v1.5 Protocol Illumina; San Diego  California according to the protocol supplied with the reagents Protocol Rev. A  published February 2009 and using 1ug of total RNA. One lane of each library was sequenced on the Genome Analyzer IIx Illumina using the 36 Cycle Sequencing Kit v5 and v4 flowcell and cluster reagents Catalog FC 104 5020 and GD 300 1001", null, "tissue:heart", "GSM1234960", "GSM1234960: Heart  Control  rep1; Danio rerio; RNA Seq", "GSM1234960", null, "1", "Total RNA was isolated using Trizol Invitrogen. RNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 BioanalyzerRNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 Bioanalyzer. Libraries of small RNAs for sequencing were prepared using the DGE Small RNA Sample Kit  Alternative v1.5 Protocol Illumina; San Diego  California according to the protocol supplied with the reagents Protocol Rev. A  published February 2009 and using 1ug of total RNA. One lane of each library was sequenced on the Genome Analyzer IIx Illumina using the 36 Cycle Sequencing Kit v5 and v4 flowcell and cluster reagents Catalog FC 104 5020 and GD 300 1001", "GEO Accession:GSM1234960", "RNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer II", null, "SRP030036", null, null, "R2D2_0122_s_6_sequence.txt.gz", "fastq", 1447346355.0, 37111445.0, "GSM1234960 r1", "0:39", "A:311132663;C:297266985;G:441400778;T:396960907;N:585022", 39, null, null, null, 311132663, 297266985, 441400778, 396960907, 585022, "SRX355598", "SRS483793", "SRA101779", "GEO", "Vital-IT, SIB Swiss Institute of Bioinformatics", 1, 0.06118, null, 0.01997, null, 0.98752, null, 0.43741, null, 39, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "bulk", "bulk", null, "Switzerland", "2013-09-19", "Undetermined", "Undetermined", "Heart", "Cardiovascular System"], [37138, "SRR997331", "SRX355597", "SRS483792", "SRP030036", "PRJNA219641", "Comparative transcriptome profiling of the injured zebrafish and mouse hearts identifies miRNA dependent repair pathways", "GSE51018", "Transcriptome Analysis", "The mammalian heart has poor regenerative capacity following injury. In contrast  certain lower vertebrates such as zebrafish retain a robust capacity for regeneration into adult life. Here we use an integrated approach to identify evolutionary conserved regenerative miRNA dependant regulatory circuits in the heart. We identified novel miRNA dependant networks involved in critical biological pathways  which are differentially utilized between the infarcted mouse heart and the regenerating zebrafish heart. Overall design: 2 conditions  4 biological replicates per condition", "parent bioproject:PRJNA219631", "pubmed:26857418", null, "Heart  Resected  rep4", "GSM1234959", null, "source name:Heart  Resected|tissue:heart", "Heart  Resected  rep4", "Base calling was with Illumina GAP Pipeline Software v1.70 Sequence reads were processed to remove the adaptor sequences and reformatted to FASTA files using the FASTX Toolkit Sequences were aligned to mouse mature microRNA sequences from miRBase Version 17 and non coding RNA sequences Rfam Version 10 using MEGABLAST with a word size of 8 nucleotides. The criteria for counting a sequence match were if the % query was >=90% of the target sequence and if there were <= 2 mismatches over the alignment. The % query was calculated as a/q x p where a= alignment length  q= query length and p= percent identity over aligned region. The matches against miRBase were parsed and the top matches based on % query were selected. If a sequence had more than one top match against different database sequences  it was excluded from the subsequent analysis. Matches to Rfam were only taken into account for sequences not matching miRBase. Genome build: miRBase17 Supplementary files format and content: Raw count data for microRNAs were normalized to the relative size of each library using R/Bioconductor package DESeq  estimateSizeFactors function. Count data are provided in tab delimited format", "Heart  Resected", null, "Total RNA was isolated using Trizol Invitrogen. RNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 BioanalyzerRNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 Bioanalyzer. Libraries of small RNAs for sequencing were prepared using the DGE Small RNA Sample Kit  Alternative v1.5 Protocol Illumina; San Diego  California according to the protocol supplied with the reagents Protocol Rev. A  published February 2009 and using 1ug of total RNA. One lane of each library was sequenced on the Genome Analyzer IIx Illumina using the 36 Cycle Sequencing Kit v5 and v4 flowcell and cluster reagents Catalog FC 104 5020 and GD 300 1001", null, "tissue:heart", "GSM1234959", "GSM1234959: Heart  Resected  rep4; Danio rerio; RNA Seq", "GSM1234959", null, "1", "Total RNA was isolated using Trizol Invitrogen. RNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 BioanalyzerRNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 Bioanalyzer. Libraries of small RNAs for sequencing were prepared using the DGE Small RNA Sample Kit  Alternative v1.5 Protocol Illumina; San Diego  California according to the protocol supplied with the reagents Protocol Rev. A  published February 2009 and using 1ug of total RNA. One lane of each library was sequenced on the Genome Analyzer IIx Illumina using the 36 Cycle Sequencing Kit v5 and v4 flowcell and cluster reagents Catalog FC 104 5020 and GD 300 1001", "GEO Accession:GSM1234959", "RNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer II", null, "SRP030036", null, null, "C3PO_0053_s_5_sequence.txt.gz", "fastq", 703519557.0, 18038963.0, "GSM1234959 r1", "0:39", "A:142685665;C:144259439;G:215526965;T:199924689;N:1122799", 39, null, null, null, 142685665, 144259439, 215526965, 199924689, 1122799, "SRX355597", "SRS483792", "SRA101779", "GEO", "Vital-IT, SIB Swiss Institute of Bioinformatics", 1, 0.00172, null, 0.00045, null, 0.99738, null, 0.34873, null, 39, null, "T", null, "under 1.2% mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "bulk", "bulk", null, "Switzerland", "2013-09-19", "Undetermined", "Undetermined", "Heart", "Cardiovascular System"], [37139, "SRR997330", "SRX355596", "SRS483791", "SRP030036", "PRJNA219641", "Comparative transcriptome profiling of the injured zebrafish and mouse hearts identifies miRNA dependent repair pathways", "GSE51018", "Transcriptome Analysis", "The mammalian heart has poor regenerative capacity following injury. In contrast  certain lower vertebrates such as zebrafish retain a robust capacity for regeneration into adult life. Here we use an integrated approach to identify evolutionary conserved regenerative miRNA dependant regulatory circuits in the heart. We identified novel miRNA dependant networks involved in critical biological pathways  which are differentially utilized between the infarcted mouse heart and the regenerating zebrafish heart. Overall design: 2 conditions  4 biological replicates per condition", "parent bioproject:PRJNA219631", "pubmed:26857418", null, "Heart  Resected  rep3", "GSM1234958", null, "source name:Heart  Resected|tissue:heart", "Heart  Resected  rep3", "Base calling was with Illumina GAP Pipeline Software v1.70 Sequence reads were processed to remove the adaptor sequences and reformatted to FASTA files using the FASTX Toolkit Sequences were aligned to mouse mature microRNA sequences from miRBase Version 17 and non coding RNA sequences Rfam Version 10 using MEGABLAST with a word size of 8 nucleotides. The criteria for counting a sequence match were if the % query was >=90% of the target sequence and if there were <= 2 mismatches over the alignment. The % query was calculated as a/q x p where a= alignment length  q= query length and p= percent identity over aligned region. The matches against miRBase were parsed and the top matches based on % query were selected. If a sequence had more than one top match against different database sequences  it was excluded from the subsequent analysis. Matches to Rfam were only taken into account for sequences not matching miRBase. Genome build: miRBase17 Supplementary files format and content: Raw count data for microRNAs were normalized to the relative size of each library using R/Bioconductor package DESeq  estimateSizeFactors function. Count data are provided in tab delimited format", "Heart  Resected", null, "Total RNA was isolated using Trizol Invitrogen. RNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 BioanalyzerRNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 Bioanalyzer. Libraries of small RNAs for sequencing were prepared using the DGE Small RNA Sample Kit  Alternative v1.5 Protocol Illumina; San Diego  California according to the protocol supplied with the reagents Protocol Rev. A  published February 2009 and using 1ug of total RNA. One lane of each library was sequenced on the Genome Analyzer IIx Illumina using the 36 Cycle Sequencing Kit v5 and v4 flowcell and cluster reagents Catalog FC 104 5020 and GD 300 1001", null, "tissue:heart", "GSM1234958", "GSM1234958: Heart  Resected  rep3; Danio rerio; RNA Seq", "GSM1234958", null, "1", "Total RNA was isolated using Trizol Invitrogen. RNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 BioanalyzerRNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 Bioanalyzer. Libraries of small RNAs for sequencing were prepared using the DGE Small RNA Sample Kit  Alternative v1.5 Protocol Illumina; San Diego  California according to the protocol supplied with the reagents Protocol Rev. A  published February 2009 and using 1ug of total RNA. One lane of each library was sequenced on the Genome Analyzer IIx Illumina using the 36 Cycle Sequencing Kit v5 and v4 flowcell and cluster reagents Catalog FC 104 5020 and GD 300 1001", "GEO Accession:GSM1234958", "RNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer II", null, "SRP030036", null, null, "C3PO_0053_s_4_sequence.txt.gz", "fastq", 918978177.0, 23563543.0, "GSM1234958 r1", "0:39", "A:188056254;C:191217660;G:283318445;T:255042736;N:1343082", 39, null, null, null, 188056254, 191217660, 283318445, 255042736, 1343082, "SRX355596", "SRS483791", "SRA101779", "GEO", "Vital-IT, SIB Swiss Institute of Bioinformatics", 1, 0.09453, null, 0.03085, null, 0.98559, null, 0.18337, null, 39, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "bulk", "bulk", null, "Switzerland", "2013-09-19", "Undetermined", "Undetermined", "Heart", "Cardiovascular System"], [37140, "SRR997329", "SRX355595", "SRS483789", "SRP030036", "PRJNA219641", "Comparative transcriptome profiling of the injured zebrafish and mouse hearts identifies miRNA dependent repair pathways", "GSE51018", "Transcriptome Analysis", "The mammalian heart has poor regenerative capacity following injury. In contrast  certain lower vertebrates such as zebrafish retain a robust capacity for regeneration into adult life. Here we use an integrated approach to identify evolutionary conserved regenerative miRNA dependant regulatory circuits in the heart. We identified novel miRNA dependant networks involved in critical biological pathways  which are differentially utilized between the infarcted mouse heart and the regenerating zebrafish heart. Overall design: 2 conditions  4 biological replicates per condition", "parent bioproject:PRJNA219631", "pubmed:26857418", null, "Heart  Resected  rep2", "GSM1234957", null, "source name:Heart  Resected|tissue:heart", "Heart  Resected  rep2", "Base calling was with Illumina GAP Pipeline Software v1.70 Sequence reads were processed to remove the adaptor sequences and reformatted to FASTA files using the FASTX Toolkit Sequences were aligned to mouse mature microRNA sequences from miRBase Version 17 and non coding RNA sequences Rfam Version 10 using MEGABLAST with a word size of 8 nucleotides. The criteria for counting a sequence match were if the % query was >=90% of the target sequence and if there were <= 2 mismatches over the alignment. The % query was calculated as a/q x p where a= alignment length  q= query length and p= percent identity over aligned region. The matches against miRBase were parsed and the top matches based on % query were selected. If a sequence had more than one top match against different database sequences  it was excluded from the subsequent analysis. Matches to Rfam were only taken into account for sequences not matching miRBase. Genome build: miRBase17 Supplementary files format and content: Raw count data for microRNAs were normalized to the relative size of each library using R/Bioconductor package DESeq  estimateSizeFactors function. Count data are provided in tab delimited format", "Heart  Resected", null, "Total RNA was isolated using Trizol Invitrogen. RNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 BioanalyzerRNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 Bioanalyzer. Libraries of small RNAs for sequencing were prepared using the DGE Small RNA Sample Kit  Alternative v1.5 Protocol Illumina; San Diego  California according to the protocol supplied with the reagents Protocol Rev. A  published February 2009 and using 1ug of total RNA. One lane of each library was sequenced on the Genome Analyzer IIx Illumina using the 36 Cycle Sequencing Kit v5 and v4 flowcell and cluster reagents Catalog FC 104 5020 and GD 300 1001", null, "tissue:heart", "GSM1234957", "GSM1234957: Heart  Resected  rep2; Danio rerio; RNA Seq", "GSM1234957", null, "1", "Total RNA was isolated using Trizol Invitrogen. RNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 BioanalyzerRNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 Bioanalyzer. Libraries of small RNAs for sequencing were prepared using the DGE Small RNA Sample Kit  Alternative v1.5 Protocol Illumina; San Diego  California according to the protocol supplied with the reagents Protocol Rev. A  published February 2009 and using 1ug of total RNA. One lane of each library was sequenced on the Genome Analyzer IIx Illumina using the 36 Cycle Sequencing Kit v5 and v4 flowcell and cluster reagents Catalog FC 104 5020 and GD 300 1001", "GEO Accession:GSM1234957", "RNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer II", null, "SRP030036", null, null, "R2D2_0122_s_5_sequence.txt.gz", "fastq", 1420874247.0, 36432673.0, "GSM1234957 r1", "0:39", "A:290914118;C:295973738;G:440368910;T:393019696;N:597785", 39, null, null, null, 290914118, 295973738, 440368910, 393019696, 597785, "SRX355595", "SRS483789", "SRA101779", "GEO", "Vital-IT, SIB Swiss Institute of Bioinformatics", 1, 0.00472, null, 0.00131, null, 0.99431, null, 0.42832, null, 39, null, "T", null, "under 1.2% mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "bulk", "bulk", null, "Switzerland", "2013-09-19", "Undetermined", "Undetermined", "Heart", "Cardiovascular System"], [37141, "SRR997328", "SRX355594", "SRS483790", "SRP030036", "PRJNA219641", "Comparative transcriptome profiling of the injured zebrafish and mouse hearts identifies miRNA dependent repair pathways", "GSE51018", "Transcriptome Analysis", "The mammalian heart has poor regenerative capacity following injury. In contrast  certain lower vertebrates such as zebrafish retain a robust capacity for regeneration into adult life. Here we use an integrated approach to identify evolutionary conserved regenerative miRNA dependant regulatory circuits in the heart. We identified novel miRNA dependant networks involved in critical biological pathways  which are differentially utilized between the infarcted mouse heart and the regenerating zebrafish heart. Overall design: 2 conditions  4 biological replicates per condition", "parent bioproject:PRJNA219631", "pubmed:26857418", null, "Heart  Resected  rep1", "GSM1234956", null, "source name:Heart  Resected|tissue:heart", "Heart  Resected  rep1", "Base calling was with Illumina GAP Pipeline Software v1.70 Sequence reads were processed to remove the adaptor sequences and reformatted to FASTA files using the FASTX Toolkit Sequences were aligned to mouse mature microRNA sequences from miRBase Version 17 and non coding RNA sequences Rfam Version 10 using MEGABLAST with a word size of 8 nucleotides. The criteria for counting a sequence match were if the % query was >=90% of the target sequence and if there were <= 2 mismatches over the alignment. The % query was calculated as a/q x p where a= alignment length  q= query length and p= percent identity over aligned region. The matches against miRBase were parsed and the top matches based on % query were selected. If a sequence had more than one top match against different database sequences  it was excluded from the subsequent analysis. Matches to Rfam were only taken into account for sequences not matching miRBase. Genome build: miRBase17 Supplementary files format and content: Raw count data for microRNAs were normalized to the relative size of each library using R/Bioconductor package DESeq  estimateSizeFactors function. Count data are provided in tab delimited format", "Heart  Resected", null, "Total RNA was isolated using Trizol Invitrogen. RNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 BioanalyzerRNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 Bioanalyzer. Libraries of small RNAs for sequencing were prepared using the DGE Small RNA Sample Kit  Alternative v1.5 Protocol Illumina; San Diego  California according to the protocol supplied with the reagents Protocol Rev. A  published February 2009 and using 1ug of total RNA. One lane of each library was sequenced on the Genome Analyzer IIx Illumina using the 36 Cycle Sequencing Kit v5 and v4 flowcell and cluster reagents Catalog FC 104 5020 and GD 300 1001", null, "tissue:heart", "GSM1234956", "GSM1234956: Heart  Resected  rep1; Danio rerio; RNA Seq", "GSM1234956", null, "1", "Total RNA was isolated using Trizol Invitrogen. RNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 BioanalyzerRNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 Bioanalyzer. Libraries of small RNAs for sequencing were prepared using the DGE Small RNA Sample Kit  Alternative v1.5 Protocol Illumina; San Diego  California according to the protocol supplied with the reagents Protocol Rev. A  published February 2009 and using 1ug of total RNA. One lane of each library was sequenced on the Genome Analyzer IIx Illumina using the 36 Cycle Sequencing Kit v5 and v4 flowcell and cluster reagents Catalog FC 104 5020 and GD 300 1001", "GEO Accession:GSM1234956", "RNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer II", null, "SRP030036", null, null, "C3PO_0054_s_8_sequence.txt.gz", "fastq", 1073339514.0, 27521526.0, "GSM1234956 r1", "0:39", "A:223670054;C:219603945;G:328718329;T:300891777;N:455409", 39, null, null, null, 223670054, 219603945, 328718329, 300891777, 455409, "SRX355594", "SRS483790", "SRA101779", "GEO", "Vital-IT, SIB Swiss Institute of Bioinformatics", 1, 0.05133, null, 0.01643, null, 0.9893, null, 0.25792, null, 39, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "size_fractionation", "unknown", "bulk", "bulk", "bulk", null, "Switzerland", "2013-09-19", "Undetermined", "Undetermined", "Heart", "Cardiovascular System"], [58969, "SRR11575113", "SRX8143233", "SRS6506144", "SRP257532", "PRJNA626621", "Identification of target genes in tie1 mutant zebrafish heart by transcriptomic analysis", "GSE148957", "Transcriptome Analysis", "Purpose: identifying  with RNA seq  genes targets of Tie1 during the cardiac development in zebrafish.  Results: we identified several differential expressed genes  with an enrichment in ECM modulator genes. Overall design: Hearts were manually extracted at 48 hpf from tie1 mutants and wild type and heterozygous siblings.", null, null, null, "tie1 WT 2", "GSM4486659", null, "source name:Tgkdrl:eGFP|tissue:Hearts|developmental stage:48 hpf|genotype:tie1 WT", "tie1 WT 2", "The resulting raw reads were assessed for quality  adapter content and duplication rates with FastQC available online at http://www.bioinformatics.babraham.ac.uk/ projects/fastqc. Reaper version 13 100 was employed to trim reads post a quality drop below a mean of Q20 in a window of 10 nucleotides 6.  Only reads between 30 and 150 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned versus the Ensembl Zebrafish genome version DanRer11 GRCz11.92 using STAR 2.4.0a with the parameter \u201coutFilterMismatchNoverLmax 0.1\u201d to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 1.4.5 p1 tool from the Subread package 8.  Only reads mapping at least partially inside exons were admitted and aggregated per gene.  Reads overlapping multiple genes or aligning to multiple regions were excluded. Genome build: DanRer11 Supplementary files format and content: library size normalized counts", "Tgkdrl:eGFP", null, "Hearts from 48 hpf tie mutant embryos and siblings were manually dissected using insulin needles  pooled in 1.5 ml tubes with TRIzol and frozen in  80\u00b0C. Total RNA was isolated using the miRNeasy micro kit Qiagen.  For exclusion of genomic DNA contamination  the samples were treated by on column DNase digestion DNase Free DNase Set  Qiagen.  Total RNA and library integrity were verified with LabChip Gx Touch 24 Perkin Elmer. 2 ng of total RNA was used as input for SMARTer\u00ae Stranded Total RNA Seq Kit   Pico Input Mammalian Takara Clontech.", null, "tissue:Hearts|developmental stage:48 hpf|genotype:tie1 WT", "GSM4486659", "GSM4486659: tie1 WT 2; Danio rerio; RNA Seq", "GSM4486659", null, "1", "Hearts from 48 hpf tie mutant embryos and siblings were manually dissected using insulin needles  pooled in 1.5 ml tubes with TRIzol and frozen in  80\u00b0C. Total RNA was isolated using the miRNeasy micro kit Qiagen.  For exclusion of genomic DNA contamination  the samples were treated by on column DNase digestion DNase Free DNase Set  Qiagen.  Total RNA and library integrity were verified with LabChip Gx Touch 24 Perkin Elmer. 2 ng of total RNA was used as input for SMARTer\u00ae Stranded Total RNA Seq Kit   Pico Input Mammalian Takara Clontech.", "GEO Accession:GSM4486659", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP257532", null, null, "Carlantoni_RNA_WT_2.fastq.gz", "fastq", 1305381389.0, 17502572.0, "GSM4486659 r1", "0:74.58 1:0", "A:237331428;C:438050630;G:373885000;T:256109188;N:5143", 74, 0, null, null, 237331428, 438050630, 373885000, 256109188, 5143, "SRX8143233", "SRS6506144", "SRA1067178", "GEO", "MPI for heart and lung research", 1, 0.9611, null, 0.16835, null, 0.89919, null, 0.79231, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "smarter", "bulk", "bulk", "bulk", null, "Germany", "2020-04-20", "Hatching", "Embryo", "Heart", "Cardiovascular System"], [58970, "SRR11575112", "SRX8143232", "SRS6506143", "SRP257532", "PRJNA626621", "Identification of target genes in tie1 mutant zebrafish heart by transcriptomic analysis", "GSE148957", "Transcriptome Analysis", "Purpose: identifying  with RNA seq  genes targets of Tie1 during the cardiac development in zebrafish.  Results: we identified several differential expressed genes  with an enrichment in ECM modulator genes. Overall design: Hearts were manually extracted at 48 hpf from tie1 mutants and wild type and heterozygous siblings.", null, null, null, "tie1 WT 1", "GSM4486658", null, "source name:Tgkdrl:eGFP|tissue:Hearts|developmental stage:48 hpf|genotype:tie1 WT", "tie1 WT 1", "The resulting raw reads were assessed for quality  adapter content and duplication rates with FastQC available online at http://www.bioinformatics.babraham.ac.uk/ projects/fastqc. Reaper version 13 100 was employed to trim reads post a quality drop below a mean of Q20 in a window of 10 nucleotides 6.  Only reads between 30 and 150 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned versus the Ensembl Zebrafish genome version DanRer11 GRCz11.92 using STAR 2.4.0a with the parameter \u201coutFilterMismatchNoverLmax 0.1\u201d to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 1.4.5 p1 tool from the Subread package 8.  Only reads mapping at least partially inside exons were admitted and aggregated per gene.  Reads overlapping multiple genes or aligning to multiple regions were excluded. Genome build: DanRer11 Supplementary files format and content: library size normalized counts", "Tgkdrl:eGFP", null, "Hearts from 48 hpf tie mutant embryos and siblings were manually dissected using insulin needles  pooled in 1.5 ml tubes with TRIzol and frozen in  80\u00b0C. Total RNA was isolated using the miRNeasy micro kit Qiagen.  For exclusion of genomic DNA contamination  the samples were treated by on column DNase digestion DNase Free DNase Set  Qiagen.  Total RNA and library integrity were verified with LabChip Gx Touch 24 Perkin Elmer. 2 ng of total RNA was used as input for SMARTer\u00ae Stranded Total RNA Seq Kit   Pico Input Mammalian Takara Clontech.", null, "tissue:Hearts|developmental stage:48 hpf|genotype:tie1 WT", "GSM4486658", "GSM4486658: tie1 WT 1; Danio rerio; RNA Seq", "GSM4486658", null, "1", "Hearts from 48 hpf tie mutant embryos and siblings were manually dissected using insulin needles  pooled in 1.5 ml tubes with TRIzol and frozen in  80\u00b0C. Total RNA was isolated using the miRNeasy micro kit Qiagen.  For exclusion of genomic DNA contamination  the samples were treated by on column DNase digestion DNase Free DNase Set  Qiagen.  Total RNA and library integrity were verified with LabChip Gx Touch 24 Perkin Elmer. 2 ng of total RNA was used as input for SMARTer\u00ae Stranded Total RNA Seq Kit   Pico Input Mammalian Takara Clontech.", "GEO Accession:GSM4486658", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP257532", null, null, "Carlantoni_RNA_WT_1.fastq.gz", "fastq", 1494085887.0, 20050038.0, "GSM4486658 r1", "0:74.52 1:0", "A:282811923;C:486533537;G:414513849;T:310220539;N:6039", 74, 0, null, null, 282811923, 486533537, 414513849, 310220539, 6039, "SRX8143232", "SRS6506143", "SRA1067178", "GEO", "MPI for heart and lung research", 1, 0.9512, null, 0.17902, null, 0.89757, null, 0.79881, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "smarter", "bulk", "bulk", "bulk", null, "Germany", "2020-04-20", "Hatching", "Embryo", "Heart", "Cardiovascular System"], [58971, "SRR11575111", "SRX8143231", "SRS6506142", "SRP257532", "PRJNA626621", "Identification of target genes in tie1 mutant zebrafish heart by transcriptomic analysis", "GSE148957", "Transcriptome Analysis", "Purpose: identifying  with RNA seq  genes targets of Tie1 during the cardiac development in zebrafish.  Results: we identified several differential expressed genes  with an enrichment in ECM modulator genes. Overall design: Hearts were manually extracted at 48 hpf from tie1 mutants and wild type and heterozygous siblings.", null, null, null, "tie1 KO 2", "GSM4486657", null, "source name:Tgkdrl:eGFP|tissue:Hearts|developmental stage:48 hpf|genotype:tie1 KO", "tie1 KO 2", "The resulting raw reads were assessed for quality  adapter content and duplication rates with FastQC available online at http://www.bioinformatics.babraham.ac.uk/ projects/fastqc. Reaper version 13 100 was employed to trim reads post a quality drop below a mean of Q20 in a window of 10 nucleotides 6.  Only reads between 30 and 150 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned versus the Ensembl Zebrafish genome version DanRer11 GRCz11.92 using STAR 2.4.0a with the parameter \u201coutFilterMismatchNoverLmax 0.1\u201d to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 1.4.5 p1 tool from the Subread package 8.  Only reads mapping at least partially inside exons were admitted and aggregated per gene.  Reads overlapping multiple genes or aligning to multiple regions were excluded. Genome build: DanRer11 Supplementary files format and content: library size normalized counts", "Tgkdrl:eGFP", null, "Hearts from 48 hpf tie mutant embryos and siblings were manually dissected using insulin needles  pooled in 1.5 ml tubes with TRIzol and frozen in  80\u00b0C. Total RNA was isolated using the miRNeasy micro kit Qiagen.  For exclusion of genomic DNA contamination  the samples were treated by on column DNase digestion DNase Free DNase Set  Qiagen.  Total RNA and library integrity were verified with LabChip Gx Touch 24 Perkin Elmer. 2 ng of total RNA was used as input for SMARTer\u00ae Stranded Total RNA Seq Kit   Pico Input Mammalian Takara Clontech.", null, "tissue:Hearts|developmental stage:48 hpf|genotype:tie1 KO", "GSM4486657", "GSM4486657: tie1 KO 2; Danio rerio; RNA Seq", "GSM4486657", null, "1", "Hearts from 48 hpf tie mutant embryos and siblings were manually dissected using insulin needles  pooled in 1.5 ml tubes with TRIzol and frozen in  80\u00b0C. Total RNA was isolated using the miRNeasy micro kit Qiagen.  For exclusion of genomic DNA contamination  the samples were treated by on column DNase digestion DNase Free DNase Set  Qiagen.  Total RNA and library integrity were verified with LabChip Gx Touch 24 Perkin Elmer. 2 ng of total RNA was used as input for SMARTer\u00ae Stranded Total RNA Seq Kit   Pico Input Mammalian Takara Clontech.", "GEO Accession:GSM4486657", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP257532", null, null, "Carlantoni_RNA_KO_2.fastq.gz", "fastq", 1398062637.0, 18750921.0, "GSM4486657 r1", "0:74.56 1:0", "A:245160828;C:482535020;G:414010795;T:256350606;N:5388", 74, 0, null, null, 245160828, 482535020, 414010795, 256350606, 5388, "SRX8143231", "SRS6506142", "SRA1067178", "GEO", "MPI for heart and lung research", 1, 0.96112, null, 0.17097, null, 0.9263, null, 0.81149, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "smarter", "bulk", "bulk", "bulk", null, "Germany", "2020-04-20", "Hatching", "Embryo", "Heart", "Cardiovascular System"], [58972, "SRR11575110", "SRX8143230", "SRS6506141", "SRP257532", "PRJNA626621", "Identification of target genes in tie1 mutant zebrafish heart by transcriptomic analysis", "GSE148957", "Transcriptome Analysis", "Purpose: identifying  with RNA seq  genes targets of Tie1 during the cardiac development in zebrafish.  Results: we identified several differential expressed genes  with an enrichment in ECM modulator genes. Overall design: Hearts were manually extracted at 48 hpf from tie1 mutants and wild type and heterozygous siblings.", null, null, null, "tie1 KO 1", "GSM4486656", null, "source name:Tgkdrl:eGFP|tissue:Hearts|developmental stage:48 hpf|genotype:tie1 KO", "tie1 KO 1", "The resulting raw reads were assessed for quality  adapter content and duplication rates with FastQC available online at http://www.bioinformatics.babraham.ac.uk/ projects/fastqc. Reaper version 13 100 was employed to trim reads post a quality drop below a mean of Q20 in a window of 10 nucleotides 6.  Only reads between 30 and 150 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned versus the Ensembl Zebrafish genome version DanRer11 GRCz11.92 using STAR 2.4.0a with the parameter \u201coutFilterMismatchNoverLmax 0.1\u201d to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 1.4.5 p1 tool from the Subread package 8.  Only reads mapping at least partially inside exons were admitted and aggregated per gene.  Reads overlapping multiple genes or aligning to multiple regions were excluded. Genome build: DanRer11 Supplementary files format and content: library size normalized counts", "Tgkdrl:eGFP", null, "Hearts from 48 hpf tie mutant embryos and siblings were manually dissected using insulin needles  pooled in 1.5 ml tubes with TRIzol and frozen in  80\u00b0C. Total RNA was isolated using the miRNeasy micro kit Qiagen.  For exclusion of genomic DNA contamination  the samples were treated by on column DNase digestion DNase Free DNase Set  Qiagen.  Total RNA and library integrity were verified with LabChip Gx Touch 24 Perkin Elmer. 2 ng of total RNA was used as input for SMARTer\u00ae Stranded Total RNA Seq Kit   Pico Input Mammalian Takara Clontech.", null, "tissue:Hearts|developmental stage:48 hpf|genotype:tie1 KO", "GSM4486656", "GSM4486656: tie1 KO 1; Danio rerio; RNA Seq", "GSM4486656", null, "1", "Hearts from 48 hpf tie mutant embryos and siblings were manually dissected using insulin needles  pooled in 1.5 ml tubes with TRIzol and frozen in  80\u00b0C. Total RNA was isolated using the miRNeasy micro kit Qiagen.  For exclusion of genomic DNA contamination  the samples were treated by on column DNase digestion DNase Free DNase Set  Qiagen.  Total RNA and library integrity were verified with LabChip Gx Touch 24 Perkin Elmer. 2 ng of total RNA was used as input for SMARTer\u00ae Stranded Total RNA Seq Kit   Pico Input Mammalian Takara Clontech.", "GEO Accession:GSM4486656", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP257532", null, null, "Carlantoni_RNA_KO_1.fastq.gz", "fastq", 1236313899.0, 16596670.0, "GSM4486656 r1", "0:74.49 1:0", "A:227398977;C:410185357;G:353761139;T:244963695;N:4731", 74, 0, null, null, 227398977, 410185357, 353761139, 244963695, 4731, "SRX8143230", "SRS6506141", "SRA1067178", "GEO", "MPI for heart and lung research", 1, 0.95313, null, 0.17078, null, 0.90723, null, 0.82365, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "smarter", "bulk", "bulk", "bulk", null, "Germany", "2020-04-20", "Hatching", "Embryo", "Heart", "Cardiovascular System"], [68874, "SRR25099319", "SRX20852449", "SRS18129438", "SRP362545", "PRJNA812617", "Sinus venosus adaptation models prolonged cardiovascular disease and reveals insights into evolutionary transitions of the vertebrate heart", "GSE195548", "Transcriptome Analysis", "How two chambered hearts in basal vertebrates have evolved from single chamber hearts found in ancestral chordates remains unclear. Here  we show that the teleost sinus venosus SV is a chamber like vessel comprised of an outer layer of smooth muscle cells. We find that in adult zebrafish nr2f1a mutants  which lack atria  the SV comes to physically resemble the thicker bulbus arteriosus BA at the arterial pole of the heart through an adaptive  hypertensive response involving smooth muscle proliferation due to aberrant hemodynamic flow. Single cell transcriptomics show that smooth muscle and endothelial cell populations within the adapting SV also take on arterial signatures. Bulk transcriptomics of the blood sinuses flanking the tunicate heart reinforce a model of greater equivalency in ancestral chordate BA and SV precursors. Our data simultaneously reveal that secondary complications from congenital heart defects can develop in adult zebrafish similar to those in humans and that the foundation of equivalency between flanking auxiliary vessels may remain latent within basal vertebrate hearts. Overall design: RNA seq of zebrafish heart chambers", "parent bioproject:PRJNA804024", "pubmed:37679366", null, "aco sinus venosus 2", "GSM7524721", null, "source name:isolated WT sinus venosus|tissue:isolated WT sinus venosus|cell type:mixed|genotype:aco AB/TU|treatment:adult 6 month 1.5 years|geo loc name:missing|collection date:missing", "aco sinus venosus 2", "Zebrafish RNA seq reads were aligned to the UCSC zebrafish genome  danRer11  using STAR aligner post trimming the Illumina adapter using cutadapt These libraries were prepped across multiple batches with different library types in terms of RNA strand and sequencing mode single end or paired end. Therefore  we treated them as single end libraries by choosing read1 or read2 to match the strand as much as possible  and batch correction was applied as described below. Only uniquely aligned reads were retained for downstream analysis. Gene expression levels were quantified as raw read counts using FeatureCounts in the subread package with an option  \u201c O   fracOverlap 0.8\u201d  and with a proper strand option  s. Given the mixed sequencing batches and library types  we incorporated RUVseq batch correction RUVs  k=1 in DESeq2 differential analysis. Differentially expressed genes were identified by FDR < 0.05. Hierarchical clustering was performed using the Pearson correlation coefficient as a similarity measure under Ward\u2019s criterion  and a heatmap was visualized in z score. Assembly: GRCz10/danRer10 Supplementary files format and content: text of DESeq2 data with LogFC  P value  FDR  normalized expression  and raw counts", "isolated WT sinus venosus", null, "The heart chambers  bulbous arteriosus  and sinus venosus were removed from the adult fish and then separated into their respective tissues. Heart tissues from 20 fish were pooled and then placed in TRIZOL. RNA was harvested using phenol chloroform separation and a PureLink RNA Micro Kit Invitrogen.  The RNA was submitted to the CCHMC core for library generation and sequencing. Singles and paired end sequencing was performed. RNA libraries prepared for sequencing using standard protocols", null, "tissue:isolated WT sinus venosus|cell type:mixed|genotype:aco AB/TU|treatment:adult 6 month 1.5 years", "GSM7524721", "GSM7524721: aco sinus venosus 2; Danio rerio; RNA Seq", "GSM7524721 r1", "GSM7524721", "1", "The heart chambers  bulbous arteriosus  and sinus venosus were removed from the adult fish and then separated into their respective tissues. Heart tissues from 20 fish were pooled and then placed in TRIZOL. RNA was harvested using phenol chloroform separation and a PureLink RNA Micro Kit Invitrogen.  The RNA was submitted to the CCHMC core for library generation and sequencing. Singles and paired end sequencing was performed. RNA libraries prepared for sequencing using standard protocols", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP362545", null, "loader:fastq load.py", "aco_V_rd2_2.fastq.gz", "fastq", 2859281114.0, 28309714.0, "GSM7524721 r1", "0:101", "A:843413397;C:640837553;G:671676851;T:703204253;N:149060", 101, null, null, null, 843413397, 640837553, 671676851, 703204253, 149060, "SRX20852449", "SRS18129438", null, null, "Molecular Cardiovascular Biology Division, Cincinnati Children's Hospital Medical Center", 1, 0.95623, null, 0.08075, null, 0.76781, null, 0.49866, null, 101, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2023-06-30", "Adult", "Adult", "Heart", "Cardiovascular System"], [68875, "SRR25099320", "SRX20852448", "SRS18129436", "SRP362545", "PRJNA812617", "Sinus venosus adaptation models prolonged cardiovascular disease and reveals insights into evolutionary transitions of the vertebrate heart", "GSE195548", "Transcriptome Analysis", "How two chambered hearts in basal vertebrates have evolved from single chamber hearts found in ancestral chordates remains unclear. Here  we show that the teleost sinus venosus SV is a chamber like vessel comprised of an outer layer of smooth muscle cells. We find that in adult zebrafish nr2f1a mutants  which lack atria  the SV comes to physically resemble the thicker bulbus arteriosus BA at the arterial pole of the heart through an adaptive  hypertensive response involving smooth muscle proliferation due to aberrant hemodynamic flow. Single cell transcriptomics show that smooth muscle and endothelial cell populations within the adapting SV also take on arterial signatures. Bulk transcriptomics of the blood sinuses flanking the tunicate heart reinforce a model of greater equivalency in ancestral chordate BA and SV precursors. Our data simultaneously reveal that secondary complications from congenital heart defects can develop in adult zebrafish similar to those in humans and that the foundation of equivalency between flanking auxiliary vessels may remain latent within basal vertebrate hearts. Overall design: RNA seq of zebrafish heart chambers", "parent bioproject:PRJNA804024", "pubmed:37679366", null, "aco sinus venosus 1", "GSM7524720", null, "source name:isolated WT sinus venosus|tissue:isolated WT sinus venosus|cell type:mixed|genotype:aco AB/TU|treatment:adult 6 month 1.5 years|geo loc name:missing|collection date:missing", "aco sinus venosus 1", "Zebrafish RNA seq reads were aligned to the UCSC zebrafish genome  danRer11  using STAR aligner post trimming the Illumina adapter using cutadapt These libraries were prepped across multiple batches with different library types in terms of RNA strand and sequencing mode single end or paired end. Therefore  we treated them as single end libraries by choosing read1 or read2 to match the strand as much as possible  and batch correction was applied as described below. Only uniquely aligned reads were retained for downstream analysis. Gene expression levels were quantified as raw read counts using FeatureCounts in the subread package with an option  \u201c O   fracOverlap 0.8\u201d  and with a proper strand option  s. Given the mixed sequencing batches and library types  we incorporated RUVseq batch correction RUVs  k=1 in DESeq2 differential analysis. Differentially expressed genes were identified by FDR < 0.05. Hierarchical clustering was performed using the Pearson correlation coefficient as a similarity measure under Ward\u2019s criterion  and a heatmap was visualized in z score. Assembly: GRCz10/danRer10 Supplementary files format and content: text of DESeq2 data with LogFC  P value  FDR  normalized expression  and raw counts", "isolated WT sinus venosus", null, "The heart chambers  bulbous arteriosus  and sinus venosus were removed from the adult fish and then separated into their respective tissues. Heart tissues from 20 fish were pooled and then placed in TRIZOL. RNA was harvested using phenol chloroform separation and a PureLink RNA Micro Kit Invitrogen.  The RNA was submitted to the CCHMC core for library generation and sequencing. Singles and paired end sequencing was performed. RNA libraries prepared for sequencing using standard protocols", null, "tissue:isolated WT sinus venosus|cell type:mixed|genotype:aco AB/TU|treatment:adult 6 month 1.5 years", "GSM7524720", "GSM7524720: aco sinus venosus 1; Danio rerio; RNA Seq", "GSM7524720 r1", "GSM7524720", "1", "The heart chambers  bulbous arteriosus  and sinus venosus were removed from the adult fish and then separated into their respective tissues. Heart tissues from 20 fish were pooled and then placed in TRIZOL. RNA was harvested using phenol chloroform separation and a PureLink RNA Micro Kit Invitrogen.  The RNA was submitted to the CCHMC core for library generation and sequencing. Singles and paired end sequencing was performed. RNA libraries prepared for sequencing using standard protocols", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP362545", null, null, "aco_V_rd1_1.fastq.gz", "fastq", 2340738375.0, 31209845.0, "GSM7524720 r1", "0:75", "A:676632613;C:521794728;G:513850202;T:628264174;N:196658", 75, null, null, null, 676632613, 521794728, 513850202, 628264174, 196658, "SRX20852448", "SRS18129436", null, null, "Molecular Cardiovascular Biology Division, Cincinnati Children's Hospital Medical Center", 1, 0.90282, null, 0.09756, null, 0.8212, null, 0.56471, null, 75, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2023-06-30", "Adult", "Adult", "Heart", "Cardiovascular System"], [68876, "SRR25099321", "SRX20852447", "SRS18129437", "SRP362545", "PRJNA812617", "Sinus venosus adaptation models prolonged cardiovascular disease and reveals insights into evolutionary transitions of the vertebrate heart", "GSE195548", "Transcriptome Analysis", "How two chambered hearts in basal vertebrates have evolved from single chamber hearts found in ancestral chordates remains unclear. Here  we show that the teleost sinus venosus SV is a chamber like vessel comprised of an outer layer of smooth muscle cells. We find that in adult zebrafish nr2f1a mutants  which lack atria  the SV comes to physically resemble the thicker bulbus arteriosus BA at the arterial pole of the heart through an adaptive  hypertensive response involving smooth muscle proliferation due to aberrant hemodynamic flow. Single cell transcriptomics show that smooth muscle and endothelial cell populations within the adapting SV also take on arterial signatures. Bulk transcriptomics of the blood sinuses flanking the tunicate heart reinforce a model of greater equivalency in ancestral chordate BA and SV precursors. Our data simultaneously reveal that secondary complications from congenital heart defects can develop in adult zebrafish similar to those in humans and that the foundation of equivalency between flanking auxiliary vessels may remain latent within basal vertebrate hearts. Overall design: RNA seq of zebrafish heart chambers", "parent bioproject:PRJNA804024", "pubmed:37679366", null, "aco mutant ventricle 2", "GSM7524718", null, "source name:isolated WT ventricle|tissue:isolated WT ventricle|cell type:mixed|genotype:aco AB/TU|treatment:adult 6 month 1.5 years|geo loc name:missing|collection date:missing", "aco mutant ventricle 2", "Zebrafish RNA seq reads were aligned to the UCSC zebrafish genome  danRer11  using STAR aligner post trimming the Illumina adapter using cutadapt These libraries were prepped across multiple batches with different library types in terms of RNA strand and sequencing mode single end or paired end. Therefore  we treated them as single end libraries by choosing read1 or read2 to match the strand as much as possible  and batch correction was applied as described below. Only uniquely aligned reads were retained for downstream analysis. Gene expression levels were quantified as raw read counts using FeatureCounts in the subread package with an option  \u201c O   fracOverlap 0.8\u201d  and with a proper strand option  s. Given the mixed sequencing batches and library types  we incorporated RUVseq batch correction RUVs  k=1 in DESeq2 differential analysis. Differentially expressed genes were identified by FDR < 0.05. Hierarchical clustering was performed using the Pearson correlation coefficient as a similarity measure under Ward\u2019s criterion  and a heatmap was visualized in z score. Assembly: GRCz10/danRer10 Supplementary files format and content: text of DESeq2 data with LogFC  P value  FDR  normalized expression  and raw counts", "isolated WT ventricle", null, "The heart chambers  bulbous arteriosus  and sinus venosus were removed from the adult fish and then separated into their respective tissues. Heart tissues from 20 fish were pooled and then placed in TRIZOL. RNA was harvested using phenol chloroform separation and a PureLink RNA Micro Kit Invitrogen.  The RNA was submitted to the CCHMC core for library generation and sequencing. Singles and paired end sequencing was performed. RNA libraries prepared for sequencing using standard protocols", null, "tissue:isolated WT ventricle|cell type:mixed|genotype:aco AB/TU|treatment:adult 6 month 1.5 years", "GSM7524718", "GSM7524718: aco mutant ventricle 2; Danio rerio; RNA Seq", "GSM7524718 r1", "GSM7524718", "1", "The heart chambers  bulbous arteriosus  and sinus venosus were removed from the adult fish and then separated into their respective tissues. Heart tissues from 20 fish were pooled and then placed in TRIZOL. RNA was harvested using phenol chloroform separation and a PureLink RNA Micro Kit Invitrogen.  The RNA was submitted to the CCHMC core for library generation and sequencing. Singles and paired end sequencing was performed. RNA libraries prepared for sequencing using standard protocols", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP362545", null, "loader:fastq load.py", "aco_SV_rd2_2.fastq.gz", "fastq", 2842036273.0, 28138973.0, "GSM7524718 r1", "0:101", "A:832566894;C:633773069;G:668950393;T:706598442;N:147475", 101, null, null, null, 832566894, 633773069, 668950393, 706598442, 147475, "SRX20852447", "SRS18129437", null, null, "Molecular Cardiovascular Biology Division, Cincinnati Children's Hospital Medical Center", 1, 0.94423, null, 0.11196, null, 0.72147, null, 0.47741, null, 101, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2023-06-30", "Adult", "Adult", "Heart", "Cardiovascular System"], [68877, "SRR25099322", "SRX20852446", "SRS18129434", "SRP362545", "PRJNA812617", "Sinus venosus adaptation models prolonged cardiovascular disease and reveals insights into evolutionary transitions of the vertebrate heart", "GSE195548", "Transcriptome Analysis", "How two chambered hearts in basal vertebrates have evolved from single chamber hearts found in ancestral chordates remains unclear. Here  we show that the teleost sinus venosus SV is a chamber like vessel comprised of an outer layer of smooth muscle cells. We find that in adult zebrafish nr2f1a mutants  which lack atria  the SV comes to physically resemble the thicker bulbus arteriosus BA at the arterial pole of the heart through an adaptive  hypertensive response involving smooth muscle proliferation due to aberrant hemodynamic flow. Single cell transcriptomics show that smooth muscle and endothelial cell populations within the adapting SV also take on arterial signatures. Bulk transcriptomics of the blood sinuses flanking the tunicate heart reinforce a model of greater equivalency in ancestral chordate BA and SV precursors. Our data simultaneously reveal that secondary complications from congenital heart defects can develop in adult zebrafish similar to those in humans and that the foundation of equivalency between flanking auxiliary vessels may remain latent within basal vertebrate hearts. Overall design: RNA seq of zebrafish heart chambers", "parent bioproject:PRJNA804024", "pubmed:37679366", null, "aco mutant ventricle 1", "GSM7524717", null, "source name:isolated WT ventricle|tissue:isolated WT ventricle|cell type:mixed|genotype:aco AB/TU|treatment:adult 6 month 1.5 years|geo loc name:missing|collection date:missing", "aco mutant ventricle 1", "Zebrafish RNA seq reads were aligned to the UCSC zebrafish genome  danRer11  using STAR aligner post trimming the Illumina adapter using cutadapt These libraries were prepped across multiple batches with different library types in terms of RNA strand and sequencing mode single end or paired end. Therefore  we treated them as single end libraries by choosing read1 or read2 to match the strand as much as possible  and batch correction was applied as described below. Only uniquely aligned reads were retained for downstream analysis. Gene expression levels were quantified as raw read counts using FeatureCounts in the subread package with an option  \u201c O   fracOverlap 0.8\u201d  and with a proper strand option  s. Given the mixed sequencing batches and library types  we incorporated RUVseq batch correction RUVs  k=1 in DESeq2 differential analysis. Differentially expressed genes were identified by FDR < 0.05. Hierarchical clustering was performed using the Pearson correlation coefficient as a similarity measure under Ward\u2019s criterion  and a heatmap was visualized in z score. Assembly: GRCz10/danRer10 Supplementary files format and content: text of DESeq2 data with LogFC  P value  FDR  normalized expression  and raw counts", "isolated WT ventricle", null, "The heart chambers  bulbous arteriosus  and sinus venosus were removed from the adult fish and then separated into their respective tissues. Heart tissues from 20 fish were pooled and then placed in TRIZOL. RNA was harvested using phenol chloroform separation and a PureLink RNA Micro Kit Invitrogen.  The RNA was submitted to the CCHMC core for library generation and sequencing. Singles and paired end sequencing was performed. RNA libraries prepared for sequencing using standard protocols", null, "tissue:isolated WT ventricle|cell type:mixed|genotype:aco AB/TU|treatment:adult 6 month 1.5 years", "GSM7524717", "GSM7524717: aco mutant ventricle 1; Danio rerio; RNA Seq", "GSM7524717 r1", "GSM7524717", "1", "The heart chambers  bulbous arteriosus  and sinus venosus were removed from the adult fish and then separated into their respective tissues. Heart tissues from 20 fish were pooled and then placed in TRIZOL. RNA was harvested using phenol chloroform separation and a PureLink RNA Micro Kit Invitrogen.  The RNA was submitted to the CCHMC core for library generation and sequencing. Singles and paired end sequencing was performed. RNA libraries prepared for sequencing using standard protocols", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP362545", null, null, "aco_SV_rd1_1.fastq.gz", "fastq", 1959378075.0, 26125041.0, "GSM7524717 r1", "0:75", "A:534233273;C:456835121;G:457557265;T:510598431;N:153985", 75, null, null, null, 534233273, 456835121, 457557265, 510598431, 153985, "SRX20852446", "SRS18129434", null, null, "Molecular Cardiovascular Biology Division, Cincinnati Children's Hospital Medical Center", 1, 0.92065, null, 0.09273, null, 0.802, null, 0.46095, null, 75, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2023-06-30", "Adult", "Adult", "Heart", "Cardiovascular System"], [68878, "SRR25099326", "SRX20852445", "SRS18129433", "SRP362545", "PRJNA812617", "Sinus venosus adaptation models prolonged cardiovascular disease and reveals insights into evolutionary transitions of the vertebrate heart", "GSE195548", "Transcriptome Analysis", "How two chambered hearts in basal vertebrates have evolved from single chamber hearts found in ancestral chordates remains unclear. Here  we show that the teleost sinus venosus SV is a chamber like vessel comprised of an outer layer of smooth muscle cells. We find that in adult zebrafish nr2f1a mutants  which lack atria  the SV comes to physically resemble the thicker bulbus arteriosus BA at the arterial pole of the heart through an adaptive  hypertensive response involving smooth muscle proliferation due to aberrant hemodynamic flow. Single cell transcriptomics show that smooth muscle and endothelial cell populations within the adapting SV also take on arterial signatures. Bulk transcriptomics of the blood sinuses flanking the tunicate heart reinforce a model of greater equivalency in ancestral chordate BA and SV precursors. Our data simultaneously reveal that secondary complications from congenital heart defects can develop in adult zebrafish similar to those in humans and that the foundation of equivalency between flanking auxiliary vessels may remain latent within basal vertebrate hearts. Overall design: RNA seq of zebrafish heart chambers", "parent bioproject:PRJNA804024", "pubmed:37679366", null, "WT sinus venosus 2", "GSM7524716", null, "source name:isolated WT sinus venosus|tissue:isolated WT sinus venosus|cell type:mixed|genotype:WT AB/TU|treatment:adult 6 month 1.5 years|geo loc name:missing|collection date:missing", "WT sinus venosus 2", "Zebrafish RNA seq reads were aligned to the UCSC zebrafish genome  danRer11  using STAR aligner post trimming the Illumina adapter using cutadapt These libraries were prepped across multiple batches with different library types in terms of RNA strand and sequencing mode single end or paired end. Therefore  we treated them as single end libraries by choosing read1 or read2 to match the strand as much as possible  and batch correction was applied as described below. Only uniquely aligned reads were retained for downstream analysis. Gene expression levels were quantified as raw read counts using FeatureCounts in the subread package with an option  \u201c O   fracOverlap 0.8\u201d  and with a proper strand option  s. Given the mixed sequencing batches and library types  we incorporated RUVseq batch correction RUVs  k=1 in DESeq2 differential analysis. Differentially expressed genes were identified by FDR < 0.05. Hierarchical clustering was performed using the Pearson correlation coefficient as a similarity measure under Ward\u2019s criterion  and a heatmap was visualized in z score. Assembly: GRCz10/danRer10 Supplementary files format and content: text of DESeq2 data with LogFC  P value  FDR  normalized expression  and raw counts", "isolated WT sinus venosus", null, "The heart chambers  bulbous arteriosus  and sinus venosus were removed from the adult fish and then separated into their respective tissues. Heart tissues from 20 fish were pooled and then placed in TRIZOL. RNA was harvested using phenol chloroform separation and a PureLink RNA Micro Kit Invitrogen.  The RNA was submitted to the CCHMC core for library generation and sequencing. Singles and paired end sequencing was performed. RNA libraries prepared for sequencing using standard protocols", null, "tissue:isolated WT sinus venosus|cell type:mixed|genotype:WT AB/TU|treatment:adult 6 month 1.5 years", "GSM7524716", "GSM7524716: WT sinus venosus 2; Danio rerio; RNA Seq", "GSM7524716 r1", "GSM7524716", "1", "The heart chambers  bulbous arteriosus  and sinus venosus were removed from the adult fish and then separated into their respective tissues. Heart tissues from 20 fish were pooled and then placed in TRIZOL. RNA was harvested using phenol chloroform separation and a PureLink RNA Micro Kit Invitrogen.  The RNA was submitted to the CCHMC core for library generation and sequencing. Singles and paired end sequencing was performed. RNA libraries prepared for sequencing using standard protocols", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP362545", null, "loader:fastq load.py", "wt_SV_rd2_2.fastq.gz", "fastq", 2991444260.0, 29618260.0, "GSM7524716 r1", "0:101", "A:829998216;C:714085718;G:747135225;T:700118135;N:106966", 101, null, null, null, 829998216, 714085718, 747135225, 700118135, 106966, "SRX20852445", "SRS18129433", null, null, "Molecular Cardiovascular Biology Division, Cincinnati Children's Hospital Medical Center", 1, 0.9468, null, 0.08371, null, 0.70841, null, 0.49714, null, 101, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2023-06-30", "Adult", "Adult", "Heart", "Cardiovascular System"], [68879, "SRR25099323", "SRX20852444", "SRS18129435", "SRP362545", "PRJNA812617", "Sinus venosus adaptation models prolonged cardiovascular disease and reveals insights into evolutionary transitions of the vertebrate heart", "GSE195548", "Transcriptome Analysis", "How two chambered hearts in basal vertebrates have evolved from single chamber hearts found in ancestral chordates remains unclear. Here  we show that the teleost sinus venosus SV is a chamber like vessel comprised of an outer layer of smooth muscle cells. We find that in adult zebrafish nr2f1a mutants  which lack atria  the SV comes to physically resemble the thicker bulbus arteriosus BA at the arterial pole of the heart through an adaptive  hypertensive response involving smooth muscle proliferation due to aberrant hemodynamic flow. Single cell transcriptomics show that smooth muscle and endothelial cell populations within the adapting SV also take on arterial signatures. Bulk transcriptomics of the blood sinuses flanking the tunicate heart reinforce a model of greater equivalency in ancestral chordate BA and SV precursors. Our data simultaneously reveal that secondary complications from congenital heart defects can develop in adult zebrafish similar to those in humans and that the foundation of equivalency between flanking auxiliary vessels may remain latent within basal vertebrate hearts. Overall design: RNA seq of zebrafish heart chambers", "parent bioproject:PRJNA804024", "pubmed:37679366", null, "WT sinus venosus 1", "GSM7524715", null, "source name:isolated WT sinus venosus|tissue:isolated WT sinus venosus|cell type:mixed|genotype:WT AB/TU|treatment:adult 6 month 1.5 years|geo loc name:missing|collection date:missing", "WT sinus venosus 1", "Zebrafish RNA seq reads were aligned to the UCSC zebrafish genome  danRer11  using STAR aligner post trimming the Illumina adapter using cutadapt These libraries were prepped across multiple batches with different library types in terms of RNA strand and sequencing mode single end or paired end. Therefore  we treated them as single end libraries by choosing read1 or read2 to match the strand as much as possible  and batch correction was applied as described below. Only uniquely aligned reads were retained for downstream analysis. Gene expression levels were quantified as raw read counts using FeatureCounts in the subread package with an option  \u201c O   fracOverlap 0.8\u201d  and with a proper strand option  s. Given the mixed sequencing batches and library types  we incorporated RUVseq batch correction RUVs  k=1 in DESeq2 differential analysis. Differentially expressed genes were identified by FDR < 0.05. Hierarchical clustering was performed using the Pearson correlation coefficient as a similarity measure under Ward\u2019s criterion  and a heatmap was visualized in z score. Assembly: GRCz10/danRer10 Supplementary files format and content: text of DESeq2 data with LogFC  P value  FDR  normalized expression  and raw counts", "isolated WT sinus venosus", null, "The heart chambers  bulbous arteriosus  and sinus venosus were removed from the adult fish and then separated into their respective tissues. Heart tissues from 20 fish were pooled and then placed in TRIZOL. RNA was harvested using phenol chloroform separation and a PureLink RNA Micro Kit Invitrogen.  The RNA was submitted to the CCHMC core for library generation and sequencing. Singles and paired end sequencing was performed. RNA libraries prepared for sequencing using standard protocols", null, "tissue:isolated WT sinus venosus|cell type:mixed|genotype:WT AB/TU|treatment:adult 6 month 1.5 years", "GSM7524715", "GSM7524715: WT sinus venosus 1; Danio rerio; RNA Seq", "GSM7524715 r1", "GSM7524715", "1", "The heart chambers  bulbous arteriosus  and sinus venosus were removed from the adult fish and then separated into their respective tissues. Heart tissues from 20 fish were pooled and then placed in TRIZOL. RNA was harvested using phenol chloroform separation and a PureLink RNA Micro Kit Invitrogen.  The RNA was submitted to the CCHMC core for library generation and sequencing. Singles and paired end sequencing was performed. RNA libraries prepared for sequencing using standard protocols", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP362545", null, null, "wt_SV_rd1_2.fastq.gz", "fastq", 2310512925.0, 30806839.0, "GSM7524715 r1", "0:75", "A:632214946;C:549666547;G:556861569;T:571611519;N:158344", 75, null, null, null, 632214946, 549666547, 556861569, 571611519, 158344, "SRX20852444", "SRS18129435", null, null, "Molecular Cardiovascular Biology Division, Cincinnati Children's Hospital Medical Center", 1, 0.92139, null, 0.09768, null, 0.74302, null, 0.49941, null, 75, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2023-06-30", "Adult", "Adult", "Heart", "Cardiovascular System"], [68880, "SRR25099324", "SRX20852443", "SRS18129432", "SRP362545", "PRJNA812617", "Sinus venosus adaptation models prolonged cardiovascular disease and reveals insights into evolutionary transitions of the vertebrate heart", "GSE195548", "Transcriptome Analysis", "How two chambered hearts in basal vertebrates have evolved from single chamber hearts found in ancestral chordates remains unclear. Here  we show that the teleost sinus venosus SV is a chamber like vessel comprised of an outer layer of smooth muscle cells. We find that in adult zebrafish nr2f1a mutants  which lack atria  the SV comes to physically resemble the thicker bulbus arteriosus BA at the arterial pole of the heart through an adaptive  hypertensive response involving smooth muscle proliferation due to aberrant hemodynamic flow. Single cell transcriptomics show that smooth muscle and endothelial cell populations within the adapting SV also take on arterial signatures. Bulk transcriptomics of the blood sinuses flanking the tunicate heart reinforce a model of greater equivalency in ancestral chordate BA and SV precursors. Our data simultaneously reveal that secondary complications from congenital heart defects can develop in adult zebrafish similar to those in humans and that the foundation of equivalency between flanking auxiliary vessels may remain latent within basal vertebrate hearts. Overall design: RNA seq of zebrafish heart chambers", "parent bioproject:PRJNA804024", "pubmed:37679366", null, "WT atrium 2", "GSM7524714", null, "source name:isolated WT atrium|tissue:isolated WT atrium|cell type:mixed|genotype:WT AB/TU|treatment:adult 6 month 1.5 years|geo loc name:missing|collection date:missing", "WT atrium 2", "Zebrafish RNA seq reads were aligned to the UCSC zebrafish genome  danRer11  using STAR aligner post trimming the Illumina adapter using cutadapt These libraries were prepped across multiple batches with different library types in terms of RNA strand and sequencing mode single end or paired end. Therefore  we treated them as single end libraries by choosing read1 or read2 to match the strand as much as possible  and batch correction was applied as described below. Only uniquely aligned reads were retained for downstream analysis. Gene expression levels were quantified as raw read counts using FeatureCounts in the subread package with an option  \u201c O   fracOverlap 0.8\u201d  and with a proper strand option  s. Given the mixed sequencing batches and library types  we incorporated RUVseq batch correction RUVs  k=1 in DESeq2 differential analysis. Differentially expressed genes were identified by FDR < 0.05. Hierarchical clustering was performed using the Pearson correlation coefficient as a similarity measure under Ward\u2019s criterion  and a heatmap was visualized in z score. Assembly: GRCz10/danRer10 Supplementary files format and content: text of DESeq2 data with LogFC  P value  FDR  normalized expression  and raw counts", "isolated WT atrium", null, "The heart chambers  bulbous arteriosus  and sinus venosus were removed from the adult fish and then separated into their respective tissues. Heart tissues from 20 fish were pooled and then placed in TRIZOL. RNA was harvested using phenol chloroform separation and a PureLink RNA Micro Kit Invitrogen.  The RNA was submitted to the CCHMC core for library generation and sequencing. Singles and paired end sequencing was performed. RNA libraries prepared for sequencing using standard protocols", null, "tissue:isolated WT atrium|cell type:mixed|genotype:WT AB/TU|treatment:adult 6 month 1.5 years", "GSM7524714", "GSM7524714: WT atrium 2; Danio rerio; RNA Seq", "GSM7524714 r1", "GSM7524714", "1", "The heart chambers  bulbous arteriosus  and sinus venosus were removed from the adult fish and then separated into their respective tissues. Heart tissues from 20 fish were pooled and then placed in TRIZOL. RNA was harvested using phenol chloroform separation and a PureLink RNA Micro Kit Invitrogen.  The RNA was submitted to the CCHMC core for library generation and sequencing. Singles and paired end sequencing was performed. RNA libraries prepared for sequencing using standard protocols", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP362545", null, "loader:fastq load.py", "wt_A_rd2_2.fastq.gz", "fastq", 9618071632.0, 95228432.0, "GSM7524714 r1", "0:101", "A:2705384557;C:2271215897;G:2312565844;T:2328563159;N:342175", 101, null, null, null, 2705384557, 2271215897, 2312565844, 2328563159, 342175, "SRX20852443", "SRS18129432", null, null, "Molecular Cardiovascular Biology Division, Cincinnati Children's Hospital Medical Center", 1, 0.95987, null, 0.07707, null, 0.75004, null, 0.51301, null, 101, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2023-06-30", "Adult", "Adult", "Heart", "Cardiovascular System"], [68881, "SRR25099325", "SRX20852442", "SRS18129431", "SRP362545", "PRJNA812617", "Sinus venosus adaptation models prolonged cardiovascular disease and reveals insights into evolutionary transitions of the vertebrate heart", "GSE195548", "Transcriptome Analysis", "How two chambered hearts in basal vertebrates have evolved from single chamber hearts found in ancestral chordates remains unclear. Here  we show that the teleost sinus venosus SV is a chamber like vessel comprised of an outer layer of smooth muscle cells. We find that in adult zebrafish nr2f1a mutants  which lack atria  the SV comes to physically resemble the thicker bulbus arteriosus BA at the arterial pole of the heart through an adaptive  hypertensive response involving smooth muscle proliferation due to aberrant hemodynamic flow. Single cell transcriptomics show that smooth muscle and endothelial cell populations within the adapting SV also take on arterial signatures. Bulk transcriptomics of the blood sinuses flanking the tunicate heart reinforce a model of greater equivalency in ancestral chordate BA and SV precursors. Our data simultaneously reveal that secondary complications from congenital heart defects can develop in adult zebrafish similar to those in humans and that the foundation of equivalency between flanking auxiliary vessels may remain latent within basal vertebrate hearts. Overall design: RNA seq of zebrafish heart chambers", "parent bioproject:PRJNA804024", "pubmed:37679366", null, "WT atrium 1", "GSM7524713", null, "source name:isolated WT atrium|tissue:isolated WT atrium|cell type:mixed|genotype:WT AB/TU|treatment:adult 6 month 1.5 years|geo loc name:missing|collection date:missing", "WT atrium 1", "Zebrafish RNA seq reads were aligned to the UCSC zebrafish genome  danRer11  using STAR aligner post trimming the Illumina adapter using cutadapt These libraries were prepped across multiple batches with different library types in terms of RNA strand and sequencing mode single end or paired end. Therefore  we treated them as single end libraries by choosing read1 or read2 to match the strand as much as possible  and batch correction was applied as described below. Only uniquely aligned reads were retained for downstream analysis. Gene expression levels were quantified as raw read counts using FeatureCounts in the subread package with an option  \u201c O   fracOverlap 0.8\u201d  and with a proper strand option  s. Given the mixed sequencing batches and library types  we incorporated RUVseq batch correction RUVs  k=1 in DESeq2 differential analysis. Differentially expressed genes were identified by FDR < 0.05. Hierarchical clustering was performed using the Pearson correlation coefficient as a similarity measure under Ward\u2019s criterion  and a heatmap was visualized in z score. Assembly: GRCz10/danRer10 Supplementary files format and content: text of DESeq2 data with LogFC  P value  FDR  normalized expression  and raw counts", "isolated WT atrium", null, "The heart chambers  bulbous arteriosus  and sinus venosus were removed from the adult fish and then separated into their respective tissues. Heart tissues from 20 fish were pooled and then placed in TRIZOL. RNA was harvested using phenol chloroform separation and a PureLink RNA Micro Kit Invitrogen.  The RNA was submitted to the CCHMC core for library generation and sequencing. Singles and paired end sequencing was performed. RNA libraries prepared for sequencing using standard protocols", null, "tissue:isolated WT atrium|cell type:mixed|genotype:WT AB/TU|treatment:adult 6 month 1.5 years", "GSM7524713", "GSM7524713: WT atrium 1; Danio rerio; RNA Seq", "GSM7524713 r1", "GSM7524713", "1", "The heart chambers  bulbous arteriosus  and sinus venosus were removed from the adult fish and then separated into their respective tissues. Heart tissues from 20 fish were pooled and then placed in TRIZOL. RNA was harvested using phenol chloroform separation and a PureLink RNA Micro Kit Invitrogen.  The RNA was submitted to the CCHMC core for library generation and sequencing. Singles and paired end sequencing was performed. RNA libraries prepared for sequencing using standard protocols", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP362545", null, null, "wt_A_rd1_1.fastq.gz", "fastq", 1666726500.0, 22223020.0, "GSM7524713 r1", "0:75", "A:461232696;C:382818598;G:376057945;T:445989781;N:627480", 75, null, null, null, 461232696, 382818598, 376057945, 445989781, 627480, "SRX20852442", "SRS18129431", null, null, "Molecular Cardiovascular Biology Division, Cincinnati Children's Hospital Medical Center", 1, 0.92558, null, 0.0728, null, 0.82016, null, 0.56029, null, 75, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2023-06-30", "Adult", "Adult", "Heart", "Cardiovascular System"], [68882, "SRR25099327", "SRX20852441", "SRS18129430", "SRP362545", "PRJNA812617", "Sinus venosus adaptation models prolonged cardiovascular disease and reveals insights into evolutionary transitions of the vertebrate heart", "GSE195548", "Transcriptome Analysis", "How two chambered hearts in basal vertebrates have evolved from single chamber hearts found in ancestral chordates remains unclear. Here  we show that the teleost sinus venosus SV is a chamber like vessel comprised of an outer layer of smooth muscle cells. We find that in adult zebrafish nr2f1a mutants  which lack atria  the SV comes to physically resemble the thicker bulbus arteriosus BA at the arterial pole of the heart through an adaptive  hypertensive response involving smooth muscle proliferation due to aberrant hemodynamic flow. Single cell transcriptomics show that smooth muscle and endothelial cell populations within the adapting SV also take on arterial signatures. Bulk transcriptomics of the blood sinuses flanking the tunicate heart reinforce a model of greater equivalency in ancestral chordate BA and SV precursors. Our data simultaneously reveal that secondary complications from congenital heart defects can develop in adult zebrafish similar to those in humans and that the foundation of equivalency between flanking auxiliary vessels may remain latent within basal vertebrate hearts. Overall design: RNA seq of zebrafish heart chambers", "parent bioproject:PRJNA804024", "pubmed:37679366", null, "WT ventricle 2", "GSM7524712", null, "source name:isolated WT ventricle|tissue:isolated WT ventricle|cell type:mixed|genotype:WT AB/TU|treatment:adult 6 month 1.5 years|geo loc name:missing|collection date:missing", "WT ventricle 2", "Zebrafish RNA seq reads were aligned to the UCSC zebrafish genome  danRer11  using STAR aligner post trimming the Illumina adapter using cutadapt These libraries were prepped across multiple batches with different library types in terms of RNA strand and sequencing mode single end or paired end. Therefore  we treated them as single end libraries by choosing read1 or read2 to match the strand as much as possible  and batch correction was applied as described below. Only uniquely aligned reads were retained for downstream analysis. Gene expression levels were quantified as raw read counts using FeatureCounts in the subread package with an option  \u201c O   fracOverlap 0.8\u201d  and with a proper strand option  s. Given the mixed sequencing batches and library types  we incorporated RUVseq batch correction RUVs  k=1 in DESeq2 differential analysis. Differentially expressed genes were identified by FDR < 0.05. Hierarchical clustering was performed using the Pearson correlation coefficient as a similarity measure under Ward\u2019s criterion  and a heatmap was visualized in z score. Assembly: GRCz10/danRer10 Supplementary files format and content: text of DESeq2 data with LogFC  P value  FDR  normalized expression  and raw counts", "isolated WT ventricle", null, "The heart chambers  bulbous arteriosus  and sinus venosus were removed from the adult fish and then separated into their respective tissues. Heart tissues from 20 fish were pooled and then placed in TRIZOL. RNA was harvested using phenol chloroform separation and a PureLink RNA Micro Kit Invitrogen.  The RNA was submitted to the CCHMC core for library generation and sequencing. Singles and paired end sequencing was performed. RNA libraries prepared for sequencing using standard protocols", null, "tissue:isolated WT ventricle|cell type:mixed|genotype:WT AB/TU|treatment:adult 6 month 1.5 years", "GSM7524712", "GSM7524712: WT ventricle 2; Danio rerio; RNA Seq", "GSM7524712 r1", "GSM7524712", "1", "The heart chambers  bulbous arteriosus  and sinus venosus were removed from the adult fish and then separated into their respective tissues. Heart tissues from 20 fish were pooled and then placed in TRIZOL. RNA was harvested using phenol chloroform separation and a PureLink RNA Micro Kit Invitrogen.  The RNA was submitted to the CCHMC core for library generation and sequencing. Singles and paired end sequencing was performed. RNA libraries prepared for sequencing using standard protocols", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP362545", null, "loader:fastq load.py", "wt_V_rd2_2.fastq.gz", "fastq", 3399755950.0, 33660950.0, "GSM7524712 r1", "0:101", "A:965986606;C:791240620;G:820060668;T:822348451;N:119605", 101, null, null, null, 965986606, 791240620, 820060668, 822348451, 119605, "SRX20852441", "SRS18129430", null, null, "Molecular Cardiovascular Biology Division, Cincinnati Children's Hospital Medical Center", 1, 0.96322, null, 0.06888, null, 0.78344, null, 0.47569, null, 101, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2023-06-30", "Adult", "Adult", "Heart", "Cardiovascular System"], [68883, "SRR25099328", "SRX20852440", "SRS18129429", "SRP362545", "PRJNA812617", "Sinus venosus adaptation models prolonged cardiovascular disease and reveals insights into evolutionary transitions of the vertebrate heart", "GSE195548", "Transcriptome Analysis", "How two chambered hearts in basal vertebrates have evolved from single chamber hearts found in ancestral chordates remains unclear. Here  we show that the teleost sinus venosus SV is a chamber like vessel comprised of an outer layer of smooth muscle cells. We find that in adult zebrafish nr2f1a mutants  which lack atria  the SV comes to physically resemble the thicker bulbus arteriosus BA at the arterial pole of the heart through an adaptive  hypertensive response involving smooth muscle proliferation due to aberrant hemodynamic flow. Single cell transcriptomics show that smooth muscle and endothelial cell populations within the adapting SV also take on arterial signatures. Bulk transcriptomics of the blood sinuses flanking the tunicate heart reinforce a model of greater equivalency in ancestral chordate BA and SV precursors. Our data simultaneously reveal that secondary complications from congenital heart defects can develop in adult zebrafish similar to those in humans and that the foundation of equivalency between flanking auxiliary vessels may remain latent within basal vertebrate hearts. Overall design: RNA seq of zebrafish heart chambers", "parent bioproject:PRJNA804024", "pubmed:37679366", null, "WT ventricle 1", "GSM7524711", null, "source name:isolated WT ventricle|tissue:isolated WT ventricle|cell type:mixed|genotype:WT AB/TU|treatment:adult 6 month 1.5 years|geo loc name:missing|collection date:missing", "WT ventricle 1", "Zebrafish RNA seq reads were aligned to the UCSC zebrafish genome  danRer11  using STAR aligner post trimming the Illumina adapter using cutadapt These libraries were prepped across multiple batches with different library types in terms of RNA strand and sequencing mode single end or paired end. Therefore  we treated them as single end libraries by choosing read1 or read2 to match the strand as much as possible  and batch correction was applied as described below. Only uniquely aligned reads were retained for downstream analysis. Gene expression levels were quantified as raw read counts using FeatureCounts in the subread package with an option  \u201c O   fracOverlap 0.8\u201d  and with a proper strand option  s. Given the mixed sequencing batches and library types  we incorporated RUVseq batch correction RUVs  k=1 in DESeq2 differential analysis. Differentially expressed genes were identified by FDR < 0.05. Hierarchical clustering was performed using the Pearson correlation coefficient as a similarity measure under Ward\u2019s criterion  and a heatmap was visualized in z score. Assembly: GRCz10/danRer10 Supplementary files format and content: text of DESeq2 data with LogFC  P value  FDR  normalized expression  and raw counts", "isolated WT ventricle", null, "The heart chambers  bulbous arteriosus  and sinus venosus were removed from the adult fish and then separated into their respective tissues. Heart tissues from 20 fish were pooled and then placed in TRIZOL. RNA was harvested using phenol chloroform separation and a PureLink RNA Micro Kit Invitrogen.  The RNA was submitted to the CCHMC core for library generation and sequencing. Singles and paired end sequencing was performed. RNA libraries prepared for sequencing using standard protocols", null, "tissue:isolated WT ventricle|cell type:mixed|genotype:WT AB/TU|treatment:adult 6 month 1.5 years", "GSM7524711", "GSM7524711: WT ventricle 1; Danio rerio; RNA Seq", "GSM7524711 r1", "GSM7524711", "1", "The heart chambers  bulbous arteriosus  and sinus venosus were removed from the adult fish and then separated into their respective tissues. Heart tissues from 20 fish were pooled and then placed in TRIZOL. RNA was harvested using phenol chloroform separation and a PureLink RNA Micro Kit Invitrogen.  The RNA was submitted to the CCHMC core for library generation and sequencing. Singles and paired end sequencing was performed. RNA libraries prepared for sequencing using standard protocols", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP362545", null, null, "wt_V_rd1_1.fastq.gz", "fastq", 1923595950.0, 25647946.0, "GSM7524711 r1", "0:75", "A:529309754;C:459634143;G:443660606;T:490814575;N:176872", 75, null, null, null, 529309754, 459634143, 443660606, 490814575, 176872, "SRX20852440", "SRS18129429", null, null, "Molecular Cardiovascular Biology Division, Cincinnati Children's Hospital Medical Center", 1, 0.9283, null, 0.04487, null, 0.85271, null, 0.54015, null, 75, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2023-06-30", "Adult", "Adult", "Heart", "Cardiovascular System"], [68884, "SRR25099329", "SRX20852439", "SRS18129427", "SRP362545", "PRJNA812617", "Sinus venosus adaptation models prolonged cardiovascular disease and reveals insights into evolutionary transitions of the vertebrate heart", "GSE195548", "Transcriptome Analysis", "How two chambered hearts in basal vertebrates have evolved from single chamber hearts found in ancestral chordates remains unclear. Here  we show that the teleost sinus venosus SV is a chamber like vessel comprised of an outer layer of smooth muscle cells. We find that in adult zebrafish nr2f1a mutants  which lack atria  the SV comes to physically resemble the thicker bulbus arteriosus BA at the arterial pole of the heart through an adaptive  hypertensive response involving smooth muscle proliferation due to aberrant hemodynamic flow. Single cell transcriptomics show that smooth muscle and endothelial cell populations within the adapting SV also take on arterial signatures. Bulk transcriptomics of the blood sinuses flanking the tunicate heart reinforce a model of greater equivalency in ancestral chordate BA and SV precursors. Our data simultaneously reveal that secondary complications from congenital heart defects can develop in adult zebrafish similar to those in humans and that the foundation of equivalency between flanking auxiliary vessels may remain latent within basal vertebrate hearts. Overall design: RNA seq of zebrafish heart chambers", "parent bioproject:PRJNA804024", "pubmed:37679366", null, "WT bulbous arteriosus 2", "GSM7524710", null, "source name:isolated WT bulbous arteriosus|tissue:isolated WT bulbous arteriosus|cell type:mixed|genotype:WT AB/TU|treatment:adult 6 month 1.5 years|geo loc name:missing|collection date:missing", "WT bulbous arteriosus 2", "Zebrafish RNA seq reads were aligned to the UCSC zebrafish genome  danRer11  using STAR aligner post trimming the Illumina adapter using cutadapt These libraries were prepped across multiple batches with different library types in terms of RNA strand and sequencing mode single end or paired end. Therefore  we treated them as single end libraries by choosing read1 or read2 to match the strand as much as possible  and batch correction was applied as described below. Only uniquely aligned reads were retained for downstream analysis. Gene expression levels were quantified as raw read counts using FeatureCounts in the subread package with an option  \u201c O   fracOverlap 0.8\u201d  and with a proper strand option  s. Given the mixed sequencing batches and library types  we incorporated RUVseq batch correction RUVs  k=1 in DESeq2 differential analysis. Differentially expressed genes were identified by FDR < 0.05. Hierarchical clustering was performed using the Pearson correlation coefficient as a similarity measure under Ward\u2019s criterion  and a heatmap was visualized in z score. Assembly: GRCz10/danRer10 Supplementary files format and content: text of DESeq2 data with LogFC  P value  FDR  normalized expression  and raw counts", "isolated WT bulbous arteriosus", null, "The heart chambers  bulbous arteriosus  and sinus venosus were removed from the adult fish and then separated into their respective tissues. Heart tissues from 20 fish were pooled and then placed in TRIZOL. RNA was harvested using phenol chloroform separation and a PureLink RNA Micro Kit Invitrogen.  The RNA was submitted to the CCHMC core for library generation and sequencing. Singles and paired end sequencing was performed. RNA libraries prepared for sequencing using standard protocols", null, "tissue:isolated WT bulbous arteriosus|cell type:mixed|genotype:WT AB/TU|treatment:adult 6 month 1.5 years", "GSM7524710", "GSM7524710: WT bulbous arteriosus 2; Danio rerio; RNA Seq", "GSM7524710 r1", "GSM7524710", "1", "The heart chambers  bulbous arteriosus  and sinus venosus were removed from the adult fish and then separated into their respective tissues. Heart tissues from 20 fish were pooled and then placed in TRIZOL. RNA was harvested using phenol chloroform separation and a PureLink RNA Micro Kit Invitrogen.  The RNA was submitted to the CCHMC core for library generation and sequencing. Singles and paired end sequencing was performed. RNA libraries prepared for sequencing using standard protocols", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP362545", null, "loader:fastq load.py", "wt_BA_rd2_2.fastq.gz", "fastq", 3512439529.0, 34776629.0, "GSM7524710 r1", "0:101", "A:965179060;C:835026230;G:876405202;T:835704294;N:124743", 101, null, null, null, 965179060, 835026230, 876405202, 835704294, 124743, "SRX20852439", "SRS18129427", null, null, "Molecular Cardiovascular Biology Division, Cincinnati Children's Hospital Medical Center", 1, 0.96002, null, 0.08977, null, 0.74923, null, 0.4637, null, 101, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2023-06-30", "Adult", "Adult", "Heart", "Cardiovascular System"], [68885, "SRR25099330", "SRX20852438", "SRS18129428", "SRP362545", "PRJNA812617", "Sinus venosus adaptation models prolonged cardiovascular disease and reveals insights into evolutionary transitions of the vertebrate heart", "GSE195548", "Transcriptome Analysis", "How two chambered hearts in basal vertebrates have evolved from single chamber hearts found in ancestral chordates remains unclear. Here  we show that the teleost sinus venosus SV is a chamber like vessel comprised of an outer layer of smooth muscle cells. We find that in adult zebrafish nr2f1a mutants  which lack atria  the SV comes to physically resemble the thicker bulbus arteriosus BA at the arterial pole of the heart through an adaptive  hypertensive response involving smooth muscle proliferation due to aberrant hemodynamic flow. Single cell transcriptomics show that smooth muscle and endothelial cell populations within the adapting SV also take on arterial signatures. Bulk transcriptomics of the blood sinuses flanking the tunicate heart reinforce a model of greater equivalency in ancestral chordate BA and SV precursors. Our data simultaneously reveal that secondary complications from congenital heart defects can develop in adult zebrafish similar to those in humans and that the foundation of equivalency between flanking auxiliary vessels may remain latent within basal vertebrate hearts. Overall design: RNA seq of zebrafish heart chambers", "parent bioproject:PRJNA804024", "pubmed:37679366", null, "WT bulbous arteriosus 1", "GSM7524709", null, "source name:isolated WT bulbous arteriosus|tissue:isolated WT bulbous arteriosus|cell type:mixed|genotype:WT AB/TU|treatment:adult 6 month 1.5 years|geo loc name:missing|collection date:missing", "WT bulbous arteriosus 1", "Zebrafish RNA seq reads were aligned to the UCSC zebrafish genome  danRer11  using STAR aligner post trimming the Illumina adapter using cutadapt These libraries were prepped across multiple batches with different library types in terms of RNA strand and sequencing mode single end or paired end. Therefore  we treated them as single end libraries by choosing read1 or read2 to match the strand as much as possible  and batch correction was applied as described below. Only uniquely aligned reads were retained for downstream analysis. Gene expression levels were quantified as raw read counts using FeatureCounts in the subread package with an option  \u201c O   fracOverlap 0.8\u201d  and with a proper strand option  s. Given the mixed sequencing batches and library types  we incorporated RUVseq batch correction RUVs  k=1 in DESeq2 differential analysis. Differentially expressed genes were identified by FDR < 0.05. Hierarchical clustering was performed using the Pearson correlation coefficient as a similarity measure under Ward\u2019s criterion  and a heatmap was visualized in z score. Assembly: GRCz10/danRer10 Supplementary files format and content: text of DESeq2 data with LogFC  P value  FDR  normalized expression  and raw counts", "isolated WT bulbous arteriosus", null, "The heart chambers  bulbous arteriosus  and sinus venosus were removed from the adult fish and then separated into their respective tissues. Heart tissues from 20 fish were pooled and then placed in TRIZOL. RNA was harvested using phenol chloroform separation and a PureLink RNA Micro Kit Invitrogen.  The RNA was submitted to the CCHMC core for library generation and sequencing. Singles and paired end sequencing was performed. RNA libraries prepared for sequencing using standard protocols", null, "tissue:isolated WT bulbous arteriosus|cell type:mixed|genotype:WT AB/TU|treatment:adult 6 month 1.5 years", "GSM7524709", "GSM7524709: WT bulbous arteriosus 1; Danio rerio; RNA Seq", "GSM7524709 r1", "GSM7524709", "1", "The heart chambers  bulbous arteriosus  and sinus venosus were removed from the adult fish and then separated into their respective tissues. Heart tissues from 20 fish were pooled and then placed in TRIZOL. RNA was harvested using phenol chloroform separation and a PureLink RNA Micro Kit Invitrogen.  The RNA was submitted to the CCHMC core for library generation and sequencing. Singles and paired end sequencing was performed. RNA libraries prepared for sequencing using standard protocols", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP362545", null, null, "wt_BA_rd1_1.fastq.gz", "fastq", 1313235525.0, 10293122.0, "GSM7524709 r1", null, "A:345513405;C:318282861;G:294671645;T:354720674;N:46940", null, null, null, null, 345513405, 318282861, 294671645, 354720674, 46940, "SRX20852438", "SRS18129428", null, null, "Molecular Cardiovascular Biology Division, Cincinnati Children's Hospital Medical Center", 2, 0.90566, 0.90567, 0.09466, 0.09459, 0.80257, 0.80294, 0.47525, 0.47428, 75, 75, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2023-06-30", "Adult", "Adult", "Heart", "Cardiovascular System"], [69528, "SRR22489946", "SRX18455102", "SRS15933712", "SRP371323", "PRJNA828542", "RNA seq experiments on heart regeneration in WT  foxm1 and dusp6 mutants.", "GSE201139", "Transcriptome Analysis", "The study compares gene expression profile at several stages post amputation of the adult zebrafish ventricular heart between zebrafish mutants and WT siblings. The first experiment was to identify genes that are activated in response to cardiac injury at 3 and 7 dy post amputation dpa. Dusp6 mutant hearts were reported to show an enhanced regenerative response. For this experiment  bulk RNA seq was obtained from WT and Dusp6 mutant hearts and genes increased at 3 and 7 dpa were identified. The forkhead transcription factor  foxm1  showed increased expression in cardiomyocytes and follow up studies show that it is required to regulate cardiomyocyte proliferation. This was further explored with RNA seq experiments comparing WT and foxm1 mutant hearts at 3dpa. We identified genes normally expressed in proliferating cells to be decreased in the foxm1 mutants. Overall design: Ventricular resection was performed on WT  dusp6 and foxm1 mutant hearts. Uninjured adult hearts were used as control to compare to hearts at 3 and 7 dy post amputation dpa.", null, "pubmed:36846912", null, "dusp6 mutant heart 7dpa", "GSM6775413", null, "source name:Heart|tissue:Heart|genotype:dusp6 pt30a/pt30a|time point:7dpa", "dusp6 mutant heart 7dpa", "fastq files were analyzed using CLC genomics workbench 20.0 sequence reads were mapped onto Danio rerio GRC.z11 EDGE test was performed using CLC genomics workbench Assembly: Danio rerio GRC.z11 Supplementary files format and content: Zuppo et al 7dpa vs. uninj.xlsx", "Heart", null, "Adutls hearts were injured through ventricular resection and allowed to recover until 7 dy post amputation. Ventricles were removed  flash frozen on dry ice  and RNA was harvested using Trizol reagent and Quiagen RNeasy micro kit Cat# 74004.", "Zebrafish adult at 6 month  1year of age", "tissue:Heart|genotype:dusp6 pt30a/pt30a|time point:7dpa", "GSM6775413", "GSM6775413: dusp6 mutant heart 7dpa; Danio rerio; RNA Seq", "GSM6775413 r1", "GSM6775413", "1", "Adutls hearts were injured through ventricular resection and allowed to recover until 7 dy post amputation. Ventricles were removed  flash frozen on dry ice  and RNA was harvested using Trizol reagent and Quiagen RNeasy micro kit Cat# 74004.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP371323", null, null, "Dusp6mut_1-2_mut2_7dpa_S2_R1_001.fastq.gz", "fastq", 11367642853.0, 75282403.0, "GSM6775413 r1", "0:151 1:0", "A:3176725758;C:2631865064;G:2593264323;T:2965392217;N:395491", 151, 0, null, null, 3176725758, 2631865064, 2593264323, 2965392217, 395491, "SRX18455102", "SRS15933712", "SRA1550906", "Developmental Biology, University of Pittsburgh", "Developmental Biology, University of Pittsburgh", 1, 0.89984, null, 0.07355, null, 0.76552, null, 0.51764, null, 151, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2022-12-01", "Adult", "Adult", "Heart", "Cardiovascular System"], [69529, "SRR22489947", "SRX18455101", "SRS15933713", "SRP371323", "PRJNA828542", "RNA seq experiments on heart regeneration in WT  foxm1 and dusp6 mutants.", "GSE201139", "Transcriptome Analysis", "The study compares gene expression profile at several stages post amputation of the adult zebrafish ventricular heart between zebrafish mutants and WT siblings. The first experiment was to identify genes that are activated in response to cardiac injury at 3 and 7 dy post amputation dpa. Dusp6 mutant hearts were reported to show an enhanced regenerative response. For this experiment  bulk RNA seq was obtained from WT and Dusp6 mutant hearts and genes increased at 3 and 7 dpa were identified. The forkhead transcription factor  foxm1  showed increased expression in cardiomyocytes and follow up studies show that it is required to regulate cardiomyocyte proliferation. This was further explored with RNA seq experiments comparing WT and foxm1 mutant hearts at 3dpa. We identified genes normally expressed in proliferating cells to be decreased in the foxm1 mutants. Overall design: Ventricular resection was performed on WT  dusp6 and foxm1 mutant hearts. Uninjured adult hearts were used as control to compare to hearts at 3 and 7 dy post amputation dpa.", null, "pubmed:36846912", null, "WT heart 7dpa", "GSM6775412", null, "source name:Heart|tissue:Heart|genotype:AB*|time point:7dpa", "WT heart 7dpa", "fastq files were analyzed using CLC genomics workbench 20.0 sequence reads were mapped onto Danio rerio GRC.z11 EDGE test was performed using CLC genomics workbench Assembly: Danio rerio GRC.z11 Supplementary files format and content: Zuppo et al 7dpa vs. uninj.xlsx", "Heart", null, "Adutls hearts were injured through ventricular resection and allowed to recover until 7 dy post amputation. Ventricles were removed  flash frozen on dry ice  and RNA was harvested using Trizol reagent and Quiagen RNeasy micro kit Cat# 74004.", "Zebrafish adult at 6 month  1year of age", "tissue:Heart|genotype:AB*|time point:7dpa", "GSM6775412", "GSM6775412: WT heart 7dpa; Danio rerio; RNA Seq", "GSM6775412 r1", "GSM6775412", "1", "Adutls hearts were injured through ventricular resection and allowed to recover until 7 dy post amputation. Ventricles were removed  flash frozen on dry ice  and RNA was harvested using Trizol reagent and Quiagen RNeasy micro kit Cat# 74004.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP371323", null, null, "Wt_1-2_Wt2_7dpa_S1_R1_001.fastq.gz", "fastq", 12872883182.0, 85250882.0, "GSM6775412 r1", "0:151 1:0", "A:3575062004;C:2980475677;G:2968169651;T:3348722223;N:453627", 151, 0, null, null, 3575062004, 2980475677, 2968169651, 3348722223, 453627, "SRX18455101", "SRS15933713", "SRA1550906", "Developmental Biology, University of Pittsburgh", "Developmental Biology, University of Pittsburgh", 1, 0.89153, null, 0.07646, null, 0.75948, null, 0.50786, null, 151, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2022-12-01", "Adult", "Adult", "Heart", "Cardiovascular System"], [69536, "SRR18837603", "SRX14935575", "SRS12686397", "SRP371323", "PRJNA828542", "RNA seq experiments on heart regeneration in WT  foxm1 and dusp6 mutants.", "GSE201139", "Transcriptome Analysis", "The study compares gene expression profile at several stages post amputation of the adult zebrafish ventricular heart between zebrafish mutants and WT siblings. The first experiment was to identify genes that are activated in response to cardiac injury at 3 and 7 dy post amputation dpa. Dusp6 mutant hearts were reported to show an enhanced regenerative response. For this experiment  bulk RNA seq was obtained from WT and Dusp6 mutant hearts and genes increased at 3 and 7 dpa were identified. The forkhead transcription factor  foxm1  showed increased expression in cardiomyocytes and follow up studies show that it is required to regulate cardiomyocyte proliferation. This was further explored with RNA seq experiments comparing WT and foxm1 mutant hearts at 3dpa. We identified genes normally expressed in proliferating cells to be decreased in the foxm1 mutants. Overall design: Ventricular resection was performed on WT  dusp6 and foxm1 mutant hearts. Uninjured adult hearts were used as control to compare to hearts at 3 and 7 dy post amputation dpa.", null, "pubmed:36846912", null, "Dusp6 mutant heart 3dpa expt. 1", "GSM6051599", null, "source name:Heart|tissue:Heart|genotype:dusp6 pt30a/pt30a", "Dusp6 mutant heart 3dpa expt. 1", "fastq files were analyzed using CLC genomics workbench 20.0 sequence reads were mapped onto Danio rerio GRC.z11 EDGE test was performed using CLC genomics workbench Assembly: Danio rerio GRC.z11 Supplementary files format and content: Zuppo 3dpa vs. uninj.xlsx Supplementary files format and content: Zuppo WT vs foxm1mut 3dpa.xlsx", "Heart", null, "Adutls hearts were injured through ventricular resection and allowed to recover until 3 dy post amputation. Ventricles were removed  flash frozen on dry ice  and RNA was harvested using Trizol reagent and Quiagen RNeasy micro kit Cat# 74004.", "Zebrafish adult at 6 1year of age", "tissue:Heart|genotype:dusp6 pt30a/pt30a", "GSM6051599", "GSM6051599: Dusp6 mutant heart 3dpa expt. 1; Danio rerio; RNA Seq", "GSM6051599 r1", "GSM6051599", "1", "Adutls hearts were injured through ventricular resection and allowed to recover until 3 dy post amputation. Ventricles were removed  flash frozen on dry ice  and RNA was harvested using Trizol reagent and Quiagen RNeasy micro kit Cat# 74004.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP371323", null, null, "Sample_4_5_Dusp6-KO_3dpa.R1.fastq", "fastq", 10458082424.0, 69258824.0, "GSM6051599 r1", "0:151 1:0", "A:2921567231;C:2380184370;G:2341511961;T:2813882994;N:935868", 151, 0, null, null, 2921567231, 2380184370, 2341511961, 2813882994, 935868, "SRX14935575", "SRS12686397", "SRA1407669", "Developmental Biology, University of Pittsburgh", "Developmental Biology, University of Pittsburgh", 1, 0.91981, null, 0.09262, null, 0.74828, null, 0.50789, null, 151, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2022-04-20", "Adult", "Adult", "Heart", "Cardiovascular System"], [69537, "SRR18837604", "SRX14935574", "SRS12686396", "SRP371323", "PRJNA828542", "RNA seq experiments on heart regeneration in WT  foxm1 and dusp6 mutants.", "GSE201139", "Transcriptome Analysis", "The study compares gene expression profile at several stages post amputation of the adult zebrafish ventricular heart between zebrafish mutants and WT siblings. The first experiment was to identify genes that are activated in response to cardiac injury at 3 and 7 dy post amputation dpa. Dusp6 mutant hearts were reported to show an enhanced regenerative response. For this experiment  bulk RNA seq was obtained from WT and Dusp6 mutant hearts and genes increased at 3 and 7 dpa were identified. The forkhead transcription factor  foxm1  showed increased expression in cardiomyocytes and follow up studies show that it is required to regulate cardiomyocyte proliferation. This was further explored with RNA seq experiments comparing WT and foxm1 mutant hearts at 3dpa. We identified genes normally expressed in proliferating cells to be decreased in the foxm1 mutants. Overall design: Ventricular resection was performed on WT  dusp6 and foxm1 mutant hearts. Uninjured adult hearts were used as control to compare to hearts at 3 and 7 dy post amputation dpa.", null, "pubmed:36846912", null, "WT heart 3dpa expt. 1", "GSM6051598", null, "source name:Heart|tissue:Heart|genotype:AB*", "WT heart 3dpa expt. 1", "fastq files were analyzed using CLC genomics workbench 20.0 sequence reads were mapped onto Danio rerio GRC.z11 EDGE test was performed using CLC genomics workbench Assembly: Danio rerio GRC.z11 Supplementary files format and content: Zuppo 3dpa vs. uninj.xlsx Supplementary files format and content: Zuppo WT vs foxm1mut 3dpa.xlsx", "Heart", null, "Adutls hearts were injured through ventricular resection and allowed to recover until 3 dy post amputation. Ventricles were removed  flash frozen on dry ice  and RNA was harvested using Trizol reagent and Quiagen RNeasy micro kit Cat# 74004.", "Zebrafish adult at 6 1year of age", "tissue:Heart|genotype:AB*", "GSM6051598", "GSM6051598: WT heart 3dpa expt. 1; Danio rerio; RNA Seq", "GSM6051598 r1", "GSM6051598", "1", "Adutls hearts were injured through ventricular resection and allowed to recover until 3 dy post amputation. Ventricles were removed  flash frozen on dry ice  and RNA was harvested using Trizol reagent and Quiagen RNeasy micro kit Cat# 74004.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP371323", null, null, "Sample_3_3_WT_3dpa.R1.fastq", "fastq", 10162908077.0, 67304027.0, "GSM6051598 r1", "0:151 1:0", "A:2833961004;C:2314358906;G:2288793270;T:2724863071;N:931826", 151, 0, null, null, 2833961004, 2314358906, 2288793270, 2724863071, 931826, "SRX14935574", "SRS12686396", "SRA1407669", "Developmental Biology, University of Pittsburgh", "Developmental Biology, University of Pittsburgh", 1, 0.91678, null, 0.09548, null, 0.7302, null, 0.51247, null, 151, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2022-04-20", "Adult", "Adult", "Heart", "Cardiovascular System"], [69538, "SRR18837605", "SRX14935573", "SRS12686395", "SRP371323", "PRJNA828542", "RNA seq experiments on heart regeneration in WT  foxm1 and dusp6 mutants.", "GSE201139", "Transcriptome Analysis", "The study compares gene expression profile at several stages post amputation of the adult zebrafish ventricular heart between zebrafish mutants and WT siblings. The first experiment was to identify genes that are activated in response to cardiac injury at 3 and 7 dy post amputation dpa. Dusp6 mutant hearts were reported to show an enhanced regenerative response. For this experiment  bulk RNA seq was obtained from WT and Dusp6 mutant hearts and genes increased at 3 and 7 dpa were identified. The forkhead transcription factor  foxm1  showed increased expression in cardiomyocytes and follow up studies show that it is required to regulate cardiomyocyte proliferation. This was further explored with RNA seq experiments comparing WT and foxm1 mutant hearts at 3dpa. We identified genes normally expressed in proliferating cells to be decreased in the foxm1 mutants. Overall design: Ventricular resection was performed on WT  dusp6 and foxm1 mutant hearts. Uninjured adult hearts were used as control to compare to hearts at 3 and 7 dy post amputation dpa.", null, "pubmed:36846912", null, "dusp6 mutant heart uninjured expt. 1", "GSM6051597", null, "source name:Heart|tissue:Heart|genotype:dusp6 pt30a/pt30a", "dusp6 mutant heart uninjured expt. 1", "fastq files were analyzed using CLC genomics workbench 20.0 sequence reads were mapped onto Danio rerio GRC.z11 EDGE test was performed using CLC genomics workbench Assembly: Danio rerio GRC.z11 Supplementary files format and content: Zuppo 3dpa vs. uninj.xlsx Supplementary files format and content: Zuppo WT vs foxm1mut 3dpa.xlsx", "Heart", null, "Adutls hearts were injured through ventricular resection and allowed to recover until 3 dy post amputation. Ventricles were removed  flash frozen on dry ice  and RNA was harvested using Trizol reagent and Quiagen RNeasy micro kit Cat# 74004.", "Zebrafish adult at 6 1year of age", "tissue:Heart|genotype:dusp6 pt30a/pt30a", "GSM6051597", "GSM6051597: dusp6 mutant heart uninjured expt. 1; Danio rerio; RNA Seq", "GSM6051597 r1", "GSM6051597", "1", "Adutls hearts were injured through ventricular resection and allowed to recover until 3 dy post amputation. Ventricles were removed  flash frozen on dry ice  and RNA was harvested using Trizol reagent and Quiagen RNeasy micro kit Cat# 74004.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP371323", null, null, "Sample_2_all_Dusp6-KO_uninjured.R1.fastq", "fastq", 12269806094.0, 81256994.0, "GSM6051597 r1", "0:151 1:0", "A:3430294578;C:2829837039;G:2769722858;T:3238835882;N:1115737", 151, 0, null, null, 3430294578, 2829837039, 2769722858, 3238835882, 1115737, "SRX14935573", "SRS12686395", "SRA1407669", "Developmental Biology, University of Pittsburgh", "Developmental Biology, University of Pittsburgh", 1, 0.92973, null, 0.07301, null, 0.76936, null, 0.5109, null, 151, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2022-04-20", "Adult", "Adult", "Heart", "Cardiovascular System"], [69539, "SRR18837606", "SRX14935572", "SRS12686394", "SRP371323", "PRJNA828542", "RNA seq experiments on heart regeneration in WT  foxm1 and dusp6 mutants.", "GSE201139", "Transcriptome Analysis", "The study compares gene expression profile at several stages post amputation of the adult zebrafish ventricular heart between zebrafish mutants and WT siblings. The first experiment was to identify genes that are activated in response to cardiac injury at 3 and 7 dy post amputation dpa. Dusp6 mutant hearts were reported to show an enhanced regenerative response. For this experiment  bulk RNA seq was obtained from WT and Dusp6 mutant hearts and genes increased at 3 and 7 dpa were identified. The forkhead transcription factor  foxm1  showed increased expression in cardiomyocytes and follow up studies show that it is required to regulate cardiomyocyte proliferation. This was further explored with RNA seq experiments comparing WT and foxm1 mutant hearts at 3dpa. We identified genes normally expressed in proliferating cells to be decreased in the foxm1 mutants. Overall design: Ventricular resection was performed on WT  dusp6 and foxm1 mutant hearts. Uninjured adult hearts were used as control to compare to hearts at 3 and 7 dy post amputation dpa.", null, "pubmed:36846912", null, "WT heart uninjured expt. 1", "GSM6051596", null, "source name:Heart|tissue:Heart|genotype:AB*", "WT heart uninjured expt. 1", "fastq files were analyzed using CLC genomics workbench 20.0 sequence reads were mapped onto Danio rerio GRC.z11 EDGE test was performed using CLC genomics workbench Assembly: Danio rerio GRC.z11 Supplementary files format and content: Zuppo 3dpa vs. uninj.xlsx Supplementary files format and content: Zuppo WT vs foxm1mut 3dpa.xlsx", "Heart", null, "Adutls hearts were injured through ventricular resection and allowed to recover until 3 dy post amputation. Ventricles were removed  flash frozen on dry ice  and RNA was harvested using Trizol reagent and Quiagen RNeasy micro kit Cat# 74004.", "Zebrafish adult at 6 1year of age", "tissue:Heart|genotype:AB*", "GSM6051596", "GSM6051596: WT heart uninjured expt. 1; Danio rerio; RNA Seq", "GSM6051596 r1", "GSM6051596", "1", "Adutls hearts were injured through ventricular resection and allowed to recover until 3 dy post amputation. Ventricles were removed  flash frozen on dry ice  and RNA was harvested using Trizol reagent and Quiagen RNeasy micro kit Cat# 74004.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP371323", null, null, "Sample_1_all_WT_uninjured.R1.fastq", "fastq", 12463416935.0, 82539185.0, "GSM6051596 r1", "0:151 1:0", "A:3464267461;C:2849577899;G:2816631155;T:3331804864;N:1135556", 151, 0, null, null, 3464267461, 2849577899, 2816631155, 3331804864, 1135556, "SRX14935572", "SRS12686394", "SRA1407669", "Developmental Biology, University of Pittsburgh", "Developmental Biology, University of Pittsburgh", 1, 0.92887, null, 0.07611, null, 0.7668, null, 0.48165, null, 151, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2022-04-20", "Adult", "Adult", "Heart", "Cardiovascular System"]], "truncated": false, "filtered_table_rows_count": 80, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"experiment.library_layout\" = :p0 and \"technology\" = :p1 and \"tissue_curation\" = :p2 order by rowid limit 101", "params": {"p0": "SINGLE", "p1": "bulk", "p2": "Heart"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=bulk&tissue_curation=Heart", "results": [{"value": "RNA-Seq", "label": "RNA-Seq", "count": 80, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=bulk&tissue_curation=Heart&experiment.library_strategy=RNA-Seq", "selected": false}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=bulk&tissue_curation=Heart", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 80, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=bulk&tissue_curation=Heart&experiment.library_source=TRANSCRIPTOMIC", "selected": false}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=bulk&tissue_curation=Heart", "results": [{"value": "cDNA", "label": "cDNA", "count": 72, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=bulk&tissue_curation=Heart&experiment.library_selection=cDNA", "selected": false}, {"value": "size fractionation", "label": "size fractionation", "count": 8, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=bulk&tissue_curation=Heart&experiment.library_selection=size+fractionation", "selected": false}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=bulk&tissue_curation=Heart", "results": [{"value": "SINGLE", "label": "SINGLE", "count": 80, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?technology=bulk&tissue_curation=Heart", "selected": true}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=bulk&tissue_curation=Heart", "results": [{"value": "ILLUMINA", "label": "ILLUMINA", "count": 80, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=bulk&tissue_curation=Heart&experiment.platform=ILLUMINA", "selected": false}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=bulk&tissue_curation=Heart", "results": [{"value": "Adult", "label": "Adult", "count": 50, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=bulk&tissue_curation=Heart&devstage_curation_coarse=Adult", "selected": false}, {"value": "Undetermined", "label": "Undetermined", "count": 20, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=bulk&tissue_curation=Heart&devstage_curation_coarse=Undetermined", "selected": false}, {"value": "Embryo", "label": "Embryo", "count": 10, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=bulk&tissue_curation=Heart&devstage_curation_coarse=Embryo", "selected": false}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=bulk&tissue_curation=Heart", "results": [{"value": "Adult", "label": "Adult", "count": 50, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=bulk&tissue_curation=Heart&devstage_curation=Adult", "selected": false}, {"value": "Undetermined", "label": "Undetermined", "count": 20, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=bulk&tissue_curation=Heart&devstage_curation=Undetermined", "selected": false}, {"value": "Pharyngula", "label": "Pharyngula", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=bulk&tissue_curation=Heart&devstage_curation=Pharyngula", "selected": false}, {"value": "Hatching", "label": "Hatching", "count": 4, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=bulk&tissue_curation=Heart&devstage_curation=Hatching", "selected": false}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=bulk&tissue_curation=Heart", "results": [{"value": "Cardiovascular System", "label": "Cardiovascular System", "count": 80, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=bulk&tissue_curation=Heart&tissue_curation_coarse=Cardiovascular+System", "selected": false}], "truncated": false}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=bulk&tissue_curation=Heart", "results": [{"value": "Heart", "label": "Heart", "count": 80, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=bulk", "selected": true}], "truncated": false}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=bulk&tissue_curation=Heart", "results": [{"value": "bulk", "label": "bulk", "count": 80, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation=Heart", "selected": true}], "truncated": false}}, "suggested_facets": [], "next": null, "next_url": null, "private": false, "allow_execute_sql": true, "query_ms": 121.57495200517587}