{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where experiment.library_layout = \"SINGLE\", technology = 454 and tissue_curation_coarse = \"Hematopoietic System\"", "rows": [[67908, "SRR017341", "SRX003632", "SRS002067", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish N", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishN", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "N_fish.tar", "fastq", 40231384.0, 173756.0, "Zebrafish IgH cDNA FishN", "0:4 1:227.54", "A:10436935;C:8800020;G:9512025;T:11471941;N:10463", 4, 227, null, null, 10436935, 8800020, 9512025, 11471941, 10463, "SRX003632", "SRS002067", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.26487, null, 0.0663, null, 0.99304, null, 0.01389, null, 229, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67909, "SRR017340", "SRX003631", "SRS002066", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish M", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishM", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "M_fish.tar", "fastq", 37492198.0, 161639.0, "Zebrafish IgH cDNA FishM", "0:4 1:227.95", "A:9527141;C:8129088;G:9025760;T:10804127;N:6082", 4, 227, null, null, 9527141, 8129088, 9025760, 10804127, 6082, "SRX003631", "SRS002066", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.31521, null, 0.11394, null, 0.99823, null, 0.00291, null, 208, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67910, "SRR017339", "SRX003630", "SRS002065", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish L", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishL", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "L_fish.tar", "fastq", 37971443.0, 163701.0, "Zebrafish IgH cDNA FishL", "0:4 1:227.96", "A:9544875;C:8363123;G:9094601;T:10963684;N:5160", 4, 227, null, null, 9544875, 8363123, 9094601, 10963684, 5160, "SRX003630", "SRS002065", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.29057, null, 0.07862, null, 0.99636, null, 0.00534, null, 245, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67911, "SRR017338", "SRX003629", "SRS002064", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish K", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishK", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "K_fish.tar", "fastq", 54201403.0, 234266.0, "Zebrafish IgH cDNA FishK", "0:4 1:227.37", "A:13608677;C:11652239;G:12945164;T:15975205;N:20118", 4, 227, null, null, 13608677, 11652239, 12945164, 15975205, 20118, "SRX003629", "SRS002064", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.27218, null, 0.07987, null, 0.99275, null, 0.01242, null, 244, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67912, "SRR017337", "SRX003628", "SRS002063", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish J", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishJ", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "J_fish.tar", "fastq", 51915342.0, 224027.0, "Zebrafish IgH cDNA FishJ", "0:4 1:227.74", "A:12664582;C:12040983;G:12609762;T:14589770;N:10245", 4, 227, null, null, 12664582, 12040983, 12609762, 14589770, 10245, "SRX003628", "SRS002063", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.29028, null, 0.10039, null, 0.9964, null, 0.00625, null, 97, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67913, "SRR017336", "SRX003627", "SRS002062", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish I", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishI", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "I_fish.tar", "fastq", 23436268.0, 100120.0, "Zebrafish IgH cDNA FishI", "0:4 1:230.08", "A:5801823;C:5246438;G:5587169;T:6797624;N:3214", 4, 230, null, null, 5801823, 5246438, 5587169, 6797624, 3214, "SRX003627", "SRS002062", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.34362, null, 0.0757, null, 0.99241, null, 0.02647, null, 232, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67914, "SRR017335", "SRX003626", "SRS002061", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish H", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishH", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "H_fish.tar", "fastq", 48443452.0, 213531.0, "Zebrafish IgH cDNA FishH", "0:4 1:222.87", "A:12720681;C:10490855;G:11923926;T:13303989;N:4001", 4, 222, null, null, 12720681, 10490855, 11923926, 13303989, 4001, "SRX003626", "SRS002061", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.45847, null, 0.04709, null, 0.98754, null, 0.0161, null, 56, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67915, "SRR017334", "SRX003625", "SRS002060", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish G", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishG", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "G_fish.tar", "fastq", 50095821.0, 217866.0, "Zebrafish IgH cDNA FishG", "0:4 1:225.94", "A:13182103;C:11299206;G:11909574;T:13700817;N:4121", 4, 225, null, null, 13182103, 11299206, 11909574, 13700817, 4121, "SRX003625", "SRS002060", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.37294, null, 0.09947, null, 0.99034, null, 0.02245, null, 230, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67916, "SRR017333", "SRX003624", "SRS002059", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish F", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishF", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "F_fish.tar", "fastq", 16577798.0, 83387.0, "Zebrafish IgH cDNA FishF", "0:4 1:194.81", "A:4215316;C:3618457;G:4002690;T:4736893;N:4442", 4, 194, null, null, 4215316, 3618457, 4002690, 4736893, 4442, "SRX003624", "SRS002059", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.57361, null, 0.0727, null, 0.99965, null, 0.00026, null, 62, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67917, "SRR017332", "SRX003623", "SRS002058", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish E", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishE", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "E_fish.tar", "fastq", 29705006.0, 131553.0, "Zebrafish IgH cDNA FishE", "0:4 1:221.80", "A:7474430;C:6417563;G:7115572;T:8693543;N:3898", 4, 221, null, null, 7474430, 6417563, 7115572, 8693543, 3898, "SRX003623", "SRS002058", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.3099, null, 0.09802, null, 0.99904, null, 0.00099, null, 45, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67918, "SRR017331", "SRX003622", "SRS002057", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish D", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishD", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "D_fish.tar", "fastq", 27611909.0, 123468.0, "Zebrafish IgH cDNA FishD", "0:4 1:219.64", "A:6809564;C:6219469;G:6636933;T:7943112;N:2831", 4, 219, null, null, 6809564, 6219469, 6636933, 7943112, 2831, "SRX003622", "SRS002057", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.45962, null, 0.09396, null, 0.99941, null, 0.00026, null, 218, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67919, "SRR017330", "SRX003621", "SRS002056", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish C", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishC", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "C_fish.tar", "fastq", 21845405.0, 95733.0, "Zebrafish IgH cDNA FishC", "0:4 1:224.19", "A:5735195;C:4746747;G:5266352;T:6095066;N:2045", 4, 224, null, null, 5735195, 4746747, 5266352, 6095066, 2045, "SRX003621", "SRS002056", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.38908, null, 0.20497, null, 0.99967, null, 0.00047, null, 145, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67920, "SRR017329", "SRX003620", "SRS002055", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish B", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishB", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "B_fish.tar", "fastq", 26680294.0, 118385.0, "Zebrafish IgH cDNA FishB", "0:4 1:221.37", "A:6380496;C:6168810;G:6541530;T:7587018;N:2440", 4, 221, null, null, 6380496, 6168810, 6541530, 7587018, 2440, "SRX003620", "SRS002055", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.35498, null, 0.14675, null, 0.99906, null, 0.00098, null, 228, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67921, "SRR017328", "SRX003619", "SRS002054", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish A", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishA", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "A_fish.tar", "fastq", 13497752.0, 61111.0, "Zebrafish IgH cDNA FishA", "0:4 1:216.87", "A:3287411;C:3078068;G:3224467;T:3906026;N:1780", 4, 216, null, null, 3287411, 3078068, 3224467, 3906026, 1780, "SRX003619", "SRS002054", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.32333, null, 0.14098, null, 0.99937, null, 0.00169, null, 52, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [68262, "SRR099333", "SRX041597", "SRS172447", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio  leading with MID barcode TAGTATCAGC", "4432 1Y D", "4432 1Y D", null, null, null, null, null, null, null, null, null, null, "1", "4432 1Y D", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 72592827.0, 232367.0, "4432 1Y D", "0:4 1:308.41", null, 4, 308, null, null, null, null, null, null, null, "SRX041597", "SRS172447", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.13098, null, 0.04666, null, 0.99943, null, 0.00078, null, 195, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68263, "SRR099332", "SRX041596", "SRS172446", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio  leading with MID barcode TAGTATCAGC", "4432 1Y C9", "4432 1Y C9", null, null, null, null, null, null, null, null, null, null, "1", "4432 1Y C9", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 78320127.0, 261806.0, "4432 1Y C9", "0:4 1:295.15", null, 4, 295, null, null, null, null, null, null, null, "SRX041596", "SRS172446", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.20079, null, 0.01319, null, 0.99971, null, 0.0004, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68264, "SRR099331", "SRX041595", "SRS172445", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio  leading with MID barcode CTCGCGTGTC", "4432 1Y B8", "4432 1Y B8", null, null, null, null, null, null, null, null, null, null, "1", "4432 1Y B8", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 46900878.0, 156154.0, "4432 1Y B8", "0:4 1:296.35", null, 4, 296, null, null, null, null, null, null, null, "SRX041595", "SRS172445", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.21827, null, 0.01485, null, 0.99961, null, 0.00018, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68265, "SRR099330", "SRX041594", "SRS172444", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio  leading with MID barcode CGTGTCTCTA", "4432 1Y A7", "4432 1Y A7", null, null, null, null, null, null, null, null, null, null, "1", "4432 1Y A7", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 22543768.0, 73425.0, "4432 1Y A7", "0:4 1:303.03", null, 4, 303, null, null, null, null, null, null, null, "SRX041594", "SRS172444", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.16879, null, 0.02006, null, 0.99973, null, 0.00063, null, 89, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68266, "SRR099325", "SRX041593", "SRS172443", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio  leading with MID barcode ATATCGCGAG", "4430 1Y C6", "4430 1Y C6", null, null, null, null, null, null, null, null, null, null, "1", "4430 1Y C6", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 38479526.0, 134024.0, "4430 1Y C6", "0:4 1:283.11", null, 4, 283, null, null, null, null, null, null, null, "SRX041593", "SRS172443", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.11658, null, 0.00464, null, 0.99928, null, 0.00323, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68267, "SRR099324", "SRX041592", "SRS172442", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio  leading with MID barcode ATCAGACACG", "4430 1Y B5", "4430 1Y B5", null, null, null, null, null, null, null, null, null, null, "1", "4430 1Y B5", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 83990641.0, 290583.0, "4430 1Y B5", "0:4 1:285.04", null, 4, 285, null, null, null, null, null, null, null, "SRX041592", "SRS172442", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.20603, null, 0.01554, null, 0.99967, null, 0.00038, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68268, "SRR099323", "SRX041591", "SRS172441", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio  leading with MID barcode AGCACTGTAG", "4430 1Y A4", "4430 1Y A4", null, null, null, null, null, null, null, null, null, null, "1", "4430 1Y A4", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 27578630.0, 90031.0, "4430 1Y A4", "0:4 1:302.32", null, 4, 302, null, null, null, null, null, null, null, "SRX041591", "SRS172441", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.12444, null, 0.0197, null, 0.99975, null, 0.00096, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68269, "SRR099322", "SRX041590", "SRS172440", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio  leading with MID barcode AGACGCACTC", "4428 1Y C3", "4428 1Y C3", null, null, null, null, null, null, null, null, null, null, "1", "4428 1Y C3", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 62333740.0, 194228.0, "4428 1Y C3", "0:4 1:316.93", null, 4, 316, null, null, null, null, null, null, null, "SRX041590", "SRS172440", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.1865, null, 0.02265, null, 0.99947, null, 0.00049, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68270, "SRR099321", "SRX041589", "SRS172439", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio  leading with MID barcode ACGCTCGACA", "4428 1Y B2", "4428 1Y B2", null, null, null, null, null, null, null, null, null, null, "1", "4428 1Y B2", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 104263503.0, 333602.0, "4428 1Y B2", "0:4 1:308.54", null, 4, 308, null, null, null, null, null, null, null, "SRX041589", "SRS172439", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.15679, null, 0.02871, null, 0.99953, null, 0.00044, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68271, "SRR099320", "SRX041588", "SRS172438", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio  leading with MID barcode ACGAGTGCGT", "4428 1Y A1", "4428 1Y A1", null, null, null, null, null, null, null, null, null, null, "1", "4428 1Y A1", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 18763476.0, 59560.0, "4428 1Y A1", "0:4 1:311.03", null, 4, 311, null, null, null, null, null, null, null, "SRX041588", "SRS172438", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.13922, null, 0.01452, null, 0.99971, null, 0.00094, null, 160, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68272, "SRR099364", "SRX041587", "SRS172437", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode TGATACGTCT", "4433 6M D", "4433 6M D", null, null, null, null, null, null, null, null, null, null, "1", "4433 6M D", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 101345153.0, 290438.0, "4433 6M D", "0:4 1:344.94", null, 4, 344, null, null, null, null, null, null, null, "SRX041587", "SRS172437", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.14815, null, 0.01925, null, 0.99908, null, 0.00202, null, 155, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68273, "SRR099363", "SRX041586", "SRS172436", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode TCTCTATGCG", "4433 6M C", "4433 6M C", null, null, null, null, null, null, null, null, null, null, "1", "4433 6M C", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 75770901.0, 213529.0, "4433 6M C", "0:4 1:350.85", null, 4, 350, null, null, null, null, null, null, null, "SRX041586", "SRS172436", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.14445, null, 0.01047, null, 0.99878, null, 0.00299, null, 57, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68274, "SRR099362", "SRX041585", "SRS172435", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode TAGTATCAGC", "4433 6M B", "4433 6M B", null, null, null, null, null, null, null, null, null, null, "1", "4433 6M B", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 67192817.0, 194503.0, "4433 6M B", "0:4 1:341.46", null, 4, 341, null, null, null, null, null, null, null, "SRX041585", "SRS172435", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.13467, null, 0.01249, null, 0.99914, null, 0.00222, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68275, "SRR099361", "SRX041584", "SRS172434", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode CTCGCGTGTC", "4433 6M A", "4433 6M A", null, null, null, null, null, null, null, null, null, null, "1", "4433 6M A", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 72299403.0, 207618.0, "4433 6M A", "0:4 1:344.23", null, 4, 344, null, null, null, null, null, null, null, "SRX041584", "SRS172434", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.1041, null, 0.01046, null, 0.99764, null, 0.00892, null, 64, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68276, "SRR099348", "SRX041583", "SRS172433", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode CGTGTCTCTA", "4432 6M G", "4432 6M G", null, null, null, null, null, null, null, null, null, null, "1", "4432 6M G", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 79715586.0, 227631.0, "4432 6M G", "0:4 1:346.20", null, 4, 346, null, null, null, null, null, null, null, "SRX041583", "SRS172433", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.11472, null, 0.01795, null, 0.99898, null, 0.00298, null, 103, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68277, "SRR099347", "SRX041582", "SRS172432", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode ATATCGCGAG", "4432 6M F", "4432 6M F", null, null, null, null, null, null, null, null, null, null, "1", "4432 6M F", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 72024740.0, 203769.0, "4432 6M F", "0:4 1:349.46", null, 4, 349, null, null, null, null, null, null, null, "SRX041582", "SRS172432", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.11535, null, 0.01205, null, 0.99855, null, 0.00395, null, 40, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68278, "SRR099346", "SRX041581", "SRS172431", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode ATCAGACACG", "4432 6M E", "4432 6M E", null, null, null, null, null, null, null, null, null, null, "1", "4432 6M E", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 65072237.0, 190441.0, "4432 6M E", "0:4 1:337.69", null, 4, 337, null, null, null, null, null, null, null, "SRX041581", "SRS172431", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.11698, null, 0.01584, null, 0.99823, null, 0.00583, null, 65, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68279, "SRR099345", "SRX041580", "SRS172430", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode AGCACTGTAG", "4432 6M D", "4432 6M D", null, null, null, null, null, null, null, null, null, null, "1", "4432 6M D", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 74122161.0, 211816.0, "4432 6M D", "0:4 1:345.94", null, 4, 345, null, null, null, null, null, null, null, "SRX041580", "SRS172430", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.10275, null, 0.01376, null, 0.99912, null, 0.00377, null, 57, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68280, "SRR099344", "SRX041579", "SRS172429", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode AGACGCACTC", "4432 6M C", "4432 6M C", null, null, null, null, null, null, null, null, null, null, "1", "4432 6M C", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 78171765.0, 220585.0, "4432 6M C", "0:4 1:350.38", null, 4, 350, null, null, null, null, null, null, null, "SRX041579", "SRS172429", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.13401, null, 0.0146, null, 0.99711, null, 0.01012, null, 222, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68281, "SRR099343", "SRX041578", "SRS172428", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode ACGCTCGACA", "4432 6M B", "4432 6M B", null, null, null, null, null, null, null, null, null, null, "1", "4432 6M B", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 75262808.0, 217309.0, "4432 6M B", "0:4 1:342.34", null, 4, 342, null, null, null, null, null, null, null, "SRX041578", "SRS172428", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.16193, null, 0.00604, null, 0.99685, null, 0.00701, null, 452, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68282, "SRR099342", "SRX041577", "SRS172427", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode ACGAGTGCGT", "4432 6M A", "4432 6M A", null, null, null, null, null, null, null, null, null, null, "1", "4432 6M A", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 66235952.0, 184208.0, "4432 6M A", "0:4 1:355.57", null, 4, 355, null, null, null, null, null, null, null, "SRX041577", "SRS172427", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.10428, null, 0.01655, null, 0.99661, null, 0.01505, null, 183, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68283, "SRR099370", "SRX041576", "SRS172426", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode TACTGAGCTA", "F2 2", "F2 2", null, null, null, null, null, null, null, null, null, null, "1", "F2 2", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 64641127.0, 184383.0, "F2 2", "0:4 1:346.58", null, 4, 346, null, null, null, null, null, null, null, "SRX041576", "SRS172426", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.23604, null, 0.01003, null, 0.99959, null, 0.00028, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68284, "SRR099369", "SRX041575", "SRS172425", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode TGATACGTCT", "E2 2", "E2 2", null, null, null, null, null, null, null, null, null, null, "1", "E2 2", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 66206147.0, 181029.0, "E2 2", "0:4 1:361.72", null, 4, 361, null, null, null, null, null, null, null, "SRX041575", "SRS172425", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.13216, null, 0.00596, null, 0.99949, null, 0.00054, null, 101, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68285, "SRR099368", "SRX041574", "SRS172424", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode TGATACGTCT", "D2 2", "D2 2", null, null, null, null, null, null, null, null, null, null, "1", "D2 2", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 190136862.0, 562067.0, "D2 2", "0:4 1:334.28", null, 4, 334, null, null, null, null, null, null, null, "SRX041574", "SRS172424", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.25384, null, 0.03443, null, 0.99933, null, 0.00056, null, 416, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68286, "SRR099367", "SRX041573", "SRS172423", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode TAGTATCAGC", "C2 2", "C2 2", null, null, null, null, null, null, null, null, null, null, "1", "C2 2", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 118356460.0, 367001.0, "C2 2", "0:4 1:318.50", null, 4, 318, null, null, null, null, null, null, null, "SRX041573", "SRS172423", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.18882, null, 0.02167, null, 0.99969, null, 9e-05, null, 40, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68287, "SRR099366", "SRX041572", "SRS172422", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode CTCGCGTGTC", "B2 2", "B2 2", null, null, null, null, null, null, null, null, null, null, "1", "B2 2", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 24757877.0, 69408.0, "B2 2", "0:4 1:352.70", null, 4, 352, null, null, null, null, null, null, null, "SRX041572", "SRS172422", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.12537, null, 0.01076, null, 0.99975, null, 0.00029, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68288, "SRR099365", "SRX041571", "SRS172421", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode CGTGTCTCTA", "A2 2", "A2 2", null, null, null, null, null, null, null, null, null, null, "1", "A2 2", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 765824405.0, 2575264.0, "A2 2", "0:4 1:293.38", null, 4, 293, null, null, null, null, null, null, null, "SRX041571", "SRS172421", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.18359, null, 0.017, null, 0.99892, null, 0.00154, null, 152, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68289, "SRR099360", "SRX041570", "SRS172420", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio  leading with MID barcode CTCGCGTGTC or with no barcode leading with either IgM reverse primer TGCACTGAGACAAACCGAAG or IgZ reverse primer TCAGAGGCCAGACATCCAAT", "4433 3MA DT", "4433 3MA DT", null, null, null, null, null, null, null, null, null, null, "1", "4433 3MA DT", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 56064850.0, 187695.0, "4433 3MA DT", "0:4 1:294.70", null, 4, 294, null, null, null, null, null, null, null, "SRX041570", "SRS172420", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.3144, null, 0.00306, null, 0.99987, null, 0.0, null, 106, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68290, "SRR099359", "SRX041569", "SRS172419", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio  leading with MID barcode CGTGTCTCTA", "4433 3MA C7", "4433 3MA C7", null, null, null, null, null, null, null, null, null, null, "1", "4433 3MA C7", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 96179902.0, 300329.0, "4433 3MA C7", "0:4 1:316.25", null, 4, 316, null, null, null, null, null, null, null, "SRX041569", "SRS172419", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.1804, null, 0.01829, null, 0.99953, null, 0.00028, null, 468, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68291, "SRR099358", "SRX041568", "SRS172418", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio  leading with MID barcode ATATCGCGAG", "4433 3MA B6", "4433 3MA B6", null, null, null, null, null, null, null, null, null, null, "1", "4433 3MA B6", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 50421822.0, 147276.0, "4433 3MA B6", "0:4 1:338.36", null, 4, 338, null, null, null, null, null, null, null, "SRX041568", "SRS172418", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.19259, null, 0.00589, null, 0.99955, null, 0.00065, null, 99, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68292, "SRR099357", "SRX041567", "SRS172417", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio  leading with MID barcode ATCAGACACG", "4433 3MA A5", "4433 3MA A5", null, null, null, null, null, null, null, null, null, null, "1", "4433 3MA A5", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 156064156.0, 515822.0, "4433 3MA A5", "0:4 1:298.55", null, 4, 298, null, null, null, null, null, null, null, "SRX041567", "SRS172417", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.22633, null, 0.01233, null, 0.99971, null, 0.00016, null, 40, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68293, "SRR099341", "SRX041566", "SRS172416", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio  leading with MID barcode AGCACTGTAG", "4432 3MA D4", "4432 3MA D4", null, null, null, null, null, null, null, null, null, null, "1", "4432 3MA D4", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 61903651.0, 206769.0, "4432 3MA D4", "0:4 1:295.39", null, 4, 295, null, null, null, null, null, null, null, "SRX041566", "SRS172416", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.23888, null, 0.01136, null, 0.99953, null, 0.00047, null, 58, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68294, "SRR099340", "SRX041565", "SRS172415", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio  leading with MID barcode AGACGCACTC", "4432 3MA C3", "4432 3MA C3", null, null, null, null, null, null, null, null, null, null, "1", "4432 3MA C3", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 37914122.0, 116980.0, "4432 3MA C3", "0:4 1:320.11", null, 4, 320, null, null, null, null, null, null, null, "SRX041565", "SRS172415", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.19288, null, 0.0142, null, 0.99955, null, 0.00034, null, 125, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68295, "SRR099339", "SRX041564", "SRS172414", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio  leading with MID barcode ACGCTCGACA", "4432 3MA B2", "4432 3MA B2", null, null, null, null, null, null, null, null, null, null, "1", "4432 3MA B2", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 89178437.0, 298194.0, "4432 3MA B2", "0:4 1:295.06", null, 4, 295, null, null, null, null, null, null, null, "SRX041564", "SRS172414", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.21059, null, 0.00985, null, 0.99969, null, 0.00012, null, 107, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68296, "SRR099338", "SRX041563", "SRS172413", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio  leading with MID barcode ACGAGTGCGT", "4432 3MA A1", "4432 3MA A1", null, null, null, null, null, null, null, null, null, null, "1", "4432 3MA A1", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 59101536.0, 194332.0, "4432 3MA A1", "0:4 1:300.13", null, 4, 300, null, null, null, null, null, null, null, "SRX041563", "SRS172413", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.26977, null, 0.00958, null, 0.99971, null, 0.00015, null, 69, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68297, "SRR099352", "SRX041562", "SRS172412", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 mpf WIK zebrafish Danio rerio  leading with MID barcode CTCGCGTGTC", "4433 1MA D8", "4433 1MA D8", null, null, null, null, null, null, null, null, null, null, "1", "4433 1MA D8", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 70233197.0, 233302.0, "4433 1MA D8", "0:4 1:297.04", null, 4, 297, null, null, null, null, null, null, null, "SRX041562", "SRS172412", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.14812, null, 0.01088, null, 0.99969, null, 0.10799, null, 36, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Juvenile", "Juvenile", "BCR TCR repertoire", "Hematopoietic System"], [68298, "SRR099351", "SRX041561", "SRS172411", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 mpf WIK zebrafish Danio rerio  leading with MID barcode CGTGTCTCTA", "4433 1MA C7", "4433 1MA C7", null, null, null, null, null, null, null, null, null, null, "1", "4433 1MA C7", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 109094731.0, 316792.0, "4433 1MA C7", "0:4 1:340.37", null, 4, 340, null, null, null, null, null, null, null, "SRX041561", "SRS172411", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.13409, null, 0.01258, null, 0.99955, null, 0.01535, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Juvenile", "Juvenile", "BCR TCR repertoire", "Hematopoietic System"], [68299, "SRR099350", "SRX041560", "SRS172410", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 mpf WIK zebrafish Danio rerio  leading with MID barcode ATATCGCGAG", "4433 1MA B6", "4433 1MA B6", null, null, null, null, null, null, null, null, null, null, "1", "4433 1MA B6", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 110436791.0, 353780.0, "4433 1MA B6", "0:4 1:308.16", null, 4, 308, null, null, null, null, null, null, null, "SRX041560", "SRS172410", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.28629, null, 0.01104, null, 0.99945, null, 0.0273, null, 107, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Juvenile", "Juvenile", "BCR TCR repertoire", "Hematopoietic System"], [68300, "SRR099349", "SRX041559", "SRS172409", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 mpf WIK zebrafish Danio rerio  leading with MID barcode ATCAGACACG", "4433 1MA A5", "4433 1MA A5", null, null, null, null, null, null, null, null, null, null, "1", "4433 1MA A5", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 107336405.0, 335816.0, "4433 1MA A5", "0:4 1:315.63", null, 4, 315, null, null, null, null, null, null, null, "SRX041559", "SRS172409", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.16203, null, 0.01649, null, 0.99935, null, 0.00111, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Juvenile", "Juvenile", "BCR TCR repertoire", "Hematopoietic System"], [68301, "SRR099329", "SRX041558", "SRS172408", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 mpf WIK zebrafish Danio rerio  leading with MID barcode AGCACTGTAG", "4432 1MA D4", "4432 1MA D4", null, null, null, null, null, null, null, null, null, null, "1", "4432 1MA D4", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 94113837.0, 297721.0, "4432 1MA D4", "0:4 1:312.11", null, 4, 312, null, null, null, null, null, null, null, "SRX041558", "SRS172408", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.16753, null, 0.02013, null, 0.99979, null, 3e-05, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Juvenile", "Juvenile", "BCR TCR repertoire", "Hematopoietic System"], [68302, "SRR099328", "SRX041557", "SRS172407", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 mpf WIK zebrafish Danio rerio  leading with MID barcode AGACGCACTC", "4432 1MA C3", "4432 1MA C3", null, null, null, null, null, null, null, null, null, null, "1", "4432 1MA C3", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 77768777.0, 243405.0, "4432 1MA C3", "0:4 1:315.50", null, 4, 315, null, null, null, null, null, null, null, "SRX041557", "SRS172407", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.16711, null, 0.01816, null, 0.99979, null, 0.0, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Juvenile", "Juvenile", "BCR TCR repertoire", "Hematopoietic System"], [68303, "SRR099327", "SRX041556", "SRS172406", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 mpf WIK zebrafish Danio rerio  leading with MID barcode ACGCTCGACA", "4432 1MA B2", "4432 1MA B2", null, null, null, null, null, null, null, null, null, null, "1", "4432 1MA B2", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 120450312.0, 390504.0, "4432 1MA B2", "0:4 1:304.45", null, 4, 304, null, null, null, null, null, null, null, "SRX041556", "SRS172406", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.18757, null, 0.01811, null, 0.99977, null, 0.00024, null, 59, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Juvenile", "Juvenile", "BCR TCR repertoire", "Hematopoietic System"], [68304, "SRR099326", "SRX041555", "SRS172405", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 mpf WIK zebrafish Danio rerio  leading with MID barcode ACGAGTGCGT", "4432 1MA A1", "4432 1MA A1", null, null, null, null, null, null, null, null, null, null, "1", "4432 1MA A1", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 145945736.0, 457354.0, "4432 1MA A1", "0:4 1:315.11", null, 4, 315, null, null, null, null, null, null, null, "SRX041555", "SRS172405", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.17607, null, 0.02473, null, 0.99957, null, 0.00036, null, 40, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Juvenile", "Juvenile", "BCR TCR repertoire", "Hematopoietic System"], [68305, "SRR099356", "SRX041554", "SRS172404", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 2 wpf WIK zebrafish Danio rerio  leading with MID barcode CTCGCGTGTC", "4433 2WD", "4433 2WD", null, null, null, null, null, null, null, null, null, null, "1", "4433 2WD", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, "4433-2WDqual.tar.gz", "fastq", 52787937.0, 159839.0, "4433 2WD", "0:4 1:326.26", null, 4, 326, null, null, null, null, null, null, null, "SRX041554", "SRS172404", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.11986, null, 0.01724, null, 0.99805, null, 0.01122, null, 313, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-08", "Larval", "Larval", "BCR TCR repertoire", "Hematopoietic System"], [68306, "SRR099355", "SRX041553", "SRS172403", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 2 wpf WIK zebrafish Danio rerio  leading with MID barcode CGTGTCTCTA", "4433 2WC", "4433 2WC", null, null, null, null, null, null, null, null, null, null, "1", "4433 2WC", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 65896148.0, 208053.0, "4433 2WC", "0:4 1:312.73", null, 4, 312, null, null, null, null, null, null, null, "SRX041553", "SRS172403", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.14138, null, 0.02922, null, 0.99855, null, 0.00348, null, 315, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Larval", "Larval", "BCR TCR repertoire", "Hematopoietic System"], [68307, "SRR099354", "SRX041552", "SRS172402", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 2 wpf WIK zebrafish Danio rerio  leading with MID barcode ATATCGCGAG", "4433 2WB", "4433 2WB", null, null, null, null, null, null, null, null, null, null, "1", "4433 2WB", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 63865512.0, 209572.0, "4433 2WB", "0:4 1:300.74", null, 4, 300, null, null, null, null, null, null, null, "SRX041552", "SRS172402", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.16321, null, 0.03058, null, 0.99926, null, 0.00107, null, 226, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Larval", "Larval", "BCR TCR repertoire", "Hematopoietic System"], [68308, "SRR099353", "SRX041551", "SRS172401", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 2 wpf WIK zebrafish Danio rerio  leading with MID barcode ATCAGACACG", "4433 2WA", "4433 2WA", null, null, null, null, null, null, null, null, null, null, "1", "4433 2WA", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 41165356.0, 128188.0, "4433 2WA", "0:4 1:317.13", null, 4, 317, null, null, null, null, null, null, null, "SRX041551", "SRS172401", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.16018, null, 0.02829, null, 0.99847, null, 0.02343, null, 452, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Larval", "Larval", "BCR TCR repertoire", "Hematopoietic System"], [68309, "SRR099337", "SRX041550", "SRS172400", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 2 wpf WIK zebrafish Danio rerio  leading with MID barcode AGCACTGTAG", "4432 2WD", "4432 2WD", null, null, null, null, null, null, null, null, null, null, "1", "4432 2WD", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 34384017.0, 109589.0, "4432 2WD", "0:4 1:309.75", null, 4, 309, null, null, null, null, null, null, null, "SRX041550", "SRS172400", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.1533, null, 0.02541, null, 0.99896, null, 0.00428, null, 254, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Larval", "Larval", "BCR TCR repertoire", "Hematopoietic System"], [68310, "SRR099336", "SRX041549", "SRS172399", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 2 wpf WIK zebrafish Danio rerio  leading with MID barcode AGACGCACTC", "4432 2WC", "4432 2WC", null, null, null, null, null, null, null, null, null, null, "1", "4432 2WC", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 71040021.0, 233525.0, "4432 2WC", "0:4 1:300.21", null, 4, 300, null, null, null, null, null, null, null, "SRX041549", "SRS172399", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.16787, null, 0.03447, null, 0.9978, null, 0.01646, null, 360, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Larval", "Larval", "BCR TCR repertoire", "Hematopoietic System"], [68311, "SRR099335", "SRX041548", "SRS172345", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 2 wpf WIK zebrafish Danio rerio  leading with MID barcode ACGCTCGACA", "4432 2WB", "4432 2WB", null, null, null, null, null, null, null, null, null, null, "1", "4432 2WB", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 98153866.0, 302470.0, "4432 2WB", "0:4 1:320.51", null, 4, 320, null, null, null, null, null, null, null, "SRX041548", "SRS172345", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.15713, null, 0.047, null, 0.99774, null, 0.02379, null, 137, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Larval", "Larval", "BCR TCR repertoire", "Hematopoietic System"], [68312, "SRR099334", "SRX041547", "SRS172117", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 2 wpf WIK zebrafish Danio rerio  leading with MID barcode ACGAGTGCGT", "4432 2WA", "4432 2WA", null, null, null, null, null, null, null, null, null, null, "1", "4432 2WA", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 91079672.0, 319475.0, "4432 2WA", "0:4 1:281.09", null, 4, 281, null, null, null, null, null, null, null, "SRX041547", "SRS172117", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.25569, null, 0.04646, null, 0.99902, null, 0.00137, null, 88, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Larval", "Larval", "BCR TCR repertoire", "Hematopoietic System"]], "truncated": false, "filtered_table_rows_count": 65, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"experiment.library_layout\" = :p0 and \"technology\" = :p1 and \"tissue_curation_coarse\" = :p2 order by rowid limit 101", "params": {"p0": "SINGLE", "p1": "454", "p2": "Hematopoietic System"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=454&tissue_curation_coarse=Hematopoietic+System", "results": [{"value": "AMPLICON", "label": "AMPLICON", "count": 65, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=454&tissue_curation_coarse=Hematopoietic+System&experiment.library_strategy=AMPLICON", "selected": false}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=454&tissue_curation_coarse=Hematopoietic+System", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 65, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=454&tissue_curation_coarse=Hematopoietic+System&experiment.library_source=TRANSCRIPTOMIC", "selected": false}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=454&tissue_curation_coarse=Hematopoietic+System", "results": [{"value": "PCR", "label": "PCR", "count": 65, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=454&tissue_curation_coarse=Hematopoietic+System&experiment.library_selection=PCR", "selected": false}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=454&tissue_curation_coarse=Hematopoietic+System", "results": [{"value": "SINGLE", "label": "SINGLE", "count": 65, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?technology=454&tissue_curation_coarse=Hematopoietic+System", "selected": true}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=454&tissue_curation_coarse=Hematopoietic+System", "results": [{"value": "LS454", "label": "LS454", "count": 65, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=454&tissue_curation_coarse=Hematopoietic+System&experiment.platform=LS454", "selected": false}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=454&tissue_curation_coarse=Hematopoietic+System", "results": [{"value": "Adult", "label": "Adult", "count": 35, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=454&tissue_curation_coarse=Hematopoietic+System&devstage_curation_coarse=Adult", "selected": false}, {"value": "Undetermined", "label": "Undetermined", "count": 14, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=454&tissue_curation_coarse=Hematopoietic+System&devstage_curation_coarse=Undetermined", "selected": false}, {"value": "Juvenile", "label": "Juvenile", "count": 8, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=454&tissue_curation_coarse=Hematopoietic+System&devstage_curation_coarse=Juvenile", "selected": false}, {"value": "Larval", "label": "Larval", "count": 8, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=454&tissue_curation_coarse=Hematopoietic+System&devstage_curation_coarse=Larval", "selected": false}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=454&tissue_curation_coarse=Hematopoietic+System", "results": [{"value": "Adult", "label": "Adult", "count": 35, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=454&tissue_curation_coarse=Hematopoietic+System&devstage_curation=Adult", "selected": false}, {"value": "Undetermined", "label": "Undetermined", "count": 14, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=454&tissue_curation_coarse=Hematopoietic+System&devstage_curation=Undetermined", "selected": false}, {"value": "Juvenile", "label": "Juvenile", "count": 8, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=454&tissue_curation_coarse=Hematopoietic+System&devstage_curation=Juvenile", "selected": false}, {"value": "Larval", "label": "Larval", "count": 8, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=454&tissue_curation_coarse=Hematopoietic+System&devstage_curation=Larval", "selected": false}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=454&tissue_curation_coarse=Hematopoietic+System", "results": [{"value": "Hematopoietic System", "label": "Hematopoietic System", "count": 65, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=454", "selected": true}], "truncated": false}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=454&tissue_curation_coarse=Hematopoietic+System", "results": [{"value": "BCR TCR repertoire", "label": "BCR TCR repertoire", "count": 65, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=454&tissue_curation_coarse=Hematopoietic+System&tissue_curation=BCR+TCR+repertoire", "selected": false}], "truncated": false}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&technology=454&tissue_curation_coarse=Hematopoietic+System", "results": [{"value": "454", "label": "454", "count": 65, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation_coarse=Hematopoietic+System", "selected": true}], "truncated": false}}, "suggested_facets": [], "next": null, "next_url": null, "private": false, "allow_execute_sql": true, "query_ms": 90.92040300311055}