{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where experiment.library_layout = \"SINGLE\" and experiment.platform = \"LS454\"", "rows": [[39609, "SRR1873571", "SRX915251", "SRS870223", "SRP056014", "PRJNA277780", "Identification of small non coding RNAs in zebrafish", "GSE66718", "Transcriptome Analysis", "MicroRNAs miRNAs are a new class of small RNAs of approximately 22 nucleotides in length that control eukaryotic gene expression by fine tuning mRNA translation. They regulate a wide variety of biological processes  namely developmental timing  cell differentiation  cell proliferation  immune response and infection. For this reason  their identification is essential to understand eukaryotic biology. Their small size  low abundance and high instability complicated early identification; however  cloning/Sanger sequencing and new generation genome sequencing approaches overcame most technical hurdles and are being used for rapid miRNA identification in many eukaryotes. We have applied 454 DNA pyrosequencing technology to miRNA discovery in zebrafish Danio rerio. For this  a series of cDNA libraries were prepared from small non coding RNAs isolated at different embryonic time points and from fully developed organs. Each cDNA library was tagged with specific sequences and was sequenced using the Roche FLX genome sequencer. This approach retrieved 90% of the 192 miRNAs previously identified by cloning/Sanger sequencing and bioinformatics and 25 novel miRNAs were predicted. Overall design: Small RNA libraries were prepared from different zebrafish developmental stages  namely  24 hpf  72 hpf  96 hpf  5 dpf dpf  45 dpf  young adult and from adult brain  eyes  gills  heart  skin and fins.", null, "pubmed:26694924", null, "fins", "GSM1630515", null, "source name:adult fins 1 year old|strain/background:AB|genotype/variation:wild type|tissue:fins|developmental stage:adult|age:1 year", "fins", "Base calling and quality trimming of sequence reads was carried out using the Genome Sequencer FLX software. Raw images were processed to remove background noise and the data was normalized. TAGs and adapter sequences of zebrafish developmental and adult tissues samples were then identified and trimmed and those reads with correct TAGs and adapters > 15 nt were retrieved for downstream analysis using the miRDeep software https://www.mdc berlin.de/8551903/en/. miRDeep aligned the sequences against the zebrafish genome using megaBlast with seed length set at 12  the traditional blast output  and minimum local identity set at 100. The blast output was then parsed for miRDeep uploading and aligned sequences with a maximum of 2 mismatches in the three prime end were retrieved. Reads that matched more than 10 different genome loci were discarded and only those with one or more alignments were kept  and using the remaining alignments as guidelines  the potential precursors were excised from the genome. The secondary structure of putative precursors was predicted using RNAfold and signatures were created by retaining reads that aligned perfectly with those putative precursors to generate the signature format. Finally  miRDeep predicted miRNAs by discarding non plausible Dicer products and scoring plausible ones. To assess seed conservation  plausible Dicer processing sequences were blasted against a local version of mature miRNAs from miRBase 12.0 that lacked zebrafish miRNA sequences. Borderline miRNA candidates were also resolved by determining their relative stability using Randfold. To distinguish between novel and known miRNAs  selected pre miRNAs were blasted against Danio rerio stem loop sequences miRBase and those that did not produce any or produced imperfect alignments were scored as novel miRNAs. Pairs of signatures and structures were used to estimate the number of false positives by randomly permutation  using miRDeep. To overcome the inherent lack of sensitivity of miRDeep  novel transcripts encoding miRNAs predicted by bioinformatics were retrieved from Ensembl 5.2 using BioMart and from literature predictions. These sequences were then used to perform a megaBlast search against our data with seed length set at 12. The transcripts with perfect matches and alignment length larger than 18 nt were kept for further processing. These transcripts were then compared with the mature miRNAs present in miRBase 12.0 and those that produced imperfect alignments or did not produce alignments were considered new miRNAs. Read numbers were normalized as described by Chen and colleagues Genes & Development 2005  19:1288 1293  and a miRNA expression profile  using identical number of reads for each sample  was generated. The number of reads between samples was normalized as indicated below:  Expression Reads = [1000 x NRmiRNAXY]/ TNRmiRNAsY  where NRmiRNAXY is the number of reads of miRNAX X = any miRNA in sample Y  and TNRmiRNAsY is the total number of miRNAs in sample Y. 1000 is an arbitrary number of reads. The data was transformed into log2 scale to build the heat map using the MeV 4.0 software package http://www.tm4.org/mev.html. Genome build: Zv8 Supplementary files format and content: Tab delimited text files include the miRNA IDs  sequences and respective raw counts post data processing for each sample.", "adult fins 1 year old", null, "100 \u03bcg of total RNA from each sample was isolated using TRIzol\u00ae and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis  the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC  three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter \"Nelson's linker\" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime  for 1 hour at 37\u00b0C  followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript\u2122 III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides  as detailed next. 24hpf   ATC; 72hpf   ACT; 96hpf   CAG; 5dpf   ATG; 45dpf   CCG; entire adult   GTA; brain   CGG; Heart   CTG; Eyes   GCT; fins   GTT; skin   TAC; gills   TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion  at 37\u00b0C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche  following established protocols for DNA library sequencing.", "Wild type AB zebrafish strain was maintained at 28\u00baC on a 14 h light/10 h dark cycle.", "strain/background:AB|genotype/variation:wild type|tissue:fins|developmental stage:adult|age:1 year", "GSM1630515", "GSM1630515: fins; Danio rerio; miRNA Seq", "GSM1630515", null, "1", "100 \u03bcg of total RNA from each sample was isolated using TRIzol\u00ae and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis  the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC  three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter \"Nelson's linker\" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime  for 1 hour at 37\u00b0C  followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript\u2122 III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides  as detailed next. 24hpf   ATC; 72hpf   ACT; 96hpf   CAG; 5dpf   ATG; 45dpf   CCG; entire adult   GTA; brain   CGG; Heart   CTG; Eyes   GCT; fins   GTT; skin   TAC; gills   TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion  at 37\u00b0C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche  following established protocols for DNA library sequencing.", "GEO Accession:GSM1630515", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "LS454", "454 GS FLX", null, "SRP056014", null, null, null, null, 113161.0, 2108.0, "GSM1630515 r1", "0:4 1:49.68", "A:30303;C:30710;G:27210;T:24785;N:153", 4, 49, null, null, 30303, 30710, 27210, 24785, 153, "SRX915251", "SRS870223", "SRA246117", "GEO", "University of Aveiro", 1, 0.0, null, 0.0, null, 1.0, null, null, null, 50, null, "T", null, "under 1.2% mapping rate", "legacy", "early", "3prime", "size_fractionation", "unknown", "bulk", "other_seq", "454", null, "Portugal", "2015-03-09", "Adult", "Adult", "Fin", "Surface Structure"], [39610, "SRR1873570", "SRX915250", "SRS870224", "SRP056014", "PRJNA277780", "Identification of small non coding RNAs in zebrafish", "GSE66718", "Transcriptome Analysis", "MicroRNAs miRNAs are a new class of small RNAs of approximately 22 nucleotides in length that control eukaryotic gene expression by fine tuning mRNA translation. They regulate a wide variety of biological processes  namely developmental timing  cell differentiation  cell proliferation  immune response and infection. For this reason  their identification is essential to understand eukaryotic biology. Their small size  low abundance and high instability complicated early identification; however  cloning/Sanger sequencing and new generation genome sequencing approaches overcame most technical hurdles and are being used for rapid miRNA identification in many eukaryotes. We have applied 454 DNA pyrosequencing technology to miRNA discovery in zebrafish Danio rerio. For this  a series of cDNA libraries were prepared from small non coding RNAs isolated at different embryonic time points and from fully developed organs. Each cDNA library was tagged with specific sequences and was sequenced using the Roche FLX genome sequencer. This approach retrieved 90% of the 192 miRNAs previously identified by cloning/Sanger sequencing and bioinformatics and 25 novel miRNAs were predicted. Overall design: Small RNA libraries were prepared from different zebrafish developmental stages  namely  24 hpf  72 hpf  96 hpf  5 dpf dpf  45 dpf  young adult and from adult brain  eyes  gills  heart  skin and fins.", null, "pubmed:26694924", null, "skin", "GSM1630514", null, "source name:adult skin 1 year old|strain/background:AB|genotype/variation:wild type|tissue:skin|developmental stage:adult|age:1 year", "skin", "Base calling and quality trimming of sequence reads was carried out using the Genome Sequencer FLX software. Raw images were processed to remove background noise and the data was normalized. TAGs and adapter sequences of zebrafish developmental and adult tissues samples were then identified and trimmed and those reads with correct TAGs and adapters > 15 nt were retrieved for downstream analysis using the miRDeep software https://www.mdc berlin.de/8551903/en/. miRDeep aligned the sequences against the zebrafish genome using megaBlast with seed length set at 12  the traditional blast output  and minimum local identity set at 100. The blast output was then parsed for miRDeep uploading and aligned sequences with a maximum of 2 mismatches in the three prime end were retrieved. Reads that matched more than 10 different genome loci were discarded and only those with one or more alignments were kept  and using the remaining alignments as guidelines  the potential precursors were excised from the genome. The secondary structure of putative precursors was predicted using RNAfold and signatures were created by retaining reads that aligned perfectly with those putative precursors to generate the signature format. Finally  miRDeep predicted miRNAs by discarding non plausible Dicer products and scoring plausible ones. To assess seed conservation  plausible Dicer processing sequences were blasted against a local version of mature miRNAs from miRBase 12.0 that lacked zebrafish miRNA sequences. Borderline miRNA candidates were also resolved by determining their relative stability using Randfold. To distinguish between novel and known miRNAs  selected pre miRNAs were blasted against Danio rerio stem loop sequences miRBase and those that did not produce any or produced imperfect alignments were scored as novel miRNAs. Pairs of signatures and structures were used to estimate the number of false positives by randomly permutation  using miRDeep. To overcome the inherent lack of sensitivity of miRDeep  novel transcripts encoding miRNAs predicted by bioinformatics were retrieved from Ensembl 5.2 using BioMart and from literature predictions. These sequences were then used to perform a megaBlast search against our data with seed length set at 12. The transcripts with perfect matches and alignment length larger than 18 nt were kept for further processing. These transcripts were then compared with the mature miRNAs present in miRBase 12.0 and those that produced imperfect alignments or did not produce alignments were considered new miRNAs. Read numbers were normalized as described by Chen and colleagues Genes & Development 2005  19:1288 1293  and a miRNA expression profile  using identical number of reads for each sample  was generated. The number of reads between samples was normalized as indicated below:  Expression Reads = [1000 x NRmiRNAXY]/ TNRmiRNAsY  where NRmiRNAXY is the number of reads of miRNAX X = any miRNA in sample Y  and TNRmiRNAsY is the total number of miRNAs in sample Y. 1000 is an arbitrary number of reads. The data was transformed into log2 scale to build the heat map using the MeV 4.0 software package http://www.tm4.org/mev.html. Genome build: Zv8 Supplementary files format and content: Tab delimited text files include the miRNA IDs  sequences and respective raw counts post data processing for each sample.", "adult skin 1 year old", null, "100 \u03bcg of total RNA from each sample was isolated using TRIzol\u00ae and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis  the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC  three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter \"Nelson's linker\" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime  for 1 hour at 37\u00b0C  followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript\u2122 III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides  as detailed next. 24hpf   ATC; 72hpf   ACT; 96hpf   CAG; 5dpf   ATG; 45dpf   CCG; entire adult   GTA; brain   CGG; Heart   CTG; Eyes   GCT; fins   GTT; skin   TAC; gills   TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion  at 37\u00b0C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche  following established protocols for DNA library sequencing.", "Wild type AB zebrafish strain was maintained at 28\u00baC on a 14 h light/10 h dark cycle.", "strain/background:AB|genotype/variation:wild type|tissue:skin|developmental stage:adult|age:1 year", "GSM1630514", "GSM1630514: skin; Danio rerio; miRNA Seq", "GSM1630514", null, "1", "100 \u03bcg of total RNA from each sample was isolated using TRIzol\u00ae and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis  the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC  three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter \"Nelson's linker\" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime  for 1 hour at 37\u00b0C  followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript\u2122 III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides  as detailed next. 24hpf   ATC; 72hpf   ACT; 96hpf   CAG; 5dpf   ATG; 45dpf   CCG; entire adult   GTA; brain   CGG; Heart   CTG; Eyes   GCT; fins   GTT; skin   TAC; gills   TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion  at 37\u00b0C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche  following established protocols for DNA library sequencing.", "GEO Accession:GSM1630514", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "LS454", "454 GS FLX", null, "SRP056014", null, null, null, null, 79232.0, 1527.0, "GSM1630514 r1", "0:4 1:47.89", "A:20622;C:23508;G:19017;T:15967;N:118", 4, 47, null, null, 20622, 23508, 19017, 15967, 118, "SRX915250", "SRS870224", "SRA246117", "GEO", "University of Aveiro", 1, 0.0, null, 0.0, null, 1.0, null, null, null, 53, null, "T", null, "under 1.2% mapping rate", "legacy", "early", "3prime", "size_fractionation", "unknown", "bulk", "other_seq", "454", null, "Portugal", "2015-03-09", "Adult", "Adult", "Skin", "Surface Structure"], [39611, "SRR1873569", "SRX915249", "SRS870225", "SRP056014", "PRJNA277780", "Identification of small non coding RNAs in zebrafish", "GSE66718", "Transcriptome Analysis", "MicroRNAs miRNAs are a new class of small RNAs of approximately 22 nucleotides in length that control eukaryotic gene expression by fine tuning mRNA translation. They regulate a wide variety of biological processes  namely developmental timing  cell differentiation  cell proliferation  immune response and infection. For this reason  their identification is essential to understand eukaryotic biology. Their small size  low abundance and high instability complicated early identification; however  cloning/Sanger sequencing and new generation genome sequencing approaches overcame most technical hurdles and are being used for rapid miRNA identification in many eukaryotes. We have applied 454 DNA pyrosequencing technology to miRNA discovery in zebrafish Danio rerio. For this  a series of cDNA libraries were prepared from small non coding RNAs isolated at different embryonic time points and from fully developed organs. Each cDNA library was tagged with specific sequences and was sequenced using the Roche FLX genome sequencer. This approach retrieved 90% of the 192 miRNAs previously identified by cloning/Sanger sequencing and bioinformatics and 25 novel miRNAs were predicted. Overall design: Small RNA libraries were prepared from different zebrafish developmental stages  namely  24 hpf  72 hpf  96 hpf  5 dpf dpf  45 dpf  young adult and from adult brain  eyes  gills  heart  skin and fins.", null, "pubmed:26694924", null, "heart", "GSM1630513", null, "source name:adult heart 1 year old|strain/background:AB|genotype/variation:wild type|tissue:heart|developmental stage:adult|age:1 year", "heart", "Base calling and quality trimming of sequence reads was carried out using the Genome Sequencer FLX software. Raw images were processed to remove background noise and the data was normalized. TAGs and adapter sequences of zebrafish developmental and adult tissues samples were then identified and trimmed and those reads with correct TAGs and adapters > 15 nt were retrieved for downstream analysis using the miRDeep software https://www.mdc berlin.de/8551903/en/. miRDeep aligned the sequences against the zebrafish genome using megaBlast with seed length set at 12  the traditional blast output  and minimum local identity set at 100. The blast output was then parsed for miRDeep uploading and aligned sequences with a maximum of 2 mismatches in the three prime end were retrieved. Reads that matched more than 10 different genome loci were discarded and only those with one or more alignments were kept  and using the remaining alignments as guidelines  the potential precursors were excised from the genome. The secondary structure of putative precursors was predicted using RNAfold and signatures were created by retaining reads that aligned perfectly with those putative precursors to generate the signature format. Finally  miRDeep predicted miRNAs by discarding non plausible Dicer products and scoring plausible ones. To assess seed conservation  plausible Dicer processing sequences were blasted against a local version of mature miRNAs from miRBase 12.0 that lacked zebrafish miRNA sequences. Borderline miRNA candidates were also resolved by determining their relative stability using Randfold. To distinguish between novel and known miRNAs  selected pre miRNAs were blasted against Danio rerio stem loop sequences miRBase and those that did not produce any or produced imperfect alignments were scored as novel miRNAs. Pairs of signatures and structures were used to estimate the number of false positives by randomly permutation  using miRDeep. To overcome the inherent lack of sensitivity of miRDeep  novel transcripts encoding miRNAs predicted by bioinformatics were retrieved from Ensembl 5.2 using BioMart and from literature predictions. These sequences were then used to perform a megaBlast search against our data with seed length set at 12. The transcripts with perfect matches and alignment length larger than 18 nt were kept for further processing. These transcripts were then compared with the mature miRNAs present in miRBase 12.0 and those that produced imperfect alignments or did not produce alignments were considered new miRNAs. Read numbers were normalized as described by Chen and colleagues Genes & Development 2005  19:1288 1293  and a miRNA expression profile  using identical number of reads for each sample  was generated. The number of reads between samples was normalized as indicated below:  Expression Reads = [1000 x NRmiRNAXY]/ TNRmiRNAsY  where NRmiRNAXY is the number of reads of miRNAX X = any miRNA in sample Y  and TNRmiRNAsY is the total number of miRNAs in sample Y. 1000 is an arbitrary number of reads. The data was transformed into log2 scale to build the heat map using the MeV 4.0 software package http://www.tm4.org/mev.html. Genome build: Zv8 Supplementary files format and content: Tab delimited text files include the miRNA IDs  sequences and respective raw counts post data processing for each sample.", "adult heart 1 year old", null, "100 \u03bcg of total RNA from each sample was isolated using TRIzol\u00ae and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis  the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC  three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter \"Nelson's linker\" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime  for 1 hour at 37\u00b0C  followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript\u2122 III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides  as detailed next. 24hpf   ATC; 72hpf   ACT; 96hpf   CAG; 5dpf   ATG; 45dpf   CCG; entire adult   GTA; brain   CGG; Heart   CTG; Eyes   GCT; fins   GTT; skin   TAC; gills   TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion  at 37\u00b0C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche  following established protocols for DNA library sequencing.", "Wild type AB zebrafish strain was maintained at 28\u00baC on a 14 h light/10 h dark cycle.", "strain/background:AB|genotype/variation:wild type|tissue:heart|developmental stage:adult|age:1 year", "GSM1630513", "GSM1630513: heart; Danio rerio; miRNA Seq", "GSM1630513", null, "1", "100 \u03bcg of total RNA from each sample was isolated using TRIzol\u00ae and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis  the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC  three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter \"Nelson's linker\" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime  for 1 hour at 37\u00b0C  followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript\u2122 III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides  as detailed next. 24hpf   ATC; 72hpf   ACT; 96hpf   CAG; 5dpf   ATG; 45dpf   CCG; entire adult   GTA; brain   CGG; Heart   CTG; Eyes   GCT; fins   GTT; skin   TAC; gills   TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion  at 37\u00b0C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche  following established protocols for DNA library sequencing.", "GEO Accession:GSM1630513", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "LS454", "454 GS FLX", null, "SRP056014", null, null, null, null, 39500.0, 711.0, "GSM1630513 r1", "0:4 1:51.56", "A:11300;C:9125;G:9195;T:9835;N:45", 4, 51, null, null, 11300, 9125, 9195, 9835, 45, "SRX915249", "SRS870225", "SRA246117", "GEO", "University of Aveiro", 1, 0.0, null, 0.0, null, 1.0, null, null, null, 53, null, "T", null, "under 1.2% mapping rate", "legacy", "early", "3prime", "size_fractionation", "unknown", "bulk", "other_seq", "454", null, "Portugal", "2015-03-09", "Adult", "Adult", "Heart", "Cardiovascular System"], [39612, "SRR1873568", "SRX915248", "SRS870226", "SRP056014", "PRJNA277780", "Identification of small non coding RNAs in zebrafish", "GSE66718", "Transcriptome Analysis", "MicroRNAs miRNAs are a new class of small RNAs of approximately 22 nucleotides in length that control eukaryotic gene expression by fine tuning mRNA translation. They regulate a wide variety of biological processes  namely developmental timing  cell differentiation  cell proliferation  immune response and infection. For this reason  their identification is essential to understand eukaryotic biology. Their small size  low abundance and high instability complicated early identification; however  cloning/Sanger sequencing and new generation genome sequencing approaches overcame most technical hurdles and are being used for rapid miRNA identification in many eukaryotes. We have applied 454 DNA pyrosequencing technology to miRNA discovery in zebrafish Danio rerio. For this  a series of cDNA libraries were prepared from small non coding RNAs isolated at different embryonic time points and from fully developed organs. Each cDNA library was tagged with specific sequences and was sequenced using the Roche FLX genome sequencer. This approach retrieved 90% of the 192 miRNAs previously identified by cloning/Sanger sequencing and bioinformatics and 25 novel miRNAs were predicted. Overall design: Small RNA libraries were prepared from different zebrafish developmental stages  namely  24 hpf  72 hpf  96 hpf  5 dpf dpf  45 dpf  young adult and from adult brain  eyes  gills  heart  skin and fins.", null, "pubmed:26694924", null, "gills", "GSM1630512", null, "source name:adult gills 1 year old|strain/background:AB|genotype/variation:wild type|tissue:gills|developmental stage:adult|age:1 year", "gills", "Base calling and quality trimming of sequence reads was carried out using the Genome Sequencer FLX software. Raw images were processed to remove background noise and the data was normalized. TAGs and adapter sequences of zebrafish developmental and adult tissues samples were then identified and trimmed and those reads with correct TAGs and adapters > 15 nt were retrieved for downstream analysis using the miRDeep software https://www.mdc berlin.de/8551903/en/. miRDeep aligned the sequences against the zebrafish genome using megaBlast with seed length set at 12  the traditional blast output  and minimum local identity set at 100. The blast output was then parsed for miRDeep uploading and aligned sequences with a maximum of 2 mismatches in the three prime end were retrieved. Reads that matched more than 10 different genome loci were discarded and only those with one or more alignments were kept  and using the remaining alignments as guidelines  the potential precursors were excised from the genome. The secondary structure of putative precursors was predicted using RNAfold and signatures were created by retaining reads that aligned perfectly with those putative precursors to generate the signature format. Finally  miRDeep predicted miRNAs by discarding non plausible Dicer products and scoring plausible ones. To assess seed conservation  plausible Dicer processing sequences were blasted against a local version of mature miRNAs from miRBase 12.0 that lacked zebrafish miRNA sequences. Borderline miRNA candidates were also resolved by determining their relative stability using Randfold. To distinguish between novel and known miRNAs  selected pre miRNAs were blasted against Danio rerio stem loop sequences miRBase and those that did not produce any or produced imperfect alignments were scored as novel miRNAs. Pairs of signatures and structures were used to estimate the number of false positives by randomly permutation  using miRDeep. To overcome the inherent lack of sensitivity of miRDeep  novel transcripts encoding miRNAs predicted by bioinformatics were retrieved from Ensembl 5.2 using BioMart and from literature predictions. These sequences were then used to perform a megaBlast search against our data with seed length set at 12. The transcripts with perfect matches and alignment length larger than 18 nt were kept for further processing. These transcripts were then compared with the mature miRNAs present in miRBase 12.0 and those that produced imperfect alignments or did not produce alignments were considered new miRNAs. Read numbers were normalized as described by Chen and colleagues Genes & Development 2005  19:1288 1293  and a miRNA expression profile  using identical number of reads for each sample  was generated. The number of reads between samples was normalized as indicated below:  Expression Reads = [1000 x NRmiRNAXY]/ TNRmiRNAsY  where NRmiRNAXY is the number of reads of miRNAX X = any miRNA in sample Y  and TNRmiRNAsY is the total number of miRNAs in sample Y. 1000 is an arbitrary number of reads. The data was transformed into log2 scale to build the heat map using the MeV 4.0 software package http://www.tm4.org/mev.html. Genome build: Zv8 Supplementary files format and content: Tab delimited text files include the miRNA IDs  sequences and respective raw counts post data processing for each sample.", "adult gills 1 year old", null, "100 \u03bcg of total RNA from each sample was isolated using TRIzol\u00ae and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis  the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC  three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter \"Nelson's linker\" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime  for 1 hour at 37\u00b0C  followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript\u2122 III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides  as detailed next. 24hpf   ATC; 72hpf   ACT; 96hpf   CAG; 5dpf   ATG; 45dpf   CCG; entire adult   GTA; brain   CGG; Heart   CTG; Eyes   GCT; fins   GTT; skin   TAC; gills   TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion  at 37\u00b0C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche  following established protocols for DNA library sequencing.", "Wild type AB zebrafish strain was maintained at 28\u00baC on a 14 h light/10 h dark cycle.", "strain/background:AB|genotype/variation:wild type|tissue:gills|developmental stage:adult|age:1 year", "GSM1630512", "GSM1630512: gills; Danio rerio; miRNA Seq", "GSM1630512", null, "1", "100 \u03bcg of total RNA from each sample was isolated using TRIzol\u00ae and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis  the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC  three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter \"Nelson's linker\" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime  for 1 hour at 37\u00b0C  followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript\u2122 III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides  as detailed next. 24hpf   ATC; 72hpf   ACT; 96hpf   CAG; 5dpf   ATG; 45dpf   CCG; entire adult   GTA; brain   CGG; Heart   CTG; Eyes   GCT; fins   GTT; skin   TAC; gills   TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion  at 37\u00b0C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche  following established protocols for DNA library sequencing.", "GEO Accession:GSM1630512", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "LS454", "454 GS FLX", null, "SRP056014", null, null, null, null, 189248.0, 3563.0, "GSM1630512 r1", "0:4 1:49.11", "A:48212;C:55198;G:44765;T:40711;N:362", 4, 49, null, null, 48212, 55198, 44765, 40711, 362, "SRX915248", "SRS870226", "SRA246117", "GEO", "University of Aveiro", 1, 0.0, null, 0.0, null, 1.0, null, null, null, 44, null, "T", null, "under 1.2% mapping rate", "legacy", "early", "3prime", "size_fractionation", "unknown", "bulk", "other_seq", "454", null, "Portugal", "2015-03-09", "Adult", "Adult", "Gill", "Respiratory System"], [39613, "SRR1873567", "SRX915247", "SRS870227", "SRP056014", "PRJNA277780", "Identification of small non coding RNAs in zebrafish", "GSE66718", "Transcriptome Analysis", "MicroRNAs miRNAs are a new class of small RNAs of approximately 22 nucleotides in length that control eukaryotic gene expression by fine tuning mRNA translation. They regulate a wide variety of biological processes  namely developmental timing  cell differentiation  cell proliferation  immune response and infection. For this reason  their identification is essential to understand eukaryotic biology. Their small size  low abundance and high instability complicated early identification; however  cloning/Sanger sequencing and new generation genome sequencing approaches overcame most technical hurdles and are being used for rapid miRNA identification in many eukaryotes. We have applied 454 DNA pyrosequencing technology to miRNA discovery in zebrafish Danio rerio. For this  a series of cDNA libraries were prepared from small non coding RNAs isolated at different embryonic time points and from fully developed organs. Each cDNA library was tagged with specific sequences and was sequenced using the Roche FLX genome sequencer. This approach retrieved 90% of the 192 miRNAs previously identified by cloning/Sanger sequencing and bioinformatics and 25 novel miRNAs were predicted. Overall design: Small RNA libraries were prepared from different zebrafish developmental stages  namely  24 hpf  72 hpf  96 hpf  5 dpf dpf  45 dpf  young adult and from adult brain  eyes  gills  heart  skin and fins.", null, "pubmed:26694924", null, "eyes", "GSM1630511", null, "source name:adult eyes 1 year old|strain/background:AB|genotype/variation:wild type|tissue:eyes|developmental stage:adult|age:1 year", "eyes", "Base calling and quality trimming of sequence reads was carried out using the Genome Sequencer FLX software. Raw images were processed to remove background noise and the data was normalized. TAGs and adapter sequences of zebrafish developmental and adult tissues samples were then identified and trimmed and those reads with correct TAGs and adapters > 15 nt were retrieved for downstream analysis using the miRDeep software https://www.mdc berlin.de/8551903/en/. miRDeep aligned the sequences against the zebrafish genome using megaBlast with seed length set at 12  the traditional blast output  and minimum local identity set at 100. The blast output was then parsed for miRDeep uploading and aligned sequences with a maximum of 2 mismatches in the three prime end were retrieved. Reads that matched more than 10 different genome loci were discarded and only those with one or more alignments were kept  and using the remaining alignments as guidelines  the potential precursors were excised from the genome. The secondary structure of putative precursors was predicted using RNAfold and signatures were created by retaining reads that aligned perfectly with those putative precursors to generate the signature format. Finally  miRDeep predicted miRNAs by discarding non plausible Dicer products and scoring plausible ones. To assess seed conservation  plausible Dicer processing sequences were blasted against a local version of mature miRNAs from miRBase 12.0 that lacked zebrafish miRNA sequences. Borderline miRNA candidates were also resolved by determining their relative stability using Randfold. To distinguish between novel and known miRNAs  selected pre miRNAs were blasted against Danio rerio stem loop sequences miRBase and those that did not produce any or produced imperfect alignments were scored as novel miRNAs. Pairs of signatures and structures were used to estimate the number of false positives by randomly permutation  using miRDeep. To overcome the inherent lack of sensitivity of miRDeep  novel transcripts encoding miRNAs predicted by bioinformatics were retrieved from Ensembl 5.2 using BioMart and from literature predictions. These sequences were then used to perform a megaBlast search against our data with seed length set at 12. The transcripts with perfect matches and alignment length larger than 18 nt were kept for further processing. These transcripts were then compared with the mature miRNAs present in miRBase 12.0 and those that produced imperfect alignments or did not produce alignments were considered new miRNAs. Read numbers were normalized as described by Chen and colleagues Genes & Development 2005  19:1288 1293  and a miRNA expression profile  using identical number of reads for each sample  was generated. The number of reads between samples was normalized as indicated below:  Expression Reads = [1000 x NRmiRNAXY]/ TNRmiRNAsY  where NRmiRNAXY is the number of reads of miRNAX X = any miRNA in sample Y  and TNRmiRNAsY is the total number of miRNAs in sample Y. 1000 is an arbitrary number of reads. The data was transformed into log2 scale to build the heat map using the MeV 4.0 software package http://www.tm4.org/mev.html. Genome build: Zv8 Supplementary files format and content: Tab delimited text files include the miRNA IDs  sequences and respective raw counts post data processing for each sample.", "adult eyes 1 year old", null, "100 \u03bcg of total RNA from each sample was isolated using TRIzol\u00ae and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis  the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC  three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter \"Nelson's linker\" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime  for 1 hour at 37\u00b0C  followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript\u2122 III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides  as detailed next. 24hpf   ATC; 72hpf   ACT; 96hpf   CAG; 5dpf   ATG; 45dpf   CCG; entire adult   GTA; brain   CGG; Heart   CTG; Eyes   GCT; fins   GTT; skin   TAC; gills   TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion  at 37\u00b0C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche  following established protocols for DNA library sequencing.", "Wild type AB zebrafish strain was maintained at 28\u00baC on a 14 h light/10 h dark cycle.", "strain/background:AB|genotype/variation:wild type|tissue:eyes|developmental stage:adult|age:1 year", "GSM1630511", "GSM1630511: eyes; Danio rerio; miRNA Seq", "GSM1630511", null, "1", "100 \u03bcg of total RNA from each sample was isolated using TRIzol\u00ae and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis  the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC  three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter \"Nelson's linker\" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime  for 1 hour at 37\u00b0C  followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript\u2122 III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides  as detailed next. 24hpf   ATC; 72hpf   ACT; 96hpf   CAG; 5dpf   ATG; 45dpf   CCG; entire adult   GTA; brain   CGG; Heart   CTG; Eyes   GCT; fins   GTT; skin   TAC; gills   TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion  at 37\u00b0C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche  following established protocols for DNA library sequencing.", "GEO Accession:GSM1630511", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "LS454", "454 GS FLX", null, "SRP056014", null, null, null, null, 173069.0, 3135.0, "GSM1630511 r1", "0:4 1:51.21", "A:50732;C:44705;G:40960;T:36324;N:348", 4, 51, null, null, 50732, 44705, 40960, 36324, 348, "SRX915247", "SRS870227", "SRA246117", "GEO", "University of Aveiro", 1, 0.0, null, 0.0, null, 1.0, null, null, null, 52, null, "T", null, "under 1.2% mapping rate", "legacy", "early", "3prime", "size_fractionation", "unknown", "bulk", "other_seq", "454", null, "Portugal", "2015-03-09", "Adult", "Adult", "Eye", "Sensory System"], [39614, "SRR1873566", "SRX915246", "SRS870228", "SRP056014", "PRJNA277780", "Identification of small non coding RNAs in zebrafish", "GSE66718", "Transcriptome Analysis", "MicroRNAs miRNAs are a new class of small RNAs of approximately 22 nucleotides in length that control eukaryotic gene expression by fine tuning mRNA translation. They regulate a wide variety of biological processes  namely developmental timing  cell differentiation  cell proliferation  immune response and infection. For this reason  their identification is essential to understand eukaryotic biology. Their small size  low abundance and high instability complicated early identification; however  cloning/Sanger sequencing and new generation genome sequencing approaches overcame most technical hurdles and are being used for rapid miRNA identification in many eukaryotes. We have applied 454 DNA pyrosequencing technology to miRNA discovery in zebrafish Danio rerio. For this  a series of cDNA libraries were prepared from small non coding RNAs isolated at different embryonic time points and from fully developed organs. Each cDNA library was tagged with specific sequences and was sequenced using the Roche FLX genome sequencer. This approach retrieved 90% of the 192 miRNAs previously identified by cloning/Sanger sequencing and bioinformatics and 25 novel miRNAs were predicted. Overall design: Small RNA libraries were prepared from different zebrafish developmental stages  namely  24 hpf  72 hpf  96 hpf  5 dpf dpf  45 dpf  young adult and from adult brain  eyes  gills  heart  skin and fins.", null, "pubmed:26694924", null, "brain", "GSM1630510", null, "source name:adult brain 1 year old|strain/background:AB|genotype/variation:wild type|tissue:brain|developmental stage:adult|age:1 year", "brain", "Base calling and quality trimming of sequence reads was carried out using the Genome Sequencer FLX software. Raw images were processed to remove background noise and the data was normalized. TAGs and adapter sequences of zebrafish developmental and adult tissues samples were then identified and trimmed and those reads with correct TAGs and adapters > 15 nt were retrieved for downstream analysis using the miRDeep software https://www.mdc berlin.de/8551903/en/. miRDeep aligned the sequences against the zebrafish genome using megaBlast with seed length set at 12  the traditional blast output  and minimum local identity set at 100. The blast output was then parsed for miRDeep uploading and aligned sequences with a maximum of 2 mismatches in the three prime end were retrieved. Reads that matched more than 10 different genome loci were discarded and only those with one or more alignments were kept  and using the remaining alignments as guidelines  the potential precursors were excised from the genome. The secondary structure of putative precursors was predicted using RNAfold and signatures were created by retaining reads that aligned perfectly with those putative precursors to generate the signature format. Finally  miRDeep predicted miRNAs by discarding non plausible Dicer products and scoring plausible ones. To assess seed conservation  plausible Dicer processing sequences were blasted against a local version of mature miRNAs from miRBase 12.0 that lacked zebrafish miRNA sequences. Borderline miRNA candidates were also resolved by determining their relative stability using Randfold. To distinguish between novel and known miRNAs  selected pre miRNAs were blasted against Danio rerio stem loop sequences miRBase and those that did not produce any or produced imperfect alignments were scored as novel miRNAs. Pairs of signatures and structures were used to estimate the number of false positives by randomly permutation  using miRDeep. To overcome the inherent lack of sensitivity of miRDeep  novel transcripts encoding miRNAs predicted by bioinformatics were retrieved from Ensembl 5.2 using BioMart and from literature predictions. These sequences were then used to perform a megaBlast search against our data with seed length set at 12. The transcripts with perfect matches and alignment length larger than 18 nt were kept for further processing. These transcripts were then compared with the mature miRNAs present in miRBase 12.0 and those that produced imperfect alignments or did not produce alignments were considered new miRNAs. Read numbers were normalized as described by Chen and colleagues Genes & Development 2005  19:1288 1293  and a miRNA expression profile  using identical number of reads for each sample  was generated. The number of reads between samples was normalized as indicated below:  Expression Reads = [1000 x NRmiRNAXY]/ TNRmiRNAsY  where NRmiRNAXY is the number of reads of miRNAX X = any miRNA in sample Y  and TNRmiRNAsY is the total number of miRNAs in sample Y. 1000 is an arbitrary number of reads. The data was transformed into log2 scale to build the heat map using the MeV 4.0 software package http://www.tm4.org/mev.html. Genome build: Zv8 Supplementary files format and content: Tab delimited text files include the miRNA IDs  sequences and respective raw counts post data processing for each sample.", "adult brain 1 year old", null, "100 \u03bcg of total RNA from each sample was isolated using TRIzol\u00ae and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis  the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC  three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter \"Nelson's linker\" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime  for 1 hour at 37\u00b0C  followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript\u2122 III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides  as detailed next. 24hpf   ATC; 72hpf   ACT; 96hpf   CAG; 5dpf   ATG; 45dpf   CCG; entire adult   GTA; brain   CGG; Heart   CTG; Eyes   GCT; fins   GTT; skin   TAC; gills   TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion  at 37\u00b0C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche  following established protocols for DNA library sequencing.", "Wild type AB zebrafish strain was maintained at 28\u00baC on a 14 h light/10 h dark cycle.", "strain/background:AB|genotype/variation:wild type|tissue:brain|developmental stage:adult|age:1 year", "GSM1630510", "GSM1630510: brain; Danio rerio; miRNA Seq", "GSM1630510", null, "1", "100 \u03bcg of total RNA from each sample was isolated using TRIzol\u00ae and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis  the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC  three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter \"Nelson's linker\" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime  for 1 hour at 37\u00b0C  followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript\u2122 III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides  as detailed next. 24hpf   ATC; 72hpf   ACT; 96hpf   CAG; 5dpf   ATG; 45dpf   CCG; entire adult   GTA; brain   CGG; Heart   CTG; Eyes   GCT; fins   GTT; skin   TAC; gills   TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion  at 37\u00b0C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche  following established protocols for DNA library sequencing.", "GEO Accession:GSM1630510", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "LS454", "454 GS FLX", null, "SRP056014", null, null, null, null, 688279.0, 12620.0, "GSM1630510 r1", "0:4 1:50.54", "A:205782;C:180028;G:171745;T:129693;N:1031", 4, 50, null, null, 205782, 180028, 171745, 129693, 1031, "SRX915246", "SRS870228", "SRA246117", "GEO", "University of Aveiro", 1, 0.0, null, 0.0, null, 1.0, null, null, null, 48, null, "T", null, "under 1.2% mapping rate", "legacy", "early", "3prime", "size_fractionation", "unknown", "bulk", "other_seq", "454", null, "Portugal", "2015-03-09", "Adult", "Adult", "Brain", "Nervous System"], [39615, "SRR1873565", "SRX915245", "SRS870229", "SRP056014", "PRJNA277780", "Identification of small non coding RNAs in zebrafish", "GSE66718", "Transcriptome Analysis", "MicroRNAs miRNAs are a new class of small RNAs of approximately 22 nucleotides in length that control eukaryotic gene expression by fine tuning mRNA translation. They regulate a wide variety of biological processes  namely developmental timing  cell differentiation  cell proliferation  immune response and infection. For this reason  their identification is essential to understand eukaryotic biology. Their small size  low abundance and high instability complicated early identification; however  cloning/Sanger sequencing and new generation genome sequencing approaches overcame most technical hurdles and are being used for rapid miRNA identification in many eukaryotes. We have applied 454 DNA pyrosequencing technology to miRNA discovery in zebrafish Danio rerio. For this  a series of cDNA libraries were prepared from small non coding RNAs isolated at different embryonic time points and from fully developed organs. Each cDNA library was tagged with specific sequences and was sequenced using the Roche FLX genome sequencer. This approach retrieved 90% of the 192 miRNAs previously identified by cloning/Sanger sequencing and bioinformatics and 25 novel miRNAs were predicted. Overall design: Small RNA libraries were prepared from different zebrafish developmental stages  namely  24 hpf  72 hpf  96 hpf  5 dpf dpf  45 dpf  young adult and from adult brain  eyes  gills  heart  skin and fins.", null, "pubmed:26694924", null, "adult", "GSM1630509", null, "source name:entire adult|strain/background:AB|genotype/variation:wild type|tissue:whole body|developmental stage:adult|age:1 year", "adult", "Base calling and quality trimming of sequence reads was carried out using the Genome Sequencer FLX software. Raw images were processed to remove background noise and the data was normalized. TAGs and adapter sequences of zebrafish developmental and adult tissues samples were then identified and trimmed and those reads with correct TAGs and adapters > 15 nt were retrieved for downstream analysis using the miRDeep software https://www.mdc berlin.de/8551903/en/. miRDeep aligned the sequences against the zebrafish genome using megaBlast with seed length set at 12  the traditional blast output  and minimum local identity set at 100. The blast output was then parsed for miRDeep uploading and aligned sequences with a maximum of 2 mismatches in the three prime end were retrieved. Reads that matched more than 10 different genome loci were discarded and only those with one or more alignments were kept  and using the remaining alignments as guidelines  the potential precursors were excised from the genome. The secondary structure of putative precursors was predicted using RNAfold and signatures were created by retaining reads that aligned perfectly with those putative precursors to generate the signature format. Finally  miRDeep predicted miRNAs by discarding non plausible Dicer products and scoring plausible ones. To assess seed conservation  plausible Dicer processing sequences were blasted against a local version of mature miRNAs from miRBase 12.0 that lacked zebrafish miRNA sequences. Borderline miRNA candidates were also resolved by determining their relative stability using Randfold. To distinguish between novel and known miRNAs  selected pre miRNAs were blasted against Danio rerio stem loop sequences miRBase and those that did not produce any or produced imperfect alignments were scored as novel miRNAs. Pairs of signatures and structures were used to estimate the number of false positives by randomly permutation  using miRDeep. To overcome the inherent lack of sensitivity of miRDeep  novel transcripts encoding miRNAs predicted by bioinformatics were retrieved from Ensembl 5.2 using BioMart and from literature predictions. These sequences were then used to perform a megaBlast search against our data with seed length set at 12. The transcripts with perfect matches and alignment length larger than 18 nt were kept for further processing. These transcripts were then compared with the mature miRNAs present in miRBase 12.0 and those that produced imperfect alignments or did not produce alignments were considered new miRNAs. Read numbers were normalized as described by Chen and colleagues Genes & Development 2005  19:1288 1293  and a miRNA expression profile  using identical number of reads for each sample  was generated. The number of reads between samples was normalized as indicated below:  Expression Reads = [1000 x NRmiRNAXY]/ TNRmiRNAsY  where NRmiRNAXY is the number of reads of miRNAX X = any miRNA in sample Y  and TNRmiRNAsY is the total number of miRNAs in sample Y. 1000 is an arbitrary number of reads. The data was transformed into log2 scale to build the heat map using the MeV 4.0 software package http://www.tm4.org/mev.html. Genome build: Zv8 Supplementary files format and content: Tab delimited text files include the miRNA IDs  sequences and respective raw counts post data processing for each sample.", "entire adult", null, "100 \u03bcg of total RNA from each sample was isolated using TRIzol\u00ae and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis  the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC  three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter \"Nelson's linker\" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime  for 1 hour at 37\u00b0C  followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript\u2122 III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides  as detailed next. 24hpf   ATC; 72hpf   ACT; 96hpf   CAG; 5dpf   ATG; 45dpf   CCG; entire adult   GTA; brain   CGG; Heart   CTG; Eyes   GCT; fins   GTT; skin   TAC; gills   TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion  at 37\u00b0C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche  following established protocols for DNA library sequencing.", "Wild type AB zebrafish strain was maintained at 28\u00baC on a 14 h light/10 h dark cycle.", "strain/background:AB|genotype/variation:wild type|tissue:whole body|developmental stage:adult|age:1 year", "GSM1630509", "GSM1630509: adult; Danio rerio; miRNA Seq", "GSM1630509", null, "1", "100 \u03bcg of total RNA from each sample was isolated using TRIzol\u00ae and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis  the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC  three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter \"Nelson's linker\" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime  for 1 hour at 37\u00b0C  followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript\u2122 III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides  as detailed next. 24hpf   ATC; 72hpf   ACT; 96hpf   CAG; 5dpf   ATG; 45dpf   CCG; entire adult   GTA; brain   CGG; Heart   CTG; Eyes   GCT; fins   GTT; skin   TAC; gills   TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion  at 37\u00b0C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche  following established protocols for DNA library sequencing.", "GEO Accession:GSM1630509", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "LS454", "454 GS FLX", null, "SRP056014", null, null, null, null, 361024.0, 6498.0, "GSM1630509 r1", "0:4 1:51.56", "A:104704;C:84406;G:83224;T:87843;N:847", 4, 51, null, null, 104704, 84406, 83224, 87843, 847, "SRX915245", "SRS870229", "SRA246117", "GEO", "University of Aveiro", 1, 0.0, null, 0.0, null, 1.0, null, null, null, 51, null, "T", null, "under 1.2% mapping rate", "legacy", "early", "3prime", "size_fractionation", "unknown", "bulk", "other_seq", "454", null, "Portugal", "2015-03-09", "Adult", "Adult", "Trunk", "Surface Structure"], [39616, "SRR1873564", "SRX915244", "SRS870230", "SRP056014", "PRJNA277780", "Identification of small non coding RNAs in zebrafish", "GSE66718", "Transcriptome Analysis", "MicroRNAs miRNAs are a new class of small RNAs of approximately 22 nucleotides in length that control eukaryotic gene expression by fine tuning mRNA translation. They regulate a wide variety of biological processes  namely developmental timing  cell differentiation  cell proliferation  immune response and infection. For this reason  their identification is essential to understand eukaryotic biology. Their small size  low abundance and high instability complicated early identification; however  cloning/Sanger sequencing and new generation genome sequencing approaches overcame most technical hurdles and are being used for rapid miRNA identification in many eukaryotes. We have applied 454 DNA pyrosequencing technology to miRNA discovery in zebrafish Danio rerio. For this  a series of cDNA libraries were prepared from small non coding RNAs isolated at different embryonic time points and from fully developed organs. Each cDNA library was tagged with specific sequences and was sequenced using the Roche FLX genome sequencer. This approach retrieved 90% of the 192 miRNAs previously identified by cloning/Sanger sequencing and bioinformatics and 25 novel miRNAs were predicted. Overall design: Small RNA libraries were prepared from different zebrafish developmental stages  namely  24 hpf  72 hpf  96 hpf  5 dpf dpf  45 dpf  young adult and from adult brain  eyes  gills  heart  skin and fins.", null, "pubmed:26694924", null, "45dpf", "GSM1630508", null, "source name:45 dpf embryos|strain/background:AB|genotype/variation:wild type|tissue:whole body|developmental stage:embryo|age:45dpf", "45dpf", "Base calling and quality trimming of sequence reads was carried out using the Genome Sequencer FLX software. Raw images were processed to remove background noise and the data was normalized. TAGs and adapter sequences of zebrafish developmental and adult tissues samples were then identified and trimmed and those reads with correct TAGs and adapters > 15 nt were retrieved for downstream analysis using the miRDeep software https://www.mdc berlin.de/8551903/en/. miRDeep aligned the sequences against the zebrafish genome using megaBlast with seed length set at 12  the traditional blast output  and minimum local identity set at 100. The blast output was then parsed for miRDeep uploading and aligned sequences with a maximum of 2 mismatches in the three prime end were retrieved. Reads that matched more than 10 different genome loci were discarded and only those with one or more alignments were kept  and using the remaining alignments as guidelines  the potential precursors were excised from the genome. The secondary structure of putative precursors was predicted using RNAfold and signatures were created by retaining reads that aligned perfectly with those putative precursors to generate the signature format. Finally  miRDeep predicted miRNAs by discarding non plausible Dicer products and scoring plausible ones. To assess seed conservation  plausible Dicer processing sequences were blasted against a local version of mature miRNAs from miRBase 12.0 that lacked zebrafish miRNA sequences. Borderline miRNA candidates were also resolved by determining their relative stability using Randfold. To distinguish between novel and known miRNAs  selected pre miRNAs were blasted against Danio rerio stem loop sequences miRBase and those that did not produce any or produced imperfect alignments were scored as novel miRNAs. Pairs of signatures and structures were used to estimate the number of false positives by randomly permutation  using miRDeep. To overcome the inherent lack of sensitivity of miRDeep  novel transcripts encoding miRNAs predicted by bioinformatics were retrieved from Ensembl 5.2 using BioMart and from literature predictions. These sequences were then used to perform a megaBlast search against our data with seed length set at 12. The transcripts with perfect matches and alignment length larger than 18 nt were kept for further processing. These transcripts were then compared with the mature miRNAs present in miRBase 12.0 and those that produced imperfect alignments or did not produce alignments were considered new miRNAs. Read numbers were normalized as described by Chen and colleagues Genes & Development 2005  19:1288 1293  and a miRNA expression profile  using identical number of reads for each sample  was generated. The number of reads between samples was normalized as indicated below:  Expression Reads = [1000 x NRmiRNAXY]/ TNRmiRNAsY  where NRmiRNAXY is the number of reads of miRNAX X = any miRNA in sample Y  and TNRmiRNAsY is the total number of miRNAs in sample Y. 1000 is an arbitrary number of reads. The data was transformed into log2 scale to build the heat map using the MeV 4.0 software package http://www.tm4.org/mev.html. Genome build: Zv8 Supplementary files format and content: Tab delimited text files include the miRNA IDs  sequences and respective raw counts post data processing for each sample.", "45 dpf embryos", null, "100 \u03bcg of total RNA from each sample was isolated using TRIzol\u00ae and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis  the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC  three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter \"Nelson's linker\" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime  for 1 hour at 37\u00b0C  followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript\u2122 III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides  as detailed next. 24hpf   ATC; 72hpf   ACT; 96hpf   CAG; 5dpf   ATG; 45dpf   CCG; entire adult   GTA; brain   CGG; Heart   CTG; Eyes   GCT; fins   GTT; skin   TAC; gills   TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion  at 37\u00b0C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche  following established protocols for DNA library sequencing.", "Wild type AB zebrafish strain was maintained at 28\u00baC on a 14 h light/10 h dark cycle.", "strain/background:AB|genotype/variation:wild type|tissue:whole body|developmental stage:embryo|age:45dpf", "GSM1630508", "GSM1630508: 45dpf; Danio rerio; miRNA Seq", "GSM1630508", null, "1", "100 \u03bcg of total RNA from each sample was isolated using TRIzol\u00ae and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis  the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC  three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter \"Nelson's linker\" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime  for 1 hour at 37\u00b0C  followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript\u2122 III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides  as detailed next. 24hpf   ATC; 72hpf   ACT; 96hpf   CAG; 5dpf   ATG; 45dpf   CCG; entire adult   GTA; brain   CGG; Heart   CTG; Eyes   GCT; fins   GTT; skin   TAC; gills   TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion  at 37\u00b0C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche  following established protocols for DNA library sequencing.", "GEO Accession:GSM1630508", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "LS454", "454 GS FLX", null, "SRP056014", null, null, null, null, 123960.0, 2248.0, "GSM1630508 r1", "0:4 1:51.14", "A:38130;C:31332;G:30088;T:24223;N:187", 4, 51, null, null, 38130, 31332, 30088, 24223, 187, "SRX915244", "SRS870230", "SRA246117", "GEO", "University of Aveiro", 1, 0.0, null, 0.0, null, 1.0, null, null, null, 52, null, "T", null, "under 1.2% mapping rate", "legacy", "early", "3prime", "size_fractionation", "unknown", "bulk", "other_seq", "454", null, "Portugal", "2015-03-09", "Juvenile", "Juvenile", "Trunk", "Surface Structure"], [39617, "SRR1873563", "SRX915243", "SRS870231", "SRP056014", "PRJNA277780", "Identification of small non coding RNAs in zebrafish", "GSE66718", "Transcriptome Analysis", "MicroRNAs miRNAs are a new class of small RNAs of approximately 22 nucleotides in length that control eukaryotic gene expression by fine tuning mRNA translation. They regulate a wide variety of biological processes  namely developmental timing  cell differentiation  cell proliferation  immune response and infection. For this reason  their identification is essential to understand eukaryotic biology. Their small size  low abundance and high instability complicated early identification; however  cloning/Sanger sequencing and new generation genome sequencing approaches overcame most technical hurdles and are being used for rapid miRNA identification in many eukaryotes. We have applied 454 DNA pyrosequencing technology to miRNA discovery in zebrafish Danio rerio. For this  a series of cDNA libraries were prepared from small non coding RNAs isolated at different embryonic time points and from fully developed organs. Each cDNA library was tagged with specific sequences and was sequenced using the Roche FLX genome sequencer. This approach retrieved 90% of the 192 miRNAs previously identified by cloning/Sanger sequencing and bioinformatics and 25 novel miRNAs were predicted. Overall design: Small RNA libraries were prepared from different zebrafish developmental stages  namely  24 hpf  72 hpf  96 hpf  5 dpf dpf  45 dpf  young adult and from adult brain  eyes  gills  heart  skin and fins.", null, "pubmed:26694924", null, "5dpf", "GSM1630507", null, "source name:5 dpf embryos|strain/background:AB|genotype/variation:wild type|tissue:whole body|developmental stage:embryo|age:5dpf", "5dpf", "Base calling and quality trimming of sequence reads was carried out using the Genome Sequencer FLX software. Raw images were processed to remove background noise and the data was normalized. TAGs and adapter sequences of zebrafish developmental and adult tissues samples were then identified and trimmed and those reads with correct TAGs and adapters > 15 nt were retrieved for downstream analysis using the miRDeep software https://www.mdc berlin.de/8551903/en/. miRDeep aligned the sequences against the zebrafish genome using megaBlast with seed length set at 12  the traditional blast output  and minimum local identity set at 100. The blast output was then parsed for miRDeep uploading and aligned sequences with a maximum of 2 mismatches in the three prime end were retrieved. Reads that matched more than 10 different genome loci were discarded and only those with one or more alignments were kept  and using the remaining alignments as guidelines  the potential precursors were excised from the genome. The secondary structure of putative precursors was predicted using RNAfold and signatures were created by retaining reads that aligned perfectly with those putative precursors to generate the signature format. Finally  miRDeep predicted miRNAs by discarding non plausible Dicer products and scoring plausible ones. To assess seed conservation  plausible Dicer processing sequences were blasted against a local version of mature miRNAs from miRBase 12.0 that lacked zebrafish miRNA sequences. Borderline miRNA candidates were also resolved by determining their relative stability using Randfold. To distinguish between novel and known miRNAs  selected pre miRNAs were blasted against Danio rerio stem loop sequences miRBase and those that did not produce any or produced imperfect alignments were scored as novel miRNAs. Pairs of signatures and structures were used to estimate the number of false positives by randomly permutation  using miRDeep. To overcome the inherent lack of sensitivity of miRDeep  novel transcripts encoding miRNAs predicted by bioinformatics were retrieved from Ensembl 5.2 using BioMart and from literature predictions. These sequences were then used to perform a megaBlast search against our data with seed length set at 12. The transcripts with perfect matches and alignment length larger than 18 nt were kept for further processing. These transcripts were then compared with the mature miRNAs present in miRBase 12.0 and those that produced imperfect alignments or did not produce alignments were considered new miRNAs. Read numbers were normalized as described by Chen and colleagues Genes & Development 2005  19:1288 1293  and a miRNA expression profile  using identical number of reads for each sample  was generated. The number of reads between samples was normalized as indicated below:  Expression Reads = [1000 x NRmiRNAXY]/ TNRmiRNAsY  where NRmiRNAXY is the number of reads of miRNAX X = any miRNA in sample Y  and TNRmiRNAsY is the total number of miRNAs in sample Y. 1000 is an arbitrary number of reads. The data was transformed into log2 scale to build the heat map using the MeV 4.0 software package http://www.tm4.org/mev.html. Genome build: Zv8 Supplementary files format and content: Tab delimited text files include the miRNA IDs  sequences and respective raw counts post data processing for each sample.", "5 dpf embryos", null, "100 \u03bcg of total RNA from each sample was isolated using TRIzol\u00ae and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis  the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC  three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter \"Nelson's linker\" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime  for 1 hour at 37\u00b0C  followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript\u2122 III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides  as detailed next. 24hpf   ATC; 72hpf   ACT; 96hpf   CAG; 5dpf   ATG; 45dpf   CCG; entire adult   GTA; brain   CGG; Heart   CTG; Eyes   GCT; fins   GTT; skin   TAC; gills   TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion  at 37\u00b0C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche  following established protocols for DNA library sequencing.", "Wild type AB zebrafish strain was maintained at 28\u00baC on a 14 h light/10 h dark cycle.", "strain/background:AB|genotype/variation:wild type|tissue:whole body|developmental stage:embryo|age:5dpf", "GSM1630507", "GSM1630507: 5dpf; Danio rerio; miRNA Seq", "GSM1630507", null, "1", "100 \u03bcg of total RNA from each sample was isolated using TRIzol\u00ae and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis  the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC  three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter \"Nelson's linker\" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime  for 1 hour at 37\u00b0C  followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript\u2122 III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides  as detailed next. 24hpf   ATC; 72hpf   ACT; 96hpf   CAG; 5dpf   ATG; 45dpf   CCG; entire adult   GTA; brain   CGG; Heart   CTG; Eyes   GCT; fins   GTT; skin   TAC; gills   TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion  at 37\u00b0C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche  following established protocols for DNA library sequencing.", "GEO Accession:GSM1630507", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "LS454", "454 GS FLX", null, "SRP056014", null, null, null, null, 168981.0, 3060.0, "GSM1630507 r1", "0:4 1:51.22", "A:51895;C:42870;G:40864;T:32741;N:611", 4, 51, null, null, 51895, 42870, 40864, 32741, 611, "SRX915243", "SRS870231", "SRA246117", "GEO", "University of Aveiro", 1, 0.0, null, 0.0, null, 1.0, null, null, null, 50, null, "T", null, "under 1.2% mapping rate", "legacy", "early", "3prime", "size_fractionation", "unknown", "bulk", "other_seq", "454", null, "Portugal", "2015-03-09", "Larval", "Larval", "Trunk", "Surface Structure"], [39618, "SRR1873562", "SRX915242", "SRS870232", "SRP056014", "PRJNA277780", "Identification of small non coding RNAs in zebrafish", "GSE66718", "Transcriptome Analysis", "MicroRNAs miRNAs are a new class of small RNAs of approximately 22 nucleotides in length that control eukaryotic gene expression by fine tuning mRNA translation. They regulate a wide variety of biological processes  namely developmental timing  cell differentiation  cell proliferation  immune response and infection. For this reason  their identification is essential to understand eukaryotic biology. Their small size  low abundance and high instability complicated early identification; however  cloning/Sanger sequencing and new generation genome sequencing approaches overcame most technical hurdles and are being used for rapid miRNA identification in many eukaryotes. We have applied 454 DNA pyrosequencing technology to miRNA discovery in zebrafish Danio rerio. For this  a series of cDNA libraries were prepared from small non coding RNAs isolated at different embryonic time points and from fully developed organs. Each cDNA library was tagged with specific sequences and was sequenced using the Roche FLX genome sequencer. This approach retrieved 90% of the 192 miRNAs previously identified by cloning/Sanger sequencing and bioinformatics and 25 novel miRNAs were predicted. Overall design: Small RNA libraries were prepared from different zebrafish developmental stages  namely  24 hpf  72 hpf  96 hpf  5 dpf dpf  45 dpf  young adult and from adult brain  eyes  gills  heart  skin and fins.", null, "pubmed:26694924", null, "96hpf", "GSM1630506", null, "source name:96 hpf embryos|strain/background:AB|genotype/variation:wild type|tissue:whole body|developmental stage:embryo|age:96hpf", "96hpf", "Base calling and quality trimming of sequence reads was carried out using the Genome Sequencer FLX software. Raw images were processed to remove background noise and the data was normalized. TAGs and adapter sequences of zebrafish developmental and adult tissues samples were then identified and trimmed and those reads with correct TAGs and adapters > 15 nt were retrieved for downstream analysis using the miRDeep software https://www.mdc berlin.de/8551903/en/. miRDeep aligned the sequences against the zebrafish genome using megaBlast with seed length set at 12  the traditional blast output  and minimum local identity set at 100. The blast output was then parsed for miRDeep uploading and aligned sequences with a maximum of 2 mismatches in the three prime end were retrieved. Reads that matched more than 10 different genome loci were discarded and only those with one or more alignments were kept  and using the remaining alignments as guidelines  the potential precursors were excised from the genome. The secondary structure of putative precursors was predicted using RNAfold and signatures were created by retaining reads that aligned perfectly with those putative precursors to generate the signature format. Finally  miRDeep predicted miRNAs by discarding non plausible Dicer products and scoring plausible ones. To assess seed conservation  plausible Dicer processing sequences were blasted against a local version of mature miRNAs from miRBase 12.0 that lacked zebrafish miRNA sequences. Borderline miRNA candidates were also resolved by determining their relative stability using Randfold. To distinguish between novel and known miRNAs  selected pre miRNAs were blasted against Danio rerio stem loop sequences miRBase and those that did not produce any or produced imperfect alignments were scored as novel miRNAs. Pairs of signatures and structures were used to estimate the number of false positives by randomly permutation  using miRDeep. To overcome the inherent lack of sensitivity of miRDeep  novel transcripts encoding miRNAs predicted by bioinformatics were retrieved from Ensembl 5.2 using BioMart and from literature predictions. These sequences were then used to perform a megaBlast search against our data with seed length set at 12. The transcripts with perfect matches and alignment length larger than 18 nt were kept for further processing. These transcripts were then compared with the mature miRNAs present in miRBase 12.0 and those that produced imperfect alignments or did not produce alignments were considered new miRNAs. Read numbers were normalized as described by Chen and colleagues Genes & Development 2005  19:1288 1293  and a miRNA expression profile  using identical number of reads for each sample  was generated. The number of reads between samples was normalized as indicated below:  Expression Reads = [1000 x NRmiRNAXY]/ TNRmiRNAsY  where NRmiRNAXY is the number of reads of miRNAX X = any miRNA in sample Y  and TNRmiRNAsY is the total number of miRNAs in sample Y. 1000 is an arbitrary number of reads. The data was transformed into log2 scale to build the heat map using the MeV 4.0 software package http://www.tm4.org/mev.html. Genome build: Zv8 Supplementary files format and content: Tab delimited text files include the miRNA IDs  sequences and respective raw counts post data processing for each sample.", "96 hpf embryos", null, "100 \u03bcg of total RNA from each sample was isolated using TRIzol\u00ae and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis  the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC  three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter \"Nelson's linker\" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime  for 1 hour at 37\u00b0C  followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript\u2122 III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides  as detailed next. 24hpf   ATC; 72hpf   ACT; 96hpf   CAG; 5dpf   ATG; 45dpf   CCG; entire adult   GTA; brain   CGG; Heart   CTG; Eyes   GCT; fins   GTT; skin   TAC; gills   TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion  at 37\u00b0C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche  following established protocols for DNA library sequencing.", "Wild type AB zebrafish strain was maintained at 28\u00baC on a 14 h light/10 h dark cycle.", "strain/background:AB|genotype/variation:wild type|tissue:whole body|developmental stage:embryo|age:96hpf", "GSM1630506", "GSM1630506: 96hpf; Danio rerio; miRNA Seq", "GSM1630506", null, "1", "100 \u03bcg of total RNA from each sample was isolated using TRIzol\u00ae and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis  the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC  three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter \"Nelson's linker\" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime  for 1 hour at 37\u00b0C  followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript\u2122 III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides  as detailed next. 24hpf   ATC; 72hpf   ACT; 96hpf   CAG; 5dpf   ATG; 45dpf   CCG; entire adult   GTA; brain   CGG; Heart   CTG; Eyes   GCT; fins   GTT; skin   TAC; gills   TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion  at 37\u00b0C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche  following established protocols for DNA library sequencing.", "GEO Accession:GSM1630506", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "LS454", "454 GS FLX", null, "SRP056014", null, null, null, null, 61235.0, 1109.0, "GSM1630506 r1", "0:4 1:51.22", "A:18594;C:15084;G:15091;T:12247;N:219", 4, 51, null, null, 18594, 15084, 15091, 12247, 219, "SRX915242", "SRS870232", "SRA246117", "GEO", "University of Aveiro", 1, 0.0, null, 0.0, null, 1.0, null, null, null, 52, null, "T", null, "under 1.2% mapping rate", "legacy", "early", "3prime", "size_fractionation", "unknown", "bulk", "other_seq", "454", null, "Portugal", "2015-03-09", "Larval", "Larval", "Trunk", "Surface Structure"], [39619, "SRR1873561", "SRX915241", "SRS870233", "SRP056014", "PRJNA277780", "Identification of small non coding RNAs in zebrafish", "GSE66718", "Transcriptome Analysis", "MicroRNAs miRNAs are a new class of small RNAs of approximately 22 nucleotides in length that control eukaryotic gene expression by fine tuning mRNA translation. They regulate a wide variety of biological processes  namely developmental timing  cell differentiation  cell proliferation  immune response and infection. For this reason  their identification is essential to understand eukaryotic biology. Their small size  low abundance and high instability complicated early identification; however  cloning/Sanger sequencing and new generation genome sequencing approaches overcame most technical hurdles and are being used for rapid miRNA identification in many eukaryotes. We have applied 454 DNA pyrosequencing technology to miRNA discovery in zebrafish Danio rerio. For this  a series of cDNA libraries were prepared from small non coding RNAs isolated at different embryonic time points and from fully developed organs. Each cDNA library was tagged with specific sequences and was sequenced using the Roche FLX genome sequencer. This approach retrieved 90% of the 192 miRNAs previously identified by cloning/Sanger sequencing and bioinformatics and 25 novel miRNAs were predicted. Overall design: Small RNA libraries were prepared from different zebrafish developmental stages  namely  24 hpf  72 hpf  96 hpf  5 dpf dpf  45 dpf  young adult and from adult brain  eyes  gills  heart  skin and fins.", null, "pubmed:26694924", null, "72hpf", "GSM1630505", null, "source name:72 hpf embryos|strain/background:AB|genotype/variation:wild type|tissue:whole body|developmental stage:embryo|age:72hpf", "72hpf", "Base calling and quality trimming of sequence reads was carried out using the Genome Sequencer FLX software. Raw images were processed to remove background noise and the data was normalized. TAGs and adapter sequences of zebrafish developmental and adult tissues samples were then identified and trimmed and those reads with correct TAGs and adapters > 15 nt were retrieved for downstream analysis using the miRDeep software https://www.mdc berlin.de/8551903/en/. miRDeep aligned the sequences against the zebrafish genome using megaBlast with seed length set at 12  the traditional blast output  and minimum local identity set at 100. The blast output was then parsed for miRDeep uploading and aligned sequences with a maximum of 2 mismatches in the three prime end were retrieved. Reads that matched more than 10 different genome loci were discarded and only those with one or more alignments were kept  and using the remaining alignments as guidelines  the potential precursors were excised from the genome. The secondary structure of putative precursors was predicted using RNAfold and signatures were created by retaining reads that aligned perfectly with those putative precursors to generate the signature format. Finally  miRDeep predicted miRNAs by discarding non plausible Dicer products and scoring plausible ones. To assess seed conservation  plausible Dicer processing sequences were blasted against a local version of mature miRNAs from miRBase 12.0 that lacked zebrafish miRNA sequences. Borderline miRNA candidates were also resolved by determining their relative stability using Randfold. To distinguish between novel and known miRNAs  selected pre miRNAs were blasted against Danio rerio stem loop sequences miRBase and those that did not produce any or produced imperfect alignments were scored as novel miRNAs. Pairs of signatures and structures were used to estimate the number of false positives by randomly permutation  using miRDeep. To overcome the inherent lack of sensitivity of miRDeep  novel transcripts encoding miRNAs predicted by bioinformatics were retrieved from Ensembl 5.2 using BioMart and from literature predictions. These sequences were then used to perform a megaBlast search against our data with seed length set at 12. The transcripts with perfect matches and alignment length larger than 18 nt were kept for further processing. These transcripts were then compared with the mature miRNAs present in miRBase 12.0 and those that produced imperfect alignments or did not produce alignments were considered new miRNAs. Read numbers were normalized as described by Chen and colleagues Genes & Development 2005  19:1288 1293  and a miRNA expression profile  using identical number of reads for each sample  was generated. The number of reads between samples was normalized as indicated below:  Expression Reads = [1000 x NRmiRNAXY]/ TNRmiRNAsY  where NRmiRNAXY is the number of reads of miRNAX X = any miRNA in sample Y  and TNRmiRNAsY is the total number of miRNAs in sample Y. 1000 is an arbitrary number of reads. The data was transformed into log2 scale to build the heat map using the MeV 4.0 software package http://www.tm4.org/mev.html. Genome build: Zv8 Supplementary files format and content: Tab delimited text files include the miRNA IDs  sequences and respective raw counts post data processing for each sample.", "72 hpf embryos", null, "100 \u03bcg of total RNA from each sample was isolated using TRIzol\u00ae and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis  the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC  three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter \"Nelson's linker\" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime  for 1 hour at 37\u00b0C  followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript\u2122 III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides  as detailed next. 24hpf   ATC; 72hpf   ACT; 96hpf   CAG; 5dpf   ATG; 45dpf   CCG; entire adult   GTA; brain   CGG; Heart   CTG; Eyes   GCT; fins   GTT; skin   TAC; gills   TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion  at 37\u00b0C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche  following established protocols for DNA library sequencing.", "Wild type AB zebrafish strain was maintained at 28\u00baC on a 14 h light/10 h dark cycle.", "strain/background:AB|genotype/variation:wild type|tissue:whole body|developmental stage:embryo|age:72hpf", "GSM1630505", "GSM1630505: 72hpf; Danio rerio; miRNA Seq", "GSM1630505", null, "1", "100 \u03bcg of total RNA from each sample was isolated using TRIzol\u00ae and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis  the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC  three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter \"Nelson's linker\" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime  for 1 hour at 37\u00b0C  followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript\u2122 III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides  as detailed next. 24hpf   ATC; 72hpf   ACT; 96hpf   CAG; 5dpf   ATG; 45dpf   CCG; entire adult   GTA; brain   CGG; Heart   CTG; Eyes   GCT; fins   GTT; skin   TAC; gills   TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion  at 37\u00b0C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche  following established protocols for DNA library sequencing.", "GEO Accession:GSM1630505", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "LS454", "454 GS FLX", null, "SRP056014", null, null, null, null, 778415.0, 14183.0, "GSM1630505 r1", "0:4 1:50.88", "A:231211;C:186354;G:190297;T:169348;N:1205", 4, 50, null, null, 231211, 186354, 190297, 169348, 1205, "SRX915241", "SRS870233", "SRA246117", "GEO", "University of Aveiro", 1, 0.0, null, 0.0, null, 1.0, null, null, null, 48, null, "T", null, "under 1.2% mapping rate", "legacy", "early", "3prime", "size_fractionation", "unknown", "bulk", "other_seq", "454", null, "Portugal", "2015-03-09", "Larval", "Larval", "Trunk", "Surface Structure"], [39620, "SRR1873560", "SRX915240", "SRS870234", "SRP056014", "PRJNA277780", "Identification of small non coding RNAs in zebrafish", "GSE66718", "Transcriptome Analysis", "MicroRNAs miRNAs are a new class of small RNAs of approximately 22 nucleotides in length that control eukaryotic gene expression by fine tuning mRNA translation. They regulate a wide variety of biological processes  namely developmental timing  cell differentiation  cell proliferation  immune response and infection. For this reason  their identification is essential to understand eukaryotic biology. Their small size  low abundance and high instability complicated early identification; however  cloning/Sanger sequencing and new generation genome sequencing approaches overcame most technical hurdles and are being used for rapid miRNA identification in many eukaryotes. We have applied 454 DNA pyrosequencing technology to miRNA discovery in zebrafish Danio rerio. For this  a series of cDNA libraries were prepared from small non coding RNAs isolated at different embryonic time points and from fully developed organs. Each cDNA library was tagged with specific sequences and was sequenced using the Roche FLX genome sequencer. This approach retrieved 90% of the 192 miRNAs previously identified by cloning/Sanger sequencing and bioinformatics and 25 novel miRNAs were predicted. Overall design: Small RNA libraries were prepared from different zebrafish developmental stages  namely  24 hpf  72 hpf  96 hpf  5 dpf dpf  45 dpf  young adult and from adult brain  eyes  gills  heart  skin and fins.", null, "pubmed:26694924", null, "24hpf", "GSM1630504", null, "source name:24 hpf embryos|strain/background:AB|genotype/variation:wild type|tissue:whole body|developmental stage:embryo|age:24hpf", "24hpf", "Base calling and quality trimming of sequence reads was carried out using the Genome Sequencer FLX software. Raw images were processed to remove background noise and the data was normalized. TAGs and adapter sequences of zebrafish developmental and adult tissues samples were then identified and trimmed and those reads with correct TAGs and adapters > 15 nt were retrieved for downstream analysis using the miRDeep software https://www.mdc berlin.de/8551903/en/. miRDeep aligned the sequences against the zebrafish genome using megaBlast with seed length set at 12  the traditional blast output  and minimum local identity set at 100. The blast output was then parsed for miRDeep uploading and aligned sequences with a maximum of 2 mismatches in the three prime end were retrieved. Reads that matched more than 10 different genome loci were discarded and only those with one or more alignments were kept  and using the remaining alignments as guidelines  the potential precursors were excised from the genome. The secondary structure of putative precursors was predicted using RNAfold and signatures were created by retaining reads that aligned perfectly with those putative precursors to generate the signature format. Finally  miRDeep predicted miRNAs by discarding non plausible Dicer products and scoring plausible ones. To assess seed conservation  plausible Dicer processing sequences were blasted against a local version of mature miRNAs from miRBase 12.0 that lacked zebrafish miRNA sequences. Borderline miRNA candidates were also resolved by determining their relative stability using Randfold. To distinguish between novel and known miRNAs  selected pre miRNAs were blasted against Danio rerio stem loop sequences miRBase and those that did not produce any or produced imperfect alignments were scored as novel miRNAs. Pairs of signatures and structures were used to estimate the number of false positives by randomly permutation  using miRDeep. To overcome the inherent lack of sensitivity of miRDeep  novel transcripts encoding miRNAs predicted by bioinformatics were retrieved from Ensembl 5.2 using BioMart and from literature predictions. These sequences were then used to perform a megaBlast search against our data with seed length set at 12. The transcripts with perfect matches and alignment length larger than 18 nt were kept for further processing. These transcripts were then compared with the mature miRNAs present in miRBase 12.0 and those that produced imperfect alignments or did not produce alignments were considered new miRNAs. Read numbers were normalized as described by Chen and colleagues Genes & Development 2005  19:1288 1293  and a miRNA expression profile  using identical number of reads for each sample  was generated. The number of reads between samples was normalized as indicated below:  Expression Reads = [1000 x NRmiRNAXY]/ TNRmiRNAsY  where NRmiRNAXY is the number of reads of miRNAX X = any miRNA in sample Y  and TNRmiRNAsY is the total number of miRNAs in sample Y. 1000 is an arbitrary number of reads. The data was transformed into log2 scale to build the heat map using the MeV 4.0 software package http://www.tm4.org/mev.html. Genome build: Zv8 Supplementary files format and content: Tab delimited text files include the miRNA IDs  sequences and respective raw counts post data processing for each sample.", "24 hpf embryos", null, "100 \u03bcg of total RNA from each sample was isolated using TRIzol\u00ae and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis  the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC  three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter \"Nelson's linker\" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime  for 1 hour at 37\u00b0C  followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript\u2122 III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides  as detailed next. 24hpf   ATC; 72hpf   ACT; 96hpf   CAG; 5dpf   ATG; 45dpf   CCG; entire adult   GTA; brain   CGG; Heart   CTG; Eyes   GCT; fins   GTT; skin   TAC; gills   TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion  at 37\u00b0C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche  following established protocols for DNA library sequencing.", "Wild type AB zebrafish strain was maintained at 28\u00baC on a 14 h light/10 h dark cycle.", "strain/background:AB|genotype/variation:wild type|tissue:whole body|developmental stage:embryo|age:24hpf", "GSM1630504", "GSM1630504: 24hpf; Danio rerio; miRNA Seq", "GSM1630504", null, "1", "100 \u03bcg of total RNA from each sample was isolated using TRIzol\u00ae and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis  the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC  three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter \"Nelson's linker\" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime  for 1 hour at 37\u00b0C  followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript\u2122 III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides  as detailed next. 24hpf   ATC; 72hpf   ACT; 96hpf   CAG; 5dpf   ATG; 45dpf   CCG; entire adult   GTA; brain   CGG; Heart   CTG; Eyes   GCT; fins   GTT; skin   TAC; gills   TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion  at 37\u00b0C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche  following established protocols for DNA library sequencing.", "GEO Accession:GSM1630504", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "LS454", "454 GS FLX", null, "SRP056014", null, null, null, null, 6831.0, 129.0, "GSM1630504 r1", "0:4 1:48.95", "A:1947;C:1747;G:1688;T:1424;N:25", 4, 48, null, null, 1947, 1747, 1688, 1424, 25, "SRX915240", "SRS870234", "SRA246117", "GEO", "University of Aveiro", 1, 0.0, null, 0.0, null, 1.0, null, null, null, 46, null, "T", null, "under 1.2% mapping rate", "legacy", "early", "3prime", "size_fractionation", "unknown", "bulk", "other_seq", "454", null, "Portugal", "2015-03-09", "Pharyngula", "Embryo", "Trunk", "Surface Structure"], [67908, "SRR017341", "SRX003632", "SRS002067", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish N", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishN", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "N_fish.tar", "fastq", 40231384.0, 173756.0, "Zebrafish IgH cDNA FishN", "0:4 1:227.54", "A:10436935;C:8800020;G:9512025;T:11471941;N:10463", 4, 227, null, null, 10436935, 8800020, 9512025, 11471941, 10463, "SRX003632", "SRS002067", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.26487, null, 0.0663, null, 0.99304, null, 0.01389, null, 229, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67909, "SRR017340", "SRX003631", "SRS002066", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish M", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishM", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "M_fish.tar", "fastq", 37492198.0, 161639.0, "Zebrafish IgH cDNA FishM", "0:4 1:227.95", "A:9527141;C:8129088;G:9025760;T:10804127;N:6082", 4, 227, null, null, 9527141, 8129088, 9025760, 10804127, 6082, "SRX003631", "SRS002066", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.31521, null, 0.11394, null, 0.99823, null, 0.00291, null, 208, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67910, "SRR017339", "SRX003630", "SRS002065", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish L", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishL", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "L_fish.tar", "fastq", 37971443.0, 163701.0, "Zebrafish IgH cDNA FishL", "0:4 1:227.96", "A:9544875;C:8363123;G:9094601;T:10963684;N:5160", 4, 227, null, null, 9544875, 8363123, 9094601, 10963684, 5160, "SRX003630", "SRS002065", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.29057, null, 0.07862, null, 0.99636, null, 0.00534, null, 245, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67911, "SRR017338", "SRX003629", "SRS002064", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish K", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishK", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "K_fish.tar", "fastq", 54201403.0, 234266.0, "Zebrafish IgH cDNA FishK", "0:4 1:227.37", "A:13608677;C:11652239;G:12945164;T:15975205;N:20118", 4, 227, null, null, 13608677, 11652239, 12945164, 15975205, 20118, "SRX003629", "SRS002064", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.27218, null, 0.07987, null, 0.99275, null, 0.01242, null, 244, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67912, "SRR017337", "SRX003628", "SRS002063", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish J", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishJ", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "J_fish.tar", "fastq", 51915342.0, 224027.0, "Zebrafish IgH cDNA FishJ", "0:4 1:227.74", "A:12664582;C:12040983;G:12609762;T:14589770;N:10245", 4, 227, null, null, 12664582, 12040983, 12609762, 14589770, 10245, "SRX003628", "SRS002063", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.29028, null, 0.10039, null, 0.9964, null, 0.00625, null, 97, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67913, "SRR017336", "SRX003627", "SRS002062", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish I", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishI", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "I_fish.tar", "fastq", 23436268.0, 100120.0, "Zebrafish IgH cDNA FishI", "0:4 1:230.08", "A:5801823;C:5246438;G:5587169;T:6797624;N:3214", 4, 230, null, null, 5801823, 5246438, 5587169, 6797624, 3214, "SRX003627", "SRS002062", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.34362, null, 0.0757, null, 0.99241, null, 0.02647, null, 232, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67914, "SRR017335", "SRX003626", "SRS002061", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish H", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishH", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "H_fish.tar", "fastq", 48443452.0, 213531.0, "Zebrafish IgH cDNA FishH", "0:4 1:222.87", "A:12720681;C:10490855;G:11923926;T:13303989;N:4001", 4, 222, null, null, 12720681, 10490855, 11923926, 13303989, 4001, "SRX003626", "SRS002061", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.45847, null, 0.04709, null, 0.98754, null, 0.0161, null, 56, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67915, "SRR017334", "SRX003625", "SRS002060", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish G", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishG", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "G_fish.tar", "fastq", 50095821.0, 217866.0, "Zebrafish IgH cDNA FishG", "0:4 1:225.94", "A:13182103;C:11299206;G:11909574;T:13700817;N:4121", 4, 225, null, null, 13182103, 11299206, 11909574, 13700817, 4121, "SRX003625", "SRS002060", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.37294, null, 0.09947, null, 0.99034, null, 0.02245, null, 230, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67916, "SRR017333", "SRX003624", "SRS002059", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish F", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishF", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "F_fish.tar", "fastq", 16577798.0, 83387.0, "Zebrafish IgH cDNA FishF", "0:4 1:194.81", "A:4215316;C:3618457;G:4002690;T:4736893;N:4442", 4, 194, null, null, 4215316, 3618457, 4002690, 4736893, 4442, "SRX003624", "SRS002059", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.57361, null, 0.0727, null, 0.99965, null, 0.00026, null, 62, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67917, "SRR017332", "SRX003623", "SRS002058", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish E", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishE", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "E_fish.tar", "fastq", 29705006.0, 131553.0, "Zebrafish IgH cDNA FishE", "0:4 1:221.80", "A:7474430;C:6417563;G:7115572;T:8693543;N:3898", 4, 221, null, null, 7474430, 6417563, 7115572, 8693543, 3898, "SRX003623", "SRS002058", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.3099, null, 0.09802, null, 0.99904, null, 0.00099, null, 45, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67918, "SRR017331", "SRX003622", "SRS002057", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish D", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishD", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "D_fish.tar", "fastq", 27611909.0, 123468.0, "Zebrafish IgH cDNA FishD", "0:4 1:219.64", "A:6809564;C:6219469;G:6636933;T:7943112;N:2831", 4, 219, null, null, 6809564, 6219469, 6636933, 7943112, 2831, "SRX003622", "SRS002057", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.45962, null, 0.09396, null, 0.99941, null, 0.00026, null, 218, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67919, "SRR017330", "SRX003621", "SRS002056", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish C", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishC", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "C_fish.tar", "fastq", 21845405.0, 95733.0, "Zebrafish IgH cDNA FishC", "0:4 1:224.19", "A:5735195;C:4746747;G:5266352;T:6095066;N:2045", 4, 224, null, null, 5735195, 4746747, 5266352, 6095066, 2045, "SRX003621", "SRS002056", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.38908, null, 0.20497, null, 0.99967, null, 0.00047, null, 145, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67920, "SRR017329", "SRX003620", "SRS002055", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish B", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishB", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "B_fish.tar", "fastq", 26680294.0, 118385.0, "Zebrafish IgH cDNA FishB", "0:4 1:221.37", "A:6380496;C:6168810;G:6541530;T:7587018;N:2440", 4, 221, null, null, 6380496, 6168810, 6541530, 7587018, 2440, "SRX003620", "SRS002055", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.35498, null, 0.14675, null, 0.99906, null, 0.00098, null, 228, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67921, "SRR017328", "SRX003619", "SRS002054", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish A", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishA", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "A_fish.tar", "fastq", 13497752.0, 61111.0, "Zebrafish IgH cDNA FishA", "0:4 1:216.87", "A:3287411;C:3078068;G:3224467;T:3906026;N:1780", 4, 216, null, null, 3287411, 3078068, 3224467, 3906026, 1780, "SRX003619", "SRS002054", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.32333, null, 0.14098, null, 0.99937, null, 0.00169, null, 52, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [68262, "SRR099333", "SRX041597", "SRS172447", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio  leading with MID barcode TAGTATCAGC", "4432 1Y D", "4432 1Y D", null, null, null, null, null, null, null, null, null, null, "1", "4432 1Y D", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 72592827.0, 232367.0, "4432 1Y D", "0:4 1:308.41", null, 4, 308, null, null, null, null, null, null, null, "SRX041597", "SRS172447", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.13098, null, 0.04666, null, 0.99943, null, 0.00078, null, 195, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68263, "SRR099332", "SRX041596", "SRS172446", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio  leading with MID barcode TAGTATCAGC", "4432 1Y C9", "4432 1Y C9", null, null, null, null, null, null, null, null, null, null, "1", "4432 1Y C9", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 78320127.0, 261806.0, "4432 1Y C9", "0:4 1:295.15", null, 4, 295, null, null, null, null, null, null, null, "SRX041596", "SRS172446", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.20079, null, 0.01319, null, 0.99971, null, 0.0004, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68264, "SRR099331", "SRX041595", "SRS172445", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio  leading with MID barcode CTCGCGTGTC", "4432 1Y B8", "4432 1Y B8", null, null, null, null, null, null, null, null, null, null, "1", "4432 1Y B8", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 46900878.0, 156154.0, "4432 1Y B8", "0:4 1:296.35", null, 4, 296, null, null, null, null, null, null, null, "SRX041595", "SRS172445", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.21827, null, 0.01485, null, 0.99961, null, 0.00018, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68265, "SRR099330", "SRX041594", "SRS172444", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio  leading with MID barcode CGTGTCTCTA", "4432 1Y A7", "4432 1Y A7", null, null, null, null, null, null, null, null, null, null, "1", "4432 1Y A7", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 22543768.0, 73425.0, "4432 1Y A7", "0:4 1:303.03", null, 4, 303, null, null, null, null, null, null, null, "SRX041594", "SRS172444", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.16879, null, 0.02006, null, 0.99973, null, 0.00063, null, 89, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68266, "SRR099325", "SRX041593", "SRS172443", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio  leading with MID barcode ATATCGCGAG", "4430 1Y C6", "4430 1Y C6", null, null, null, null, null, null, null, null, null, null, "1", "4430 1Y C6", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 38479526.0, 134024.0, "4430 1Y C6", "0:4 1:283.11", null, 4, 283, null, null, null, null, null, null, null, "SRX041593", "SRS172443", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.11658, null, 0.00464, null, 0.99928, null, 0.00323, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68267, "SRR099324", "SRX041592", "SRS172442", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio  leading with MID barcode ATCAGACACG", "4430 1Y B5", "4430 1Y B5", null, null, null, null, null, null, null, null, null, null, "1", "4430 1Y B5", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 83990641.0, 290583.0, "4430 1Y B5", "0:4 1:285.04", null, 4, 285, null, null, null, null, null, null, null, "SRX041592", "SRS172442", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.20603, null, 0.01554, null, 0.99967, null, 0.00038, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68268, "SRR099323", "SRX041591", "SRS172441", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio  leading with MID barcode AGCACTGTAG", "4430 1Y A4", "4430 1Y A4", null, null, null, null, null, null, null, null, null, null, "1", "4430 1Y A4", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 27578630.0, 90031.0, "4430 1Y A4", "0:4 1:302.32", null, 4, 302, null, null, null, null, null, null, null, "SRX041591", "SRS172441", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.12444, null, 0.0197, null, 0.99975, null, 0.00096, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68269, "SRR099322", "SRX041590", "SRS172440", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio  leading with MID barcode AGACGCACTC", "4428 1Y C3", "4428 1Y C3", null, null, null, null, null, null, null, null, null, null, "1", "4428 1Y C3", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 62333740.0, 194228.0, "4428 1Y C3", "0:4 1:316.93", null, 4, 316, null, null, null, null, null, null, null, "SRX041590", "SRS172440", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.1865, null, 0.02265, null, 0.99947, null, 0.00049, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68270, "SRR099321", "SRX041589", "SRS172439", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio  leading with MID barcode ACGCTCGACA", "4428 1Y B2", "4428 1Y B2", null, null, null, null, null, null, null, null, null, null, "1", "4428 1Y B2", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 104263503.0, 333602.0, "4428 1Y B2", "0:4 1:308.54", null, 4, 308, null, null, null, null, null, null, null, "SRX041589", "SRS172439", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.15679, null, 0.02871, null, 0.99953, null, 0.00044, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68271, "SRR099320", "SRX041588", "SRS172438", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio  leading with MID barcode ACGAGTGCGT", "4428 1Y A1", "4428 1Y A1", null, null, null, null, null, null, null, null, null, null, "1", "4428 1Y A1", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 18763476.0, 59560.0, "4428 1Y A1", "0:4 1:311.03", null, 4, 311, null, null, null, null, null, null, null, "SRX041588", "SRS172438", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.13922, null, 0.01452, null, 0.99971, null, 0.00094, null, 160, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68272, "SRR099364", "SRX041587", "SRS172437", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode TGATACGTCT", "4433 6M D", "4433 6M D", null, null, null, null, null, null, null, null, null, null, "1", "4433 6M D", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 101345153.0, 290438.0, "4433 6M D", "0:4 1:344.94", null, 4, 344, null, null, null, null, null, null, null, "SRX041587", "SRS172437", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.14815, null, 0.01925, null, 0.99908, null, 0.00202, null, 155, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68273, "SRR099363", "SRX041586", "SRS172436", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode TCTCTATGCG", "4433 6M C", "4433 6M C", null, null, null, null, null, null, null, null, null, null, "1", "4433 6M C", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 75770901.0, 213529.0, "4433 6M C", "0:4 1:350.85", null, 4, 350, null, null, null, null, null, null, null, "SRX041586", "SRS172436", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.14445, null, 0.01047, null, 0.99878, null, 0.00299, null, 57, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68274, "SRR099362", "SRX041585", "SRS172435", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode TAGTATCAGC", "4433 6M B", "4433 6M B", null, null, null, null, null, null, null, null, null, null, "1", "4433 6M B", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 67192817.0, 194503.0, "4433 6M B", "0:4 1:341.46", null, 4, 341, null, null, null, null, null, null, null, "SRX041585", "SRS172435", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.13467, null, 0.01249, null, 0.99914, null, 0.00222, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68275, "SRR099361", "SRX041584", "SRS172434", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode CTCGCGTGTC", "4433 6M A", "4433 6M A", null, null, null, null, null, null, null, null, null, null, "1", "4433 6M A", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 72299403.0, 207618.0, "4433 6M A", "0:4 1:344.23", null, 4, 344, null, null, null, null, null, null, null, "SRX041584", "SRS172434", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.1041, null, 0.01046, null, 0.99764, null, 0.00892, null, 64, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68276, "SRR099348", "SRX041583", "SRS172433", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode CGTGTCTCTA", "4432 6M G", "4432 6M G", null, null, null, null, null, null, null, null, null, null, "1", "4432 6M G", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 79715586.0, 227631.0, "4432 6M G", "0:4 1:346.20", null, 4, 346, null, null, null, null, null, null, null, "SRX041583", "SRS172433", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.11472, null, 0.01795, null, 0.99898, null, 0.00298, null, 103, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68277, "SRR099347", "SRX041582", "SRS172432", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode ATATCGCGAG", "4432 6M F", "4432 6M F", null, null, null, null, null, null, null, null, null, null, "1", "4432 6M F", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 72024740.0, 203769.0, "4432 6M F", "0:4 1:349.46", null, 4, 349, null, null, null, null, null, null, null, "SRX041582", "SRS172432", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.11535, null, 0.01205, null, 0.99855, null, 0.00395, null, 40, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68278, "SRR099346", "SRX041581", "SRS172431", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode ATCAGACACG", "4432 6M E", "4432 6M E", null, null, null, null, null, null, null, null, null, null, "1", "4432 6M E", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 65072237.0, 190441.0, "4432 6M E", "0:4 1:337.69", null, 4, 337, null, null, null, null, null, null, null, "SRX041581", "SRS172431", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.11698, null, 0.01584, null, 0.99823, null, 0.00583, null, 65, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68279, "SRR099345", "SRX041580", "SRS172430", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode AGCACTGTAG", "4432 6M D", "4432 6M D", null, null, null, null, null, null, null, null, null, null, "1", "4432 6M D", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 74122161.0, 211816.0, "4432 6M D", "0:4 1:345.94", null, 4, 345, null, null, null, null, null, null, null, "SRX041580", "SRS172430", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.10275, null, 0.01376, null, 0.99912, null, 0.00377, null, 57, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68280, "SRR099344", "SRX041579", "SRS172429", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode AGACGCACTC", "4432 6M C", "4432 6M C", null, null, null, null, null, null, null, null, null, null, "1", "4432 6M C", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 78171765.0, 220585.0, "4432 6M C", "0:4 1:350.38", null, 4, 350, null, null, null, null, null, null, null, "SRX041579", "SRS172429", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.13401, null, 0.0146, null, 0.99711, null, 0.01012, null, 222, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68281, "SRR099343", "SRX041578", "SRS172428", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode ACGCTCGACA", "4432 6M B", "4432 6M B", null, null, null, null, null, null, null, null, null, null, "1", "4432 6M B", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 75262808.0, 217309.0, "4432 6M B", "0:4 1:342.34", null, 4, 342, null, null, null, null, null, null, null, "SRX041578", "SRS172428", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.16193, null, 0.00604, null, 0.99685, null, 0.00701, null, 452, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68282, "SRR099342", "SRX041577", "SRS172427", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode ACGAGTGCGT", "4432 6M A", "4432 6M A", null, null, null, null, null, null, null, null, null, null, "1", "4432 6M A", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 66235952.0, 184208.0, "4432 6M A", "0:4 1:355.57", null, 4, 355, null, null, null, null, null, null, null, "SRX041577", "SRS172427", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.10428, null, 0.01655, null, 0.99661, null, 0.01505, null, 183, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68283, "SRR099370", "SRX041576", "SRS172426", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode TACTGAGCTA", "F2 2", "F2 2", null, null, null, null, null, null, null, null, null, null, "1", "F2 2", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 64641127.0, 184383.0, "F2 2", "0:4 1:346.58", null, 4, 346, null, null, null, null, null, null, null, "SRX041576", "SRS172426", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.23604, null, 0.01003, null, 0.99959, null, 0.00028, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68284, "SRR099369", "SRX041575", "SRS172425", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode TGATACGTCT", "E2 2", "E2 2", null, null, null, null, null, null, null, null, null, null, "1", "E2 2", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 66206147.0, 181029.0, "E2 2", "0:4 1:361.72", null, 4, 361, null, null, null, null, null, null, null, "SRX041575", "SRS172425", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.13216, null, 0.00596, null, 0.99949, null, 0.00054, null, 101, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68285, "SRR099368", "SRX041574", "SRS172424", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode TGATACGTCT", "D2 2", "D2 2", null, null, null, null, null, null, null, null, null, null, "1", "D2 2", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 190136862.0, 562067.0, "D2 2", "0:4 1:334.28", null, 4, 334, null, null, null, null, null, null, null, "SRX041574", "SRS172424", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.25384, null, 0.03443, null, 0.99933, null, 0.00056, null, 416, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68286, "SRR099367", "SRX041573", "SRS172423", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode TAGTATCAGC", "C2 2", "C2 2", null, null, null, null, null, null, null, null, null, null, "1", "C2 2", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 118356460.0, 367001.0, "C2 2", "0:4 1:318.50", null, 4, 318, null, null, null, null, null, null, null, "SRX041573", "SRS172423", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.18882, null, 0.02167, null, 0.99969, null, 9e-05, null, 40, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68287, "SRR099366", "SRX041572", "SRS172422", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode CTCGCGTGTC", "B2 2", "B2 2", null, null, null, null, null, null, null, null, null, null, "1", "B2 2", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 24757877.0, 69408.0, "B2 2", "0:4 1:352.70", null, 4, 352, null, null, null, null, null, null, null, "SRX041572", "SRS172422", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.12537, null, 0.01076, null, 0.99975, null, 0.00029, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68288, "SRR099365", "SRX041571", "SRS172421", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode CGTGTCTCTA", "A2 2", "A2 2", null, null, null, null, null, null, null, null, null, null, "1", "A2 2", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 765824405.0, 2575264.0, "A2 2", "0:4 1:293.38", null, 4, 293, null, null, null, null, null, null, null, "SRX041571", "SRS172421", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.18359, null, 0.017, null, 0.99892, null, 0.00154, null, 152, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68289, "SRR099360", "SRX041570", "SRS172420", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio  leading with MID barcode CTCGCGTGTC or with no barcode leading with either IgM reverse primer TGCACTGAGACAAACCGAAG or IgZ reverse primer TCAGAGGCCAGACATCCAAT", "4433 3MA DT", "4433 3MA DT", null, null, null, null, null, null, null, null, null, null, "1", "4433 3MA DT", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 56064850.0, 187695.0, "4433 3MA DT", "0:4 1:294.70", null, 4, 294, null, null, null, null, null, null, null, "SRX041570", "SRS172420", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.3144, null, 0.00306, null, 0.99987, null, 0.0, null, 106, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68290, "SRR099359", "SRX041569", "SRS172419", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio  leading with MID barcode CGTGTCTCTA", "4433 3MA C7", "4433 3MA C7", null, null, null, null, null, null, null, null, null, null, "1", "4433 3MA C7", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 96179902.0, 300329.0, "4433 3MA C7", "0:4 1:316.25", null, 4, 316, null, null, null, null, null, null, null, "SRX041569", "SRS172419", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.1804, null, 0.01829, null, 0.99953, null, 0.00028, null, 468, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68291, "SRR099358", "SRX041568", "SRS172418", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio  leading with MID barcode ATATCGCGAG", "4433 3MA B6", "4433 3MA B6", null, null, null, null, null, null, null, null, null, null, "1", "4433 3MA B6", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 50421822.0, 147276.0, "4433 3MA B6", "0:4 1:338.36", null, 4, 338, null, null, null, null, null, null, null, "SRX041568", "SRS172418", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.19259, null, 0.00589, null, 0.99955, null, 0.00065, null, 99, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68292, "SRR099357", "SRX041567", "SRS172417", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio  leading with MID barcode ATCAGACACG", "4433 3MA A5", "4433 3MA A5", null, null, null, null, null, null, null, null, null, null, "1", "4433 3MA A5", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 156064156.0, 515822.0, "4433 3MA A5", "0:4 1:298.55", null, 4, 298, null, null, null, null, null, null, null, "SRX041567", "SRS172417", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.22633, null, 0.01233, null, 0.99971, null, 0.00016, null, 40, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68293, "SRR099341", "SRX041566", "SRS172416", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio  leading with MID barcode AGCACTGTAG", "4432 3MA D4", "4432 3MA D4", null, null, null, null, null, null, null, null, null, null, "1", "4432 3MA D4", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 61903651.0, 206769.0, "4432 3MA D4", "0:4 1:295.39", null, 4, 295, null, null, null, null, null, null, null, "SRX041566", "SRS172416", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.23888, null, 0.01136, null, 0.99953, null, 0.00047, null, 58, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68294, "SRR099340", "SRX041565", "SRS172415", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio  leading with MID barcode AGACGCACTC", "4432 3MA C3", "4432 3MA C3", null, null, null, null, null, null, null, null, null, null, "1", "4432 3MA C3", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 37914122.0, 116980.0, "4432 3MA C3", "0:4 1:320.11", null, 4, 320, null, null, null, null, null, null, null, "SRX041565", "SRS172415", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.19288, null, 0.0142, null, 0.99955, null, 0.00034, null, 125, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68295, "SRR099339", "SRX041564", "SRS172414", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio  leading with MID barcode ACGCTCGACA", "4432 3MA B2", "4432 3MA B2", null, null, null, null, null, null, null, null, null, null, "1", "4432 3MA B2", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 89178437.0, 298194.0, "4432 3MA B2", "0:4 1:295.06", null, 4, 295, null, null, null, null, null, null, null, "SRX041564", "SRS172414", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.21059, null, 0.00985, null, 0.99969, null, 0.00012, null, 107, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68296, "SRR099338", "SRX041563", "SRS172413", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio  leading with MID barcode ACGAGTGCGT", "4432 3MA A1", "4432 3MA A1", null, null, null, null, null, null, null, null, null, null, "1", "4432 3MA A1", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 59101536.0, 194332.0, "4432 3MA A1", "0:4 1:300.13", null, 4, 300, null, null, null, null, null, null, null, "SRX041563", "SRS172413", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.26977, null, 0.00958, null, 0.99971, null, 0.00015, null, 69, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68297, "SRR099352", "SRX041562", "SRS172412", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 mpf WIK zebrafish Danio rerio  leading with MID barcode CTCGCGTGTC", "4433 1MA D8", "4433 1MA D8", null, null, null, null, null, null, null, null, null, null, "1", "4433 1MA D8", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 70233197.0, 233302.0, "4433 1MA D8", "0:4 1:297.04", null, 4, 297, null, null, null, null, null, null, null, "SRX041562", "SRS172412", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.14812, null, 0.01088, null, 0.99969, null, 0.10799, null, 36, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Juvenile", "Juvenile", "BCR TCR repertoire", "Hematopoietic System"], [68298, "SRR099351", "SRX041561", "SRS172411", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 mpf WIK zebrafish Danio rerio  leading with MID barcode CGTGTCTCTA", "4433 1MA C7", "4433 1MA C7", null, null, null, null, null, null, null, null, null, null, "1", "4433 1MA C7", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 109094731.0, 316792.0, "4433 1MA C7", "0:4 1:340.37", null, 4, 340, null, null, null, null, null, null, null, "SRX041561", "SRS172411", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.13409, null, 0.01258, null, 0.99955, null, 0.01535, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Juvenile", "Juvenile", "BCR TCR repertoire", "Hematopoietic System"], [68299, "SRR099350", "SRX041560", "SRS172410", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 mpf WIK zebrafish Danio rerio  leading with MID barcode ATATCGCGAG", "4433 1MA B6", "4433 1MA B6", null, null, null, null, null, null, null, null, null, null, "1", "4433 1MA B6", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 110436791.0, 353780.0, "4433 1MA B6", "0:4 1:308.16", null, 4, 308, null, null, null, null, null, null, null, "SRX041560", "SRS172410", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.28629, null, 0.01104, null, 0.99945, null, 0.0273, null, 107, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Juvenile", "Juvenile", "BCR TCR repertoire", "Hematopoietic System"], [68300, "SRR099349", "SRX041559", "SRS172409", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 mpf WIK zebrafish Danio rerio  leading with MID barcode ATCAGACACG", "4433 1MA A5", "4433 1MA A5", null, null, null, null, null, null, null, null, null, null, "1", "4433 1MA A5", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 107336405.0, 335816.0, "4433 1MA A5", "0:4 1:315.63", null, 4, 315, null, null, null, null, null, null, null, "SRX041559", "SRS172409", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.16203, null, 0.01649, null, 0.99935, null, 0.00111, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Juvenile", "Juvenile", "BCR TCR repertoire", "Hematopoietic System"], [68301, "SRR099329", "SRX041558", "SRS172408", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 mpf WIK zebrafish Danio rerio  leading with MID barcode AGCACTGTAG", "4432 1MA D4", "4432 1MA D4", null, null, null, null, null, null, null, null, null, null, "1", "4432 1MA D4", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 94113837.0, 297721.0, "4432 1MA D4", "0:4 1:312.11", null, 4, 312, null, null, null, null, null, null, null, "SRX041558", "SRS172408", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.16753, null, 0.02013, null, 0.99979, null, 3e-05, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Juvenile", "Juvenile", "BCR TCR repertoire", "Hematopoietic System"], [68302, "SRR099328", "SRX041557", "SRS172407", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 mpf WIK zebrafish Danio rerio  leading with MID barcode AGACGCACTC", "4432 1MA C3", "4432 1MA C3", null, null, null, null, null, null, null, null, null, null, "1", "4432 1MA C3", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 77768777.0, 243405.0, "4432 1MA C3", "0:4 1:315.50", null, 4, 315, null, null, null, null, null, null, null, "SRX041557", "SRS172407", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.16711, null, 0.01816, null, 0.99979, null, 0.0, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Juvenile", "Juvenile", "BCR TCR repertoire", "Hematopoietic System"], [68303, "SRR099327", "SRX041556", "SRS172406", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 mpf WIK zebrafish Danio rerio  leading with MID barcode ACGCTCGACA", "4432 1MA B2", "4432 1MA B2", null, null, null, null, null, null, null, null, null, null, "1", "4432 1MA B2", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 120450312.0, 390504.0, "4432 1MA B2", "0:4 1:304.45", null, 4, 304, null, null, null, null, null, null, null, "SRX041556", "SRS172406", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.18757, null, 0.01811, null, 0.99977, null, 0.00024, null, 59, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Juvenile", "Juvenile", "BCR TCR repertoire", "Hematopoietic System"], [68304, "SRR099326", "SRX041555", "SRS172405", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 mpf WIK zebrafish Danio rerio  leading with MID barcode ACGAGTGCGT", "4432 1MA A1", "4432 1MA A1", null, null, null, null, null, null, null, null, null, null, "1", "4432 1MA A1", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 145945736.0, 457354.0, "4432 1MA A1", "0:4 1:315.11", null, 4, 315, null, null, null, null, null, null, null, "SRX041555", "SRS172405", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.17607, null, 0.02473, null, 0.99957, null, 0.00036, null, 40, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Juvenile", "Juvenile", "BCR TCR repertoire", "Hematopoietic System"], [68305, "SRR099356", "SRX041554", "SRS172404", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 2 wpf WIK zebrafish Danio rerio  leading with MID barcode CTCGCGTGTC", "4433 2WD", "4433 2WD", null, null, null, null, null, null, null, null, null, null, "1", "4433 2WD", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, "4433-2WDqual.tar.gz", "fastq", 52787937.0, 159839.0, "4433 2WD", "0:4 1:326.26", null, 4, 326, null, null, null, null, null, null, null, "SRX041554", "SRS172404", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.11986, null, 0.01724, null, 0.99805, null, 0.01122, null, 313, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-08", "Larval", "Larval", "BCR TCR repertoire", "Hematopoietic System"], [68306, "SRR099355", "SRX041553", "SRS172403", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 2 wpf WIK zebrafish Danio rerio  leading with MID barcode CGTGTCTCTA", "4433 2WC", "4433 2WC", null, null, null, null, null, null, null, null, null, null, "1", "4433 2WC", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 65896148.0, 208053.0, "4433 2WC", "0:4 1:312.73", null, 4, 312, null, null, null, null, null, null, null, "SRX041553", "SRS172403", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.14138, null, 0.02922, null, 0.99855, null, 0.00348, null, 315, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Larval", "Larval", "BCR TCR repertoire", "Hematopoietic System"], [68307, "SRR099354", "SRX041552", "SRS172402", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 2 wpf WIK zebrafish Danio rerio  leading with MID barcode ATATCGCGAG", "4433 2WB", "4433 2WB", null, null, null, null, null, null, null, null, null, null, "1", "4433 2WB", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 63865512.0, 209572.0, "4433 2WB", "0:4 1:300.74", null, 4, 300, null, null, null, null, null, null, null, "SRX041552", "SRS172402", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.16321, null, 0.03058, null, 0.99926, null, 0.00107, null, 226, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Larval", "Larval", "BCR TCR repertoire", "Hematopoietic System"], [68308, "SRR099353", "SRX041551", "SRS172401", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 2 wpf WIK zebrafish Danio rerio  leading with MID barcode ATCAGACACG", "4433 2WA", "4433 2WA", null, null, null, null, null, null, null, null, null, null, "1", "4433 2WA", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 41165356.0, 128188.0, "4433 2WA", "0:4 1:317.13", null, 4, 317, null, null, null, null, null, null, null, "SRX041551", "SRS172401", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.16018, null, 0.02829, null, 0.99847, null, 0.02343, null, 452, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Larval", "Larval", "BCR TCR repertoire", "Hematopoietic System"], [68309, "SRR099337", "SRX041550", "SRS172400", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 2 wpf WIK zebrafish Danio rerio  leading with MID barcode AGCACTGTAG", "4432 2WD", "4432 2WD", null, null, null, null, null, null, null, null, null, null, "1", "4432 2WD", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 34384017.0, 109589.0, "4432 2WD", "0:4 1:309.75", null, 4, 309, null, null, null, null, null, null, null, "SRX041550", "SRS172400", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.1533, null, 0.02541, null, 0.99896, null, 0.00428, null, 254, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Larval", "Larval", "BCR TCR repertoire", "Hematopoietic System"], [68310, "SRR099336", "SRX041549", "SRS172399", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 2 wpf WIK zebrafish Danio rerio  leading with MID barcode AGACGCACTC", "4432 2WC", "4432 2WC", null, null, null, null, null, null, null, null, null, null, "1", "4432 2WC", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 71040021.0, 233525.0, "4432 2WC", "0:4 1:300.21", null, 4, 300, null, null, null, null, null, null, null, "SRX041549", "SRS172399", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.16787, null, 0.03447, null, 0.9978, null, 0.01646, null, 360, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Larval", "Larval", "BCR TCR repertoire", "Hematopoietic System"], [68311, "SRR099335", "SRX041548", "SRS172345", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 2 wpf WIK zebrafish Danio rerio  leading with MID barcode ACGCTCGACA", "4432 2WB", "4432 2WB", null, null, null, null, null, null, null, null, null, null, "1", "4432 2WB", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 98153866.0, 302470.0, "4432 2WB", "0:4 1:320.51", null, 4, 320, null, null, null, null, null, null, null, "SRX041548", "SRS172345", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.15713, null, 0.047, null, 0.99774, null, 0.02379, null, 137, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Larval", "Larval", "BCR TCR repertoire", "Hematopoietic System"], [68312, "SRR099334", "SRX041547", "SRS172117", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 2 wpf WIK zebrafish Danio rerio  leading with MID barcode ACGAGTGCGT", "4432 2WA", "4432 2WA", null, null, null, null, null, null, null, null, null, null, "1", "4432 2WA", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 91079672.0, 319475.0, "4432 2WA", "0:4 1:281.09", null, 4, 281, null, null, null, null, null, null, null, "SRX041547", "SRS172117", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.25569, null, 0.04646, null, 0.99902, null, 0.00137, null, 88, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Larval", "Larval", "BCR TCR repertoire", "Hematopoietic System"]], "truncated": false, "filtered_table_rows_count": 77, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"experiment.library_layout\" = :p0 and \"experiment.platform\" = :p1 order by rowid limit 101", "params": {"p0": "SINGLE", "p1": "LS454"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454", "results": [{"value": "AMPLICON", "label": "AMPLICON", "count": 65, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454&experiment.library_strategy=AMPLICON", "selected": false}, {"value": "miRNA-Seq", "label": "miRNA-Seq", "count": 12, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454&experiment.library_strategy=miRNA-Seq", "selected": false}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 77, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454&experiment.library_source=TRANSCRIPTOMIC", "selected": false}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454", "results": [{"value": "PCR", "label": "PCR", "count": 65, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454&experiment.library_selection=PCR", "selected": false}, {"value": "size fractionation", "label": "size fractionation", "count": 12, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454&experiment.library_selection=size+fractionation", "selected": false}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454", "results": [{"value": "SINGLE", "label": "SINGLE", "count": 77, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.platform=LS454", "selected": true}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454", "results": [{"value": "LS454", "label": "LS454", "count": 77, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE", "selected": true}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454", "results": [{"value": "Adult", "label": "Adult", "count": 42, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454&devstage_curation_coarse=Adult", "selected": false}, {"value": "Undetermined", "label": "Undetermined", "count": 14, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454&devstage_curation_coarse=Undetermined", "selected": false}, {"value": "Larval", "label": "Larval", "count": 11, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454&devstage_curation_coarse=Larval", "selected": false}, {"value": "Juvenile", "label": "Juvenile", "count": 9, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454&devstage_curation_coarse=Juvenile", "selected": false}, {"value": "Embryo", "label": "Embryo", "count": 1, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454&devstage_curation_coarse=Embryo", "selected": false}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454", "results": [{"value": "Adult", "label": "Adult", "count": 42, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454&devstage_curation=Adult", "selected": false}, {"value": "Undetermined", "label": "Undetermined", "count": 14, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454&devstage_curation=Undetermined", "selected": false}, {"value": "Larval", "label": "Larval", "count": 11, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454&devstage_curation=Larval", "selected": false}, {"value": "Juvenile", "label": "Juvenile", "count": 9, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454&devstage_curation=Juvenile", "selected": false}, {"value": "Pharyngula", "label": "Pharyngula", "count": 1, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454&devstage_curation=Pharyngula", "selected": false}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454", "results": [{"value": "Hematopoietic System", "label": "Hematopoietic System", "count": 65, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454&tissue_curation_coarse=Hematopoietic+System", "selected": false}, {"value": "Surface Structure", "label": "Surface Structure", "count": 8, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454&tissue_curation_coarse=Surface+Structure", "selected": false}, {"value": "Cardiovascular System", "label": "Cardiovascular System", "count": 1, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454&tissue_curation_coarse=Cardiovascular+System", "selected": false}, {"value": "Nervous System", "label": "Nervous System", "count": 1, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454&tissue_curation_coarse=Nervous+System", "selected": false}, {"value": "Respiratory System", "label": "Respiratory System", "count": 1, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454&tissue_curation_coarse=Respiratory+System", "selected": false}, {"value": "Sensory System", "label": "Sensory System", "count": 1, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454&tissue_curation_coarse=Sensory+System", "selected": false}], "truncated": false}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454", "results": [{"value": "BCR TCR repertoire", "label": "BCR TCR repertoire", "count": 65, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454&tissue_curation=BCR+TCR+repertoire", "selected": false}, {"value": "Trunk", "label": "Trunk", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454&tissue_curation=Trunk", "selected": false}, {"value": "Brain", "label": "Brain", "count": 1, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454&tissue_curation=Brain", "selected": false}, {"value": "Eye", "label": "Eye", "count": 1, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454&tissue_curation=Eye", "selected": false}, {"value": "Fin", "label": "Fin", "count": 1, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454&tissue_curation=Fin", "selected": false}, {"value": "Gill", "label": "Gill", "count": 1, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454&tissue_curation=Gill", "selected": false}, {"value": "Heart", "label": "Heart", "count": 1, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454&tissue_curation=Heart", "selected": false}, {"value": "Skin", "label": "Skin", "count": 1, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454&tissue_curation=Skin", "selected": false}], "truncated": false}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454", "results": [{"value": "454", "label": "454", "count": 77, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=LS454&technology=454", "selected": false}], "truncated": false}}, "suggested_facets": [], "next": null, "next_url": null, "private": false, "allow_execute_sql": true, "query_ms": 77.90454999485519}