{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where experiment.library_layout = \"SINGLE\", experiment.platform = \"ILLUMINA\" and tissue_curation_coarse = \"Cancer or Tumor\"", "rows": [[41564, "SRR5044691", "SRX2367699", "SRS1813797", "SRP093723", "PRJNA354577", "RNA seq of zebrafish melanoma cells post metastatic dissemination", "GSE90143", "Transcriptome Analysis", "We report how the zebrafish melanoma cell line ZMEL1 changes post intravascular injection into 2dpf zebrafish embryos  as compared to the cells growing in vitro. Overall design: Examination of ZMEL1 cells in vitro versus 21 days in vivo in the zebrafish", null, "pubmed:28181494", null, "ZMEL1 METASTATIC REP 4", "GSM2399713", null, "tissue:ZMEL1 cells in vivo|cell type:ZMEL1|tissue type:melanoma", "ZMEL1 METASTATIC REP 4", "GSNAP alignment to Av9 zebrafish reference genome Read counts extracted with HTSeq Differential expression with DeSeq2 Zebrafish genes converted to human orthologs using DIOPT Genome build: Zv9 Supplementary files format and content: XLSX sheet with normalized read counts output from HTSeq", "ZMEL1 cells in vivo", "n/a", "Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq", "in vitro: DMEM/10% FCS/1X glutamax/28.5C     in vivo: growth in the zebrafish from 2 21dpf", "cell type:ZMEL1|tissue type:melanoma", "GSM2399713", "GSM2399713: ZMEL1 METASTATIC REP 4; Danio rerio; RNA Seq", "GSM2399713", null, "1", "Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq", "GEO Accession:GSM2399713", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP093723", null, null, "DISSEMINATED-A1-ISK-GFP-pos_CTTGTA_AHBENJADXX_L001_001.R1.fastq", "fastq", 1021688450.0, 20433769.0, "GSM2399713 r1", "0:50", "A:263964434;C:226020906;G:246160135;T:285440788;N:102187", 50, null, null, null, 263964434, 226020906, 246160135, 285440788, 102187, "SRX2367699", "SRS1813797", "SRA497524", "GEO", "White Lab, Cancer Biology & Genetics, Memorial Sloan Kettering Cancer Center", 1, 0.86173, null, 0.35054, null, 0.78305, null, 0.63081, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2016-11-22", "Larval", "Larval", "Cancer or Tumor", "Cancer or Tumor"], [41565, "SRR5044692", "SRX2367699", "SRS1813797", "SRP093723", "PRJNA354577", "RNA seq of zebrafish melanoma cells post metastatic dissemination", "GSE90143", "Transcriptome Analysis", "We report how the zebrafish melanoma cell line ZMEL1 changes post intravascular injection into 2dpf zebrafish embryos  as compared to the cells growing in vitro. Overall design: Examination of ZMEL1 cells in vitro versus 21 days in vivo in the zebrafish", null, "pubmed:28181494", null, "ZMEL1 METASTATIC REP 4", "GSM2399713", null, "tissue:ZMEL1 cells in vivo|cell type:ZMEL1|tissue type:melanoma", "ZMEL1 METASTATIC REP 4", "GSNAP alignment to Av9 zebrafish reference genome Read counts extracted with HTSeq Differential expression with DeSeq2 Zebrafish genes converted to human orthologs using DIOPT Genome build: Zv9 Supplementary files format and content: XLSX sheet with normalized read counts output from HTSeq", "ZMEL1 cells in vivo", "n/a", "Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq", "in vitro: DMEM/10% FCS/1X glutamax/28.5C     in vivo: growth in the zebrafish from 2 21dpf", "cell type:ZMEL1|tissue type:melanoma", "GSM2399713", "GSM2399713: ZMEL1 METASTATIC REP 4; Danio rerio; RNA Seq", "GSM2399713", null, "1", "Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq", "GEO Accession:GSM2399713", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP093723", null, null, "DISSEMINATED-A1-ISK-GFP-pos_CTTGTA_AHBENJADXX_L002_001.R1.fastq", "fastq", 948274550.0, 18965491.0, "GSM2399713 r2", "0:50", "A:244756056;C:209496504;G:228095978;T:264427260;N:1498752", 50, null, null, null, 244756056, 209496504, 228095978, 264427260, 1498752, "SRX2367699", "SRS1813797", "SRA497524", "GEO", "White Lab, Cancer Biology & Genetics, Memorial Sloan Kettering Cancer Center", 1, 0.86249, null, 0.35012, null, 0.78147, null, 0.61412, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2016-11-22", "Larval", "Larval", "Cancer or Tumor", "Cancer or Tumor"], [41566, "SRR5044689", "SRX2367698", "SRS1813796", "SRP093723", "PRJNA354577", "RNA seq of zebrafish melanoma cells post metastatic dissemination", "GSE90143", "Transcriptome Analysis", "We report how the zebrafish melanoma cell line ZMEL1 changes post intravascular injection into 2dpf zebrafish embryos  as compared to the cells growing in vitro. Overall design: Examination of ZMEL1 cells in vitro versus 21 days in vivo in the zebrafish", null, "pubmed:28181494", null, "ZMEL1 METASTATIC REP 3", "GSM2399712", null, "tissue:ZMEL1 cells in vivo|cell type:ZMEL1|tissue type:melanoma", "ZMEL1 METASTATIC REP 3", "GSNAP alignment to Av9 zebrafish reference genome Read counts extracted with HTSeq Differential expression with DeSeq2 Zebrafish genes converted to human orthologs using DIOPT Genome build: Zv9 Supplementary files format and content: XLSX sheet with normalized read counts output from HTSeq", "ZMEL1 cells in vivo", "n/a", "Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq", "in vitro: DMEM/10% FCS/1X glutamax/28.5C     in vivo: growth in the zebrafish from 2 21dpf", "cell type:ZMEL1|tissue type:melanoma", "GSM2399712", "GSM2399712: ZMEL1 METASTATIC REP 3; Danio rerio; RNA Seq", "GSM2399712", null, "1", "Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq", "GEO Accession:GSM2399712", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP093723", null, null, "DISSEMINATED-4-GFP-POS_AGTTCC_AHBENJADXX_L001_001.R1.fastq", "fastq", 547347950.0, 10946959.0, "GSM2399712 r1", "0:50", "A:142532772;C:118021475;G:130457816;T:156280877;N:55010", 50, null, null, null, 142532772, 118021475, 130457816, 156280877, 55010, "SRX2367698", "SRS1813796", "SRA497524", "GEO", "White Lab, Cancer Biology & Genetics, Memorial Sloan Kettering Cancer Center", 1, 0.82238, null, 0.37848, null, 0.81511, null, 0.68704, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2016-11-22", "Larval", "Larval", "Cancer or Tumor", "Cancer or Tumor"], [41567, "SRR5044690", "SRX2367698", "SRS1813796", "SRP093723", "PRJNA354577", "RNA seq of zebrafish melanoma cells post metastatic dissemination", "GSE90143", "Transcriptome Analysis", "We report how the zebrafish melanoma cell line ZMEL1 changes post intravascular injection into 2dpf zebrafish embryos  as compared to the cells growing in vitro. Overall design: Examination of ZMEL1 cells in vitro versus 21 days in vivo in the zebrafish", null, "pubmed:28181494", null, "ZMEL1 METASTATIC REP 3", "GSM2399712", null, "tissue:ZMEL1 cells in vivo|cell type:ZMEL1|tissue type:melanoma", "ZMEL1 METASTATIC REP 3", "GSNAP alignment to Av9 zebrafish reference genome Read counts extracted with HTSeq Differential expression with DeSeq2 Zebrafish genes converted to human orthologs using DIOPT Genome build: Zv9 Supplementary files format and content: XLSX sheet with normalized read counts output from HTSeq", "ZMEL1 cells in vivo", "n/a", "Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq", "in vitro: DMEM/10% FCS/1X glutamax/28.5C     in vivo: growth in the zebrafish from 2 21dpf", "cell type:ZMEL1|tissue type:melanoma", "GSM2399712", "GSM2399712: ZMEL1 METASTATIC REP 3; Danio rerio; RNA Seq", "GSM2399712", null, "1", "Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq", "GEO Accession:GSM2399712", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP093723", null, null, "DISSEMINATED-4-GFP-POS_AGTTCC_AHBENJADXX_L002_001.R1.fastq", "fastq", 507753450.0, 10155069.0, "GSM2399712 r2", "0:50", "A:132079203;C:109301536;G:120877231;T:144665731;N:829749", 50, null, null, null, 132079203, 109301536, 120877231, 144665731, 829749, "SRX2367698", "SRS1813796", "SRA497524", "GEO", "White Lab, Cancer Biology & Genetics, Memorial Sloan Kettering Cancer Center", 1, 0.8144, null, 0.37493, null, 0.81682, null, 0.68224, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2016-11-22", "Larval", "Larval", "Cancer or Tumor", "Cancer or Tumor"], [41568, "SRR5044687", "SRX2367697", "SRS1813798", "SRP093723", "PRJNA354577", "RNA seq of zebrafish melanoma cells post metastatic dissemination", "GSE90143", "Transcriptome Analysis", "We report how the zebrafish melanoma cell line ZMEL1 changes post intravascular injection into 2dpf zebrafish embryos  as compared to the cells growing in vitro. Overall design: Examination of ZMEL1 cells in vitro versus 21 days in vivo in the zebrafish", null, "pubmed:28181494", null, "ZMEL1 METASTATIC REP 2", "GSM2399711", null, "tissue:ZMEL1 cells in vivo|cell type:ZMEL1|tissue type:melanoma", "ZMEL1 METASTATIC REP 2", "GSNAP alignment to Av9 zebrafish reference genome Read counts extracted with HTSeq Differential expression with DeSeq2 Zebrafish genes converted to human orthologs using DIOPT Genome build: Zv9 Supplementary files format and content: XLSX sheet with normalized read counts output from HTSeq", "ZMEL1 cells in vivo", "n/a", "Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq", "in vitro: DMEM/10% FCS/1X glutamax/28.5C     in vivo: growth in the zebrafish from 2 21dpf", "cell type:ZMEL1|tissue type:melanoma", "GSM2399711", "GSM2399711: ZMEL1 METASTATIC REP 2; Danio rerio; RNA Seq", "GSM2399711", null, "1", "Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq", "GEO Accession:GSM2399711", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP093723", null, null, "DISSEMINATED-3-GFP-POS_AGTCAA_AHBENJADXX_L001_001.R1.fastq", "fastq", 487099600.0, 9741992.0, "GSM2399711 r1", "0:50", "A:128774562;C:103935704;G:114312614;T:140027704;N:49016", 50, null, null, null, 128774562, 103935704, 114312614, 140027704, 49016, "SRX2367697", "SRS1813798", "SRA497524", "GEO", "White Lab, Cancer Biology & Genetics, Memorial Sloan Kettering Cancer Center", 1, 0.83241, null, 0.38945, null, 0.77759, null, 0.63782, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2016-11-22", "Larval", "Larval", "Cancer or Tumor", "Cancer or Tumor"], [41569, "SRR5044688", "SRX2367697", "SRS1813798", "SRP093723", "PRJNA354577", "RNA seq of zebrafish melanoma cells post metastatic dissemination", "GSE90143", "Transcriptome Analysis", "We report how the zebrafish melanoma cell line ZMEL1 changes post intravascular injection into 2dpf zebrafish embryos  as compared to the cells growing in vitro. Overall design: Examination of ZMEL1 cells in vitro versus 21 days in vivo in the zebrafish", null, "pubmed:28181494", null, "ZMEL1 METASTATIC REP 2", "GSM2399711", null, "tissue:ZMEL1 cells in vivo|cell type:ZMEL1|tissue type:melanoma", "ZMEL1 METASTATIC REP 2", "GSNAP alignment to Av9 zebrafish reference genome Read counts extracted with HTSeq Differential expression with DeSeq2 Zebrafish genes converted to human orthologs using DIOPT Genome build: Zv9 Supplementary files format and content: XLSX sheet with normalized read counts output from HTSeq", "ZMEL1 cells in vivo", "n/a", "Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq", "in vitro: DMEM/10% FCS/1X glutamax/28.5C     in vivo: growth in the zebrafish from 2 21dpf", "cell type:ZMEL1|tissue type:melanoma", "GSM2399711", "GSM2399711: ZMEL1 METASTATIC REP 2; Danio rerio; RNA Seq", "GSM2399711", null, "1", "Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq", "GEO Accession:GSM2399711", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP093723", null, null, "DISSEMINATED-3-GFP-POS_AGTCAA_AHBENJADXX_L002_001.R1.fastq", "fastq", 452003900.0, 9040078.0, "GSM2399711 r2", "0:50", "A:119365829;C:96270497;G:105927958;T:129699772;N:739844", 50, null, null, null, 119365829, 96270497, 105927958, 129699772, 739844, "SRX2367697", "SRS1813798", "SRA497524", "GEO", "White Lab, Cancer Biology & Genetics, Memorial Sloan Kettering Cancer Center", 1, 0.8334, null, 0.39284, null, 0.78033, null, 0.63687, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2016-11-22", "Larval", "Larval", "Cancer or Tumor", "Cancer or Tumor"], [41571, "SRR5044684", "SRX2367695", "SRS1813794", "SRP093723", "PRJNA354577", "RNA seq of zebrafish melanoma cells post metastatic dissemination", "GSE90143", "Transcriptome Analysis", "We report how the zebrafish melanoma cell line ZMEL1 changes post intravascular injection into 2dpf zebrafish embryos  as compared to the cells growing in vitro. Overall design: Examination of ZMEL1 cells in vitro versus 21 days in vivo in the zebrafish", null, "pubmed:28181494", null, "ZMEL1 IN VITRO REP 2", "GSM2399709", null, "tissue:ZMEL1 cells in vitro|cell type:ZMEL1|tissue type:melanoma", "ZMEL1 IN VITRO REP 2", "GSNAP alignment to Av9 zebrafish reference genome Read counts extracted with HTSeq Differential expression with DeSeq2 Zebrafish genes converted to human orthologs using DIOPT Genome build: Zv9 Supplementary files format and content: XLSX sheet with normalized read counts output from HTSeq", "ZMEL1 cells in vitro", "n/a", "Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq", "in vitro: DMEM/10% FCS/1X glutamax/28.5C     in vivo: growth in the zebrafish from 2 21dpf", "cell type:ZMEL1|tissue type:melanoma", "GSM2399709", "GSM2399709: ZMEL1 IN VITRO REP 2; Danio rerio; RNA Seq", "GSM2399709", null, "1", "Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq", "GEO Accession:GSM2399709", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP093723", null, null, "ZMEL3-ISK_CGATGT_AHBENJADXX_L001_001.R1.fastq", "fastq", 769908950.0, 15398179.0, "GSM2399709 r1", "0:50", "A:182817342;C:191713397;G:197387080;T:197914424;N:76707", 50, null, null, null, 182817342, 191713397, 197387080, 197914424, 76707, "SRX2367695", "SRS1813794", "SRA497524", "GEO", "White Lab, Cancer Biology & Genetics, Memorial Sloan Kettering Cancer Center", 1, 0.90333, null, 0.27932, null, 0.80894, null, 0.6691, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2016-11-22", "Larval", "Larval", "Cancer or Tumor", "Cancer or Tumor"], [41572, "SRR5044685", "SRX2367695", "SRS1813794", "SRP093723", "PRJNA354577", "RNA seq of zebrafish melanoma cells post metastatic dissemination", "GSE90143", "Transcriptome Analysis", "We report how the zebrafish melanoma cell line ZMEL1 changes post intravascular injection into 2dpf zebrafish embryos  as compared to the cells growing in vitro. Overall design: Examination of ZMEL1 cells in vitro versus 21 days in vivo in the zebrafish", null, "pubmed:28181494", null, "ZMEL1 IN VITRO REP 2", "GSM2399709", null, "tissue:ZMEL1 cells in vitro|cell type:ZMEL1|tissue type:melanoma", "ZMEL1 IN VITRO REP 2", "GSNAP alignment to Av9 zebrafish reference genome Read counts extracted with HTSeq Differential expression with DeSeq2 Zebrafish genes converted to human orthologs using DIOPT Genome build: Zv9 Supplementary files format and content: XLSX sheet with normalized read counts output from HTSeq", "ZMEL1 cells in vitro", "n/a", "Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq", "in vitro: DMEM/10% FCS/1X glutamax/28.5C     in vivo: growth in the zebrafish from 2 21dpf", "cell type:ZMEL1|tissue type:melanoma", "GSM2399709", "GSM2399709: ZMEL1 IN VITRO REP 2; Danio rerio; RNA Seq", "GSM2399709", null, "1", "Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq", "GEO Accession:GSM2399709", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP093723", null, null, "ZMEL3-ISK_CGATGT_AHBENJADXX_L002_001.R1.fastq", "fastq", 713052900.0, 14261058.0, "GSM2399709 r2", "0:50", "A:169193359;C:177235371;G:182562897;T:182889589;N:1171684", 50, null, null, null, 169193359, 177235371, 182562897, 182889589, 1171684, "SRX2367695", "SRS1813794", "SRA497524", "GEO", "White Lab, Cancer Biology & Genetics, Memorial Sloan Kettering Cancer Center", 1, 0.90483, null, 0.2787, null, 0.80892, null, 0.66955, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2016-11-22", "Larval", "Larval", "Cancer or Tumor", "Cancer or Tumor"], [41573, "SRR5044682", "SRX2367694", "SRS1813793", "SRP093723", "PRJNA354577", "RNA seq of zebrafish melanoma cells post metastatic dissemination", "GSE90143", "Transcriptome Analysis", "We report how the zebrafish melanoma cell line ZMEL1 changes post intravascular injection into 2dpf zebrafish embryos  as compared to the cells growing in vitro. Overall design: Examination of ZMEL1 cells in vitro versus 21 days in vivo in the zebrafish", null, "pubmed:28181494", null, "ZMEL1 IN VITRO REP 1", "GSM2399708", null, "tissue:ZMEL1 cells in vitro|cell type:ZMEL1|tissue type:melanoma", "ZMEL1 IN VITRO REP 1", "GSNAP alignment to Av9 zebrafish reference genome Read counts extracted with HTSeq Differential expression with DeSeq2 Zebrafish genes converted to human orthologs using DIOPT Genome build: Zv9 Supplementary files format and content: XLSX sheet with normalized read counts output from HTSeq", "ZMEL1 cells in vitro", "n/a", "Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq", "in vitro: DMEM/10% FCS/1X glutamax/28.5C     in vivo: growth in the zebrafish from 2 21dpf", "cell type:ZMEL1|tissue type:melanoma", "GSM2399708", "GSM2399708: ZMEL1 IN VITRO REP 1; Danio rerio; RNA Seq", "GSM2399708", null, "1", "Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq", "GEO Accession:GSM2399708", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP093723", null, null, "ZMEL1_ATCACG_AHBENJADXX_L001_001.R1.fastq", "fastq", 480071700.0, 9601434.0, "GSM2399708 r1", "0:50", "A:126381285;C:102596587;G:111718527;T:139327539;N:47762", 50, null, null, null, 126381285, 102596587, 111718527, 139327539, 47762, "SRX2367694", "SRS1813793", "SRA497524", "GEO", "White Lab, Cancer Biology & Genetics, Memorial Sloan Kettering Cancer Center", 1, 0.86224, null, 0.32994, null, 0.78106, null, 0.62148, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2016-11-22", "Larval", "Larval", "Cancer or Tumor", "Cancer or Tumor"], [41574, "SRR5044683", "SRX2367694", "SRS1813793", "SRP093723", "PRJNA354577", "RNA seq of zebrafish melanoma cells post metastatic dissemination", "GSE90143", "Transcriptome Analysis", "We report how the zebrafish melanoma cell line ZMEL1 changes post intravascular injection into 2dpf zebrafish embryos  as compared to the cells growing in vitro. Overall design: Examination of ZMEL1 cells in vitro versus 21 days in vivo in the zebrafish", null, "pubmed:28181494", null, "ZMEL1 IN VITRO REP 1", "GSM2399708", null, "tissue:ZMEL1 cells in vitro|cell type:ZMEL1|tissue type:melanoma", "ZMEL1 IN VITRO REP 1", "GSNAP alignment to Av9 zebrafish reference genome Read counts extracted with HTSeq Differential expression with DeSeq2 Zebrafish genes converted to human orthologs using DIOPT Genome build: Zv9 Supplementary files format and content: XLSX sheet with normalized read counts output from HTSeq", "ZMEL1 cells in vitro", "n/a", "Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq", "in vitro: DMEM/10% FCS/1X glutamax/28.5C     in vivo: growth in the zebrafish from 2 21dpf", "cell type:ZMEL1|tissue type:melanoma", "GSM2399708", "GSM2399708: ZMEL1 IN VITRO REP 1; Danio rerio; RNA Seq", "GSM2399708", null, "1", "Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq", "GEO Accession:GSM2399708", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP093723", null, null, "ZMEL1_ATCACG_AHBENJADXX_L002_001.R1.fastq", "fastq", 444225800.0, 8884516.0, "GSM2399708 r2", "0:50", "A:116866564;C:94744486;G:103253213;T:128645533;N:716004", 50, null, null, null, 116866564, 94744486, 103253213, 128645533, 716004, "SRX2367694", "SRS1813793", "SRA497524", "GEO", "White Lab, Cancer Biology & Genetics, Memorial Sloan Kettering Cancer Center", 1, 0.86139, null, 0.32876, null, 0.78259, null, 0.62694, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2016-11-22", "Larval", "Larval", "Cancer or Tumor", "Cancer or Tumor"], [41616, "SRR5099113", "SRX2415891", "SRS1853479", "SRP094947", "PRJNA357051", "Development of zebrafish medulloblastoma model by TALENs induced somatic gene inactivation methods", "GSE92260", "Transcriptome Analysis", "we developed the zebrafish cancer models by TALENs mediated somatic inactivation of tumor suppressor genes  rb1  induced brain tumors in tp53 mutation background. Using RNA sequencing analysis in addition to histopathology and immunohistochemistry  we demonstrated that the brain tumors induced by rb1 gene somatic inactivation have a molecular feature of MB like PNETs Overall design: QuantSeq three prime mRNA sequencing with whole brain tissue wild type WT zebrafish and tumors induced by rb1 TALENs injected zebrafish at xxx mpf", null, "pubmed:28903419", null, "FFPE 2", "GSM2424730", null, "source name:tumor 2 induced by rb1 TALENs|strain:p53M214K|tissue:tumor tissues 2 induced by rb1 TALENs|developmental stage:5 mpf", "FFPE 2", "Illumina Casava1.8 software used for basecalling. Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequenceusing fastx trimmer  then mapped to danRer10 whole genome using Bowtie2 Read count extraction and nomalization were performed using edgeR. Genome build: danRer10 Supplementary files format and content: FFPE 1.txt and FFPE 2.txt report quantile normalized abundance measurements. Supplementary files format and content: WT.txt report quantile normalized abundance measurements.  Column WT1 reports quantile normalized abundance measurements post quantile   normalization had done between WT and FFPE 1.  Column WT2 reports quantile normalized abundance measurements post quantile   normalization had done between WT and FFPE 2.", "tumor 2 induced by rb1 TALENs", null, "RNA was harvested using Trizol reagent Invitrogen. 500 ng of total RNA was used for the construction of sequencing libraries. RNA libraries were prepared for sequencing using LEXOGEN Quant Seq Library Prep Kit Cat#001.24 standard protocols.", null, "strain:p53M214K|tissue:tumor tissues 2 induced by rb1 TALENs|developmental stage:5 mpf", "GSM2424730", "GSM2424730: FFPE 2; Danio rerio; RNA Seq", "GSM2424730", null, "1", "RNA was harvested using Trizol reagent Invitrogen. 500 ng of total RNA was used for the construction of sequencing libraries. RNA libraries were prepared for sequencing using LEXOGEN Quant Seq Library Prep Kit Cat#001.24 standard protocols.", "GEO Accession:GSM2424730", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP094947", null, null, "FFPE-2_fastq.gz", "fastq", 900420050.0, 8915050.0, "GSM2424730 r1", "0:101", "A:404381931;C:201118712;G:149335807;T:145550067;N:33533", 101, null, null, null, 404381931, 201118712, 149335807, 145550067, 33533, "SRX2415891", "SRS1853479", "SRA502460", "GEO", "Research Institute, National Cancer Center", 1, 0.03639, null, 0.02825, null, 0.9978, null, 0.55688, null, 101, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "lexogen", "bulk", "unknown", "unknown", null, "Unknown", "2016-12-12", "Adult", "Adult", "Cancer or Tumor", "Cancer or Tumor"], [41617, "SRR5099112", "SRX2415890", "SRS1853478", "SRP094947", "PRJNA357051", "Development of zebrafish medulloblastoma model by TALENs induced somatic gene inactivation methods", "GSE92260", "Transcriptome Analysis", "we developed the zebrafish cancer models by TALENs mediated somatic inactivation of tumor suppressor genes  rb1  induced brain tumors in tp53 mutation background. Using RNA sequencing analysis in addition to histopathology and immunohistochemistry  we demonstrated that the brain tumors induced by rb1 gene somatic inactivation have a molecular feature of MB like PNETs Overall design: QuantSeq three prime mRNA sequencing with whole brain tissue wild type WT zebrafish and tumors induced by rb1 TALENs injected zebrafish at xxx mpf", null, "pubmed:28903419", null, "FFPE 1", "GSM2424729", null, "source name:tumor 1 induced by rb1 TALENs|strain:p53M214K|tissue:tumor tissues 1 induced by rb1 TALENs|developmental stage:5 mpf", "FFPE 1", "Illumina Casava1.8 software used for basecalling. Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequenceusing fastx trimmer  then mapped to danRer10 whole genome using Bowtie2 Read count extraction and nomalization were performed using edgeR. Genome build: danRer10 Supplementary files format and content: FFPE 1.txt and FFPE 2.txt report quantile normalized abundance measurements. Supplementary files format and content: WT.txt report quantile normalized abundance measurements.  Column WT1 reports quantile normalized abundance measurements post quantile   normalization had done between WT and FFPE 1.  Column WT2 reports quantile normalized abundance measurements post quantile   normalization had done between WT and FFPE 2.", "tumor 1 induced by rb1 TALENs", null, "RNA was harvested using Trizol reagent Invitrogen. 500 ng of total RNA was used for the construction of sequencing libraries. RNA libraries were prepared for sequencing using LEXOGEN Quant Seq Library Prep Kit Cat#001.24 standard protocols.", null, "strain:p53M214K|tissue:tumor tissues 1 induced by rb1 TALENs|developmental stage:5 mpf", "GSM2424729", "GSM2424729: FFPE 1; Danio rerio; RNA Seq", "GSM2424729", null, "1", "RNA was harvested using Trizol reagent Invitrogen. 500 ng of total RNA was used for the construction of sequencing libraries. RNA libraries were prepared for sequencing using LEXOGEN Quant Seq Library Prep Kit Cat#001.24 standard protocols.", "GEO Accession:GSM2424729", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP094947", null, null, "FFPE-1_fastq.gz", "fastq", 985654556.0, 9758956.0, "GSM2424729 r1", "0:101", "A:642158389;C:109642019;G:103170689;T:130633868;N:49591", 101, null, null, null, 642158389, 109642019, 103170689, 130633868, 49591, "SRX2415890", "SRS1853478", "SRA502460", "GEO", "Research Institute, National Cancer Center", 1, 0.71847, null, 0.59813, null, 0.9376, null, 0.57167, null, 101, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "lexogen", "bulk", "unknown", "unknown", null, "Unknown", "2016-12-12", "Adult", "Adult", "Cancer or Tumor", "Cancer or Tumor"], [50848, "SRR8312803", "SRX5126180", "SRS4139302", "SRP173302", "PRJNA509471", "The side population enriches for leukemia propagating cell activity and Wnt pathway expression in zebrafish acute lymphoblastic leukemia.", "GSE123665", "Transcriptome Analysis", "Cancer stem cells have been strongly linked to resistance and relapse in many malignancies. However  purifying them from within the bulk tumor has been challenging  so their precise genetic and functional characteristics are not well defined. The side population assay exploits the ability of some cells to efflux Hoechst dye via ABC transporters. Stem cells have increased expression of these transporters and this assay has been shown to enrich for stem cells in various tissues and cancers. This study identifies the side population within a zebrafish model of acute lymphoblastic leukemia and correlates the frequency of side population cells with the frequency of leukemia stem cells more precisely referred to as leukemia propagating cells within our transplantation model. In addition  the side population within the leukemia evolves with serial transplantation  increasing in tandem with leukemia propagating cell frequency over subsequent generations. Sorted side population cells from these tumors are enriched for leukemia propagating cells and have enhanced engraftment compared to sorted non side population cells when transplanted into syngeneic recipients. RNA sequencing analysis of sorted side population cells compared to non side population cells identified a shared expression profile within the side population and pathway analysis yielded Wnt signaling as the most overrepresented. Gene set enrichment analysis showed that stem cell differentiation and canonical Wnt signaling were significantly upregulated in the side population. Overall  these results demonstrate that the side population in zebrafish acute lymphoblastic leukemia significantly enriches for leukemia propagating cells and identifies the Wnt pathway as a likely genetic driver of leukemia stem cell fate. Overall design: mRNA expression comparison between sorted side population and non side population in 3 zebrafish ALL tumors", null, "pubmed:30630989", null, "nonSP 1314", "GSM3509262", null, "source name:ALL tumor|strain:CG2|tissue:ALL", "nonSP 1314", "Illumina Casava1.7 software used for basecalling. All RNA seq reads were used to align to the genome assembly GRCz10 using STAR v2.5.1b with default configurations. Transcripts were assembled from the aligned reads using Cufflinks v2.2.1 with the default configurations to generate FPKM Fragments Per Kilobase Million tables. Using 4 as the fold change cutoff  DEGs Differentially expressed genes were detected using both Tuxedo suite FPKM based method and featureCounts DESeq v1.30.0  edgeR v3.20.7 read count based method with default configurations. Genes detected by at least more than one method were collected to create a high confidence DEG lists. Genome build: GRCz10 Supplementary files format and content: Count tables were generated using featureCount v1.28.1 based on Ensembl annotation GRCz10.", "ALL tumor", "None", "Tumors were removed  sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols", "None", "strain:CG2|tissue:ALL", "GSM3509262", "GSM3509262: nonSP 1314; Danio rerio; RNA Seq", "GSM3509262", null, "1", "Tumors were removed  sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3509262", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP173302", null, null, null, null, 1102240750.0, 22044815.0, "GSM3509262 r1", "0:50 1:0", "A:238366338;C:290902481;G:270336209;T:302466123;N:169599", 50, 0, null, null, 238366338, 290902481, 270336209, 302466123, 169599, "SRX5126180", "SRS4139302", "SRA822847", "GEO", "Bioinformatics Core, Biological Sciences Division, The University of Chicago", 1, 0.95733, null, 0.05326, null, 0.82195, null, 0.45391, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2018-12-11", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [50849, "SRR8312804", "SRX5126180", "SRS4139302", "SRP173302", "PRJNA509471", "The side population enriches for leukemia propagating cell activity and Wnt pathway expression in zebrafish acute lymphoblastic leukemia.", "GSE123665", "Transcriptome Analysis", "Cancer stem cells have been strongly linked to resistance and relapse in many malignancies. However  purifying them from within the bulk tumor has been challenging  so their precise genetic and functional characteristics are not well defined. The side population assay exploits the ability of some cells to efflux Hoechst dye via ABC transporters. Stem cells have increased expression of these transporters and this assay has been shown to enrich for stem cells in various tissues and cancers. This study identifies the side population within a zebrafish model of acute lymphoblastic leukemia and correlates the frequency of side population cells with the frequency of leukemia stem cells more precisely referred to as leukemia propagating cells within our transplantation model. In addition  the side population within the leukemia evolves with serial transplantation  increasing in tandem with leukemia propagating cell frequency over subsequent generations. Sorted side population cells from these tumors are enriched for leukemia propagating cells and have enhanced engraftment compared to sorted non side population cells when transplanted into syngeneic recipients. RNA sequencing analysis of sorted side population cells compared to non side population cells identified a shared expression profile within the side population and pathway analysis yielded Wnt signaling as the most overrepresented. Gene set enrichment analysis showed that stem cell differentiation and canonical Wnt signaling were significantly upregulated in the side population. Overall  these results demonstrate that the side population in zebrafish acute lymphoblastic leukemia significantly enriches for leukemia propagating cells and identifies the Wnt pathway as a likely genetic driver of leukemia stem cell fate. Overall design: mRNA expression comparison between sorted side population and non side population in 3 zebrafish ALL tumors", null, "pubmed:30630989", null, "nonSP 1314", "GSM3509262", null, "source name:ALL tumor|strain:CG2|tissue:ALL", "nonSP 1314", "Illumina Casava1.7 software used for basecalling. All RNA seq reads were used to align to the genome assembly GRCz10 using STAR v2.5.1b with default configurations. Transcripts were assembled from the aligned reads using Cufflinks v2.2.1 with the default configurations to generate FPKM Fragments Per Kilobase Million tables. Using 4 as the fold change cutoff  DEGs Differentially expressed genes were detected using both Tuxedo suite FPKM based method and featureCounts DESeq v1.30.0  edgeR v3.20.7 read count based method with default configurations. Genes detected by at least more than one method were collected to create a high confidence DEG lists. Genome build: GRCz10 Supplementary files format and content: Count tables were generated using featureCount v1.28.1 based on Ensembl annotation GRCz10.", "ALL tumor", "None", "Tumors were removed  sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols", "None", "strain:CG2|tissue:ALL", "GSM3509262", "GSM3509262: nonSP 1314; Danio rerio; RNA Seq", "GSM3509262", null, "1", "Tumors were removed  sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3509262", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP173302", null, null, null, null, 2100323600.0, 42006472.0, "GSM3509262 r2", "0:50 1:0", "A:454665602;C:553824333;G:514968464;T:576182722;N:682479", 50, 0, null, null, 454665602, 553824333, 514968464, 576182722, 682479, "SRX5126180", "SRS4139302", "SRA822847", "GEO", "Bioinformatics Core, Biological Sciences Division, The University of Chicago", 1, 0.95581, null, 0.05304, null, 0.82246, null, 0.44598, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2018-12-11", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [50850, "SRR8312801", "SRX5126179", "SRS4139301", "SRP173302", "PRJNA509471", "The side population enriches for leukemia propagating cell activity and Wnt pathway expression in zebrafish acute lymphoblastic leukemia.", "GSE123665", "Transcriptome Analysis", "Cancer stem cells have been strongly linked to resistance and relapse in many malignancies. However  purifying them from within the bulk tumor has been challenging  so their precise genetic and functional characteristics are not well defined. The side population assay exploits the ability of some cells to efflux Hoechst dye via ABC transporters. Stem cells have increased expression of these transporters and this assay has been shown to enrich for stem cells in various tissues and cancers. This study identifies the side population within a zebrafish model of acute lymphoblastic leukemia and correlates the frequency of side population cells with the frequency of leukemia stem cells more precisely referred to as leukemia propagating cells within our transplantation model. In addition  the side population within the leukemia evolves with serial transplantation  increasing in tandem with leukemia propagating cell frequency over subsequent generations. Sorted side population cells from these tumors are enriched for leukemia propagating cells and have enhanced engraftment compared to sorted non side population cells when transplanted into syngeneic recipients. RNA sequencing analysis of sorted side population cells compared to non side population cells identified a shared expression profile within the side population and pathway analysis yielded Wnt signaling as the most overrepresented. Gene set enrichment analysis showed that stem cell differentiation and canonical Wnt signaling were significantly upregulated in the side population. Overall  these results demonstrate that the side population in zebrafish acute lymphoblastic leukemia significantly enriches for leukemia propagating cells and identifies the Wnt pathway as a likely genetic driver of leukemia stem cell fate. Overall design: mRNA expression comparison between sorted side population and non side population in 3 zebrafish ALL tumors", null, "pubmed:30630989", null, "SP 1314", "GSM3509261", null, "source name:ALL tumor|strain:CG2|tissue:ALL", "SP 1314", "Illumina Casava1.7 software used for basecalling. All RNA seq reads were used to align to the genome assembly GRCz10 using STAR v2.5.1b with default configurations. Transcripts were assembled from the aligned reads using Cufflinks v2.2.1 with the default configurations to generate FPKM Fragments Per Kilobase Million tables. Using 4 as the fold change cutoff  DEGs Differentially expressed genes were detected using both Tuxedo suite FPKM based method and featureCounts DESeq v1.30.0  edgeR v3.20.7 read count based method with default configurations. Genes detected by at least more than one method were collected to create a high confidence DEG lists. Genome build: GRCz10 Supplementary files format and content: Count tables were generated using featureCount v1.28.1 based on Ensembl annotation GRCz10.", "ALL tumor", "None", "Tumors were removed  sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols", "None", "strain:CG2|tissue:ALL", "GSM3509261", "GSM3509261: SP 1314; Danio rerio; RNA Seq", "GSM3509261", null, "1", "Tumors were removed  sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3509261", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP173302", null, null, null, null, 1795016300.0, 35900326.0, "GSM3509261 r1", "0:50 1:0", "A:414364764;C:453952517;G:425127792;T:501295946;N:275281", 50, 0, null, null, 414364764, 453952517, 425127792, 501295946, 275281, "SRX5126179", "SRS4139301", "SRA822847", "GEO", "Bioinformatics Core, Biological Sciences Division, The University of Chicago", 1, 0.94054, null, 0.1034, null, 0.77199, null, 0.50665, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2018-12-11", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [50851, "SRR8312802", "SRX5126179", "SRS4139301", "SRP173302", "PRJNA509471", "The side population enriches for leukemia propagating cell activity and Wnt pathway expression in zebrafish acute lymphoblastic leukemia.", "GSE123665", "Transcriptome Analysis", "Cancer stem cells have been strongly linked to resistance and relapse in many malignancies. However  purifying them from within the bulk tumor has been challenging  so their precise genetic and functional characteristics are not well defined. The side population assay exploits the ability of some cells to efflux Hoechst dye via ABC transporters. Stem cells have increased expression of these transporters and this assay has been shown to enrich for stem cells in various tissues and cancers. This study identifies the side population within a zebrafish model of acute lymphoblastic leukemia and correlates the frequency of side population cells with the frequency of leukemia stem cells more precisely referred to as leukemia propagating cells within our transplantation model. In addition  the side population within the leukemia evolves with serial transplantation  increasing in tandem with leukemia propagating cell frequency over subsequent generations. Sorted side population cells from these tumors are enriched for leukemia propagating cells and have enhanced engraftment compared to sorted non side population cells when transplanted into syngeneic recipients. RNA sequencing analysis of sorted side population cells compared to non side population cells identified a shared expression profile within the side population and pathway analysis yielded Wnt signaling as the most overrepresented. Gene set enrichment analysis showed that stem cell differentiation and canonical Wnt signaling were significantly upregulated in the side population. Overall  these results demonstrate that the side population in zebrafish acute lymphoblastic leukemia significantly enriches for leukemia propagating cells and identifies the Wnt pathway as a likely genetic driver of leukemia stem cell fate. Overall design: mRNA expression comparison between sorted side population and non side population in 3 zebrafish ALL tumors", null, "pubmed:30630989", null, "SP 1314", "GSM3509261", null, "source name:ALL tumor|strain:CG2|tissue:ALL", "SP 1314", "Illumina Casava1.7 software used for basecalling. All RNA seq reads were used to align to the genome assembly GRCz10 using STAR v2.5.1b with default configurations. Transcripts were assembled from the aligned reads using Cufflinks v2.2.1 with the default configurations to generate FPKM Fragments Per Kilobase Million tables. Using 4 as the fold change cutoff  DEGs Differentially expressed genes were detected using both Tuxedo suite FPKM based method and featureCounts DESeq v1.30.0  edgeR v3.20.7 read count based method with default configurations. Genes detected by at least more than one method were collected to create a high confidence DEG lists. Genome build: GRCz10 Supplementary files format and content: Count tables were generated using featureCount v1.28.1 based on Ensembl annotation GRCz10.", "ALL tumor", "None", "Tumors were removed  sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols", "None", "strain:CG2|tissue:ALL", "GSM3509261", "GSM3509261: SP 1314; Danio rerio; RNA Seq", "GSM3509261", null, "1", "Tumors were removed  sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3509261", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP173302", null, null, null, null, 1643807200.0, 32876144.0, "GSM3509261 r2", "0:50 1:0", "A:379875320;C:415331594;G:389155351;T:458912143;N:532792", 50, 0, null, null, 379875320, 415331594, 389155351, 458912143, 532792, "SRX5126179", "SRS4139301", "SRA822847", "GEO", "Bioinformatics Core, Biological Sciences Division, The University of Chicago", 1, 0.93812, null, 0.1016, null, 0.77281, null, 0.50853, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2018-12-11", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [50852, "SRR8312799", "SRX5126178", "SRS4139300", "SRP173302", "PRJNA509471", "The side population enriches for leukemia propagating cell activity and Wnt pathway expression in zebrafish acute lymphoblastic leukemia.", "GSE123665", "Transcriptome Analysis", "Cancer stem cells have been strongly linked to resistance and relapse in many malignancies. However  purifying them from within the bulk tumor has been challenging  so their precise genetic and functional characteristics are not well defined. The side population assay exploits the ability of some cells to efflux Hoechst dye via ABC transporters. Stem cells have increased expression of these transporters and this assay has been shown to enrich for stem cells in various tissues and cancers. This study identifies the side population within a zebrafish model of acute lymphoblastic leukemia and correlates the frequency of side population cells with the frequency of leukemia stem cells more precisely referred to as leukemia propagating cells within our transplantation model. In addition  the side population within the leukemia evolves with serial transplantation  increasing in tandem with leukemia propagating cell frequency over subsequent generations. Sorted side population cells from these tumors are enriched for leukemia propagating cells and have enhanced engraftment compared to sorted non side population cells when transplanted into syngeneic recipients. RNA sequencing analysis of sorted side population cells compared to non side population cells identified a shared expression profile within the side population and pathway analysis yielded Wnt signaling as the most overrepresented. Gene set enrichment analysis showed that stem cell differentiation and canonical Wnt signaling were significantly upregulated in the side population. Overall  these results demonstrate that the side population in zebrafish acute lymphoblastic leukemia significantly enriches for leukemia propagating cells and identifies the Wnt pathway as a likely genetic driver of leukemia stem cell fate. Overall design: mRNA expression comparison between sorted side population and non side population in 3 zebrafish ALL tumors", null, "pubmed:30630989", null, "nonSP 1279", "GSM3509260", null, "source name:ALL tumor|strain:CG2|tissue:ALL", "nonSP 1279", "Illumina Casava1.7 software used for basecalling. All RNA seq reads were used to align to the genome assembly GRCz10 using STAR v2.5.1b with default configurations. Transcripts were assembled from the aligned reads using Cufflinks v2.2.1 with the default configurations to generate FPKM Fragments Per Kilobase Million tables. Using 4 as the fold change cutoff  DEGs Differentially expressed genes were detected using both Tuxedo suite FPKM based method and featureCounts DESeq v1.30.0  edgeR v3.20.7 read count based method with default configurations. Genes detected by at least more than one method were collected to create a high confidence DEG lists. Genome build: GRCz10 Supplementary files format and content: Count tables were generated using featureCount v1.28.1 based on Ensembl annotation GRCz10.", "ALL tumor", "None", "Tumors were removed  sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols", "None", "strain:CG2|tissue:ALL", "GSM3509260", "GSM3509260: nonSP 1279; Danio rerio; RNA Seq", "GSM3509260", null, "1", "Tumors were removed  sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3509260", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP173302", null, null, null, null, 971515350.0, 19430307.0, "GSM3509260 r1", "0:50 1:0", "A:209882045;C:255304153;G:238689373;T:267489989;N:149790", 50, 0, null, null, 209882045, 255304153, 238689373, 267489989, 149790, "SRX5126178", "SRS4139300", "SRA822847", "GEO", "Bioinformatics Core, Biological Sciences Division, The University of Chicago", 1, 0.96223, null, 0.08865, null, 0.85437, null, 0.45664, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2018-12-11", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [50853, "SRR8312800", "SRX5126178", "SRS4139300", "SRP173302", "PRJNA509471", "The side population enriches for leukemia propagating cell activity and Wnt pathway expression in zebrafish acute lymphoblastic leukemia.", "GSE123665", "Transcriptome Analysis", "Cancer stem cells have been strongly linked to resistance and relapse in many malignancies. However  purifying them from within the bulk tumor has been challenging  so their precise genetic and functional characteristics are not well defined. The side population assay exploits the ability of some cells to efflux Hoechst dye via ABC transporters. Stem cells have increased expression of these transporters and this assay has been shown to enrich for stem cells in various tissues and cancers. This study identifies the side population within a zebrafish model of acute lymphoblastic leukemia and correlates the frequency of side population cells with the frequency of leukemia stem cells more precisely referred to as leukemia propagating cells within our transplantation model. In addition  the side population within the leukemia evolves with serial transplantation  increasing in tandem with leukemia propagating cell frequency over subsequent generations. Sorted side population cells from these tumors are enriched for leukemia propagating cells and have enhanced engraftment compared to sorted non side population cells when transplanted into syngeneic recipients. RNA sequencing analysis of sorted side population cells compared to non side population cells identified a shared expression profile within the side population and pathway analysis yielded Wnt signaling as the most overrepresented. Gene set enrichment analysis showed that stem cell differentiation and canonical Wnt signaling were significantly upregulated in the side population. Overall  these results demonstrate that the side population in zebrafish acute lymphoblastic leukemia significantly enriches for leukemia propagating cells and identifies the Wnt pathway as a likely genetic driver of leukemia stem cell fate. Overall design: mRNA expression comparison between sorted side population and non side population in 3 zebrafish ALL tumors", null, "pubmed:30630989", null, "nonSP 1279", "GSM3509260", null, "source name:ALL tumor|strain:CG2|tissue:ALL", "nonSP 1279", "Illumina Casava1.7 software used for basecalling. All RNA seq reads were used to align to the genome assembly GRCz10 using STAR v2.5.1b with default configurations. Transcripts were assembled from the aligned reads using Cufflinks v2.2.1 with the default configurations to generate FPKM Fragments Per Kilobase Million tables. Using 4 as the fold change cutoff  DEGs Differentially expressed genes were detected using both Tuxedo suite FPKM based method and featureCounts DESeq v1.30.0  edgeR v3.20.7 read count based method with default configurations. Genes detected by at least more than one method were collected to create a high confidence DEG lists. Genome build: GRCz10 Supplementary files format and content: Count tables were generated using featureCount v1.28.1 based on Ensembl annotation GRCz10.", "ALL tumor", "None", "Tumors were removed  sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols", "None", "strain:CG2|tissue:ALL", "GSM3509260", "GSM3509260: nonSP 1279; Danio rerio; RNA Seq", "GSM3509260", null, "1", "Tumors were removed  sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3509260", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP173302", null, null, null, null, 859048800.0, 17180976.0, "GSM3509260 r2", "0:50 1:0", "A:185797914;C:225529235;G:211061558;T:236378727;N:281366", 50, 0, null, null, 185797914, 225529235, 211061558, 236378727, 281366, "SRX5126178", "SRS4139300", "SRA822847", "GEO", "Bioinformatics Core, Biological Sciences Division, The University of Chicago", 1, 0.96055, null, 0.08804, null, 0.85283, null, 0.48896, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2018-12-11", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [50854, "SRR8312797", "SRX5126177", "SRS4139299", "SRP173302", "PRJNA509471", "The side population enriches for leukemia propagating cell activity and Wnt pathway expression in zebrafish acute lymphoblastic leukemia.", "GSE123665", "Transcriptome Analysis", "Cancer stem cells have been strongly linked to resistance and relapse in many malignancies. However  purifying them from within the bulk tumor has been challenging  so their precise genetic and functional characteristics are not well defined. The side population assay exploits the ability of some cells to efflux Hoechst dye via ABC transporters. Stem cells have increased expression of these transporters and this assay has been shown to enrich for stem cells in various tissues and cancers. This study identifies the side population within a zebrafish model of acute lymphoblastic leukemia and correlates the frequency of side population cells with the frequency of leukemia stem cells more precisely referred to as leukemia propagating cells within our transplantation model. In addition  the side population within the leukemia evolves with serial transplantation  increasing in tandem with leukemia propagating cell frequency over subsequent generations. Sorted side population cells from these tumors are enriched for leukemia propagating cells and have enhanced engraftment compared to sorted non side population cells when transplanted into syngeneic recipients. RNA sequencing analysis of sorted side population cells compared to non side population cells identified a shared expression profile within the side population and pathway analysis yielded Wnt signaling as the most overrepresented. Gene set enrichment analysis showed that stem cell differentiation and canonical Wnt signaling were significantly upregulated in the side population. Overall  these results demonstrate that the side population in zebrafish acute lymphoblastic leukemia significantly enriches for leukemia propagating cells and identifies the Wnt pathway as a likely genetic driver of leukemia stem cell fate. Overall design: mRNA expression comparison between sorted side population and non side population in 3 zebrafish ALL tumors", null, "pubmed:30630989", null, "SP 1279", "GSM3509259", null, "source name:ALL tumor|strain:CG2|tissue:ALL", "SP 1279", "Illumina Casava1.7 software used for basecalling. All RNA seq reads were used to align to the genome assembly GRCz10 using STAR v2.5.1b with default configurations. Transcripts were assembled from the aligned reads using Cufflinks v2.2.1 with the default configurations to generate FPKM Fragments Per Kilobase Million tables. Using 4 as the fold change cutoff  DEGs Differentially expressed genes were detected using both Tuxedo suite FPKM based method and featureCounts DESeq v1.30.0  edgeR v3.20.7 read count based method with default configurations. Genes detected by at least more than one method were collected to create a high confidence DEG lists. Genome build: GRCz10 Supplementary files format and content: Count tables were generated using featureCount v1.28.1 based on Ensembl annotation GRCz10.", "ALL tumor", "None", "Tumors were removed  sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols", "None", "strain:CG2|tissue:ALL", "GSM3509259", "GSM3509259: SP 1279; Danio rerio; RNA Seq", "GSM3509259", null, "1", "Tumors were removed  sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3509259", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP173302", null, null, null, null, 843819050.0, 16876381.0, "GSM3509259 r1", "0:50 1:0", "A:199287616;C:210295815;G:195583208;T:238522867;N:129544", 50, 0, null, null, 199287616, 210295815, 195583208, 238522867, 129544, "SRX5126177", "SRS4139299", "SRA822847", "GEO", "Bioinformatics Core, Biological Sciences Division, The University of Chicago", 1, 0.9391, null, 0.1451, null, 0.79683, null, 0.50281, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2018-12-11", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [50855, "SRR8312798", "SRX5126177", "SRS4139299", "SRP173302", "PRJNA509471", "The side population enriches for leukemia propagating cell activity and Wnt pathway expression in zebrafish acute lymphoblastic leukemia.", "GSE123665", "Transcriptome Analysis", "Cancer stem cells have been strongly linked to resistance and relapse in many malignancies. However  purifying them from within the bulk tumor has been challenging  so their precise genetic and functional characteristics are not well defined. The side population assay exploits the ability of some cells to efflux Hoechst dye via ABC transporters. Stem cells have increased expression of these transporters and this assay has been shown to enrich for stem cells in various tissues and cancers. This study identifies the side population within a zebrafish model of acute lymphoblastic leukemia and correlates the frequency of side population cells with the frequency of leukemia stem cells more precisely referred to as leukemia propagating cells within our transplantation model. In addition  the side population within the leukemia evolves with serial transplantation  increasing in tandem with leukemia propagating cell frequency over subsequent generations. Sorted side population cells from these tumors are enriched for leukemia propagating cells and have enhanced engraftment compared to sorted non side population cells when transplanted into syngeneic recipients. RNA sequencing analysis of sorted side population cells compared to non side population cells identified a shared expression profile within the side population and pathway analysis yielded Wnt signaling as the most overrepresented. Gene set enrichment analysis showed that stem cell differentiation and canonical Wnt signaling were significantly upregulated in the side population. Overall  these results demonstrate that the side population in zebrafish acute lymphoblastic leukemia significantly enriches for leukemia propagating cells and identifies the Wnt pathway as a likely genetic driver of leukemia stem cell fate. Overall design: mRNA expression comparison between sorted side population and non side population in 3 zebrafish ALL tumors", null, "pubmed:30630989", null, "SP 1279", "GSM3509259", null, "source name:ALL tumor|strain:CG2|tissue:ALL", "SP 1279", "Illumina Casava1.7 software used for basecalling. All RNA seq reads were used to align to the genome assembly GRCz10 using STAR v2.5.1b with default configurations. Transcripts were assembled from the aligned reads using Cufflinks v2.2.1 with the default configurations to generate FPKM Fragments Per Kilobase Million tables. Using 4 as the fold change cutoff  DEGs Differentially expressed genes were detected using both Tuxedo suite FPKM based method and featureCounts DESeq v1.30.0  edgeR v3.20.7 read count based method with default configurations. Genes detected by at least more than one method were collected to create a high confidence DEG lists. Genome build: GRCz10 Supplementary files format and content: Count tables were generated using featureCount v1.28.1 based on Ensembl annotation GRCz10.", "ALL tumor", "None", "Tumors were removed  sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols", "None", "strain:CG2|tissue:ALL", "GSM3509259", "GSM3509259: SP 1279; Danio rerio; RNA Seq", "GSM3509259", null, "1", "Tumors were removed  sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3509259", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP173302", null, null, null, null, 2285635100.0, 45712702.0, "GSM3509259 r2", "0:50 1:0", "A:540527368;C:568996224;G:529423615;T:645948448;N:739445", 50, 0, null, null, 540527368, 568996224, 529423615, 645948448, 739445, "SRX5126177", "SRS4139299", "SRA822847", "GEO", "Bioinformatics Core, Biological Sciences Division, The University of Chicago", 1, 0.93725, null, 0.14453, null, 0.79746, null, 0.4961, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2018-12-11", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [50856, "SRR8312795", "SRX5126176", "SRS4139298", "SRP173302", "PRJNA509471", "The side population enriches for leukemia propagating cell activity and Wnt pathway expression in zebrafish acute lymphoblastic leukemia.", "GSE123665", "Transcriptome Analysis", "Cancer stem cells have been strongly linked to resistance and relapse in many malignancies. However  purifying them from within the bulk tumor has been challenging  so their precise genetic and functional characteristics are not well defined. The side population assay exploits the ability of some cells to efflux Hoechst dye via ABC transporters. Stem cells have increased expression of these transporters and this assay has been shown to enrich for stem cells in various tissues and cancers. This study identifies the side population within a zebrafish model of acute lymphoblastic leukemia and correlates the frequency of side population cells with the frequency of leukemia stem cells more precisely referred to as leukemia propagating cells within our transplantation model. In addition  the side population within the leukemia evolves with serial transplantation  increasing in tandem with leukemia propagating cell frequency over subsequent generations. Sorted side population cells from these tumors are enriched for leukemia propagating cells and have enhanced engraftment compared to sorted non side population cells when transplanted into syngeneic recipients. RNA sequencing analysis of sorted side population cells compared to non side population cells identified a shared expression profile within the side population and pathway analysis yielded Wnt signaling as the most overrepresented. Gene set enrichment analysis showed that stem cell differentiation and canonical Wnt signaling were significantly upregulated in the side population. Overall  these results demonstrate that the side population in zebrafish acute lymphoblastic leukemia significantly enriches for leukemia propagating cells and identifies the Wnt pathway as a likely genetic driver of leukemia stem cell fate. Overall design: mRNA expression comparison between sorted side population and non side population in 3 zebrafish ALL tumors", null, "pubmed:30630989", null, "nonSP 1404", "GSM3509258", null, "source name:ALL tumor|strain:CG2|tissue:ALL", "nonSP 1404", "Illumina Casava1.7 software used for basecalling. All RNA seq reads were used to align to the genome assembly GRCz10 using STAR v2.5.1b with default configurations. Transcripts were assembled from the aligned reads using Cufflinks v2.2.1 with the default configurations to generate FPKM Fragments Per Kilobase Million tables. Using 4 as the fold change cutoff  DEGs Differentially expressed genes were detected using both Tuxedo suite FPKM based method and featureCounts DESeq v1.30.0  edgeR v3.20.7 read count based method with default configurations. Genes detected by at least more than one method were collected to create a high confidence DEG lists. Genome build: GRCz10 Supplementary files format and content: Count tables were generated using featureCount v1.28.1 based on Ensembl annotation GRCz10.", "ALL tumor", "None", "Tumors were removed  sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols", "None", "strain:CG2|tissue:ALL", "GSM3509258", "GSM3509258: nonSP 1404; Danio rerio; RNA Seq", "GSM3509258", null, "1", "Tumors were removed  sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3509258", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP173302", null, null, null, null, 2069543600.0, 41390872.0, "GSM3509258 r1", "0:50 1:0", "A:459382162;C:532071054;G:508544948;T:569228380;N:317056", 50, 0, null, null, 459382162, 532071054, 508544948, 569228380, 317056, "SRX5126176", "SRS4139298", "SRA822847", "GEO", "Bioinformatics Core, Biological Sciences Division, The University of Chicago", 1, 0.96095, null, 0.06905, null, 0.83412, null, 0.4818, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2018-12-11", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [50857, "SRR8312796", "SRX5126176", "SRS4139298", "SRP173302", "PRJNA509471", "The side population enriches for leukemia propagating cell activity and Wnt pathway expression in zebrafish acute lymphoblastic leukemia.", "GSE123665", "Transcriptome Analysis", "Cancer stem cells have been strongly linked to resistance and relapse in many malignancies. However  purifying them from within the bulk tumor has been challenging  so their precise genetic and functional characteristics are not well defined. The side population assay exploits the ability of some cells to efflux Hoechst dye via ABC transporters. Stem cells have increased expression of these transporters and this assay has been shown to enrich for stem cells in various tissues and cancers. This study identifies the side population within a zebrafish model of acute lymphoblastic leukemia and correlates the frequency of side population cells with the frequency of leukemia stem cells more precisely referred to as leukemia propagating cells within our transplantation model. In addition  the side population within the leukemia evolves with serial transplantation  increasing in tandem with leukemia propagating cell frequency over subsequent generations. Sorted side population cells from these tumors are enriched for leukemia propagating cells and have enhanced engraftment compared to sorted non side population cells when transplanted into syngeneic recipients. RNA sequencing analysis of sorted side population cells compared to non side population cells identified a shared expression profile within the side population and pathway analysis yielded Wnt signaling as the most overrepresented. Gene set enrichment analysis showed that stem cell differentiation and canonical Wnt signaling were significantly upregulated in the side population. Overall  these results demonstrate that the side population in zebrafish acute lymphoblastic leukemia significantly enriches for leukemia propagating cells and identifies the Wnt pathway as a likely genetic driver of leukemia stem cell fate. Overall design: mRNA expression comparison between sorted side population and non side population in 3 zebrafish ALL tumors", null, "pubmed:30630989", null, "nonSP 1404", "GSM3509258", null, "source name:ALL tumor|strain:CG2|tissue:ALL", "nonSP 1404", "Illumina Casava1.7 software used for basecalling. All RNA seq reads were used to align to the genome assembly GRCz10 using STAR v2.5.1b with default configurations. Transcripts were assembled from the aligned reads using Cufflinks v2.2.1 with the default configurations to generate FPKM Fragments Per Kilobase Million tables. Using 4 as the fold change cutoff  DEGs Differentially expressed genes were detected using both Tuxedo suite FPKM based method and featureCounts DESeq v1.30.0  edgeR v3.20.7 read count based method with default configurations. Genes detected by at least more than one method were collected to create a high confidence DEG lists. Genome build: GRCz10 Supplementary files format and content: Count tables were generated using featureCount v1.28.1 based on Ensembl annotation GRCz10.", "ALL tumor", "None", "Tumors were removed  sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols", "None", "strain:CG2|tissue:ALL", "GSM3509258", "GSM3509258: nonSP 1404; Danio rerio; RNA Seq", "GSM3509258", null, "1", "Tumors were removed  sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3509258", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP173302", null, null, null, null, 1547447200.0, 30948944.0, "GSM3509258 r2", "0:50 1:0", "A:343821341;C:397523901;G:380174292;T:425426296;N:501370", 50, 0, null, null, 343821341, 397523901, 380174292, 425426296, 501370, "SRX5126176", "SRS4139298", "SRA822847", "GEO", "Bioinformatics Core, Biological Sciences Division, The University of Chicago", 1, 0.95838, null, 0.06884, null, 0.83414, null, 0.48727, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2018-12-11", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [50858, "SRR8312793", "SRX5126175", "SRS4139297", "SRP173302", "PRJNA509471", "The side population enriches for leukemia propagating cell activity and Wnt pathway expression in zebrafish acute lymphoblastic leukemia.", "GSE123665", "Transcriptome Analysis", "Cancer stem cells have been strongly linked to resistance and relapse in many malignancies. However  purifying them from within the bulk tumor has been challenging  so their precise genetic and functional characteristics are not well defined. The side population assay exploits the ability of some cells to efflux Hoechst dye via ABC transporters. Stem cells have increased expression of these transporters and this assay has been shown to enrich for stem cells in various tissues and cancers. This study identifies the side population within a zebrafish model of acute lymphoblastic leukemia and correlates the frequency of side population cells with the frequency of leukemia stem cells more precisely referred to as leukemia propagating cells within our transplantation model. In addition  the side population within the leukemia evolves with serial transplantation  increasing in tandem with leukemia propagating cell frequency over subsequent generations. Sorted side population cells from these tumors are enriched for leukemia propagating cells and have enhanced engraftment compared to sorted non side population cells when transplanted into syngeneic recipients. RNA sequencing analysis of sorted side population cells compared to non side population cells identified a shared expression profile within the side population and pathway analysis yielded Wnt signaling as the most overrepresented. Gene set enrichment analysis showed that stem cell differentiation and canonical Wnt signaling were significantly upregulated in the side population. Overall  these results demonstrate that the side population in zebrafish acute lymphoblastic leukemia significantly enriches for leukemia propagating cells and identifies the Wnt pathway as a likely genetic driver of leukemia stem cell fate. Overall design: mRNA expression comparison between sorted side population and non side population in 3 zebrafish ALL tumors", null, "pubmed:30630989", null, "SP 1404", "GSM3509257", null, "source name:ALL tumor|strain:CG2|tissue:ALL", "SP 1404", "Illumina Casava1.7 software used for basecalling. All RNA seq reads were used to align to the genome assembly GRCz10 using STAR v2.5.1b with default configurations. Transcripts were assembled from the aligned reads using Cufflinks v2.2.1 with the default configurations to generate FPKM Fragments Per Kilobase Million tables. Using 4 as the fold change cutoff  DEGs Differentially expressed genes were detected using both Tuxedo suite FPKM based method and featureCounts DESeq v1.30.0  edgeR v3.20.7 read count based method with default configurations. Genes detected by at least more than one method were collected to create a high confidence DEG lists. Genome build: GRCz10 Supplementary files format and content: Count tables were generated using featureCount v1.28.1 based on Ensembl annotation GRCz10.", "ALL tumor", "None", "Tumors were removed  sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols", "None", "strain:CG2|tissue:ALL", "GSM3509257", "GSM3509257: SP 1404; Danio rerio; RNA Seq", "GSM3509257", null, "1", "Tumors were removed  sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3509257", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP173302", null, null, null, null, 2020346850.0, 40406937.0, "GSM3509257 r1", "0:50 1:0", "A:476259938;C:502400578;G:476364320;T:565010528;N:311486", 50, 0, null, null, 476259938, 502400578, 476364320, 565010528, 311486, "SRX5126175", "SRS4139297", "SRA822847", "GEO", "Bioinformatics Core, Biological Sciences Division, The University of Chicago", 1, 0.94163, null, 0.11567, null, 0.79287, null, 0.52008, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2018-12-11", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [50859, "SRR8312794", "SRX5126175", "SRS4139297", "SRP173302", "PRJNA509471", "The side population enriches for leukemia propagating cell activity and Wnt pathway expression in zebrafish acute lymphoblastic leukemia.", "GSE123665", "Transcriptome Analysis", "Cancer stem cells have been strongly linked to resistance and relapse in many malignancies. However  purifying them from within the bulk tumor has been challenging  so their precise genetic and functional characteristics are not well defined. The side population assay exploits the ability of some cells to efflux Hoechst dye via ABC transporters. Stem cells have increased expression of these transporters and this assay has been shown to enrich for stem cells in various tissues and cancers. This study identifies the side population within a zebrafish model of acute lymphoblastic leukemia and correlates the frequency of side population cells with the frequency of leukemia stem cells more precisely referred to as leukemia propagating cells within our transplantation model. In addition  the side population within the leukemia evolves with serial transplantation  increasing in tandem with leukemia propagating cell frequency over subsequent generations. Sorted side population cells from these tumors are enriched for leukemia propagating cells and have enhanced engraftment compared to sorted non side population cells when transplanted into syngeneic recipients. RNA sequencing analysis of sorted side population cells compared to non side population cells identified a shared expression profile within the side population and pathway analysis yielded Wnt signaling as the most overrepresented. Gene set enrichment analysis showed that stem cell differentiation and canonical Wnt signaling were significantly upregulated in the side population. Overall  these results demonstrate that the side population in zebrafish acute lymphoblastic leukemia significantly enriches for leukemia propagating cells and identifies the Wnt pathway as a likely genetic driver of leukemia stem cell fate. Overall design: mRNA expression comparison between sorted side population and non side population in 3 zebrafish ALL tumors", null, "pubmed:30630989", null, "SP 1404", "GSM3509257", null, "source name:ALL tumor|strain:CG2|tissue:ALL", "SP 1404", "Illumina Casava1.7 software used for basecalling. All RNA seq reads were used to align to the genome assembly GRCz10 using STAR v2.5.1b with default configurations. Transcripts were assembled from the aligned reads using Cufflinks v2.2.1 with the default configurations to generate FPKM Fragments Per Kilobase Million tables. Using 4 as the fold change cutoff  DEGs Differentially expressed genes were detected using both Tuxedo suite FPKM based method and featureCounts DESeq v1.30.0  edgeR v3.20.7 read count based method with default configurations. Genes detected by at least more than one method were collected to create a high confidence DEG lists. Genome build: GRCz10 Supplementary files format and content: Count tables were generated using featureCount v1.28.1 based on Ensembl annotation GRCz10.", "ALL tumor", "None", "Tumors were removed  sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols", "None", "strain:CG2|tissue:ALL", "GSM3509257", "GSM3509257: SP 1404; Danio rerio; RNA Seq", "GSM3509257", null, "1", "Tumors were removed  sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3509257", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP173302", null, null, null, null, 1560387300.0, 31207746.0, "GSM3509257 r2", "0:50 1:0", "A:368229806;C:387650010;G:367757630;T:436243680;N:506174", 50, 0, null, null, 368229806, 387650010, 367757630, 436243680, 506174, "SRX5126175", "SRS4139297", "SRA822847", "GEO", "Bioinformatics Core, Biological Sciences Division, The University of Chicago", 1, 0.93995, null, 0.11774, null, 0.79444, null, 0.49697, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United States", "2018-12-11", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [59561, "SRR11926643", "SRX8472289", "SRS6772890", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "T2", "GSM4591324", null, "tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP|tumor stg:Primary T ALL|lab of sample collection and sequencing:Speleman lab", "T2", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP|tumor stg:Primary T ALL|lab of sample collection and sequencing:Speleman lab", "GSM4591324", "GSM4591324: T2; Danio rerio; RNA Seq", "GSM4591324", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591324", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP265974", null, null, "sample_24.fastq.gz", "fastq", 3352396700.0, 44370046.0, "GSM4591324 r1", "0:75.56 1:0", "A:755348675;C:859386520;G:800067906;T:937329969;N:263630", 75, 0, null, null, 755348675, 859386520, 800067906, 937329969, 263630, "SRX8472289", "SRS6772890", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 1, 0.96963, null, 0.06719, null, 0.81755, null, 0.50255, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [59562, "SRR11926642", "SRX8472288", "SRS6772889", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "T2 2", "GSM4591323", null, "tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP|tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab", "T2 2", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP|tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab", "GSM4591323", "GSM4591323: T2 2; Danio rerio; RNA Seq", "GSM4591323", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591323", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP265974", null, null, "sample_23.fastq.gz", "fastq", 3718498010.0, 49228779.0, "GSM4591323 r1", "0:75.54 1:0", "A:848213188;C:950067431;G:877745427;T:1042167763;N:304201", 75, 0, null, null, 848213188, 950067431, 877745427, 1042167763, 304201, "SRX8472288", "SRS6772889", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 1, 0.96846, null, 0.08566, null, 0.80708, null, 0.51642, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [59563, "SRR11926641", "SRX8472287", "SRS6772888", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "T2 2 3", "GSM4591322", null, "tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP|tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab", "T2 2 3", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP|tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab", "GSM4591322", "GSM4591322: T2 2 3; Danio rerio; RNA Seq", "GSM4591322", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591322", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP265974", null, null, "sample_22.fastq.gz", "fastq", 3433698150.0, 45471576.0, "GSM4591322 r1", "0:75.51 1:0", "A:791522856;C:866434769;G:797134042;T:978335562;N:270921", 75, 0, null, null, 791522856, 866434769, 797134042, 978335562, 270921, "SRX8472287", "SRS6772888", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 1, 0.96727, null, 0.13235, null, 0.80375, null, 0.51948, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [59564, "SRR11926640", "SRX8472286", "SRS6772887", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "T2 2 1", "GSM4591321", null, "tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP|tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab", "T2 2 1", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP|tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab", "GSM4591321", "GSM4591321: T2 2 1; Danio rerio; RNA Seq", "GSM4591321", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591321", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP265974", null, null, "sample_21.fastq.gz", "fastq", 3340319927.0, 44222057.0, "GSM4591321 r1", "0:75.54 1:0", "A:783394487;C:834577900;G:758192327;T:963889109;N:266104", 75, 0, null, null, 783394487, 834577900, 758192327, 963889109, 266104, "SRX8472286", "SRS6772887", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 1, 0.95862, null, 0.19113, null, 0.80117, null, 0.51412, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [59565, "SRR11926639", "SRX8472285", "SRS6772885", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "T2 1", "GSM4591320", null, "tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP|tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab", "T2 1", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP|tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab", "GSM4591320", "GSM4591320: T2 1; Danio rerio; RNA Seq", "GSM4591320", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591320", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP265974", null, null, "sample_20.fastq.gz", "fastq", 3407895222.0, 45108733.0, "GSM4591320 r1", "0:75.55 1:0", "A:772284922;C:869002714;G:804588273;T:961751439;N:267874", 75, 0, null, null, 772284922, 869002714, 804588273, 961751439, 267874, "SRX8472285", "SRS6772885", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 1, 0.96729, null, 0.10404, null, 0.80819, null, 0.50282, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [59566, "SRR11926638", "SRX8472284", "SRS6772886", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "T1", "GSM4591319", null, "tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP|tumor stg:Primary T ALL|lab of sample collection and sequencing:Speleman lab", "T1", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP|tumor stg:Primary T ALL|lab of sample collection and sequencing:Speleman lab", "GSM4591319", "GSM4591319: T1; Danio rerio; RNA Seq", "GSM4591319", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591319", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP265974", null, null, "sample_19.fastq.gz", "fastq", 3399960459.0, 45000945.0, "GSM4591319 r1", "0:75.55 1:0", "A:757716117;C:885849357;G:808221386;T:947866574;N:307025", 75, 0, null, null, 757716117, 885849357, 808221386, 947866574, 307025, "SRX8472284", "SRS6772886", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 1, 0.96322, null, 0.0579, null, 0.80509, null, 0.51314, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [59567, "SRR11926637", "SRX8472283", "SRS6772884", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "T1 2", "GSM4591318", null, "tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP|tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab", "T1 2", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP|tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab", "GSM4591318", "GSM4591318: T1 2; Danio rerio; RNA Seq", "GSM4591318", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591318", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP265974", null, null, "sample_18.fastq.gz", "fastq", 3375335979.0, 44692348.0, "GSM4591318 r1", "0:75.52 1:0", "A:752811966;C:868444009;G:810580314;T:943232624;N:267066", 75, 0, null, null, 752811966, 868444009, 810580314, 943232624, 267066, "SRX8472283", "SRS6772884", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 1, 0.96578, null, 0.07571, null, 0.82558, null, 0.50359, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [59568, "SRR11926636", "SRX8472282", "SRS6772883", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "T1 1", "GSM4591317", null, "tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP|tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab", "T1 1", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP|tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab", "GSM4591317", "GSM4591317: T1 1; Danio rerio; RNA Seq", "GSM4591317", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591317", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP265974", null, null, "sample_17.fastq.gz", "fastq", 3010940849.0, 39848118.0, "GSM4591317 r1", "0:75.56 1:0", "A:668391154;C:785449019;G:724383036;T:832480672;N:236968", 75, 0, null, null, 668391154, 785449019, 724383036, 832480672, 236968, "SRX8472282", "SRS6772883", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 1, 0.96967, null, 0.04925, null, 0.84764, null, 0.52577, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [59569, "SRR11926635", "SRX8472281", "SRS6772882", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "PT4", "GSM4591316", null, "tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Primary T ALL|lab of sample collection and sequencing:Speleman lab", "PT4", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Primary T ALL|lab of sample collection and sequencing:Speleman lab", "GSM4591316", "GSM4591316: PT4; Danio rerio; RNA Seq", "GSM4591316", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591316", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP265974", null, null, "sample_16.fastq.gz", "fastq", 2704327748.0, 35795276.0, "GSM4591316 r1", "0:75.55 1:0", "A:606123714;C:696847421;G:651551202;T:749582467;N:222944", 75, 0, null, null, 606123714, 696847421, 651551202, 749582467, 222944, "SRX8472281", "SRS6772882", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 1, 0.97216, null, 0.06109, null, 0.81832, null, 0.49375, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [59570, "SRR11926634", "SRX8472280", "SRS6772881", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "PT3", "GSM4591315", null, "tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Primary T ALL|lab of sample collection and sequencing:Speleman lab", "PT3", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Primary T ALL|lab of sample collection and sequencing:Speleman lab", "GSM4591315", "GSM4591315: PT3; Danio rerio; RNA Seq", "GSM4591315", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591315", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP265974", null, null, "sample_15.fastq.gz", "fastq", 2516254096.0, 33304042.0, "GSM4591315 r1", "0:75.55 1:0", "A:572120254;C:639148525;G:596715581;T:708079869;N:189867", 75, 0, null, null, 572120254, 639148525, 596715581, 708079869, 189867, "SRX8472280", "SRS6772881", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 1, 0.96526, null, 0.07769, null, 0.80758, null, 0.53064, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [59571, "SRR11926633", "SRX8472279", "SRS6772880", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "PT2", "GSM4591314", null, "tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Primary T ALL|lab of sample collection and sequencing:Speleman lab", "PT2", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Primary T ALL|lab of sample collection and sequencing:Speleman lab", "GSM4591314", "GSM4591314: PT2; Danio rerio; RNA Seq", "GSM4591314", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591314", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP265974", null, null, "sample_14.fastq.gz", "fastq", 2805545977.0, 37135357.0, "GSM4591314 r1", "0:75.55 1:0", "A:632305395;C:719045953;G:676770065;T:777205477;N:219087", 75, 0, null, null, 632305395, 719045953, 676770065, 777205477, 219087, "SRX8472279", "SRS6772880", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 1, 0.97087, null, 0.01807, null, 0.83364, null, 0.54322, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [59572, "SRR11926632", "SRX8472278", "SRS6772879", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "PT2 3", "GSM4591313", null, "tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab", "PT2 3", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab", "GSM4591313", "GSM4591313: PT2 3; Danio rerio; RNA Seq", "GSM4591313", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591313", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP265974", null, null, "sample_13.fastq.gz", "fastq", 3227070397.0, 42713584.0, "GSM4591313 r1", "0:75.55 1:0", "A:717490964;C:839799892;G:773804253;T:895714100;N:261188", 75, 0, null, null, 717490964, 839799892, 773804253, 895714100, 261188, "SRX8472278", "SRS6772879", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 1, 0.97134, null, 0.05713, null, 0.81099, null, 0.49228, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [59573, "SRR11926631", "SRX8472277", "SRS6772878", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "PT2 2", "GSM4591312", null, "tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab", "PT2 2", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab", "GSM4591312", "GSM4591312: PT2 2; Danio rerio; RNA Seq", "GSM4591312", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591312", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP265974", null, null, "sample_12.fastq.gz", "fastq", 3212726304.0, 42523190.0, "GSM4591312 r1", "0:75.55 1:0", "A:719132496;C:829799997;G:771562071;T:891973714;N:258026", 75, 0, null, null, 719132496, 829799997, 771562071, 891973714, 258026, "SRX8472277", "SRS6772878", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 1, 0.9721, null, 0.04902, null, 0.80902, null, 0.52414, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [59574, "SRR11926630", "SRX8472276", "SRS6772877", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "PT2 1", "GSM4591311", null, "tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab", "PT2 1", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab", "GSM4591311", "GSM4591311: PT2 1; Danio rerio; RNA Seq", "GSM4591311", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591311", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP265974", null, null, "sample_11.fastq.gz", "fastq", 3021393530.0, 39988248.0, "GSM4591311 r1", "0:75.56 1:0", "A:672620933;C:786720838;G:726121643;T:835686624;N:243492", 75, 0, null, null, 672620933, 786720838, 726121643, 835686624, 243492, "SRX8472276", "SRS6772877", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 1, 0.97407, null, 0.03891, null, 0.81716, null, 0.49217, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [59575, "SRR11926629", "SRX8472275", "SRS6772876", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "PT1", "GSM4591310", null, "tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Primary T ALL|lab of sample collection and sequencing:Speleman lab", "PT1", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Primary T ALL|lab of sample collection and sequencing:Speleman lab", "GSM4591310", "GSM4591310: PT1; Danio rerio; RNA Seq", "GSM4591310", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591310", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP265974", null, null, "sample_10.fastq.gz", "fastq", 3216194683.0, 42575567.0, "GSM4591310 r1", "0:75.54 1:0", "A:754906399;C:800124470;G:747953707;T:912956321;N:253786", 75, 0, null, null, 754906399, 800124470, 747953707, 912956321, 253786, "SRX8472275", "SRS6772876", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 1, 0.95808, null, 0.13813, null, 0.79782, null, 0.5126, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [59576, "SRR11926628", "SRX8472274", "SRS6772875", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "PT1 3", "GSM4591309", null, "tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab", "PT1 3", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab", "GSM4591309", "GSM4591309: PT1 3; Danio rerio; RNA Seq", "GSM4591309", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591309", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP265974", null, null, "sample_9.fastq.gz", "fastq", 3632705131.0, 48084818.0, "GSM4591309 r1", "0:75.55 1:0", "A:864204924;C:896630766;G:806140808;T:1065445772;N:282861", 75, 0, null, null, 864204924, 896630766, 806140808, 1065445772, 282861, "SRX8472274", "SRS6772875", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 1, 0.94792, null, 0.24728, null, 0.78882, null, 0.49754, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [59577, "SRR11926627", "SRX8472273", "SRS6772874", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "PT1 2", "GSM4591308", null, "tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab", "PT1 2", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab", "GSM4591308", "GSM4591308: PT1 2; Danio rerio; RNA Seq", "GSM4591308", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591308", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP265974", null, null, "sample_8.fastq.gz", "fastq", 2694796792.0, 35662689.0, "GSM4591308 r1", "0:75.56 1:0", "A:647242858;C:662131043;G:597596390;T:787640018;N:186483", 75, 0, null, null, 647242858, 662131043, 597596390, 787640018, 186483, "SRX8472273", "SRS6772874", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 1, 0.94581, null, 0.21549, null, 0.79064, null, 0.50568, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [59578, "SRR11926626", "SRX8472272", "SRS6772873", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "PT1 1", "GSM4591307", null, "tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab", "PT1 1", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab", "GSM4591307", "GSM4591307: PT1 1; Danio rerio; RNA Seq", "GSM4591307", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591307", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP265974", null, null, "sample_7.fastq.gz", "fastq", 3283930508.0, 43472772.0, "GSM4591307 r1", "0:75.54 1:0", "A:777409453;C:814864928;G:740583382;T:950812702;N:260043", 75, 0, null, null, 777409453, 814864928, 740583382, 950812702, 260043, "SRX8472272", "SRS6772873", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 1, 0.94952, null, 0.17765, null, 0.78108, null, 0.50322, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [65013, "SRR14902693", "SRX11217415", "SRS9271514", "SRP325444", "PRJNA741108", "Transcriptional Profile in Zebrafish Melanocytes and Melanoma Tumors [RNA seq]", "GSE178801", "Transcriptome Analysis", "With high genetic heterogeneity in melanoma  understanding epigenetic and transcriptional differences between melanocytes and melanoma cells will enable further understanding of the genes  pathways  and epigenetic regions influencing melanoma development. We performed RNA seq and ATAC seq on fluorescently isolated melanocytes and melanoma cells from a zebrafish melanoma model. Overall design: RNA seq profiles of FACS isolated mitfa:mCherry reporter positive melanocytes and crestin:GFP positive melanoma cells from adult zebrafish D. rerio.", "parent bioproject:PRJNA741103", "pubmed:34791221", null, "MA3C RNAseq", "GSM5397960", null, "source name:Sorted melanoma tumor|genotype:BRAFV600E/p53lf/lf/crestin:EGFP|tissue:Melanoma", "MA3C RNAseq", "Assess read quality with FastQC Align to GRCz11/danRer11 using STAR Quantify transcriptome using RSEM Normalize reads with DESeq2 Genome build: danRer11 Supplementary files format and content: tab delimited text files with CPM values for each sample Supplementary files format and content: tab delimited text files with RPKM values for each sample Supplementary files format and content: Excel spreadsheet summarizing log2FC values between melanocytes and melanoma cells  as well as", "Sorted melanoma tumor", null, "FACS for fluorescent tag: mCherry for melanocytes MC and GFP for melanoma cells MA  then use Machery Nagel kit to extract total RNA cDNA generated using Clontech SMARTer cDNA amplification kit", null, "genotype:BRAFV600E/p53lf/lf/crestin:EGFP|tissue:Melanoma|run #:1", "GSM5397960", "GSM5397960: MA3C RNAseq; Danio rerio; RNA Seq", "GSM5397960", null, "1", "FACS for fluorescent tag: mCherry for melanocytes MC and GFP for melanoma cells MA  then use Machery Nagel kit to extract total RNA cDNA generated using Clontech SMARTer cDNA amplification kit", "GEO Accession:GSM5397960", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP325444", null, null, "MA3C.fq.gz", "fastq", 1678480250.0, 33569605.0, "GSM5397960 r1", "0:50 1:0", "A:463941895;C:370163467;G:364477555;T:478705617;N:1191716", 50, 0, null, null, 463941895, 370163467, 364477555, 478705617, 1191716, "SRX11217415", "SRS9271514", "SRA1250059", "GEO", "Kaufman, Oncology, Washington University in St. Louis", 1, 0.90303, null, 0.16625, null, 0.74696, null, 0.55133, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "cdna_unspecified", "smarter", "bulk", "unknown", "unknown", null, "United States", "2021-06-24", "Undetermined", "Adult", "Cancer or Tumor", "Cancer or Tumor"], [65014, "SRR14902692", "SRX11217414", "SRS9271513", "SRP325444", "PRJNA741108", "Transcriptional Profile in Zebrafish Melanocytes and Melanoma Tumors [RNA seq]", "GSE178801", "Transcriptome Analysis", "With high genetic heterogeneity in melanoma  understanding epigenetic and transcriptional differences between melanocytes and melanoma cells will enable further understanding of the genes  pathways  and epigenetic regions influencing melanoma development. We performed RNA seq and ATAC seq on fluorescently isolated melanocytes and melanoma cells from a zebrafish melanoma model. Overall design: RNA seq profiles of FACS isolated mitfa:mCherry reporter positive melanocytes and crestin:GFP positive melanoma cells from adult zebrafish D. rerio.", "parent bioproject:PRJNA741103", "pubmed:34791221", null, "MA3B RNAseq", "GSM5397959", null, "source name:Sorted melanoma tumor|genotype:BRAFV600E/p53lf/lf/crestin:EGFP|tissue:Melanoma", "MA3B RNAseq", "Assess read quality with FastQC Align to GRCz11/danRer11 using STAR Quantify transcriptome using RSEM Normalize reads with DESeq2 Genome build: danRer11 Supplementary files format and content: tab delimited text files with CPM values for each sample Supplementary files format and content: tab delimited text files with RPKM values for each sample Supplementary files format and content: Excel spreadsheet summarizing log2FC values between melanocytes and melanoma cells  as well as", "Sorted melanoma tumor", null, "FACS for fluorescent tag: mCherry for melanocytes MC and GFP for melanoma cells MA  then use Machery Nagel kit to extract total RNA cDNA generated using Clontech SMARTer cDNA amplification kit", null, "genotype:BRAFV600E/p53lf/lf/crestin:EGFP|tissue:Melanoma|run #:1", "GSM5397959", "GSM5397959: MA3B RNAseq; Danio rerio; RNA Seq", "GSM5397959", null, "1", "FACS for fluorescent tag: mCherry for melanocytes MC and GFP for melanoma cells MA  then use Machery Nagel kit to extract total RNA cDNA generated using Clontech SMARTer cDNA amplification kit", "GEO Accession:GSM5397959", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP325444", null, null, "MA3B.fq.gz", "fastq", 1437189100.0, 28743782.0, "GSM5397959 r1", "0:50 1:0", "A:398259972;C:317724608;G:311519412;T:408662664;N:1022444", 50, 0, null, null, 398259972, 317724608, 311519412, 408662664, 1022444, "SRX11217414", "SRS9271513", "SRA1250059", "GEO", "Kaufman, Oncology, Washington University in St. Louis", 1, 0.89689, null, 0.14892, null, 0.73959, null, 0.52927, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "cdna_unspecified", "smarter", "bulk", "unknown", "unknown", null, "United States", "2021-06-24", "Undetermined", "Adult", "Cancer or Tumor", "Cancer or Tumor"], [65015, "SRR14902691", "SRX11217413", "SRS9271512", "SRP325444", "PRJNA741108", "Transcriptional Profile in Zebrafish Melanocytes and Melanoma Tumors [RNA seq]", "GSE178801", "Transcriptome Analysis", "With high genetic heterogeneity in melanoma  understanding epigenetic and transcriptional differences between melanocytes and melanoma cells will enable further understanding of the genes  pathways  and epigenetic regions influencing melanoma development. We performed RNA seq and ATAC seq on fluorescently isolated melanocytes and melanoma cells from a zebrafish melanoma model. Overall design: RNA seq profiles of FACS isolated mitfa:mCherry reporter positive melanocytes and crestin:GFP positive melanoma cells from adult zebrafish D. rerio.", "parent bioproject:PRJNA741103", "pubmed:34791221", null, "MA3A RNAseq", "GSM5397958", null, "source name:Sorted melanoma tumor|genotype:BRAFV600E/p53lf/lf/crestin:EGFP|tissue:Melanoma", "MA3A RNAseq", "Assess read quality with FastQC Align to GRCz11/danRer11 using STAR Quantify transcriptome using RSEM Normalize reads with DESeq2 Genome build: danRer11 Supplementary files format and content: tab delimited text files with CPM values for each sample Supplementary files format and content: tab delimited text files with RPKM values for each sample Supplementary files format and content: Excel spreadsheet summarizing log2FC values between melanocytes and melanoma cells  as well as", "Sorted melanoma tumor", null, "FACS for fluorescent tag: mCherry for melanocytes MC and GFP for melanoma cells MA  then use Machery Nagel kit to extract total RNA cDNA generated using Clontech SMARTer cDNA amplification kit", null, "genotype:BRAFV600E/p53lf/lf/crestin:EGFP|tissue:Melanoma|run #:1", "GSM5397958", "GSM5397958: MA3A RNAseq; Danio rerio; RNA Seq", "GSM5397958", null, "1", "FACS for fluorescent tag: mCherry for melanocytes MC and GFP for melanoma cells MA  then use Machery Nagel kit to extract total RNA cDNA generated using Clontech SMARTer cDNA amplification kit", "GEO Accession:GSM5397958", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP325444", null, null, "MA3A.fq.gz", "fastq", 1442377200.0, 28847544.0, "GSM5397958 r1", "0:50 1:0", "A:405524842;C:314014451;G:304964281;T:416845768;N:1027858", 50, 0, null, null, 405524842, 314014451, 304964281, 416845768, 1027858, "SRX11217413", "SRS9271512", "SRA1250059", "GEO", "Kaufman, Oncology, Washington University in St. Louis", 1, 0.88956, null, 0.1683, null, 0.74018, null, 0.52927, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "cdna_unspecified", "smarter", "bulk", "unknown", "unknown", null, "United States", "2021-06-24", "Undetermined", "Adult", "Cancer or Tumor", "Cancer or Tumor"], [65016, "SRR14902690", "SRX11217412", "SRS9271511", "SRP325444", "PRJNA741108", "Transcriptional Profile in Zebrafish Melanocytes and Melanoma Tumors [RNA seq]", "GSE178801", "Transcriptome Analysis", "With high genetic heterogeneity in melanoma  understanding epigenetic and transcriptional differences between melanocytes and melanoma cells will enable further understanding of the genes  pathways  and epigenetic regions influencing melanoma development. We performed RNA seq and ATAC seq on fluorescently isolated melanocytes and melanoma cells from a zebrafish melanoma model. Overall design: RNA seq profiles of FACS isolated mitfa:mCherry reporter positive melanocytes and crestin:GFP positive melanoma cells from adult zebrafish D. rerio.", "parent bioproject:PRJNA741103", "pubmed:34791221", null, "MA2 RNAseq", "GSM5397957", null, "source name:Sorted melanoma tumor|genotype:BRAFV600E/p53lf/lf/crestin:EGFP|tissue:Melanoma", "MA2 RNAseq", "Assess read quality with FastQC Align to GRCz11/danRer11 using STAR Quantify transcriptome using RSEM Normalize reads with DESeq2 Genome build: danRer11 Supplementary files format and content: tab delimited text files with CPM values for each sample Supplementary files format and content: tab delimited text files with RPKM values for each sample Supplementary files format and content: Excel spreadsheet summarizing log2FC values between melanocytes and melanoma cells  as well as", "Sorted melanoma tumor", null, "FACS for fluorescent tag: mCherry for melanocytes MC and GFP for melanoma cells MA  then use Machery Nagel kit to extract total RNA cDNA generated using Clontech SMARTer cDNA amplification kit", null, "genotype:BRAFV600E/p53lf/lf/crestin:EGFP|tissue:Melanoma|run #:1", "GSM5397957", "GSM5397957: MA2 RNAseq; Danio rerio; RNA Seq", "GSM5397957", null, "1", "FACS for fluorescent tag: mCherry for melanocytes MC and GFP for melanoma cells MA  then use Machery Nagel kit to extract total RNA cDNA generated using Clontech SMARTer cDNA amplification kit", "GEO Accession:GSM5397957", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP325444", null, null, "MA2.fq.gz", "fastq", 1402279300.0, 28045586.0, "GSM5397957 r1", "0:50 1:0", "A:389166788;C:306462364;G:298729361;T:406923403;N:997384", 50, 0, null, null, 389166788, 306462364, 298729361, 406923403, 997384, "SRX11217412", "SRS9271511", "SRA1250059", "GEO", "Kaufman, Oncology, Washington University in St. Louis", 1, 0.88844, null, 0.14383, null, 0.74923, null, 0.53282, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "cdna_unspecified", "smarter", "bulk", "unknown", "unknown", null, "United States", "2021-06-24", "Undetermined", "Adult", "Cancer or Tumor", "Cancer or Tumor"], [65017, "SRR14902689", "SRX11217411", "SRS9271510", "SRP325444", "PRJNA741108", "Transcriptional Profile in Zebrafish Melanocytes and Melanoma Tumors [RNA seq]", "GSE178801", "Transcriptome Analysis", "With high genetic heterogeneity in melanoma  understanding epigenetic and transcriptional differences between melanocytes and melanoma cells will enable further understanding of the genes  pathways  and epigenetic regions influencing melanoma development. We performed RNA seq and ATAC seq on fluorescently isolated melanocytes and melanoma cells from a zebrafish melanoma model. Overall design: RNA seq profiles of FACS isolated mitfa:mCherry reporter positive melanocytes and crestin:GFP positive melanoma cells from adult zebrafish D. rerio.", "parent bioproject:PRJNA741103", "pubmed:34791221", null, "MA1 RNAseq", "GSM5397956", null, "source name:Sorted melanoma tumor|genotype:BRAFV600E/p53lf/lf/crestin:EGFP|tissue:Melanoma", "MA1 RNAseq", "Assess read quality with FastQC Align to GRCz11/danRer11 using STAR Quantify transcriptome using RSEM Normalize reads with DESeq2 Genome build: danRer11 Supplementary files format and content: tab delimited text files with CPM values for each sample Supplementary files format and content: tab delimited text files with RPKM values for each sample Supplementary files format and content: Excel spreadsheet summarizing log2FC values between melanocytes and melanoma cells  as well as", "Sorted melanoma tumor", null, "FACS for fluorescent tag: mCherry for melanocytes MC and GFP for melanoma cells MA  then use Machery Nagel kit to extract total RNA cDNA generated using Clontech SMARTer cDNA amplification kit", null, "genotype:BRAFV600E/p53lf/lf/crestin:EGFP|tissue:Melanoma|run #:1", "GSM5397956", "GSM5397956: MA1 RNAseq; Danio rerio; RNA Seq", "GSM5397956", null, "1", "FACS for fluorescent tag: mCherry for melanocytes MC and GFP for melanoma cells MA  then use Machery Nagel kit to extract total RNA cDNA generated using Clontech SMARTer cDNA amplification kit", "GEO Accession:GSM5397956", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP325444", null, null, "MA1.fq.gz", "fastq", 1456780700.0, 29135614.0, "GSM5397956 r1", "0:50 1:0", "A:403913103;C:308144749;G:305293739;T:438394612;N:1034497", 50, 0, null, null, 403913103, 308144749, 305293739, 438394612, 1034497, "SRX11217411", "SRS9271510", "SRA1250059", "GEO", "Kaufman, Oncology, Washington University in St. Louis", 1, 0.85833, null, 0.16781, null, 0.73407, null, 0.52469, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "cdna_unspecified", "smarter", "bulk", "unknown", "unknown", null, "United States", "2021-06-24", "Undetermined", "Adult", "Cancer or Tumor", "Cancer or Tumor"], [67037, "SRR17007607", "SRX13197809", "SRS11124869", "SRP347244", "PRJNA782626", "Characterization of zebrafish melanoma derived interstitial EVs and their ncRNA content", "GSE189352", "Transcriptome Analysis", "Extracellular vesicles EVs are membranous particles released by all cell types. Their role as functional carriers of bioactive molecules is boosted in cancer where they can be either secreted in biological fluids or found in the intercellular space interstitial EVs  iEVs. Here we have opti mised a method for the isolation and characterization of zebrafish iEVs from whole melanoma tissues. Zebrafish melanoma iEVs are in the range of  140 nm by nanoparticle tracking analysis NTA and TEM analysis. Western blot revealed enrichment for CD63 and Alix in the iEV frac tion  but not in melanoma cell lysates. Super resolution and confocal microscopy revealed that purified zebrafish iEVs were GFP+ indicating that they integrate the oncogene  GFP HRASV12G within their vesicular membrane.  Analysis of RNA Seq data revealed that 118 ncRNAs are differentially distributed between zebrafish melanoma and their iEVs  with only 18 of them be ing selectively enriched in iEVs. Among these  the RNA components of RNAses MRP and P  which process ribosomal RNA precursors  mitochondrial RNAs and some mRNAs  were enriched in iEVs. We found that melanoma iEVs induce an inflammatory response when injected in larval blood stream with increase of macrophage and induction of Interferon Responsive Genes. To clarify whether MRP and P contribute to the inflammation induced by melanoma iEVs we inject ed larvae with MRP or P RNAs and found an inflammatory response similar to that induced by melanoma iEVs. This suggests that zebrafish melanoma iEVs are a source of MRP and P RNAs that can trigger inflammation in cells of the tumor microenvironment. Overall design: In order to identify small RNAs preferentially accumulated in extracellular vesicles derived from zebrafish melanoma   we performed RNA sequencing analysis RNA Seq  of small RNAs isolated from EVs and melanoma samples.", null, "pubmed:35628321", null, "VA 6 S6: EVs3", "GSM5699732", null, "tissue:EVs3|cell type:extracellular vesicles|strain:kita:RAS", "VA 6 S6: EVs3", "Basecalls performed using CASAVA Illumina Inc. Reads were aligned to the reference genome Danio rerio assembly GRCz11 using STAR [PMID: 23104886] with recommended options and thresholds version 2.5. HTSeq count version 0.9.1 [PMID: 25260700 ] was used to generate raw gene counts. EdgeR package version 3.24.3 [PMID: 19910308] was used to normalize counts to Trimmed Mean of M values TMM for visualization methods. Differential expression analysis was performed using DESeq2 package version 1.22.2 and for significance testing  the Wald test was used. Genome build: GRCz11 Supplementary files format and content: tab delimited text files include COUNTS values for each Sample", "EVs3", null, "RNA extracts were collected from melanoma developing in adult zebrafish or from EVs isolated from the same tumors. Total RNA was isolated using Single Cell RNA Purification Kit Norgen following manufacturer\u2019s instructions  subjected to DNase I Thermo Fisher Scientific treatment and subsequently purified using phenol chloroform Libraries were constructed using Clontech SMARTer smRNA Seq kit. Libraries were sequenced on the Illumina HiSeq 2500 following the manufacturer's protocols.", "Melanomas were induced in developing zebrafish through the Gal4/UAS system  using the kita:Gal4 driver line and the injection of a UAS:HRASV12G plasmid", "cell type:extracellular vesicles|strain:kita:RAS", "GSM5699732", "GSM5699732: VA 6 S6: EVs3; Danio rerio; ncRNA Seq", "GSM5699732 r1", "GSM5699732", "1", "RNA extracts were collected from melanoma developing in adult zebrafish or from EVs isolated from the same tumors. Total RNA was isolated using Single Cell RNA Purification Kit Norgen following manufacturer's instructions  subjected to DNase I Thermo Fisher Scientific treatment and subsequently purified using phenol chloroform Libraries were constructed using Clontech SMARTer smRNA Seq kit. Libraries were sequenced on the Illumina HiSeq 2500 following the manufacturer's protocols.", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP347244", null, "loader:fastq load.py", "VA_6_S6.fastq", "fastq", 1252482921.0, 12400821.0, "GSM5699732 r1", "0:101", "A:419008099;C:291188018;G:325856780;T:216362198;N:67826", 101, null, null, null, 419008099, 291188018, 325856780, 216362198, 67826, "SRX13197809", "SRS11124869", "SRA1429699", "Experimental Cancer Biology, CIBIO, University of Trento", "Experimental Cancer Biology, CIBIO, University of Trento", 1, 0.39065, null, 0.05651, null, 0.9752, null, 0.82248, null, 101, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "size_fractionation", "smarter", "bulk", "unknown", "unknown", null, "Italy", "2021-11-22", "Adult", "Adult", "Cancer or Tumor", "Cancer or Tumor"], [67038, "SRR17007608", "SRX13197808", "SRS11124868", "SRP347244", "PRJNA782626", "Characterization of zebrafish melanoma derived interstitial EVs and their ncRNA content", "GSE189352", "Transcriptome Analysis", "Extracellular vesicles EVs are membranous particles released by all cell types. Their role as functional carriers of bioactive molecules is boosted in cancer where they can be either secreted in biological fluids or found in the intercellular space interstitial EVs  iEVs. Here we have opti mised a method for the isolation and characterization of zebrafish iEVs from whole melanoma tissues. Zebrafish melanoma iEVs are in the range of  140 nm by nanoparticle tracking analysis NTA and TEM analysis. Western blot revealed enrichment for CD63 and Alix in the iEV frac tion  but not in melanoma cell lysates. Super resolution and confocal microscopy revealed that purified zebrafish iEVs were GFP+ indicating that they integrate the oncogene  GFP HRASV12G within their vesicular membrane.  Analysis of RNA Seq data revealed that 118 ncRNAs are differentially distributed between zebrafish melanoma and their iEVs  with only 18 of them be ing selectively enriched in iEVs. Among these  the RNA components of RNAses MRP and P  which process ribosomal RNA precursors  mitochondrial RNAs and some mRNAs  were enriched in iEVs. We found that melanoma iEVs induce an inflammatory response when injected in larval blood stream with increase of macrophage and induction of Interferon Responsive Genes. To clarify whether MRP and P contribute to the inflammation induced by melanoma iEVs we inject ed larvae with MRP or P RNAs and found an inflammatory response similar to that induced by melanoma iEVs. This suggests that zebrafish melanoma iEVs are a source of MRP and P RNAs that can trigger inflammation in cells of the tumor microenvironment. Overall design: In order to identify small RNAs preferentially accumulated in extracellular vesicles derived from zebrafish melanoma   we performed RNA sequencing analysis RNA Seq  of small RNAs isolated from EVs and melanoma samples.", null, "pubmed:35628321", null, "VA 5 S5: EVs2", "GSM5699731", null, "tissue:EVs2|cell type:extracellular vesicles|strain:kita:RAS", "VA 5 S5: EVs2", "Basecalls performed using CASAVA Illumina Inc. Reads were aligned to the reference genome Danio rerio assembly GRCz11 using STAR [PMID: 23104886] with recommended options and thresholds version 2.5. HTSeq count version 0.9.1 [PMID: 25260700 ] was used to generate raw gene counts. EdgeR package version 3.24.3 [PMID: 19910308] was used to normalize counts to Trimmed Mean of M values TMM for visualization methods. Differential expression analysis was performed using DESeq2 package version 1.22.2 and for significance testing  the Wald test was used. Genome build: GRCz11 Supplementary files format and content: tab delimited text files include COUNTS values for each Sample", "EVs2", null, "RNA extracts were collected from melanoma developing in adult zebrafish or from EVs isolated from the same tumors. Total RNA was isolated using Single Cell RNA Purification Kit Norgen following manufacturer\u2019s instructions  subjected to DNase I Thermo Fisher Scientific treatment and subsequently purified using phenol chloroform Libraries were constructed using Clontech SMARTer smRNA Seq kit. Libraries were sequenced on the Illumina HiSeq 2500 following the manufacturer's protocols.", "Melanomas were induced in developing zebrafish through the Gal4/UAS system  using the kita:Gal4 driver line and the injection of a UAS:HRASV12G plasmid", "cell type:extracellular vesicles|strain:kita:RAS", "GSM5699731", "GSM5699731: VA 5 S5: EVs2; Danio rerio; ncRNA Seq", "GSM5699731 r1", "GSM5699731", "1", "RNA extracts were collected from melanoma developing in adult zebrafish or from EVs isolated from the same tumors. Total RNA was isolated using Single Cell RNA Purification Kit Norgen following manufacturer's instructions  subjected to DNase I Thermo Fisher Scientific treatment and subsequently purified using phenol chloroform Libraries were constructed using Clontech SMARTer smRNA Seq kit. Libraries were sequenced on the Illumina HiSeq 2500 following the manufacturer's protocols.", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP347244", null, "loader:fastq load.py", "VA_5_S5.fastq", "fastq", 1338062039.0, 13248139.0, "GSM5699731 r1", "0:101", "A:479478471;C:303639439;G:333339820;T:221533029;N:71280", 101, null, null, null, 479478471, 303639439, 333339820, 221533029, 71280, "SRX13197808", "SRS11124868", "SRA1429699", "Experimental Cancer Biology, CIBIO, University of Trento", "Experimental Cancer Biology, CIBIO, University of Trento", 1, 0.20158, null, 0.0338, null, 0.98979, null, 0.73724, null, 101, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "size_fractionation", "smarter", "bulk", "unknown", "unknown", null, "Italy", "2021-11-22", "Adult", "Adult", "Cancer or Tumor", "Cancer or Tumor"], [67039, "SRR17007609", "SRX13197807", "SRS11124867", "SRP347244", "PRJNA782626", "Characterization of zebrafish melanoma derived interstitial EVs and their ncRNA content", "GSE189352", "Transcriptome Analysis", "Extracellular vesicles EVs are membranous particles released by all cell types. Their role as functional carriers of bioactive molecules is boosted in cancer where they can be either secreted in biological fluids or found in the intercellular space interstitial EVs  iEVs. Here we have opti mised a method for the isolation and characterization of zebrafish iEVs from whole melanoma tissues. Zebrafish melanoma iEVs are in the range of  140 nm by nanoparticle tracking analysis NTA and TEM analysis. Western blot revealed enrichment for CD63 and Alix in the iEV frac tion  but not in melanoma cell lysates. Super resolution and confocal microscopy revealed that purified zebrafish iEVs were GFP+ indicating that they integrate the oncogene  GFP HRASV12G within their vesicular membrane.  Analysis of RNA Seq data revealed that 118 ncRNAs are differentially distributed between zebrafish melanoma and their iEVs  with only 18 of them be ing selectively enriched in iEVs. Among these  the RNA components of RNAses MRP and P  which process ribosomal RNA precursors  mitochondrial RNAs and some mRNAs  were enriched in iEVs. We found that melanoma iEVs induce an inflammatory response when injected in larval blood stream with increase of macrophage and induction of Interferon Responsive Genes. To clarify whether MRP and P contribute to the inflammation induced by melanoma iEVs we inject ed larvae with MRP or P RNAs and found an inflammatory response similar to that induced by melanoma iEVs. This suggests that zebrafish melanoma iEVs are a source of MRP and P RNAs that can trigger inflammation in cells of the tumor microenvironment. Overall design: In order to identify small RNAs preferentially accumulated in extracellular vesicles derived from zebrafish melanoma   we performed RNA sequencing analysis RNA Seq  of small RNAs isolated from EVs and melanoma samples.", null, "pubmed:35628321", null, "VA 4 S4: EVs1", "GSM5699730", null, "tissue:EVs1|cell type:extracellular vesicles|strain:kita:RAS", "VA 4 S4: EVs1", "Basecalls performed using CASAVA Illumina Inc. Reads were aligned to the reference genome Danio rerio assembly GRCz11 using STAR [PMID: 23104886] with recommended options and thresholds version 2.5. HTSeq count version 0.9.1 [PMID: 25260700 ] was used to generate raw gene counts. EdgeR package version 3.24.3 [PMID: 19910308] was used to normalize counts to Trimmed Mean of M values TMM for visualization methods. Differential expression analysis was performed using DESeq2 package version 1.22.2 and for significance testing  the Wald test was used. Genome build: GRCz11 Supplementary files format and content: tab delimited text files include COUNTS values for each Sample", "EVs1", null, "RNA extracts were collected from melanoma developing in adult zebrafish or from EVs isolated from the same tumors. Total RNA was isolated using Single Cell RNA Purification Kit Norgen following manufacturer\u2019s instructions  subjected to DNase I Thermo Fisher Scientific treatment and subsequently purified using phenol chloroform Libraries were constructed using Clontech SMARTer smRNA Seq kit. Libraries were sequenced on the Illumina HiSeq 2500 following the manufacturer's protocols.", "Melanomas were induced in developing zebrafish through the Gal4/UAS system  using the kita:Gal4 driver line and the injection of a UAS:HRASV12G plasmid", "cell type:extracellular vesicles|strain:kita:RAS", "GSM5699730", "GSM5699730: VA 4 S4: EVs1; Danio rerio; ncRNA Seq", "GSM5699730 r1", "GSM5699730", "1", "RNA extracts were collected from melanoma developing in adult zebrafish or from EVs isolated from the same tumors. Total RNA was isolated using Single Cell RNA Purification Kit Norgen following manufacturer's instructions  subjected to DNase I Thermo Fisher Scientific treatment and subsequently purified using phenol chloroform Libraries were constructed using Clontech SMARTer smRNA Seq kit. Libraries were sequenced on the Illumina HiSeq 2500 following the manufacturer's protocols.", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP347244", null, "loader:fastq load.py", "VA_4_S4.fastq", "fastq", 1355391215.0, 13419715.0, "GSM5699730 r1", "0:101", "A:480538643;C:302531816;G:333018117;T:239227931;N:74708", 101, null, null, null, 480538643, 302531816, 333018117, 239227931, 74708, "SRX13197807", "SRS11124867", "SRA1429699", "Experimental Cancer Biology, CIBIO, University of Trento", "Experimental Cancer Biology, CIBIO, University of Trento", 1, 0.15363, null, 0.03047, null, 0.98563, null, 0.85818, null, 101, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "size_fractionation", "smarter", "bulk", "unknown", "unknown", null, "Italy", "2021-11-22", "Adult", "Adult", "Cancer or Tumor", "Cancer or Tumor"], [67040, "SRR17007610", "SRX13197806", "SRS11124866", "SRP347244", "PRJNA782626", "Characterization of zebrafish melanoma derived interstitial EVs and their ncRNA content", "GSE189352", "Transcriptome Analysis", "Extracellular vesicles EVs are membranous particles released by all cell types. Their role as functional carriers of bioactive molecules is boosted in cancer where they can be either secreted in biological fluids or found in the intercellular space interstitial EVs  iEVs. Here we have opti mised a method for the isolation and characterization of zebrafish iEVs from whole melanoma tissues. Zebrafish melanoma iEVs are in the range of  140 nm by nanoparticle tracking analysis NTA and TEM analysis. Western blot revealed enrichment for CD63 and Alix in the iEV frac tion  but not in melanoma cell lysates. Super resolution and confocal microscopy revealed that purified zebrafish iEVs were GFP+ indicating that they integrate the oncogene  GFP HRASV12G within their vesicular membrane.  Analysis of RNA Seq data revealed that 118 ncRNAs are differentially distributed between zebrafish melanoma and their iEVs  with only 18 of them be ing selectively enriched in iEVs. Among these  the RNA components of RNAses MRP and P  which process ribosomal RNA precursors  mitochondrial RNAs and some mRNAs  were enriched in iEVs. We found that melanoma iEVs induce an inflammatory response when injected in larval blood stream with increase of macrophage and induction of Interferon Responsive Genes. To clarify whether MRP and P contribute to the inflammation induced by melanoma iEVs we inject ed larvae with MRP or P RNAs and found an inflammatory response similar to that induced by melanoma iEVs. This suggests that zebrafish melanoma iEVs are a source of MRP and P RNAs that can trigger inflammation in cells of the tumor microenvironment. Overall design: In order to identify small RNAs preferentially accumulated in extracellular vesicles derived from zebrafish melanoma   we performed RNA sequencing analysis RNA Seq  of small RNAs isolated from EVs and melanoma samples.", null, "pubmed:35628321", null, "VA 24 S14: Melanoma3", "GSM5699729", null, "tissue:Melanoma3|cell type:Melanocytes|strain:kita:RAS", "VA 24 S14: Melanoma3", "Basecalls performed using CASAVA Illumina Inc. Reads were aligned to the reference genome Danio rerio assembly GRCz11 using STAR [PMID: 23104886] with recommended options and thresholds version 2.5. HTSeq count version 0.9.1 [PMID: 25260700 ] was used to generate raw gene counts. EdgeR package version 3.24.3 [PMID: 19910308] was used to normalize counts to Trimmed Mean of M values TMM for visualization methods. Differential expression analysis was performed using DESeq2 package version 1.22.2 and for significance testing  the Wald test was used. Genome build: GRCz11 Supplementary files format and content: tab delimited text files include COUNTS values for each Sample", "Melanoma3", null, "RNA extracts were collected from melanoma developing in adult zebrafish or from EVs isolated from the same tumors. Total RNA was isolated using Single Cell RNA Purification Kit Norgen following manufacturer\u2019s instructions  subjected to DNase I Thermo Fisher Scientific treatment and subsequently purified using phenol chloroform Libraries were constructed using Clontech SMARTer smRNA Seq kit. Libraries were sequenced on the Illumina HiSeq 2500 following the manufacturer's protocols.", "Melanomas were induced in developing zebrafish through the Gal4/UAS system  using the kita:Gal4 driver line and the injection of a UAS:HRASV12G plasmid", "cell type:Melanocytes|strain:kita:RAS", "GSM5699729", "GSM5699729: VA 24 S14: Melanoma3; Danio rerio; ncRNA Seq", "GSM5699729 r1", "GSM5699729", "1", "RNA extracts were collected from melanoma developing in adult zebrafish or from EVs isolated from the same tumors. Total RNA was isolated using Single Cell RNA Purification Kit Norgen following manufacturer's instructions  subjected to DNase I Thermo Fisher Scientific treatment and subsequently purified using phenol chloroform Libraries were constructed using Clontech SMARTer smRNA Seq kit. Libraries were sequenced on the Illumina HiSeq 2500 following the manufacturer's protocols.", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP347244", null, "loader:fastq load.py", "VA_24_S14.fastq", "fastq", 1029043954.0, 10188554.0, "GSM5699729 r1", "0:101", "A:385266918;C:235984418;G:223100119;T:184638731;N:53768", 101, null, null, null, 385266918, 235984418, 223100119, 184638731, 53768, "SRX13197806", "SRS11124866", "SRA1429699", "Experimental Cancer Biology, CIBIO, University of Trento", "Experimental Cancer Biology, CIBIO, University of Trento", 1, 0.31444, null, 0.04431, null, 0.97477, null, 0.79077, null, 101, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "size_fractionation", "smarter", "bulk", "unknown", "unknown", null, "Italy", "2021-11-22", "Adult", "Adult", "Cancer or Tumor", "Cancer or Tumor"], [67041, "SRR17007611", "SRX13197805", "SRS11124865", "SRP347244", "PRJNA782626", "Characterization of zebrafish melanoma derived interstitial EVs and their ncRNA content", "GSE189352", "Transcriptome Analysis", "Extracellular vesicles EVs are membranous particles released by all cell types. Their role as functional carriers of bioactive molecules is boosted in cancer where they can be either secreted in biological fluids or found in the intercellular space interstitial EVs  iEVs. Here we have opti mised a method for the isolation and characterization of zebrafish iEVs from whole melanoma tissues. Zebrafish melanoma iEVs are in the range of  140 nm by nanoparticle tracking analysis NTA and TEM analysis. Western blot revealed enrichment for CD63 and Alix in the iEV frac tion  but not in melanoma cell lysates. Super resolution and confocal microscopy revealed that purified zebrafish iEVs were GFP+ indicating that they integrate the oncogene  GFP HRASV12G within their vesicular membrane.  Analysis of RNA Seq data revealed that 118 ncRNAs are differentially distributed between zebrafish melanoma and their iEVs  with only 18 of them be ing selectively enriched in iEVs. Among these  the RNA components of RNAses MRP and P  which process ribosomal RNA precursors  mitochondrial RNAs and some mRNAs  were enriched in iEVs. We found that melanoma iEVs induce an inflammatory response when injected in larval blood stream with increase of macrophage and induction of Interferon Responsive Genes. To clarify whether MRP and P contribute to the inflammation induced by melanoma iEVs we inject ed larvae with MRP or P RNAs and found an inflammatory response similar to that induced by melanoma iEVs. This suggests that zebrafish melanoma iEVs are a source of MRP and P RNAs that can trigger inflammation in cells of the tumor microenvironment. Overall design: In order to identify small RNAs preferentially accumulated in extracellular vesicles derived from zebrafish melanoma   we performed RNA sequencing analysis RNA Seq  of small RNAs isolated from EVs and melanoma samples.", null, "pubmed:35628321", null, "VA 23 S13: Melanoma2", "GSM5699728", null, "tissue:Melanoma2|cell type:Melanocytes|strain:kita:RAS", "VA 23 S13: Melanoma2", "Basecalls performed using CASAVA Illumina Inc. Reads were aligned to the reference genome Danio rerio assembly GRCz11 using STAR [PMID: 23104886] with recommended options and thresholds version 2.5. HTSeq count version 0.9.1 [PMID: 25260700 ] was used to generate raw gene counts. EdgeR package version 3.24.3 [PMID: 19910308] was used to normalize counts to Trimmed Mean of M values TMM for visualization methods. Differential expression analysis was performed using DESeq2 package version 1.22.2 and for significance testing  the Wald test was used. Genome build: GRCz11 Supplementary files format and content: tab delimited text files include COUNTS values for each Sample", "Melanoma2", null, "RNA extracts were collected from melanoma developing in adult zebrafish or from EVs isolated from the same tumors. Total RNA was isolated using Single Cell RNA Purification Kit Norgen following manufacturer\u2019s instructions  subjected to DNase I Thermo Fisher Scientific treatment and subsequently purified using phenol chloroform Libraries were constructed using Clontech SMARTer smRNA Seq kit. Libraries were sequenced on the Illumina HiSeq 2500 following the manufacturer's protocols.", "Melanomas were induced in developing zebrafish through the Gal4/UAS system  using the kita:Gal4 driver line and the injection of a UAS:HRASV12G plasmid", "cell type:Melanocytes|strain:kita:RAS", "GSM5699728", "GSM5699728: VA 23 S13: Melanoma2; Danio rerio; ncRNA Seq", "GSM5699728 r1", "GSM5699728", "1", "RNA extracts were collected from melanoma developing in adult zebrafish or from EVs isolated from the same tumors. Total RNA was isolated using Single Cell RNA Purification Kit Norgen following manufacturer's instructions  subjected to DNase I Thermo Fisher Scientific treatment and subsequently purified using phenol chloroform Libraries were constructed using Clontech SMARTer smRNA Seq kit. Libraries were sequenced on the Illumina HiSeq 2500 following the manufacturer's protocols.", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP347244", null, "loader:fastq load.py", "VA_23_S13.fastq", "fastq", 1191776669.0, 11799769.0, "GSM5699728 r1", "0:101", "A:445740725;C:275311735;G:268819689;T:201841457;N:63063", 101, null, null, null, 445740725, 275311735, 268819689, 201841457, 63063, "SRX13197805", "SRS11124865", "SRA1429699", "Experimental Cancer Biology, CIBIO, University of Trento", "Experimental Cancer Biology, CIBIO, University of Trento", 1, 0.3168, null, 0.04419, null, 0.96978, null, 0.837, null, 101, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "size_fractionation", "smarter", "bulk", "unknown", "unknown", null, "Italy", "2021-11-22", "Adult", "Adult", "Cancer or Tumor", "Cancer or Tumor"], [67042, "SRR17007612", "SRX13197804", "SRS11124864", "SRP347244", "PRJNA782626", "Characterization of zebrafish melanoma derived interstitial EVs and their ncRNA content", "GSE189352", "Transcriptome Analysis", "Extracellular vesicles EVs are membranous particles released by all cell types. Their role as functional carriers of bioactive molecules is boosted in cancer where they can be either secreted in biological fluids or found in the intercellular space interstitial EVs  iEVs. Here we have opti mised a method for the isolation and characterization of zebrafish iEVs from whole melanoma tissues. Zebrafish melanoma iEVs are in the range of  140 nm by nanoparticle tracking analysis NTA and TEM analysis. Western blot revealed enrichment for CD63 and Alix in the iEV frac tion  but not in melanoma cell lysates. Super resolution and confocal microscopy revealed that purified zebrafish iEVs were GFP+ indicating that they integrate the oncogene  GFP HRASV12G within their vesicular membrane.  Analysis of RNA Seq data revealed that 118 ncRNAs are differentially distributed between zebrafish melanoma and their iEVs  with only 18 of them be ing selectively enriched in iEVs. Among these  the RNA components of RNAses MRP and P  which process ribosomal RNA precursors  mitochondrial RNAs and some mRNAs  were enriched in iEVs. We found that melanoma iEVs induce an inflammatory response when injected in larval blood stream with increase of macrophage and induction of Interferon Responsive Genes. To clarify whether MRP and P contribute to the inflammation induced by melanoma iEVs we inject ed larvae with MRP or P RNAs and found an inflammatory response similar to that induced by melanoma iEVs. This suggests that zebrafish melanoma iEVs are a source of MRP and P RNAs that can trigger inflammation in cells of the tumor microenvironment. Overall design: In order to identify small RNAs preferentially accumulated in extracellular vesicles derived from zebrafish melanoma   we performed RNA sequencing analysis RNA Seq  of small RNAs isolated from EVs and melanoma samples.", null, "pubmed:35628321", null, "VA 22 S12: Melanoma1", "GSM5699727", null, "tissue:Melanoma1|cell type:Melanocytes|strain:Kita:RAS", "VA 22 S12: Melanoma1", "Basecalls performed using CASAVA Illumina Inc. Reads were aligned to the reference genome Danio rerio assembly GRCz11 using STAR [PMID: 23104886] with recommended options and thresholds version 2.5. HTSeq count version 0.9.1 [PMID: 25260700 ] was used to generate raw gene counts. EdgeR package version 3.24.3 [PMID: 19910308] was used to normalize counts to Trimmed Mean of M values TMM for visualization methods. Differential expression analysis was performed using DESeq2 package version 1.22.2 and for significance testing  the Wald test was used. Genome build: GRCz11 Supplementary files format and content: tab delimited text files include COUNTS values for each Sample", "Melanoma1", null, "RNA extracts were collected from melanoma developing in adult zebrafish or from EVs isolated from the same tumors. Total RNA was isolated using Single Cell RNA Purification Kit Norgen following manufacturer\u2019s instructions  subjected to DNase I Thermo Fisher Scientific treatment and subsequently purified using phenol chloroform Libraries were constructed using Clontech SMARTer smRNA Seq kit. Libraries were sequenced on the Illumina HiSeq 2500 following the manufacturer's protocols.", "Melanomas were induced in developing zebrafish through the Gal4/UAS system  using the kita:Gal4 driver line and the injection of a UAS:HRASV12G plasmid", "cell type:Melanocytes|strain:Kita:RAS", "GSM5699727", "GSM5699727: VA 22 S12: Melanoma1; Danio rerio; ncRNA Seq", "GSM5699727 r1", "GSM5699727", "1", "RNA extracts were collected from melanoma developing in adult zebrafish or from EVs isolated from the same tumors. Total RNA was isolated using Single Cell RNA Purification Kit Norgen following manufacturer's instructions  subjected to DNase I Thermo Fisher Scientific treatment and subsequently purified using phenol chloroform Libraries were constructed using Clontech SMARTer smRNA Seq kit. Libraries were sequenced on the Illumina HiSeq 2500 following the manufacturer's protocols.", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP347244", null, "loader:fastq load.py", "VA_22_S12.fastq", "fastq", 849183861.0, 8407761.0, "GSM5699727 r1", "0:101", "A:315648935;C:198401378;G:181384813;T:153698818;N:49917", 101, null, null, null, 315648935, 198401378, 181384813, 153698818, 49917, "SRX13197804", "SRS11124864", "SRA1429699", "Experimental Cancer Biology, CIBIO, University of Trento", "Experimental Cancer Biology, CIBIO, University of Trento", 1, 0.37018, null, 0.04901, null, 0.96209, null, 0.55085, null, 101, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "full_length", "size_fractionation", "smarter", "bulk", "unknown", "unknown", null, "Italy", "2021-11-22", "Adult", "Adult", "Cancer or Tumor", "Cancer or Tumor"], [67620, "SRR17219949", "SRX13399948", "SRS11303068", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qp skin tumor 4", "GSM5732243", null, "source name:Qp skin tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor", "Qp skin tumor 4", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qp skin tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor", "GSM5732243", "GSM5732243: Qp skin tumor 4; Danio rerio; RNA Seq", "GSM5732243", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732243", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101283.fastq.gz", "fastq", 122886760.0, 3072169.0, "GSM5732243 r1", "0:40", "A:41729821;C:25705614;G:27345231;T:28036062;N:70032", 40, null, null, null, 41729821, 25705614, 27345231, 28036062, 70032, "SRX13399948", "SRS11303068", "SRA1343073", "GEO", "Koch Institute", 1, 0.82784, null, 0.32837, null, 0.87756, null, 0.66545, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67621, "SRR17219947", "SRX13399947", "SRS11303067", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qp skin tumor 3", "GSM5732242", null, "source name:Qp skin tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor", "Qp skin tumor 3", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qp skin tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor", "GSM5732242", "GSM5732242: Qp skin tumor 3; Danio rerio; RNA Seq", "GSM5732242", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732242", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101282.fastq.gz", "fastq", 283770840.0, 7094271.0, "GSM5732242 r1", "0:40", "A:98647149;C:57235772;G:60084594;T:67639169;N:164156", 40, null, null, null, 98647149, 57235772, 60084594, 67639169, 164156, "SRX13399947", "SRS11303067", "SRA1343073", "GEO", "Koch Institute", 1, 0.82456, null, 0.20326, null, 0.87194, null, 0.65575, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67622, "SRR17219945", "SRX13399946", "SRS11303065", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qp skin tumor 2", "GSM5732241", null, "source name:Qp skin tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor", "Qp skin tumor 2", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qp skin tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor", "GSM5732241", "GSM5732241: Qp skin tumor 2; Danio rerio; RNA Seq", "GSM5732241", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732241", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101281.fastq.gz", "fastq", 187440520.0, 4686013.0, "GSM5732241 r1", "0:40", "A:64031749;C:38508754;G:39411330;T:45381562;N:107125", 40, null, null, null, 64031749, 38508754, 39411330, 45381562, 107125, "SRX13399946", "SRS11303065", "SRA1343073", "GEO", "Koch Institute", 1, 0.8171, null, 0.15628, null, 0.85593, null, 0.5865, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67623, "SRR17219943", "SRX13399945", "SRS11303066", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qp skin tumor 1", "GSM5732240", null, "source name:Qp skin tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor", "Qp skin tumor 1", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qp skin tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor", "GSM5732240", "GSM5732240: Qp skin tumor 1; Danio rerio; RNA Seq", "GSM5732240", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732240", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101280.fastq.gz", "fastq", 118902800.0, 2972570.0, "GSM5732240 r1", "0:40", "A:41431989;C:24163332;G:24495495;T:28744442;N:67542", 40, null, null, null, 41431989, 24163332, 24495495, 28744442, 67542, "SRX13399945", "SRS11303066", "SRA1343073", "GEO", "Koch Institute", 1, 0.82006, null, 0.15984, null, 0.8604, null, 0.56292, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67624, "SRR17219941", "SRX13399944", "SRS11303064", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qp eye tumor 8", "GSM5732239", null, "source name:Qp eye tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor", "Qp eye tumor 8", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qp eye tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor", "GSM5732239", "GSM5732239: Qp eye tumor 8; Danio rerio; RNA Seq", "GSM5732239", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732239", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101279.fastq.gz", "fastq", 146962160.0, 3674054.0, "GSM5732239 r1", "0:40", "A:50428551;C:30417822;G:31827580;T:34204334;N:83873", 40, null, null, null, 50428551, 30417822, 31827580, 34204334, 83873, "SRX13399944", "SRS11303064", "SRA1343073", "GEO", "Koch Institute", 1, 0.80609, null, 0.25781, null, 0.85583, null, 0.63728, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67625, "SRR17219939", "SRX13399943", "SRS11303063", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qp eye tumor 7", "GSM5732238", null, "source name:Qp eye tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor", "Qp eye tumor 7", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qp eye tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor", "GSM5732238", "GSM5732238: Qp eye tumor 7; Danio rerio; RNA Seq", "GSM5732238", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732238", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101278.fastq.gz", "fastq", 215250880.0, 5381272.0, "GSM5732238 r1", "0:40", "A:75096682;C:43785266;G:46300057;T:49947139;N:121736", 40, null, null, null, 75096682, 43785266, 46300057, 49947139, 121736, "SRX13399943", "SRS11303063", "SRA1343073", "GEO", "Koch Institute", 1, 0.81371, null, 0.25397, null, 0.85815, null, 0.65296, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67626, "SRR17219937", "SRX13399942", "SRS11303062", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qp eye tumor 6", "GSM5732237", null, "source name:Qp eye tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor", "Qp eye tumor 6", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qp eye tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor", "GSM5732237", "GSM5732237: Qp eye tumor 6; Danio rerio; RNA Seq", "GSM5732237", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732237", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101277.fastq.gz", "fastq", 148936240.0, 3723406.0, "GSM5732237 r1", "0:40", "A:49984372;C:31061474;G:32793566;T:35009887;N:86941", 40, null, null, null, 49984372, 31061474, 32793566, 35009887, 86941, "SRX13399942", "SRS11303062", "SRA1343073", "GEO", "Koch Institute", 1, 0.82112, null, 0.28545, null, 0.85527, null, 0.64027, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67627, "SRR17219935", "SRX13399941", "SRS11303061", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qp eye tumor 5", "GSM5732236", null, "source name:Qp eye tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor", "Qp eye tumor 5", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qp eye tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor", "GSM5732236", "GSM5732236: Qp eye tumor 5; Danio rerio; RNA Seq", "GSM5732236", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732236", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101276.fastq.gz", "fastq", 54051040.0, 1351276.0, "GSM5732236 r1", "0:40", "A:18297537;C:11096954;G:11777149;T:12846946;N:32454", 40, null, null, null, 18297537, 11096954, 11777149, 12846946, 32454, "SRX13399941", "SRS11303061", "SRA1343073", "GEO", "Koch Institute", 1, 0.81006, null, 0.30042, null, 0.85072, null, 0.63453, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67628, "SRR17219977", "SRX13399940", "SRS11303060", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Bp tumor 9", "GSM5732257", null, "source name:Bp tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor", "Bp tumor 9", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Bp tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor", "GSM5732257", "GSM5732257: Bp tumor 9; Danio rerio; RNA Seq", "GSM5732257", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732257", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101299.fastq.gz", "fastq", 210377040.0, 5259426.0, "GSM5732257 r1", "0:40", "A:74755471;C:40672211;G:42048467;T:52783767;N:117124", 40, null, null, null, 74755471, 40672211, 42048467, 52783767, 117124, "SRX13399940", "SRS11303060", "SRA1343073", "GEO", "Koch Institute", 1, 0.81918, null, 0.19474, null, 0.84352, null, 0.58427, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67629, "SRR17219975", "SRX13399939", "SRS11303059", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Bp tumor 8", "GSM5732256", null, "source name:Bp tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor", "Bp tumor 8", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Bp tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor", "GSM5732256", "GSM5732256: Bp tumor 8; Danio rerio; RNA Seq", "GSM5732256", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732256", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101298.fastq.gz", "fastq", 61311760.0, 1532794.0, "GSM5732256 r1", "0:40", "A:21165931;C:12861878;G:13049767;T:14199958;N:34226", 40, null, null, null, 21165931, 12861878, 13049767, 14199958, 34226, "SRX13399939", "SRS11303059", "SRA1343073", "GEO", "Koch Institute", 1, 0.82689, null, 0.32586, null, 0.8829, null, 0.64682, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67630, "SRR17219973", "SRX13399938", "SRS11303057", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Bp tumor 7", "GSM5732255", null, "source name:Bp tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor", "Bp tumor 7", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Bp tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor", "GSM5732255", "GSM5732255: Bp tumor 7; Danio rerio; RNA Seq", "GSM5732255", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732255", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101297.fastq.gz", "fastq", 77653280.0, 1941332.0, "GSM5732255 r1", "0:40", "A:25595564;C:16454184;G:17705274;T:17852242;N:46016", 40, null, null, null, 25595564, 16454184, 17705274, 17852242, 46016, "SRX13399938", "SRS11303057", "SRA1343073", "GEO", "Koch Institute", 1, 0.82555, null, 0.35244, null, 0.87414, null, 0.64795, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67631, "SRR17219971", "SRX13399937", "SRS11303056", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Bp tumor 6", "GSM5732254", null, "source name:Bp tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor", "Bp tumor 6", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Bp tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor", "GSM5732254", "GSM5732254: Bp tumor 6; Danio rerio; RNA Seq", "GSM5732254", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732254", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101296.fastq.gz", "fastq", 153995840.0, 3849896.0, "GSM5732254 r1", "0:40", "A:54845937;C:30246084;G:30853649;T:37960198;N:89972", 40, null, null, null, 54845937, 30246084, 30853649, 37960198, 89972, "SRX13399937", "SRS11303056", "SRA1343073", "GEO", "Koch Institute", 1, 0.81951, null, 0.24749, null, 0.85492, null, 0.63444, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67632, "SRR17219969", "SRX13399936", "SRS11303058", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Bp tumor 5", "GSM5732253", null, "source name:Bp tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor", "Bp tumor 5", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Bp tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor", "GSM5732253", "GSM5732253: Bp tumor 5; Danio rerio; RNA Seq", "GSM5732253", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732253", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101295.fastq.gz", "fastq", 145077520.0, 3626938.0, "GSM5732253 r1", "0:40", "A:50896676;C:28947088;G:29778646;T:35373335;N:81775", 40, null, null, null, 50896676, 28947088, 29778646, 35373335, 81775, "SRX13399936", "SRS11303058", "SRA1343073", "GEO", "Koch Institute", 1, 0.83261, null, 0.15352, null, 0.8714, null, 0.66861, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67633, "SRR17219967", "SRX13399935", "SRS11303055", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Bp tumor 4", "GSM5732252", null, "source name:Bp tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor", "Bp tumor 4", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Bp tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor", "GSM5732252", "GSM5732252: Bp tumor 4; Danio rerio; RNA Seq", "GSM5732252", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732252", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101294.fastq.gz", "fastq", 164977400.0, 4124435.0, "GSM5732252 r1", "0:40", "A:56984652;C:35127348;G:35228728;T:37543026;N:93646", 40, null, null, null, 56984652, 35127348, 35228728, 37543026, 93646, "SRX13399935", "SRS11303055", "SRA1343073", "GEO", "Koch Institute", 1, 0.8376, null, 0.16272, null, 0.8871, null, 0.60385, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67634, "SRR17219933", "SRX13399934", "SRS11303054", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qp eye tumor 4", "GSM5732235", null, "source name:Qp eye tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor", "Qp eye tumor 4", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qp eye tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor", "GSM5732235", "GSM5732235: Qp eye tumor 4; Danio rerio; RNA Seq", "GSM5732235", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732235", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101275.fastq.gz", "fastq", 69014880.0, 1725372.0, "GSM5732235 r1", "0:40", "A:23878875;C:13623172;G:14194689;T:17279107;N:39037", 40, null, null, null, 23878875, 13623172, 14194689, 17279107, 39037, "SRX13399934", "SRS11303054", "SRA1343073", "GEO", "Koch Institute", 1, 0.80282, null, 0.22626, null, 0.83489, null, 0.6254, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67635, "SRR17219931", "SRX13399933", "SRS11303053", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qp eye tumor 3", "GSM5732234", null, "source name:Qp eye tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor", "Qp eye tumor 3", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qp eye tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor", "GSM5732234", "GSM5732234: Qp eye tumor 3; Danio rerio; RNA Seq", "GSM5732234", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732234", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101274.fastq.gz", "fastq", 85565720.0, 2139143.0, "GSM5732234 r1", "0:40", "A:30643576;C:16725788;G:16483878;T:21663657;N:48821", 40, null, null, null, 30643576, 16725788, 16483878, 21663657, 48821, "SRX13399933", "SRS11303053", "SRA1343073", "GEO", "Koch Institute", 1, 0.80932, null, 0.18194, null, 0.84952, null, 0.59231, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67636, "SRR17219929", "SRX13399932", "SRS11303052", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qp eye tumor 2", "GSM5732233", null, "source name:Qp eye tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor", "Qp eye tumor 2", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qp eye tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor", "GSM5732233", "GSM5732233: Qp eye tumor 2; Danio rerio; RNA Seq", "GSM5732233", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732233", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101273.fastq.gz", "fastq", 49625960.0, 1240649.0, "GSM5732233 r1", "0:40", "A:16689341;C:10162844;G:10888880;T:11856436;N:28459", 40, null, null, null, 16689341, 10162844, 10888880, 11856436, 28459, "SRX13399932", "SRS11303052", "SRA1343073", "GEO", "Koch Institute", 1, 0.81618, null, 0.26509, null, 0.84827, null, 0.65117, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67637, "SRR17219927", "SRX13399931", "SRS11303050", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qp eye tumor 1", "GSM5732232", null, "source name:Qp eye tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor", "Qp eye tumor 1", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qp eye tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor", "GSM5732232", "GSM5732232: Qp eye tumor 1; Danio rerio; RNA Seq", "GSM5732232", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732232", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101272.fastq.gz", "fastq", 73671880.0, 1841797.0, "GSM5732232 r1", "0:40", "A:26063623;C:14422230;G:14515642;T:18627765;N:42620", 40, null, null, null, 26063623, 14422230, 14515642, 18627765, 42620, "SRX13399931", "SRS11303050", "SRA1343073", "GEO", "Koch Institute", 1, 0.80786, null, 0.21001, null, 0.84938, null, 0.6324, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67638, "SRR17219925", "SRX13399930", "SRS11303051", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qm tumor 10", "GSM5732231", null, "source name:Qm tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor", "Qm tumor 10", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qm tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor", "GSM5732231", "GSM5732231: Qm tumor 10; Danio rerio; RNA Seq", "GSM5732231", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732231", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101271.fastq.gz", "fastq", 101188800.0, 2529720.0, "GSM5732231 r1", "0:40", "A:35586693;C:19763784;G:20181202;T:25598600;N:58521", 40, null, null, null, 35586693, 19763784, 20181202, 25598600, 58521, "SRX13399930", "SRS11303051", "SRA1343073", "GEO", "Koch Institute", 1, 0.80571, null, 0.20498, null, 0.84273, null, 0.61432, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67639, "SRR17219923", "SRX13399929", "SRS11303049", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qm tumor 9", "GSM5732230", null, "source name:Qm tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor", "Qm tumor 9", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qm tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor", "GSM5732230", "GSM5732230: Qm tumor 9; Danio rerio; RNA Seq", "GSM5732230", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732230", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101270.fastq.gz", "fastq", 116338960.0, 2908474.0, "GSM5732230 r1", "0:40", "A:40934240;C:23631257;G:23574658;T:28131114;N:67691", 40, null, null, null, 40934240, 23631257, 23574658, 28131114, 67691, "SRX13399929", "SRS11303049", "SRA1343073", "GEO", "Koch Institute", 1, 0.8118, null, 0.18354, null, 0.85354, null, 0.60389, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67640, "SRR17219921", "SRX13399928", "SRS11303048", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qm tumor 8", "GSM5732229", null, "source name:Qm tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor", "Qm tumor 8", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qm tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor", "GSM5732229", "GSM5732229: Qm tumor 8; Danio rerio; RNA Seq", "GSM5732229", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732229", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101269.fastq.gz", "fastq", 113227280.0, 2830682.0, "GSM5732229 r1", "0:40", "A:38328913;C:23480607;G:24489533;T:26864215;N:64012", 40, null, null, null, 38328913, 23480607, 24489533, 26864215, 64012, "SRX13399928", "SRS11303048", "SRA1343073", "GEO", "Koch Institute", 1, 0.82097, null, 0.20002, null, 0.85904, null, 0.65238, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67641, "SRR17219919", "SRX13399927", "SRS11303047", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qm tumor 7", "GSM5732228", null, "source name:Qm tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor", "Qm tumor 7", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qm tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor", "GSM5732228", "GSM5732228: Qm tumor 7; Danio rerio; RNA Seq", "GSM5732228", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732228", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101268.fastq.gz", "fastq", 104497160.0, 2612429.0, "GSM5732228 r1", "0:40", "A:35306615;C:21368264;G:22765419;T:24995701;N:61161", 40, null, null, null, 35306615, 21368264, 22765419, 24995701, 61161, "SRX13399927", "SRS11303047", "SRA1343073", "GEO", "Koch Institute", 1, 0.82081, null, 0.20118, null, 0.85082, null, 0.60839, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67642, "SRR17219965", "SRX13399926", "SRS11303046", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Bp tumor 3", "GSM5732251", null, "source name:Bp tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor", "Bp tumor 3", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Bp tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor", "GSM5732251", "GSM5732251: Bp tumor 3; Danio rerio; RNA Seq", "GSM5732251", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732251", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101293.fastq.gz", "fastq", 160349920.0, 4008748.0, "GSM5732251 r1", "0:40", "A:52636356;C:34485561;G:37062014;T:36075665;N:90324", 40, null, null, null, 52636356, 34485561, 37062014, 36075665, 90324, "SRX13399926", "SRS11303046", "SRA1343073", "GEO", "Koch Institute", 1, 0.83192, null, 0.18947, null, 0.86645, null, 0.63435, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67643, "SRR17219963", "SRX13399925", "SRS11303045", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Bp tumor 2", "GSM5732250", null, "source name:Bp tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor", "Bp tumor 2", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Bp tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor", "GSM5732250", "GSM5732250: Bp tumor 2; Danio rerio; RNA Seq", "GSM5732250", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732250", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101291.fastq.gz", "fastq", 86530240.0, 2163256.0, "GSM5732250 r1", "0:40", "A:28567808;C:18531588;G:20031608;T:19348376;N:50860", 40, null, null, null, 28567808, 18531588, 20031608, 19348376, 50860, "SRX13399925", "SRS11303045", "SRA1343073", "GEO", "Koch Institute", 1, 0.8305, null, 0.33333, null, 0.89286, null, 0.68581, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67644, "SRR17219961", "SRX13399924", "SRS11303044", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Bp tumor 1", "GSM5732249", null, "source name:Bp tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor", "Bp tumor 1", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Bp tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor", "GSM5732249", "GSM5732249: Bp tumor 1; Danio rerio; RNA Seq", "GSM5732249", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732249", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101290.fastq.gz", "fastq", 129363640.0, 3234091.0, "GSM5732249 r1", "0:40", "A:44511787;C:27719005;G:28065443;T:28993522;N:73883", 40, null, null, null, 44511787, 27719005, 28065443, 28993522, 73883, "SRX13399924", "SRS11303044", "SRA1343073", "GEO", "Koch Institute", 1, 0.83185, null, 0.31848, null, 0.88534, null, 0.65619, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67645, "SRR17219959", "SRX13399923", "SRS11303043", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qp skin tumor 9", "GSM5732248", null, "source name:Qp skin tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor", "Qp skin tumor 9", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qp skin tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor", "GSM5732248", "GSM5732248: Qp skin tumor 9; Danio rerio; RNA Seq", "GSM5732248", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732248", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101289.fastq.gz", "fastq", 152510400.0, 3812760.0, "GSM5732248 r1", "0:40", "A:52274113;C:31326291;G:31850664;T:36971245;N:88087", 40, null, null, null, 52274113, 31326291, 31850664, 36971245, 88087, "SRX13399923", "SRS11303043", "SRA1343073", "GEO", "Koch Institute", 1, 0.82364, null, 0.24647, null, 0.85871, null, 0.66872, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67646, "SRR17219957", "SRX13399922", "SRS11303042", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qp skin tumor 8", "GSM5732247", null, "source name:Qp skin tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor", "Qp skin tumor 8", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qp skin tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor", "GSM5732247", "GSM5732247: Qp skin tumor 8; Danio rerio; RNA Seq", "GSM5732247", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732247", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101287.fastq.gz", "fastq", 76828360.0, 1920709.0, "GSM5732247 r1", "0:40", "A:26523726;C:15399788;G:16949111;T:17911010;N:44725", 40, null, null, null, 26523726, 15399788, 16949111, 17911010, 44725, "SRX13399922", "SRS11303042", "SRA1343073", "GEO", "Koch Institute", 1, 0.82316, null, 0.38565, null, 0.87801, null, 0.65616, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67647, "SRR17219955", "SRX13399921", "SRS11303041", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qp skin tumor 7", "GSM5732246", null, "source name:Qp skin tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor", "Qp skin tumor 7", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qp skin tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor", "GSM5732246", "GSM5732246: Qp skin tumor 7; Danio rerio; RNA Seq", "GSM5732246", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732246", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101286.fastq.gz", "fastq", 77108080.0, 1927702.0, "GSM5732246 r1", "0:40", "A:26570402;C:15649619;G:16889594;T:17953263;N:45202", 40, null, null, null, 26570402, 15649619, 16889594, 17953263, 45202, "SRX13399921", "SRS11303041", "SRA1343073", "GEO", "Koch Institute", 1, 0.81122, null, 0.33667, null, 0.87178, null, 0.66288, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67648, "SRR17219953", "SRX13399920", "SRS11303040", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qp skin tumor 6", "GSM5732245", null, "source name:Qp skin tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor", "Qp skin tumor 6", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qp skin tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor", "GSM5732245", "GSM5732245: Qp skin tumor 6; Danio rerio; RNA Seq", "GSM5732245", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732245", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101285.fastq.gz", "fastq", 124624040.0, 3115601.0, "GSM5732245 r1", "0:40", "A:41502232;C:26253849;G:27083319;T:29714036;N:70604", 40, null, null, null, 41502232, 26253849, 27083319, 29714036, 70604, "SRX13399920", "SRS11303040", "SRA1343073", "GEO", "Koch Institute", 1, 0.81706, null, 0.26109, null, 0.85811, null, 0.65526, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67649, "SRR17219951", "SRX13399919", "SRS11303039", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qp skin tumor 5", "GSM5732244", null, "source name:Qp skin tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor", "Qp skin tumor 5", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qp skin tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor", "GSM5732244", "GSM5732244: Qp skin tumor 5; Danio rerio; RNA Seq", "GSM5732244", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732244", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101284.fastq.gz", "fastq", 97066400.0, 2426660.0, "GSM5732244 r1", "0:40", "A:32977109;C:19973503;G:20845864;T:23215430;N:54494", 40, null, null, null, 32977109, 19973503, 20845864, 23215430, 54494, "SRX13399919", "SRS11303039", "SRA1343073", "GEO", "Koch Institute", 1, 0.82484, null, 0.28858, null, 0.86561, null, 0.64518, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67650, "SRR17219917", "SRX13399918", "SRS11303037", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qm tumor 6", "GSM5732227", null, "source name:Qm tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor", "Qm tumor 6", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qm tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor", "GSM5732227", "GSM5732227: Qm tumor 6; Danio rerio; RNA Seq", "GSM5732227", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732227", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101267.fastq.gz", "fastq", 94190240.0, 2354756.0, "GSM5732227 r1", "0:40", "A:32749934;C:18714126;G:19617591;T:23052224;N:56365", 40, null, null, null, 32749934, 18714126, 19617591, 23052224, 56365, "SRX13399918", "SRS11303037", "SRA1343073", "GEO", "Koch Institute", 1, 0.8137, null, 0.21484, null, 0.85395, null, 0.6013, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67651, "SRR17219915", "SRX13399917", "SRS11303036", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qm tumor 5", "GSM5732226", null, "source name:Qm tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor", "Qm tumor 5", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qm tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor", "GSM5732226", "GSM5732226: Qm tumor 5; Danio rerio; RNA Seq", "GSM5732226", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732226", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101266.fastq.gz", "fastq", 142630800.0, 3565770.0, "GSM5732226 r1", "0:40", "A:50773272;C:29136199;G:28699617;T:33938415;N:83297", 40, null, null, null, 50773272, 29136199, 28699617, 33938415, 83297, "SRX13399917", "SRS11303036", "SRA1343073", "GEO", "Koch Institute", 1, 0.81831, null, 0.21344, null, 0.86935, null, 0.62355, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67652, "SRR17219913", "SRX13399916", "SRS11303038", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qm tumor 4", "GSM5732225", null, "source name:Qm tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor", "Qm tumor 4", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qm tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor", "GSM5732225", "GSM5732225: Qm tumor 4; Danio rerio; RNA Seq", "GSM5732225", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732225", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101265.fastq.gz", "fastq", 72664840.0, 1816621.0, "GSM5732225 r1", "0:40", "A:24936806;C:14864464;G:15139082;T:17684025;N:40463", 40, null, null, null, 24936806, 14864464, 15139082, 17684025, 40463, "SRX13399916", "SRS11303038", "SRA1343073", "GEO", "Koch Institute", 1, 0.81563, null, 0.19935, null, 0.84956, null, 0.61926, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67653, "SRR17219911", "SRX13399915", "SRS11303035", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qm tumor 3", "GSM5732224", null, "source name:Qm tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor", "Qm tumor 3", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qm tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor", "GSM5732224", "GSM5732224: Qm tumor 3; Danio rerio; RNA Seq", "GSM5732224", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732224", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101264.fastq.gz", "fastq", 137738640.0, 3443466.0, "GSM5732224 r1", "0:40", "A:46262332;C:28700073;G:30367217;T:32328223;N:80795", 40, null, null, null, 46262332, 28700073, 30367217, 32328223, 80795, "SRX13399915", "SRS11303035", "SRA1343073", "GEO", "Koch Institute", 1, 0.82243, null, 0.19809, null, 0.86103, null, 0.62402, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67654, "SRR17219909", "SRX13399914", "SRS11303034", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qm tumor 2", "GSM5732223", null, "source name:Qm tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor", "Qm tumor 2", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qm tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor", "GSM5732223", "GSM5732223: Qm tumor 2; Danio rerio; RNA Seq", "GSM5732223", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732223", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101263.fastq.gz", "fastq", 100736440.0, 2518411.0, "GSM5732223 r1", "0:40", "A:35350874;C:19629100;G:20709910;T:24987897;N:58659", 40, null, null, null, 35350874, 19629100, 20709910, 24987897, 58659, "SRX13399914", "SRS11303034", "SRA1343073", "GEO", "Koch Institute", 1, 0.816, null, 0.19534, null, 0.85498, null, 0.58105, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67655, "SRR17219907", "SRX13399913", "SRS11303033", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qm tumor 1", "GSM5732222", null, "source name:Qm tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor", "Qm tumor 1", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qm tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor", "GSM5732222", "GSM5732222: Qm tumor 1; Danio rerio; RNA Seq", "GSM5732222", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732222", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101262.fastq.gz", "fastq", 105944280.0, 2648607.0, "GSM5732222 r1", "0:40", "A:37210955;C:21008075;G:21663482;T:26000794;N:60974", 40, null, null, null, 37210955, 21008075, 21663482, 26000794, 60974, "SRX13399913", "SRS11303033", "SRA1343073", "GEO", "Koch Institute", 1, 0.81581, null, 0.20031, null, 0.86334, null, 0.6085, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67656, "SRR17219905", "SRX13399912", "SRS11303032", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qpm tumor 10", "GSM5732221", null, "source name:Qpm tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor", "Qpm tumor 10", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qpm tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor", "GSM5732221", "GSM5732221: Qpm tumor 10; Danio rerio; RNA Seq", "GSM5732221", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732221", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101261.fastq.gz", "fastq", 101472840.0, 2536821.0, "GSM5732221 r1", "0:40", "A:34475762;C:20816302;G:21286989;T:24838307;N:55480", 40, null, null, null, 34475762, 20816302, 21286989, 24838307, 55480, "SRX13399912", "SRS11303032", "SRA1343073", "GEO", "Koch Institute", 1, 0.81061, null, 0.20131, null, 0.84613, null, 0.60722, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67657, "SRR17219903", "SRX13399911", "SRS11303031", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qpm tumor 9", "GSM5732220", null, "source name:Qpm tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor", "Qpm tumor 9", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qpm tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor", "GSM5732220", "GSM5732220: Qpm tumor 9; Danio rerio; RNA Seq", "GSM5732220", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732220", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101260.fastq.gz", "fastq", 99755640.0, 2493891.0, "GSM5732220 r1", "0:40", "A:34870327;C:19628149;G:20126136;T:25072821;N:58207", 40, null, null, null, 34870327, 19628149, 20126136, 25072821, 58207, "SRX13399911", "SRS11303031", "SRA1343073", "GEO", "Koch Institute", 1, 0.80894, null, 0.20798, null, 0.84678, null, 0.61006, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67658, "SRR17219901", "SRX13399910", "SRS11303030", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qpm tumor 8", "GSM5732219", null, "source name:Qpm tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor", "Qpm tumor 8", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qpm tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor", "GSM5732219", "GSM5732219: Qpm tumor 8; Danio rerio; RNA Seq", "GSM5732219", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732219", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101259.fastq.gz", "fastq", 164204720.0, 4105118.0, "GSM5732219 r1", "0:40", "A:57421304;C:32261871;G:33727368;T:40700224;N:93953", 40, null, null, null, 57421304, 32261871, 33727368, 40700224, 93953, "SRX13399910", "SRS11303030", "SRA1343073", "GEO", "Koch Institute", 1, 0.81413, null, 0.19281, null, 0.85001, null, 0.62212, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67659, "SRR17219899", "SRX13399909", "SRS11303027", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qpm tumor 7", "GSM5732217", null, "source name:Qpm tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor", "Qpm tumor 7", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qpm tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor", "GSM5732217", "GSM5732217: Qpm tumor 7; Danio rerio; RNA Seq", "GSM5732217", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732217", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101258.fastq.gz", "fastq", 170806960.0, 4270174.0, "GSM5732217 r1", "0:40", "A:59047625;C:34088876;G:36165441;T:41402090;N:102928", 40, null, null, null, 59047625, 34088876, 36165441, 41402090, 102928, "SRX13399909", "SRS11303027", "SRA1343073", "GEO", "Koch Institute", 1, 0.81948, null, 0.19309, null, 0.85222, null, 0.62553, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67660, "SRR17219897", "SRX13399908", "SRS11303029", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qpm tumor 6", "GSM5732215", null, "source name:Qpm tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor", "Qpm tumor 6", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qpm tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor", "GSM5732215", "GSM5732215: Qpm tumor 6; Danio rerio; RNA Seq", "GSM5732215", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732215", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101257.fastq.gz", "fastq", 115180880.0, 2879522.0, "GSM5732215 r1", "0:40", "A:39638720;C:23294416;G:23781904;T:28400153;N:65687", 40, null, null, null, 39638720, 23294416, 23781904, 28400153, 65687, "SRX13399908", "SRS11303029", "SRA1343073", "GEO", "Koch Institute", 1, 0.80861, null, 0.19172, null, 0.84528, null, 0.62263, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67661, "SRR17219895", "SRX13399907", "SRS11303028", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qpm tumor 5", "GSM5732214", null, "source name:Qpm tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor", "Qpm tumor 5", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qpm tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor", "GSM5732214", "GSM5732214: Qpm tumor 5; Danio rerio; RNA Seq", "GSM5732214", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732214", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101256.fastq.gz", "fastq", 98789880.0, 2469747.0, "GSM5732214 r1", "0:40", "A:34779177;C:19539836;G:19833227;T:24577420;N:60220", 40, null, null, null, 34779177, 19539836, 19833227, 24577420, 60220, "SRX13399907", "SRS11303028", "SRA1343073", "GEO", "Koch Institute", 1, 0.8048, null, 0.19299, null, 0.85216, null, 0.5989, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67662, "SRR17219893", "SRX13399906", "SRS11303026", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qpm tumor 4", "GSM5732212", null, "source name:Qpm tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor", "Qpm tumor 4", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qpm tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor", "GSM5732212", "GSM5732212: Qpm tumor 4; Danio rerio; RNA Seq", "GSM5732212", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732212", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101255.fastq.gz", "fastq", 156209080.0, 3905227.0, "GSM5732212 r1", "0:40", "A:54435131;C:31318276;G:32371758;T:37994070;N:89845", 40, null, null, null, 54435131, 31318276, 32371758, 37994070, 89845, "SRX13399906", "SRS11303026", "SRA1343073", "GEO", "Koch Institute", 1, 0.81902, null, 0.18706, null, 0.84524, null, 0.62441, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67663, "SRR17219891", "SRX13399905", "SRS11303025", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qpm tumor 3", "GSM5732211", null, "source name:Qpm tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor", "Qpm tumor 3", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qpm tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor", "GSM5732211", "GSM5732211: Qpm tumor 3; Danio rerio; RNA Seq", "GSM5732211", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732211", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101254.fastq.gz", "fastq", 148839960.0, 3720999.0, "GSM5732211 r1", "0:40", "A:52156979;C:30408766;G:31252231;T:34935943;N:86041", 40, null, null, null, 52156979, 30408766, 31252231, 34935943, 86041, "SRX13399905", "SRS11303025", "SRA1343073", "GEO", "Koch Institute", 1, 0.82271, null, 0.19102, null, 0.8633, null, 0.64179, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67664, "SRR17219889", "SRX13399904", "SRS11303024", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qpm tumor 2", "GSM5732209", null, "source name:Qpm tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor", "Qpm tumor 2", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qpm tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor", "GSM5732209", "GSM5732209: Qpm tumor 2; Danio rerio; RNA Seq", "GSM5732209", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732209", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101253.fastq.gz", "fastq", 128233680.0, 3205842.0, "GSM5732209 r1", "0:40", "A:44051377;C:26029222;G:27011242;T:31066810;N:75029", 40, null, null, null, 44051377, 26029222, 27011242, 31066810, 75029, "SRX13399904", "SRS11303024", "SRA1343073", "GEO", "Koch Institute", 1, 0.81523, null, 0.2073, null, 0.84285, null, 0.58754, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67665, "SRR17219887", "SRX13399903", "SRS11303023", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qpm tumor 1", "GSM5732208", null, "source name:Qpm tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor", "Qpm tumor 1", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qpm tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor", "GSM5732208", "GSM5732208: Qpm tumor 1; Danio rerio; RNA Seq", "GSM5732208", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732208", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101252.fastq.gz", "fastq", 141895280.0, 3547382.0, "GSM5732208 r1", "0:40", "A:48598049;C:29057904;G:30058661;T:34100467;N:80199", 40, null, null, null, 48598049, 29057904, 30058661, 34100467, 80199, "SRX13399903", "SRS11303023", "SRA1343073", "GEO", "Koch Institute", 1, 0.82023, null, 0.20855, null, 0.85878, null, 0.62752, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [71533, "SRR21659014", "SRX17658778", "SRS15191045", "SRP398439", "PRJNA882818", "Defining function of wild type and three patient specific TP53 mutations in a zebrafish model of embryonal rhabdomyosarcoma", "GSE213869", "Transcriptome Analysis", "RNAseq analyses comparing gene expression in zebrafish embryonal rhabdomyosarcoma tumors expressing kRASG12D/tp53 / /GFP or /kRASG12Dtp53 /  + TP53 P153?/GFP Overall design: The RNAseq samples being submitted are of zebrafish  embryonal rhabdomyosarcoma tumors generated in th CG1 syngeneic background expressing kRASG12D/tp53 / /GFP and /kRASG12Dtp53 /  + TP53 P153?/GFP", null, "pubmed:37266578", null, "ProDel3 c", "GSM6595573", null, "source name:rhabdomyosarcoma tumors in zebrafish|tissue:zebrafish|geo loc name:missing|collection date:missing", "ProDel3 c", "Illumina Casava v1.8.2 software used for base calling All RNA seq FastQ reads were aligned with the reference genome danRer11 using TopHat2 default settings. The aligned BAM files sorted SAMTools and then processed using HTSeq count to obtain the counts per gene gene count measurements were obtained using HTSeq count Assembly: danRer11 Supplementary files format and content: The processed data files are in tabular format.  The first column contains the gene symbols and the second column contain the read counts of the gene using htseq count.", "rhabdomyosarcoma tumors in zebrafish", null, "post tissue grinding and homogenization in RNA lysis buffer  total RNA was isolated from harvested tumors using the RNAeasy Kit Qiagen; Valencia  CA according to the manufacturer\u2019s recommendation. post quantification with Nanodrop Thermo Scientific; Rockford  IL  RNA was stored at  80\u00baC. Total RNA was used for RNA Seq library preparation by following the KAPA Stranded RNA Seq Kit", "For expression of mutant human TP53 experiments  tumors were generated by injecting XhoI linearized rag2 kRASG12D and rag2 GFP along with Xmn1 linearized rag2 TP53 P153\u25b3  35 ng/ml of rag2 kRASG12D  15 ng/ml rag2 GFP or mutant TP53 and 10 ng/ml of rag2 GFP into the one cell stage of syngeneic zebrafish CG1/tp53 /  embryos <1 hpf Ignatius et al.  2012. Animals were monitored for tumor onset beginning at 10 dpf by scoring for GFP fluorescence under an Olympus MVX10 stereomicroscope with an X Cite series 120Q fluorescence illuminator. Scoring for tumor initiation was conducted for 60 days. 3 tumors each expressing kRASG12D/GFP/tp53 /   or kRASG12D/GFP/tp53 /  +TP53 P153\u25b3 were transplanted into secondary CG1 recipients and engrafted tumors were isolated  prepared as single cell suspensions and sorted by flowcytometry. Tumor cells were then processed to isolate RNA which was then submitted for RNAseq analyses Ignatius et al.  2012.", "tissue:zebrafish|tp53 /  + TP53 P153\u25b3", "GSM6595573", "GSM6595573: ProDel3 c; Danio rerio; RNA Seq", "GSM6595573 r1", "GSM6595573", "1", "post tissue grinding and homogenization in RNA lysis buffer  total RNA was isolated from harvested tumors using the RNAeasy Kit Qiagen; Valencia  CA according to the manufacturer's recommendation. post quantification with Nanodrop Thermo Scientific; Rockford  IL  RNA was stored at  80\u00baC. Total RNA was used for RNA Seq library preparation by following the KAPA Stranded RNA Seq Kit", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 3000", null, "SRP398439", null, null, "ProDel3_c_S41_R1.fastq", "fastq", 1583531283.0, 31049633.0, "GSM6595573 r1", "0:51 1:0", "A:371274884;C:377726847;G:377321846;T:456738328;N:469378", 51, 0, null, null, 371274884, 377726847, 377321846, 456738328, 469378, "SRX17658778", "SRS15191045", "SRA1503133", "Population Health Sciences, UT Health Science Center at San Antonio", "Population Health Sciences, UT Health Science Center at San Antonio", 1, 0.9215, null, 0.08584, null, 0.73028, null, 0.52093, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2022-09-21", "Multi-stage", "Multi-stage", "Cancer or Tumor", "Cancer or Tumor"]], "truncated": false, "filtered_table_rows_count": 102, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"experiment.library_layout\" = :p0 and \"experiment.platform\" = :p1 and \"tissue_curation_coarse\" = :p2 order by rowid limit 101", "params": {"p0": "SINGLE", "p1": "ILLUMINA", "p2": "Cancer or Tumor"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=ILLUMINA&tissue_curation_coarse=Cancer+or+Tumor", "results": [{"value": "RNA-Seq", "label": "RNA-Seq", "count": 96, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=ILLUMINA&tissue_curation_coarse=Cancer+or+Tumor&experiment.library_strategy=RNA-Seq", "selected": false}, {"value": "ncRNA-Seq", "label": "ncRNA-Seq", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=ILLUMINA&tissue_curation_coarse=Cancer+or+Tumor&experiment.library_strategy=ncRNA-Seq", "selected": false}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=ILLUMINA&tissue_curation_coarse=Cancer+or+Tumor", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 102, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=ILLUMINA&tissue_curation_coarse=Cancer+or+Tumor&experiment.library_source=TRANSCRIPTOMIC", "selected": false}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=ILLUMINA&tissue_curation_coarse=Cancer+or+Tumor", "results": [{"value": "cDNA", "label": "cDNA", "count": 96, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=ILLUMINA&tissue_curation_coarse=Cancer+or+Tumor&experiment.library_selection=cDNA", "selected": false}, {"value": "size fractionation", "label": "size fractionation", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=ILLUMINA&tissue_curation_coarse=Cancer+or+Tumor&experiment.library_selection=size+fractionation", "selected": false}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=ILLUMINA&tissue_curation_coarse=Cancer+or+Tumor", "results": [{"value": "SINGLE", "label": "SINGLE", "count": 102, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.platform=ILLUMINA&tissue_curation_coarse=Cancer+or+Tumor", "selected": true}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=ILLUMINA&tissue_curation_coarse=Cancer+or+Tumor", "results": [{"value": "ILLUMINA", "label": "ILLUMINA", "count": 102, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation_coarse=Cancer+or+Tumor", "selected": true}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=ILLUMINA&tissue_curation_coarse=Cancer+or+Tumor", "results": [{"value": "Undetermined", "label": "Undetermined", "count": 76, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=ILLUMINA&tissue_curation_coarse=Cancer+or+Tumor&devstage_curation_coarse=Undetermined", "selected": false}, {"value": "Adult", "label": "Adult", "count": 13, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=ILLUMINA&tissue_curation_coarse=Cancer+or+Tumor&devstage_curation_coarse=Adult", "selected": false}, {"value": "Larval", "label": "Larval", "count": 10, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=ILLUMINA&tissue_curation_coarse=Cancer+or+Tumor&devstage_curation_coarse=Larval", "selected": false}, {"value": "Multi-stage", "label": "Multi-stage", "count": 3, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=ILLUMINA&tissue_curation_coarse=Cancer+or+Tumor&devstage_curation_coarse=Multi-stage", "selected": false}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=ILLUMINA&tissue_curation_coarse=Cancer+or+Tumor", "results": [{"value": "Undetermined", "label": "Undetermined", "count": 81, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=ILLUMINA&tissue_curation_coarse=Cancer+or+Tumor&devstage_curation=Undetermined", "selected": false}, {"value": "Larval", "label": "Larval", "count": 10, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=ILLUMINA&tissue_curation_coarse=Cancer+or+Tumor&devstage_curation=Larval", "selected": false}, {"value": "Adult", "label": "Adult", "count": 8, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=ILLUMINA&tissue_curation_coarse=Cancer+or+Tumor&devstage_curation=Adult", "selected": false}, {"value": "Multi-stage", "label": "Multi-stage", "count": 3, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=ILLUMINA&tissue_curation_coarse=Cancer+or+Tumor&devstage_curation=Multi-stage", "selected": false}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=ILLUMINA&tissue_curation_coarse=Cancer+or+Tumor", "results": [{"value": "Cancer or Tumor", "label": "Cancer or Tumor", "count": 102, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=ILLUMINA", "selected": true}], "truncated": false}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=ILLUMINA&tissue_curation_coarse=Cancer+or+Tumor", "results": [{"value": "Cancer or Tumor", "label": "Cancer or Tumor", "count": 102, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=ILLUMINA&tissue_curation_coarse=Cancer+or+Tumor&tissue_curation=Cancer+or+Tumor", "selected": false}], "truncated": false}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=ILLUMINA&tissue_curation_coarse=Cancer+or+Tumor", "results": [{"value": "unknown", "label": "unknown", "count": 53, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=ILLUMINA&tissue_curation_coarse=Cancer+or+Tumor&technology=unknown", "selected": false}, {"value": "bulk", "label": "bulk", "count": 49, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=ILLUMINA&tissue_curation_coarse=Cancer+or+Tumor&technology=bulk", "selected": false}], "truncated": false}}, "suggested_facets": [], "next": "71533", "next_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.platform=ILLUMINA&tissue_curation_coarse=Cancer+or+Tumor&_next=71533", "private": false, "allow_execute_sql": true, "query_ms": 114.22453600061999}