{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where experiment.library_layout = \"SINGLE\", experiment.library_strategy = \"ncRNA-Seq\" and tissue_curation_coarse = \"All anatomical structures\"", "rows": [[25277, "SRR30160454", "SRX25627658", "SRS22272474", "SRP457111", "PRJNA1009808", "Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq]", "GSE241754", "Transcriptome Analysis", "Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.", "parent bioproject:PRJNA1009800", "pubmed:39402326", null, "WT bud 10 hpf charged tRNA seqrep 3", "GSM8441306", null, "tissue:10 hpf embryos|cell type:10 hpf embryos|geo loc name:missing|collection date:missing", "WT bud 10 hpf charged tRNA seqrep 3", "Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5\u2019 RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters: species Drer cluster id 0.93 threads 40 min cov 0.001 deconv cov ratio 0.4 max mismatches 0.075 remap remap mismatches 0.075 max multi 10 max multi 6 remap remap mismatches 0.075 crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions", "10 hpf embryos", null, "Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.", null, "cell type:10 hpf embryos", "GSM8441306", "GSM8441306: WT bud 10 hpf charged tRNA seqrep 3; Danio rerio; ncRNA Seq", "GSM8441306 r1", "GSM8441306", "1", "Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP457111", null, null, "10hpf_aa_rep3.fastq.gz", "fastq", 193965330.0, 3367323.0, "GSM8441306 r1", "0:57.60", "A:36799299;C:55100074;G:53758955;T:48306966;N:36", 57, null, null, null, 36799299, 55100074, 53758955, 48306966, 36, "SRX25627658", "SRS22272474", "SRA1941998", "Max Planck Institute of Biochemistry", "Max Planck Institute of Biochemistry", 1, 0.34405, null, 0.05049, null, 0.89471, null, 0.46469, null, 88, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2024-08-05", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [25278, "SRR30160455", "SRX25627657", "SRS22272473", "SRP457111", "PRJNA1009808", "Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq]", "GSE241754", "Transcriptome Analysis", "Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.", "parent bioproject:PRJNA1009800", "pubmed:39402326", null, "WT bud 10 hpf charged tRNA seqrep 2", "GSM8441305", null, "tissue:10 hpf embryos|cell type:10 hpf embryos|geo loc name:missing|collection date:missing", "WT bud 10 hpf charged tRNA seqrep 2", "Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5\u2019 RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters: species Drer cluster id 0.93 threads 40 min cov 0.001 deconv cov ratio 0.4 max mismatches 0.075 remap remap mismatches 0.075 max multi 10 max multi 6 remap remap mismatches 0.075 crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions", "10 hpf embryos", null, "Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.", null, "cell type:10 hpf embryos", "GSM8441305", "GSM8441305: WT bud 10 hpf charged tRNA seqrep 2; Danio rerio; ncRNA Seq", "GSM8441305 r1", "GSM8441305", "1", "Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP457111", null, null, "10hpf_aa_rep2.fastq.gz", "fastq", 138524715.0, 2369009.0, "GSM8441305 r1", "0:58.47", "A:26396279;C:39139297;G:38459048;T:34530060;N:31", 58, null, null, null, 26396279, 39139297, 38459048, 34530060, 31, "SRX25627657", "SRS22272473", "SRA1941998", "Max Planck Institute of Biochemistry", "Max Planck Institute of Biochemistry", 1, 0.35458, null, 0.05179, null, 0.89424, null, 0.46401, null, 74, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2024-08-05", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [25279, "SRR30160456", "SRX25627656", "SRS22272472", "SRP457111", "PRJNA1009808", "Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq]", "GSE241754", "Transcriptome Analysis", "Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.", "parent bioproject:PRJNA1009800", "pubmed:39402326", null, "WT bud 10 hpf charged tRNA seqrep 1", "GSM8441304", null, "tissue:10 hpf embryos|cell type:10 hpf embryos|geo loc name:missing|collection date:missing", "WT bud 10 hpf charged tRNA seqrep 1", "Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5\u2019 RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters: species Drer cluster id 0.93 threads 40 min cov 0.001 deconv cov ratio 0.4 max mismatches 0.075 remap remap mismatches 0.075 max multi 10 max multi 6 remap remap mismatches 0.075 crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions", "10 hpf embryos", null, "Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.", null, "cell type:10 hpf embryos", "GSM8441304", "GSM8441304: WT bud 10 hpf charged tRNA seqrep 1; Danio rerio; ncRNA Seq", "GSM8441304 r1", "GSM8441304", "1", "Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP457111", null, null, "10hpf_aa_rep1.fastq.gz", "fastq", 54473618.0, 946419.0, "GSM8441304 r1", "0:57.56", "A:10345022;C:15413782;G:15135500;T:13579304;N:10", 57, null, null, null, 10345022, 15413782, 15135500, 13579304, 10, "SRX25627656", "SRS22272472", "SRA1941998", "Max Planck Institute of Biochemistry", "Max Planck Institute of Biochemistry", 1, 0.36103, null, 0.0515, null, 0.89227, null, 0.4748, null, 81, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2024-08-05", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [25280, "SRR30160457", "SRX25627655", "SRS22272471", "SRP457111", "PRJNA1009808", "Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq]", "GSE241754", "Transcriptome Analysis", "Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.", "parent bioproject:PRJNA1009800", "pubmed:39402326", null, "WT sphere 4 hpf charged tRNA seqrep 3", "GSM8441303", null, "tissue:4 hpf embryos|cell type:4 hpf embryos|geo loc name:missing|collection date:missing", "WT sphere 4 hpf charged tRNA seqrep 3", "Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5\u2019 RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters: species Drer cluster id 0.93 threads 40 min cov 0.001 deconv cov ratio 0.4 max mismatches 0.075 remap remap mismatches 0.075 max multi 10 max multi 6 remap remap mismatches 0.075 crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions", "4 hpf embryos", null, "Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.", null, "cell type:4 hpf embryos", "GSM8441303", "GSM8441303: WT sphere 4 hpf charged tRNA seqrep 3; Danio rerio; ncRNA Seq", "GSM8441303 r1", "GSM8441303", "1", "Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP457111", null, null, "4hpf_aa_rep3.fastq.gz", "fastq", 100810543.0, 1747597.0, "GSM8441303 r1", "0:57.69", "A:20466558;C:28054923;G:26849246;T:25439798;N:18", 57, null, null, null, 20466558, 28054923, 26849246, 25439798, 18, "SRX25627655", "SRS22272471", "SRA1941998", "Max Planck Institute of Biochemistry", "Max Planck Institute of Biochemistry", 1, 0.36374, null, 0.06294, null, 0.87316, null, 0.54642, null, 39, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2024-08-05", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [25281, "SRR30160458", "SRX25627654", "SRS22272470", "SRP457111", "PRJNA1009808", "Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq]", "GSE241754", "Transcriptome Analysis", "Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.", "parent bioproject:PRJNA1009800", "pubmed:39402326", null, "WT sphere 4 hpf charged tRNA seqrep 2", "GSM8441302", null, "tissue:4 hpf embryos|cell type:4 hpf embryos|geo loc name:missing|collection date:missing", "WT sphere 4 hpf charged tRNA seqrep 2", "Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5\u2019 RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters: species Drer cluster id 0.93 threads 40 min cov 0.001 deconv cov ratio 0.4 max mismatches 0.075 remap remap mismatches 0.075 max multi 10 max multi 6 remap remap mismatches 0.075 crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions", "4 hpf embryos", null, "Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.", null, "cell type:4 hpf embryos", "GSM8441302", "GSM8441302: WT sphere 4 hpf charged tRNA seqrep 2; Danio rerio; ncRNA Seq", "GSM8441302 r1", "GSM8441302", "1", "Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP457111", null, null, "4hpf_aa_rep2.fastq.gz", "fastq", 121662759.0, 2046536.0, "GSM8441302 r1", "0:59.45", "A:24519095;C:33689156;G:32726095;T:30728382;N:31", 59, null, null, null, 24519095, 33689156, 32726095, 30728382, 31, "SRX25627654", "SRS22272470", "SRA1941998", "Max Planck Institute of Biochemistry", "Max Planck Institute of Biochemistry", 1, 0.3726, null, 0.06263, null, 0.87136, null, 0.55584, null, 31, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2024-08-05", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [25282, "SRR30160459", "SRX25627653", "SRS22272469", "SRP457111", "PRJNA1009808", "Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq]", "GSE241754", "Transcriptome Analysis", "Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.", "parent bioproject:PRJNA1009800", "pubmed:39402326", null, "WT sphere 4 hpf charged tRNA seqrep 1", "GSM8441301", null, "tissue:4 hpf embryos|cell type:4 hpf embryos|geo loc name:missing|collection date:missing", "WT sphere 4 hpf charged tRNA seqrep 1", "Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5\u2019 RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters: species Drer cluster id 0.93 threads 40 min cov 0.001 deconv cov ratio 0.4 max mismatches 0.075 remap remap mismatches 0.075 max multi 10 max multi 6 remap remap mismatches 0.075 crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions", "4 hpf embryos", null, "Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.", null, "cell type:4 hpf embryos", "GSM8441301", "GSM8441301: WT sphere 4 hpf charged tRNA seqrep 1; Danio rerio; ncRNA Seq", "GSM8441301 r1", "GSM8441301", "1", "Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP457111", null, null, "4hpf_aa_rep1.fastq.gz", "fastq", 124990980.0, 2116213.0, "GSM8441301 r1", "0:59.06", "A:25487542;C:34621140;G:33284460;T:31597816;N:22", 59, null, null, null, 25487542, 34621140, 33284460, 31597816, 22, "SRX25627653", "SRS22272469", "SRA1941998", "Max Planck Institute of Biochemistry", "Max Planck Institute of Biochemistry", 1, 0.36013, null, 0.05967, null, 0.87387, null, 0.55002, null, 44, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2024-08-05", "Multi-stage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [25283, "SRR25764121", "SRX21486801", "SRS18719093", "SRP457111", "PRJNA1009808", "Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq]", "GSE241754", "Transcriptome Analysis", "Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.", "parent bioproject:PRJNA1009800", "pubmed:39402326", null, "WT bud 10 hpf tRNA seq rep2", "GSM7734782", null, "source name:Gastrula|strain:TLAB strain|tissue:Gastrula|developmental stage:Bud 10 hpf|genotype:WT|geo loc name:missing|collection date:missing", "WT bud 10 hpf tRNA seq rep2", "Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5\u2019 RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts", "Gastrula", "unperturbed growth conditions in E3 medium for zebrafish embryos.", "50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq", "Embryos were grown in standard housing conditions namely28\u00b0C at a 14/10 hour light/dark cycle.", "strain:TLAB strain|tissue:Gastrula|developmental stage:Bud 10 hpf|genotype:WT", "GSM7734782", "GSM7734782: WT bud 10 hpf tRNA seq rep2; Danio rerio; ncRNA Seq", "GSM7734782 r1", "GSM7734782", "1", "50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP457111", null, null, "WT_tRNA_bud_2.fastq.gz", "fastq", 278145656.0, 4215107.0, "GSM7734782 r1", "0:65.99", "A:52499947;C:77161357;G:79314034;T:69169753;N:565", 65, null, null, null, 52499947, 77161357, 79314034, 69169753, 565, "SRX21486801", "SRS18719093", "SRA1700461", "Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry", "Max Planck Institute of Biochemistry", 1, 0.31888, null, 0.01661, null, 0.92348, null, 0.40156, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2023-08-28", "Gastrula", "Embryo", "Whole Organism", "All anatomical structures"], [25284, "SRR25764122", "SRX21486800", "SRS18719092", "SRP457111", "PRJNA1009808", "Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq]", "GSE241754", "Transcriptome Analysis", "Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.", "parent bioproject:PRJNA1009800", "pubmed:39402326", null, "WT bud 10 hpf tRNA seq rep1", "GSM7734781", null, "source name:Gastrula|strain:TLAB strain|tissue:Gastrula|developmental stage:Bud 10 hpf|genotype:WT|geo loc name:missing|collection date:missing", "WT bud 10 hpf tRNA seq rep1", "Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5\u2019 RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts", "Gastrula", "unperturbed growth conditions in E3 medium for zebrafish embryos.", "50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq", "Embryos were grown in standard housing conditions namely28\u00b0C at a 14/10 hour light/dark cycle.", "strain:TLAB strain|tissue:Gastrula|developmental stage:Bud 10 hpf|genotype:WT", "GSM7734781", "GSM7734781: WT bud 10 hpf tRNA seq rep1; Danio rerio; ncRNA Seq", "GSM7734781 r1", "GSM7734781", "1", "50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP457111", null, null, "WT_tRNA_bud_1.fastq.gz", "fastq", 385514625.0, 5770392.0, "GSM7734781 r1", "0:66.81", "A:73305393;C:107155246;G:109793285;T:95259823;N:878", 66, null, null, null, 73305393, 107155246, 109793285, 95259823, 878, "SRX21486800", "SRS18719092", "SRA1700461", "Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry", "Max Planck Institute of Biochemistry", 1, 0.33213, null, 0.01782, null, 0.92354, null, 0.42724, null, 39, null, "B", null, "usable mapping rate", "illumina", "nextseq", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2023-08-28", "Gastrula", "Embryo", "Whole Organism", "All anatomical structures"], [25285, "SRR25764123", "SRX21486799", "SRS18719098", "SRP457111", "PRJNA1009808", "Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq]", "GSE241754", "Transcriptome Analysis", "Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.", "parent bioproject:PRJNA1009800", "pubmed:39402326", null, "WT shield 6 hpf tRNA seq rep2", "GSM7734780", null, "source name:Gastrula|strain:TLAB strain|tissue:Gastrula|developmental stage:Shield 6 hpf|genotype:WT|geo loc name:missing|collection date:missing", "WT shield 6 hpf tRNA seq rep2", "Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5\u2019 RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts", "Gastrula", "unperturbed growth conditions in E3 medium for zebrafish embryos.", "50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq", "Embryos were grown in standard housing conditions namely28\u00b0C at a 14/10 hour light/dark cycle.", "strain:TLAB strain|tissue:Gastrula|developmental stage:Shield 6 hpf|genotype:WT", "GSM7734780", "GSM7734780: WT shield 6 hpf tRNA seq rep2; Danio rerio; ncRNA Seq", "GSM7734780 r1", "GSM7734780", "1", "50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP457111", null, null, "WT_tRNA_shield_2.fastq.gz", "fastq", 469031736.0, 7421688.0, "GSM7734780 r1", "0:63.20", "A:90257219;C:130440728;G:130549302;T:117783411;N:1076", 63, null, null, null, 90257219, 130440728, 130549302, 117783411, 1076, "SRX21486799", "SRS18719098", "SRA1700461", "Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry", "Max Planck Institute of Biochemistry", 1, 0.29535, null, 0.02113, null, 0.91528, null, 0.43824, null, 37, null, "B", null, "usable mapping rate", "illumina", "nextseq", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2023-08-28", "Gastrula", "Embryo", "Whole Organism", "All anatomical structures"], [25286, "SRR25764124", "SRX21486798", "SRS18719100", "SRP457111", "PRJNA1009808", "Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq]", "GSE241754", "Transcriptome Analysis", "Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.", "parent bioproject:PRJNA1009800", "pubmed:39402326", null, "WT shield 6 hpf tRNA seq rep1", "GSM7734779", null, "source name:Gastrula|strain:TLAB strain|tissue:Gastrula|developmental stage:Shield 6 hpf|genotype:WT|geo loc name:missing|collection date:missing", "WT shield 6 hpf tRNA seq rep1", "Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5\u2019 RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts", "Gastrula", "unperturbed growth conditions in E3 medium for zebrafish embryos.", "50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq", "Embryos were grown in standard housing conditions namely28\u00b0C at a 14/10 hour light/dark cycle.", "strain:TLAB strain|tissue:Gastrula|developmental stage:Shield 6 hpf|genotype:WT", "GSM7734779", "GSM7734779: WT shield 6 hpf tRNA seq rep1; Danio rerio; ncRNA Seq", "GSM7734779 r1", "GSM7734779", "1", "50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP457111", null, null, "WT_tRNA_shield_1.fastq.gz", "fastq", 487207771.0, 7521930.0, "GSM7734779 r1", "0:64.77", "A:94654510;C:134893975;G:135716906;T:121941280;N:1100", 64, null, null, null, 94654510, 134893975, 135716906, 121941280, 1100, "SRX21486798", "SRS18719100", "SRA1700461", "Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry", "Max Planck Institute of Biochemistry", 1, 0.30664, null, 0.02274, null, 0.91297, null, 0.46012, null, 79, null, "B", null, "usable mapping rate", "illumina", "nextseq", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2023-08-28", "Gastrula", "Embryo", "Whole Organism", "All anatomical structures"], [25287, "SRR25764125", "SRX21486797", "SRS18719094", "SRP457111", "PRJNA1009808", "Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq]", "GSE241754", "Transcriptome Analysis", "Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.", "parent bioproject:PRJNA1009800", "pubmed:39402326", null, "WT sphere 4 hpf tRNA seq rep2", "GSM7734778", null, "source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:Sphere 4 hpf|genotype:WT|geo loc name:missing|collection date:missing", "WT sphere 4 hpf tRNA seq rep2", "Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5\u2019 RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts", "Blastula", "unperturbed growth conditions in E3 medium for zebrafish embryos.", "50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq", "Embryos were grown in standard housing conditions namely28\u00b0C at a 14/10 hour light/dark cycle.", "strain:TLAB strain|tissue:Blastula|developmental stage:Sphere 4 hpf|genotype:WT", "GSM7734778", "GSM7734778: WT sphere 4 hpf tRNA seq rep2; Danio rerio; ncRNA Seq", "GSM7734778 r1", "GSM7734778", "1", "50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP457111", null, null, "WT_tRNA_sphere_2.fastq.gz", "fastq", 196089572.0, 2998867.0, "GSM7734778 r1", "0:65.39", "A:39134451;C:53803100;G:53602781;T:49548779;N:461", 65, null, null, null, 39134451, 53803100, 53602781, 49548779, 461, "SRX21486797", "SRS18719094", "SRA1700461", "Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry", "Max Planck Institute of Biochemistry", 1, 0.28808, null, 0.01959, null, 0.91553, null, 0.47742, null, 78, null, "B", null, "usable mapping rate", "illumina", "nextseq", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2023-08-28", "Blastula", "Embryo", "Whole Organism", "All anatomical structures"], [25288, "SRR25764126", "SRX21486796", "SRS18719096", "SRP457111", "PRJNA1009808", "Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq]", "GSE241754", "Transcriptome Analysis", "Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.", "parent bioproject:PRJNA1009800", "pubmed:39402326", null, "WT sphere 4 hpf tRNA seq rep1", "GSM7734777", null, "source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:Sphere 4 hpf|genotype:WT|geo loc name:missing|collection date:missing", "WT sphere 4 hpf tRNA seq rep1", "Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5\u2019 RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts", "Blastula", "unperturbed growth conditions in E3 medium for zebrafish embryos.", "50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq", "Embryos were grown in standard housing conditions namely28\u00b0C at a 14/10 hour light/dark cycle.", "strain:TLAB strain|tissue:Blastula|developmental stage:Sphere 4 hpf|genotype:WT", "GSM7734777", "GSM7734777: WT sphere 4 hpf tRNA seq rep1; Danio rerio; ncRNA Seq", "GSM7734777 r1", "GSM7734777", "1", "50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP457111", null, null, "WT_tRNA_sphere_1.fastq.gz", "fastq", 273027894.0, 4080366.0, "GSM7734777 r1", "0:66.91", "A:54678043;C:74713512;G:74872888;T:68762883;N:568", 66, null, null, null, 54678043, 74713512, 74872888, 68762883, 568, "SRX21486796", "SRS18719096", "SRA1700461", "Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry", "Max Planck Institute of Biochemistry", 1, 0.30124, null, 0.01877, null, 0.9163, null, 0.49987, null, 79, null, "B", null, "usable mapping rate", "illumina", "nextseq", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2023-08-28", "Blastula", "Embryo", "Whole Organism", "All anatomical structures"], [25289, "SRR25764127", "SRX21486795", "SRS18719097", "SRP457111", "PRJNA1009808", "Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq]", "GSE241754", "Transcriptome Analysis", "Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.", "parent bioproject:PRJNA1009800", "pubmed:39402326", null, "WT 1000 cell 3 hpf tRNA seq rep2", "GSM7734776", null, "source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:1000 cell 3 hpf|genotype:WT|geo loc name:missing|collection date:missing", "WT 1000 cell 3 hpf tRNA seq rep2", "Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5\u2019 RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts", "Blastula", "unperturbed growth conditions in E3 medium for zebrafish embryos.", "50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq", "Embryos were grown in standard housing conditions namely28\u00b0C at a 14/10 hour light/dark cycle.", "strain:TLAB strain|tissue:Blastula|developmental stage:1000 cell 3 hpf|genotype:WT", "GSM7734776", "GSM7734776: WT 1000 cell 3 hpf tRNA seq rep2; Danio rerio; ncRNA Seq", "GSM7734776 r1", "GSM7734776", "1", "50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP457111", null, null, "WT_tRNA_1Kcell_2.fastq.gz", "fastq", 240973473.0, 3918764.0, "GSM7734776 r1", "0:61.49", "A:48091658;C:66684510;G:65183534;T:61013184;N:587", 61, null, null, null, 48091658, 66684510, 65183534, 61013184, 587, "SRX21486795", "SRS18719097", "SRA1700461", "Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry", "Max Planck Institute of Biochemistry", 1, 0.26629, null, 0.02297, null, 0.92305, null, 0.48525, null, 79, null, "B", null, "usable mapping rate", "illumina", "nextseq", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2023-08-28", "Blastula", "Embryo", "Whole Organism", "All anatomical structures"], [25290, "SRR25764128", "SRX21486794", "SRS18719095", "SRP457111", "PRJNA1009808", "Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq]", "GSE241754", "Transcriptome Analysis", "Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.", "parent bioproject:PRJNA1009800", "pubmed:39402326", null, "WT 1000 cell 3 hpf tRNA seq rep1", "GSM7734775", null, "source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:1000 cell 3 hpf|genotype:WT|geo loc name:missing|collection date:missing", "WT 1000 cell 3 hpf tRNA seq rep1", "Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5\u2019 RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts", "Blastula", "unperturbed growth conditions in E3 medium for zebrafish embryos.", "50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq", "Embryos were grown in standard housing conditions namely28\u00b0C at a 14/10 hour light/dark cycle.", "strain:TLAB strain|tissue:Blastula|developmental stage:1000 cell 3 hpf|genotype:WT", "GSM7734775", "GSM7734775: WT 1000 cell 3 hpf tRNA seq rep1; Danio rerio; ncRNA Seq", "GSM7734775 r1", "GSM7734775", "1", "50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP457111", null, null, "WT_tRNA_1Kcell_1.fastq.gz", "fastq", 153597915.0, 2445091.0, "GSM7734775 r1", "0:62.82", "A:30905842;C:42377268;G:41639937;T:38674503;N:365", 62, null, null, null, 30905842, 42377268, 41639937, 38674503, 365, "SRX21486794", "SRS18719095", "SRA1700461", "Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry", "Max Planck Institute of Biochemistry", 1, 0.27317, null, 0.02516, null, 0.92454, null, 0.49385, null, 77, null, "B", null, "usable mapping rate", "illumina", "nextseq", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2023-08-28", "Blastula", "Embryo", "Whole Organism", "All anatomical structures"], [25291, "SRR25764129", "SRX21486793", "SRS18719091", "SRP457111", "PRJNA1009808", "Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq]", "GSE241754", "Transcriptome Analysis", "Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.", "parent bioproject:PRJNA1009800", "pubmed:39402326", null, "WT 256 cell 2.5 hpf tRNA seq rep2", "GSM7734774", null, "source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:256 cell 2.5 hpf|genotype:WT|geo loc name:missing|collection date:missing", "WT 256 cell 2.5 hpf tRNA seq rep2", "Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5\u2019 RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts", "Blastula", "unperturbed growth conditions in E3 medium for zebrafish embryos.", "50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq", "Embryos were grown in standard housing conditions namely28\u00b0C at a 14/10 hour light/dark cycle.", "strain:TLAB strain|tissue:Blastula|developmental stage:256 cell 2.5 hpf|genotype:WT", "GSM7734774", "GSM7734774: WT 256 cell 2.5 hpf tRNA seq rep2; Danio rerio; ncRNA Seq", "GSM7734774 r1", "GSM7734774", "1", "50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP457111", null, null, "WT_tRNA_256cell_2.fastq.gz", "fastq", 844659062.0, 13660310.0, "GSM7734774 r1", "0:61.83", "A:165996817;C:234451560;G:230230791;T:213977958;N:1936", 61, null, null, null, 165996817, 234451560, 230230791, 213977958, 1936, "SRX21486793", "SRS18719091", "SRA1700461", "Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry", "Max Planck Institute of Biochemistry", 1, 0.26001, null, 0.01993, null, 0.92594, null, 0.45714, null, 61, null, "B", null, "usable mapping rate", "illumina", "nextseq", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2023-08-28", "Blastula", "Embryo", "Whole Organism", "All anatomical structures"], [25292, "SRR25764130", "SRX21486792", "SRS18719088", "SRP457111", "PRJNA1009808", "Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq]", "GSE241754", "Transcriptome Analysis", "Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.", "parent bioproject:PRJNA1009800", "pubmed:39402326", null, "WT 256 cell 2.5 hpf tRNA seq rep1", "GSM7734773", null, "source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:256 cell 2.5 hpf|genotype:WT|geo loc name:missing|collection date:missing", "WT 256 cell 2.5 hpf tRNA seq rep1", "Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5\u2019 RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts", "Blastula", "unperturbed growth conditions in E3 medium for zebrafish embryos.", "50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq", "Embryos were grown in standard housing conditions namely28\u00b0C at a 14/10 hour light/dark cycle.", "strain:TLAB strain|tissue:Blastula|developmental stage:256 cell 2.5 hpf|genotype:WT", "GSM7734773", "GSM7734773: WT 256 cell 2.5 hpf tRNA seq rep1; Danio rerio; ncRNA Seq", "GSM7734773 r1", "GSM7734773", "1", "50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP457111", null, null, "WT_tRNA_256cell_1.fastq.gz", "fastq", 215968508.0, 3436266.0, "GSM7734773 r1", "0:62.85", "A:43791388;C:59547637;G:58130851;T:54498124;N:508", 62, null, null, null, 43791388, 59547637, 58130851, 54498124, 508, "SRX21486792", "SRS18719088", "SRA1700461", "Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry", "Max Planck Institute of Biochemistry", 1, 0.27383, null, 0.02205, null, 0.92748, null, 0.46217, null, 71, null, "B", null, "usable mapping rate", "illumina", "nextseq", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2023-08-28", "Blastula", "Embryo", "Whole Organism", "All anatomical structures"], [36266, "SRR953577", "SRX336218", "SRS471213", "SRP028895", "PRJNA138095", "Transcriptome wide analysis of small RNA expression in early zebrafish development", "GSE27722", "Transcriptome Analysis", "During early vertebrate development a large number of noncoding RNAs are maternally inherited or expressed upon activation of zygotic transcription. The exact identity expression levels and function during early vertebrate development for most of these noncoding RNAs remains largely unknown. miRNAs microRNAs and piRNAs piwi interacting RNAs are two classes of small non coding RNAs that play important roles in gene regulation during early embryonic development. Here we utilized Illumina next generation sequencing technology to determine temporal expression patterns for both miRNAs and piRNAs during four distinct stages of early vertebrate development using zebrafish as a model system. For miRNAs the expression patterns for 192 known miRNAs and 12 novel miRNAs within 123 different miRNA families were determined. Significant sequence variation was observed at the five prime' and three prime' ends of miRNAs with a large number of extra nucleotides added in a non template directed manner. We also identified a large and diverse set of piRNAs expressed during early development far beyond that expected if piRNA expression is restricted to germ cells. Our analyses represent the deepest investigation to date of small RNA expression during early vertebrate development and suggest important novel functions for small RNAs during embryogenesis. Overall design: Identify the expression of small RNAs in zebrafish embryos of four different developmental stages using high through put sequencing", null, "pubmed:22408181", null, "embryo 1dpf rep1", "GSM686385", null, "source name:the whole embryo|strain:AB*WT|developmental stage:1dpf|tissue:the whole embryos", "embryo 1dpf rep1", "fasta: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. All the sequence with N inside was removed as well. The unique sequences were retained with the counts indicating thier abundance. The header of each sequence is composed of a unique sequence ID followed by a \" x\" and the reads counts. e.g. unique ID x counts. alignment: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. Small RNAs with perfect matches to the zebrafish genome Zv8 from Ensembl http://www.ensembl.org were retrieved using megaBLAST http://www.ncbi.nlm.nih.gov/blast/megablast.shtml and Bowtie http://bowtie bio.sourceforge.net/tutorial.shtml. To identify piRNAs consensus sequences from zebrafish repetitive elements were retrieved from Repbase http://www.girinst.org/repbase/index.html and Repeat Maskers using the UCSC genome browser http://genome.ucsc.edu. Small RNAs perfectly mapping to these consensus sequences and their genomic flanking regions were sorted into piRNA libraries with up to 3 genomic mapping positions for each unique RNA sequence. fasta files description: small RNA 15 30 nt alignment file description: piRNA map to repetitive elements", "the whole embryo", null, "Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform.", "Embryos were raised at 28\u00c2\u00b0C in egg water 0.03% Instant Ocean marine salt mix for the initial several hours of development", "strain:AB*WT|developmental stage:1dpf|tissue:the whole embryos", "GSM686385", "GSM686385: embryo 1dpf rep1; Danio rerio; ncRNA Seq", "GSM686385", null, "1", "Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform.", "GEO Accession:GSM686385", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer II", null, "SRP028895", null, null, "GSM686385_1dpf_Raw.txt", "fastq", 293700240.0, 8158340.0, "GSM686385 r1", "0:36", "A:74642033;C:62153879;G:83836688;T:69542606;N:3525034", 36, null, null, null, 74642033, 62153879, 83836688, 69542606, 3525034, "SRX336218", "SRS471213", "SRA098146", "GEO", "Lee Lab, Molecular Biology, Mass General Hospital", 1, 0.00386, null, 0.00274, null, 0.99758, null, 0.53623, null, 36, null, "T", null, "under 1.2% mapping rate", "illumina", "early_illumina", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2011-03-07", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [36267, "SRR953576", "SRX336217", "SRS471211", "SRP028895", "PRJNA138095", "Transcriptome wide analysis of small RNA expression in early zebrafish development", "GSE27722", "Transcriptome Analysis", "During early vertebrate development a large number of noncoding RNAs are maternally inherited or expressed upon activation of zygotic transcription. The exact identity expression levels and function during early vertebrate development for most of these noncoding RNAs remains largely unknown. miRNAs microRNAs and piRNAs piwi interacting RNAs are two classes of small non coding RNAs that play important roles in gene regulation during early embryonic development. Here we utilized Illumina next generation sequencing technology to determine temporal expression patterns for both miRNAs and piRNAs during four distinct stages of early vertebrate development using zebrafish as a model system. For miRNAs the expression patterns for 192 known miRNAs and 12 novel miRNAs within 123 different miRNA families were determined. Significant sequence variation was observed at the five prime' and three prime' ends of miRNAs with a large number of extra nucleotides added in a non template directed manner. We also identified a large and diverse set of piRNAs expressed during early development far beyond that expected if piRNA expression is restricted to germ cells. Our analyses represent the deepest investigation to date of small RNA expression during early vertebrate development and suggest important novel functions for small RNAs during embryogenesis. Overall design: Identify the expression of small RNAs in zebrafish embryos of four different developmental stages using high through put sequencing", null, "pubmed:22408181", null, "embryo Shield rep1", "GSM686384", null, "source name:the whole embryo|strain:AB*WT|developmental stage:Shield|tissue:the whole embryos", "embryo Shield rep1", "fasta: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. All the sequence with N inside was removed as well. The unique sequences were retained with the counts indicating thier abundance. The header of each sequence is composed of a unique sequence ID followed by a \" x\" and the reads counts. e.g. unique ID x counts. alignment: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. Small RNAs with perfect matches to the zebrafish genome Zv8 from Ensembl http://www.ensembl.org were retrieved using megaBLAST http://www.ncbi.nlm.nih.gov/blast/megablast.shtml and Bowtie http://bowtie bio.sourceforge.net/tutorial.shtml. To identify piRNAs consensus sequences from zebrafish repetitive elements were retrieved from Repbase http://www.girinst.org/repbase/index.html and Repeat Maskers using the UCSC genome browser http://genome.ucsc.edu. Small RNAs perfectly mapping to these consensus sequences and their genomic flanking regions were sorted into piRNA libraries with up to 3 genomic mapping positions for each unique RNA sequence. fasta files description: small RNA 15 30 nt alignment file description: piRNA map to repetitive elements", "the whole embryo", null, "Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform.", "Embryos were raised at 28\u00c2\u00b0C in egg water 0.03% Instant Ocean marine salt mix for the initial several hours of development", "strain:AB*WT|developmental stage:Shield|tissue:the whole embryos", "GSM686384", "GSM686384: embryo Shield rep1; Danio rerio; ncRNA Seq", "GSM686384", null, "1", "Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform.", "GEO Accession:GSM686384", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer II", null, "SRP028895", null, null, "GSM686384_Shield_Raw.txt", "fastq", 115067916.0, 3196331.0, "GSM686384 r1", "0:36", "A:28435718;C:21893278;G:31779352;T:26635839;N:6323729", 36, null, null, null, 28435718, 21893278, 31779352, 26635839, 6323729, "SRX336217", "SRS471211", "SRA098146", "GEO", "Lee Lab, Molecular Biology, Mass General Hospital", 1, 0.00278, null, 0.00217, null, 0.99933, null, 0.60606, null, 36, null, "T", null, "under 1.2% mapping rate", "illumina", "early_illumina", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2011-03-07", "Gastrula", "Embryo", "Whole Organism", "All anatomical structures"], [36268, "SRR953575", "SRX336216", "SRS471212", "SRP028895", "PRJNA138095", "Transcriptome wide analysis of small RNA expression in early zebrafish development", "GSE27722", "Transcriptome Analysis", "During early vertebrate development a large number of noncoding RNAs are maternally inherited or expressed upon activation of zygotic transcription. The exact identity expression levels and function during early vertebrate development for most of these noncoding RNAs remains largely unknown. miRNAs microRNAs and piRNAs piwi interacting RNAs are two classes of small non coding RNAs that play important roles in gene regulation during early embryonic development. Here we utilized Illumina next generation sequencing technology to determine temporal expression patterns for both miRNAs and piRNAs during four distinct stages of early vertebrate development using zebrafish as a model system. For miRNAs the expression patterns for 192 known miRNAs and 12 novel miRNAs within 123 different miRNA families were determined. Significant sequence variation was observed at the five prime' and three prime' ends of miRNAs with a large number of extra nucleotides added in a non template directed manner. We also identified a large and diverse set of piRNAs expressed during early development far beyond that expected if piRNA expression is restricted to germ cells. Our analyses represent the deepest investigation to date of small RNA expression during early vertebrate development and suggest important novel functions for small RNAs during embryogenesis. Overall design: Identify the expression of small RNAs in zebrafish embryos of four different developmental stages using high through put sequencing", null, "pubmed:22408181", null, "embryo sphere rep2", "GSM686383", null, "source name:the whole embryo|strain:AB*WT|developmental stage:sphere|tissue:the whole embryos", "embryo sphere rep2", "fasta: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. All the sequence with N inside was removed as well. The unique sequences were retained with the counts indicating thier abundance. The header of each sequence is composed of a unique sequence ID followed by a \" x\" and the reads counts. e.g. unique ID x counts. alignment: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. Small RNAs with perfect matches to the zebrafish genome Zv8 from Ensembl http://www.ensembl.org were retrieved using megaBLAST http://www.ncbi.nlm.nih.gov/blast/megablast.shtml and Bowtie http://bowtie bio.sourceforge.net/tutorial.shtml. To identify piRNAs consensus sequences from zebrafish repetitive elements were retrieved from Repbase http://www.girinst.org/repbase/index.html and Repeat Maskers using the UCSC genome browser http://genome.ucsc.edu. Small RNAs perfectly mapping to these consensus sequences and their genomic flanking regions were sorted into piRNA libraries with up to 3 genomic mapping positions for each unique RNA sequence. fasta files description: small RNA 15 30 nt alignment file description: piRNA map to repetitive elements", "the whole embryo", null, "Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform.", "Embryos were raised at 28\u00c2\u00b0C in egg water 0.03% Instant Ocean marine salt mix for the initial several hours of development", "strain:AB*WT|developmental stage:sphere|tissue:the whole embryos", "GSM686383", "GSM686383: embryo sphere rep2; Danio rerio; ncRNA Seq", "GSM686383", null, "1", "Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform.", "GEO Accession:GSM686383", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer II", null, "SRP028895", null, null, "GSM686383_Sphere_2_Raw.txt", "fastq", 369741456.0, 10270596.0, "GSM686383 r1", "0:36", "A:89854472;C:70044086;G:109552597;T:100266590;N:23711", 36, null, null, null, 89854472, 70044086, 109552597, 100266590, 23711, "SRX336216", "SRS471212", "SRA098146", "GEO", "Lee Lab, Molecular Biology, Mass General Hospital", 1, 0.00421, null, 0.00367, null, 0.99924, null, 0.51111, null, 36, null, "T", null, "under 1.2% mapping rate", "illumina", "early_illumina", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2011-03-07", "Blastula", "Embryo", "Whole Organism", "All anatomical structures"], [36269, "SRR953574", "SRX336215", "SRS471209", "SRP028895", "PRJNA138095", "Transcriptome wide analysis of small RNA expression in early zebrafish development", "GSE27722", "Transcriptome Analysis", "During early vertebrate development a large number of noncoding RNAs are maternally inherited or expressed upon activation of zygotic transcription. The exact identity expression levels and function during early vertebrate development for most of these noncoding RNAs remains largely unknown. miRNAs microRNAs and piRNAs piwi interacting RNAs are two classes of small non coding RNAs that play important roles in gene regulation during early embryonic development. Here we utilized Illumina next generation sequencing technology to determine temporal expression patterns for both miRNAs and piRNAs during four distinct stages of early vertebrate development using zebrafish as a model system. For miRNAs the expression patterns for 192 known miRNAs and 12 novel miRNAs within 123 different miRNA families were determined. Significant sequence variation was observed at the five prime' and three prime' ends of miRNAs with a large number of extra nucleotides added in a non template directed manner. We also identified a large and diverse set of piRNAs expressed during early development far beyond that expected if piRNA expression is restricted to germ cells. Our analyses represent the deepest investigation to date of small RNA expression during early vertebrate development and suggest important novel functions for small RNAs during embryogenesis. Overall design: Identify the expression of small RNAs in zebrafish embryos of four different developmental stages using high through put sequencing", null, "pubmed:22408181", null, "embryo sphere rep1", "GSM686382", null, "source name:the whole embryo|strain:AB*WT|developmental stage:sphere|tissue:the whole embryos", "embryo sphere rep1", "fasta: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. All the sequence with N inside was removed as well. The unique sequences were retained with the counts indicating thier abundance. The header of each sequence is composed of a unique sequence ID followed by a \" x\" and the reads counts. e.g. unique ID x counts. alignment: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. Small RNAs with perfect matches to the zebrafish genome Zv8 from Ensembl http://www.ensembl.org were retrieved using megaBLAST http://www.ncbi.nlm.nih.gov/blast/megablast.shtml and Bowtie http://bowtie bio.sourceforge.net/tutorial.shtml. To identify piRNAs consensus sequences from zebrafish repetitive elements were retrieved from Repbase http://www.girinst.org/repbase/index.html and Repeat Maskers using the UCSC genome browser http://genome.ucsc.edu. Small RNAs perfectly mapping to these consensus sequences and their genomic flanking regions were sorted into piRNA libraries with up to 3 genomic mapping positions for each unique RNA sequence. fasta files description: small RNA 15 30 nt alignment file description: piRNA map to repetitive elements", "the whole embryo", null, "Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform.", "Embryos were raised at 28\u00c2\u00b0C in egg water 0.03% Instant Ocean marine salt mix for the initial several hours of development", "strain:AB*WT|developmental stage:sphere|tissue:the whole embryos", "GSM686382", "GSM686382: embryo sphere rep1; Danio rerio; ncRNA Seq", "GSM686382", null, "1", "Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform.", "GEO Accession:GSM686382", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer II", null, "SRP028895", null, null, "GSM686382_Sphere_1_Raw.txt", "fastq", 492502284.0, 13680619.0, "GSM686382 r1", "0:36", "A:114418890;C:99502519;G:142841794;T:135061742;N:677339", 36, null, null, null, 114418890, 99502519, 142841794, 135061742, 677339, "SRX336215", "SRS471209", "SRA098146", "GEO", "Lee Lab, Molecular Biology, Mass General Hospital", 1, 0.00828, null, 0.00636, null, 0.9964, null, 0.54822, null, 36, null, "T", null, "under 1.2% mapping rate", "illumina", "early_illumina", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2011-03-07", "Blastula", "Embryo", "Whole Organism", "All anatomical structures"], [36270, "SRR953573", "SRX336214", "SRS471210", "SRP028895", "PRJNA138095", "Transcriptome wide analysis of small RNA expression in early zebrafish development", "GSE27722", "Transcriptome Analysis", "During early vertebrate development a large number of noncoding RNAs are maternally inherited or expressed upon activation of zygotic transcription. The exact identity expression levels and function during early vertebrate development for most of these noncoding RNAs remains largely unknown. miRNAs microRNAs and piRNAs piwi interacting RNAs are two classes of small non coding RNAs that play important roles in gene regulation during early embryonic development. Here we utilized Illumina next generation sequencing technology to determine temporal expression patterns for both miRNAs and piRNAs during four distinct stages of early vertebrate development using zebrafish as a model system. For miRNAs the expression patterns for 192 known miRNAs and 12 novel miRNAs within 123 different miRNA families were determined. Significant sequence variation was observed at the five prime' and three prime' ends of miRNAs with a large number of extra nucleotides added in a non template directed manner. We also identified a large and diverse set of piRNAs expressed during early development far beyond that expected if piRNA expression is restricted to germ cells. Our analyses represent the deepest investigation to date of small RNA expression during early vertebrate development and suggest important novel functions for small RNAs during embryogenesis. Overall design: Identify the expression of small RNAs in zebrafish embryos of four different developmental stages using high through put sequencing", null, "pubmed:22408181", null, "embryo 256 cell rep1", "GSM686381", null, "source name:the whole embryo|strain:AB* WT|developmental stage:256 cell|tissue:the whole embryos", "embryo 256 cell rep1", "fasta: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. All the sequence with N inside was removed as well. The unique sequences were retained with the counts indicating thier abundance. The header of each sequence is composed of a unique sequence ID followed by a \" x\" and the reads counts. e.g. unique ID x counts. alignment: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. Small RNAs with perfect matches to the zebrafish genome Zv8 from Ensembl http://www.ensembl.org were retrieved using megaBLAST http://www.ncbi.nlm.nih.gov/blast/megablast.shtml and Bowtie http://bowtie bio.sourceforge.net/tutorial.shtml. To identify piRNAs consensus sequences from zebrafish repetitive elements were retrieved from Repbase http://www.girinst.org/repbase/index.html and Repeat Maskers using the UCSC genome browser http://genome.ucsc.edu. Small RNAs perfectly mapping to these consensus sequences and their genomic flanking regions were sorted into piRNA libraries with up to 3 genomic mapping positions for each unique RNA sequence. fasta files description: small RNA 15 30 nt alignment file description: piRNA map to repetitive elements", "the whole embryo", null, "Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform.", "Embryos were raised at 28\u00c2\u00b0C in egg water 0.03% Instant Ocean marine salt mix for the initial several hours of development", "strain:AB* WT|developmental stage:256 cell|tissue:the whole embryos", "GSM686381", "GSM686381: embryo 256 cell rep1; Danio rerio; ncRNA Seq", "GSM686381", null, "1", "Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform.", "GEO Accession:GSM686381", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer II", null, "SRP028895", null, null, "GSM686381_256-cell_Raw.txt", "fastq", 177430716.0, 4928631.0, "GSM686381 r1", "0:36", "A:46047586;C:39494059;G:46591098;T:42305117;N:2992856", 36, null, null, null, 46047586, 39494059, 46591098, 42305117, 2992856, "SRX336214", "SRS471210", "SRA098146", "GEO", "Lee Lab, Molecular Biology, Mass General Hospital", 1, 0.01914, null, 0.01515, null, 0.99164, null, 0.52579, null, 36, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2011-03-07", "Blastula", "Embryo", "Whole Organism", "All anatomical structures"], [55851, "SRR10863004", "SRX7533076", "SRS5972269", "SRP241074", "PRJNA597223", "Danio rerio primordial germ cell expression pofiling", "PRJNA597223", "Whole Genome Sequencing", "Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.", null, null, "The vasa:eGFP line Kr\u00f8vel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200\u00b5l low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 \u00b5m siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85\u00b5m nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80\u00b0C until library preparation was done.", null, "wt PGCs 2dpf rep1", null, "strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:2dpf|dev stage:Long pec stage|sex:not applicable|tissue:germline|biological replicate:replicate 1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "small RNA of Zebrafish: PGCs 2dpf", "imb ketting 2018 03 redl smRNA 04 07 2dpf PGCs rep1 S4.R1", "imb ketting 2018 03 redl smRNA 04 07 2dpf PGCs rep1 S4.R1", "Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.", null, null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP241074", null, null, "imb_ketting_2018_03_redl_smRNA_04_07_2dpf_PGCs_rep1_S4.R1.fastq.gz", "fastq", 3376468872.0, 40196058.0, "imb ketting 2018 03 redl smRNA 04 07 2dpf PGCs rep1 S4.R1.fastq.gz", "0:84 1:0", "A:844908938;C:858861843;G:817445857;T:855220450;N:31784", 84, 0, null, null, 844908938, 858861843, 817445857, 855220450, 31784, "SRX7533076", "SRS5972269", "SRA1023320", "Rene Ketting group|Ketting Lab", "Rene Ketting group", 1, 0.0005, null, 3e-05, null, 0.99922, null, 0.65853, null, 84, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2020-01-10", "Hatching", "Embryo", "Whole Organism", "All anatomical structures"], [55862, "SRR10863003", "SRX7533065", "SRS5972268", "SRP241074", "PRJNA597223", "Danio rerio primordial germ cell expression pofiling", "PRJNA597223", "Whole Genome Sequencing", "Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.", null, null, "The vasa:eGFP line Kr\u00f8vel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200\u00b5l low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 \u00b5m siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85\u00b5m nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80\u00b0C until library preparation was done.", null, "wt PGCs 1dpf rep3", null, "strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:1dpf|dev stage:Pharyngula period|sex:not applicable|tissue:germline|biological replicate:replicate 3|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "small RNA of Zebrafish: PGCs 1dpf", "imb ketting 2018 03 redl smRNA 03 20 1dpf PGCs rep3 S3.R1", "imb ketting 2018 03 redl smRNA 03 20 1dpf PGCs rep3 S3.R1", "Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.", null, null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP241074", null, null, "imb_ketting_2018_03_redl_smRNA_03_20_1dpf_PGCs_rep3_S3.R1.fastq.gz", "fastq", 3136475328.0, 37338992.0, "imb ketting 2018 03 redl smRNA 03 20 1dpf PGCs rep3 S3.R1.fastq.gz", "0:84 1:0", "A:743596563;C:770089055;G:796526363;T:826235723;N:27624", 84, 0, null, null, 743596563, 770089055, 796526363, 826235723, 27624, "SRX7533065", "SRS5972268", "SRA1023320", "Rene Ketting group|Ketting Lab", "Rene Ketting group", 1, 0.00094, null, 2e-05, null, 0.999, null, 0.69871, null, 84, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2020-01-10", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55872, "SRR10863015", "SRX7533055", "SRS5972267", "SRP241074", "PRJNA597223", "Danio rerio primordial germ cell expression pofiling", "PRJNA597223", "Whole Genome Sequencing", "Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.", null, null, "The vasa:eGFP line Kr\u00f8vel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200\u00b5l low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 \u00b5m siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85\u00b5m nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80\u00b0C until library preparation was done.", null, "wt PGCs 1dpf rep2", null, "strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:1dpf|dev stage:Pharyngula period|sex:not applicable|tissue:germline|biological replicate:replicate 2|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "small RNA of Zebrafish: PGCs 1dpf", "imb ketting 2018 03 redl smRNA 02 30 1dpf PGCs rep2 S2.R1", "imb ketting 2018 03 redl smRNA 02 30 1dpf PGCs rep2 S2.R1", "Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.", null, null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP241074", null, null, "imb_ketting_2018_03_redl_smRNA_02_30_1dpf_PGCs_rep2_S2.R1.fastq.gz", "fastq", 3186833832.0, 37938498.0, "imb ketting 2018 03 redl smRNA 02 30 1dpf PGCs rep2 S2.R1.fastq.gz", "0:84 1:0", "A:772047868;C:764764928;G:803857310;T:846133704;N:30022", 84, 0, null, null, 772047868, 764764928, 803857310, 846133704, 30022, "SRX7533055", "SRS5972267", "SRA1023320", "Rene Ketting group|Ketting Lab", "Rene Ketting group", 1, 0.00072, null, 1e-05, null, 0.99922, null, 0.65573, null, 84, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2020-01-10", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55882, "SRR10863050", "SRX7533045", "SRS5972243", "SRP241074", "PRJNA597223", "Danio rerio primordial germ cell expression pofiling", "PRJNA597223", "Whole Genome Sequencing", "Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.", null, null, "The vasa:eGFP line Kr\u00f8vel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200\u00b5l low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 \u00b5m siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85\u00b5m nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80\u00b0C until library preparation was done.", null, "wt PGCs 3dpf rep2", null, "strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:3dpf|dev stage:protruding mouth|sex:not applicable|tissue:germline|biological replicate:replicate 2|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "small RNA of Zebrafish: PGCs 3dpf", "imb ketting 2018 03 redl smRNA 08 46 3dpf PGCs rep2 S8.R1", "imb ketting 2018 03 redl smRNA 08 46 3dpf PGCs rep2 S8.R1", "Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.", null, null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP241074", null, null, "imb_ketting_2018_03_redl_smRNA_08_46_3dpf_PGCs_rep2_S8.R1.fastq.gz", "fastq", 3852707292.0, 45865563.0, "imb ketting 2018 03 redl smRNA 08 46 3dpf PGCs rep2 S8.R1.fastq.gz", "0:84 1:0", "A:980860932;C:926253063;G:920737181;T:1024819575;N:36541", 84, 0, null, null, 980860932, 926253063, 920737181, 1024819575, 36541, "SRX7533045", "SRS5972243", "SRA1023320", "Rene Ketting group|Ketting Lab", "Rene Ketting group", 1, 0.00017, null, 2e-05, null, 0.99963, null, 0.75, null, 84, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2020-01-10", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [55883, "SRR10863025", "SRX7533044", "SRS5972254", "SRP241074", "PRJNA597223", "Danio rerio primordial germ cell expression pofiling", "PRJNA597223", "Whole Genome Sequencing", "Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.", null, null, "The vasa:eGFP line Kr\u00f8vel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200\u00b5l low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 \u00b5m siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85\u00b5m nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80\u00b0C until library preparation was done.", null, "wt zygote 0hpf rep2", null, "strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:0hpf|dev stage:zygote|sex:not applicable|tissue:whole embryo|biological replicate:replicate 2|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "small RNA of Zebrafish: zygotes 0hpf", "imb ketting 2018 19 redl smRNA 07 0hpf zygotes rep2 S30.R1", "imb ketting 2018 19 redl smRNA 07 0hpf zygotes rep2 S30.R1", "Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.", null, null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP241074", null, null, "imb_ketting_2018_19_redl_smRNA-07_0hpf_zygotes_rep2_S30.R1.fastq.gz", "fastq", 1083028275.0, 14440377.0, "imb ketting 2018 19 redl smRNA 07 0hpf zygotes rep2 S30.R1.fastq.gz", "0:75 1:0", "A:261596209;C:277009311;G:258733780;T:285678456;N:10519", 75, 0, null, null, 261596209, 277009311, 258733780, 285678456, 10519, "SRX7533044", "SRS5972254", "SRA1023320", "Rene Ketting group|Ketting Lab", "Rene Ketting group", 1, 0.00065, null, 8e-05, null, 0.99906, null, 0.73076, null, 75, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2020-01-10", "Zygote", "Embryo", "Whole Organism", "All anatomical structures"], [55884, "SRR10863026", "SRX7533043", "SRS5972253", "SRP241074", "PRJNA597223", "Danio rerio primordial germ cell expression pofiling", "PRJNA597223", "Whole Genome Sequencing", "Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.", null, null, "The vasa:eGFP line Kr\u00f8vel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200\u00b5l low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 \u00b5m siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85\u00b5m nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80\u00b0C until library preparation was done.", null, "wt zygote 0hpf rep1", null, "strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:0hpf|dev stage:zygote|sex:not applicable|tissue:whole embryo|biological replicate:replicate 1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "small RNA of Zebrafish: zygotes 0hpf", "imb ketting 2018 19 redl smRNA 06 0hpf zygotes rep1 S29.R1", "imb ketting 2018 19 redl smRNA 06 0hpf zygotes rep1 S29.R1", "Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.", null, null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP241074", null, null, "imb_ketting_2018_19_redl_smRNA-06_0hpf_zygotes_rep1_S29.R1.fastq.gz", "fastq", 1094583075.0, 14594441.0, "imb ketting 2018 19 redl smRNA 06 0hpf zygotes rep1 S29.R1.fastq.gz", "0:75 1:0", "A:272231426;C:272258006;G:282795391;T:267287656;N:10596", 75, 0, null, null, 272231426, 272258006, 282795391, 267287656, 10596, "SRX7533043", "SRS5972253", "SRA1023320", "Rene Ketting group|Ketting Lab", "Rene Ketting group", 1, 0.00035, null, 7e-05, null, 0.99935, null, 0.63043, null, 75, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2020-01-10", "Zygote", "Embryo", "Whole Organism", "All anatomical structures"], [55887, "SRR10863028", "SRX7533040", "SRS5972265", "SRP241074", "PRJNA597223", "Danio rerio primordial germ cell expression pofiling", "PRJNA597223", "Whole Genome Sequencing", "Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.", null, null, "The vasa:eGFP line Kr\u00f8vel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200\u00b5l low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 \u00b5m siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85\u00b5m nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80\u00b0C until library preparation was done.", null, "wt PGCs 1dpf rep1", null, "strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:1dpf|dev stage:Pharyngula period|sex:not applicable|tissue:germline|biological replicate:replicate 1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "small RNA of Zebrafish: PGCs 1dpf", "imb ketting 2018 03 redl smRNA 01 24 1dpf PGCs rep1 S1.R1", "imb ketting 2018 03 redl smRNA 01 24 1dpf PGCs rep1 S1.R1", "Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.", null, null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP241074", null, null, "imb_ketting_2018_03_redl_smRNA_01_24_1dpf_PGCs_rep1_S1.R1.fastq.gz", "fastq", 2999534160.0, 35708740.0, "imb ketting 2018 03 redl smRNA 01 24 1dpf PGCs rep1 S1.R1.fastq.gz", "0:84 1:0", "A:763136061;C:754741465;G:717861943;T:763766703;N:27988", 84, 0, null, null, 763136061, 754741465, 717861943, 763766703, 27988, "SRX7533040", "SRS5972265", "SRA1023320", "Rene Ketting group|Ketting Lab", "Rene Ketting group", 1, 0.00031, null, 0.0, null, 0.99945, null, 0.59259, null, 84, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2020-01-10", "Pharyngula", "Embryo", "Whole Organism", "All anatomical structures"], [55898, "SRR10863039", "SRX7533029", "SRS5972255", "SRP241074", "PRJNA597223", "Danio rerio primordial germ cell expression pofiling", "PRJNA597223", "Whole Genome Sequencing", "Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.", null, null, "The vasa:eGFP line Kr\u00f8vel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200\u00b5l low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 \u00b5m siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85\u00b5m nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80\u00b0C until library preparation was done.", null, "wt zygote 0hpf rep3", null, "strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:0hpf|dev stage:zygote|sex:not applicable|tissue:whole embryo|biological replicate:replicate 3|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "small RNA of Zebrafish: zygotes 0hpf", "imb ketting 2018 19 redl smRNA 08 0hpf zygotes rep3 S31.R1", "imb ketting 2018 19 redl smRNA 08 0hpf zygotes rep3 S31.R1", "Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.", null, null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP241074", null, null, "imb_ketting_2018_19_redl_smRNA-08_0hpf_zygotes_rep3_S31.R1.fastq.gz", "fastq", 1174146225.0, 15655283.0, "imb ketting 2018 19 redl smRNA 08 0hpf zygotes rep3 S31.R1.fastq.gz", "0:75 1:0", "A:275690402;C:320014688;G:295706949;T:282722725;N:11461", 75, 0, null, null, 275690402, 320014688, 295706949, 282722725, 11461, "SRX7533029", "SRS5972255", "SRA1023320", "Rene Ketting group|Ketting Lab", "Rene Ketting group", 1, 0.00017, null, 2e-05, null, 0.99977, null, 0.26315, null, 75, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2020-01-10", "Zygote", "Embryo", "Whole Organism", "All anatomical structures"], [55901, "SRR10863042", "SRX7533026", "SRS5972251", "SRP241074", "PRJNA597223", "Danio rerio primordial germ cell expression pofiling", "PRJNA597223", "Whole Genome Sequencing", "Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.", null, null, "The vasa:eGFP line Kr\u00f8vel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200\u00b5l low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 \u00b5m siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85\u00b5m nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80\u00b0C until library preparation was done.", null, "wt PGCs 10dpf rep3", null, "strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:10dpf|dev stage:larval|sex:not applicable|tissue:germline|biological replicate:replicate 3|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "small RNA of Zebrafish: PGCs 10dpf", "imb ketting 2018 19 redl smRNA 05 10dpf PGCs rep3 S28.R1", "imb ketting 2018 19 redl smRNA 05 10dpf PGCs rep3 S28.R1", "Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.", null, null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP241074", null, null, "imb_ketting_2018_19_redl_smRNA-05_10dpf_PGCs_rep3_S28.R1.fastq.gz", "fastq", 1042531125.0, 13900415.0, "imb ketting 2018 19 redl smRNA 05 10dpf PGCs rep3 S28.R1.fastq.gz", "0:75 1:0", "A:256767457;C:264830616;G:280326422;T:240596693;N:9937", 75, 0, null, null, 256767457, 264830616, 280326422, 240596693, 9937, "SRX7533026", "SRS5972251", "SRA1023320", "Rene Ketting group|Ketting Lab", "Rene Ketting group", 1, 9e-05, null, 3e-05, null, 0.99981, null, 0.55555, null, 75, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2020-01-10", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [55902, "SRR10863043", "SRX7533025", "SRS5972250", "SRP241074", "PRJNA597223", "Danio rerio primordial germ cell expression pofiling", "PRJNA597223", "Whole Genome Sequencing", "Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.", null, null, "The vasa:eGFP line Kr\u00f8vel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200\u00b5l low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 \u00b5m siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85\u00b5m nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80\u00b0C until library preparation was done.", null, "wt PGCs 10dpf rep2", null, "strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:10dpf|dev stage:larval|sex:not applicable|tissue:germline|biological replicate:replicate 2|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "small RNA of Zebrafish: PGCs 10dpf", "imb ketting 2018 19 redl smRNA 04 10dpf PGCs rep2 S27.R1", "imb ketting 2018 19 redl smRNA 04 10dpf PGCs rep2 S27.R1", "Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.", null, null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP241074", null, null, "imb_ketting_2018_19_redl_smRNA-04_10dpf_PGCs_rep2_S27.R1.fastq.gz", "fastq", 1011225675.0, 13483009.0, "imb ketting 2018 19 redl smRNA 04 10dpf PGCs rep2 S27.R1.fastq.gz", "0:75 1:0", "A:249509861;C:240472285;G:259641490;T:261592569;N:9470", 75, 0, null, null, 249509861, 240472285, 259641490, 261592569, 9470, "SRX7533025", "SRS5972250", "SRA1023320", "Rene Ketting group|Ketting Lab", "Rene Ketting group", 1, 0.0001, null, 3e-05, null, 0.99981, null, 0.6, null, 75, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2020-01-10", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [55903, "SRR10863047", "SRX7533024", "SRS5972249", "SRP241074", "PRJNA597223", "Danio rerio primordial germ cell expression pofiling", "PRJNA597223", "Whole Genome Sequencing", "Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.", null, null, "The vasa:eGFP line Kr\u00f8vel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200\u00b5l low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 \u00b5m siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85\u00b5m nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80\u00b0C until library preparation was done.", null, "wt PGCs 10dpf rep1", null, "strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:10dpf|dev stage:larval|sex:not applicable|tissue:germline|biological replicate:replicate 1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "small RNA of Zebrafish: PGCs 10dpf", "imb ketting 2018 19 redl smRNA 03 10dpf PGCs rep1 S26.R1", "imb ketting 2018 19 redl smRNA 03 10dpf PGCs rep1 S26.R1", "Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.", null, null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP241074", null, null, "imb_ketting_2018_19_redl_smRNA-03_10dpf_PGCs_rep1_S26.R1.fastq.gz", "fastq", 1084119750.0, 14454930.0, "imb ketting 2018 19 redl smRNA 03 10dpf PGCs rep1 S26.R1.fastq.gz", "0:75 1:0", "A:284983733;C:273119022;G:259385750;T:266620639;N:10606", 75, 0, null, null, 284983733, 273119022, 259385750, 266620639, 10606, "SRX7533024", "SRS5972249", "SRA1023320", "Rene Ketting group|Ketting Lab", "Rene Ketting group", 1, 7e-05, null, 4e-05, null, 0.99991, null, 1.0, null, 75, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2020-01-10", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [55904, "SRR10863044", "SRX7533023", "SRS5972248", "SRP241074", "PRJNA597223", "Danio rerio primordial germ cell expression pofiling", "PRJNA597223", "Whole Genome Sequencing", "Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.", null, null, "The vasa:eGFP line Kr\u00f8vel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200\u00b5l low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 \u00b5m siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85\u00b5m nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80\u00b0C until library preparation was done.", null, "wt PGCs 6dpf rep3", null, "strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:6dpf|dev stage:larval|sex:not applicable|tissue:germline|biological replicate:replicate 3|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "small RNA of Zebrafish: PGCs 6dpf", "imb ketting 2018 03 redl smRNA 12 57 6dpf PGCs rep3 S12.R1", "imb ketting 2018 03 redl smRNA 12 57 6dpf PGCs rep3 S12.R1", "Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.", null, null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP241074", null, null, "imb_ketting_2018_03_redl_smRNA_12_57_6dpf_PGCs_rep3_S12.R1.fastq.gz", "fastq", 3431563044.0, 40851941.0, "imb ketting 2018 03 redl smRNA 12 57 6dpf PGCs rep3 S12.R1.fastq.gz", "0:84 1:0", "A:823584243;C:893116880;G:899744072;T:815086020;N:31829", 84, 0, null, null, 823584243, 893116880, 899744072, 815086020, 31829, "SRX7533023", "SRS5972248", "SRA1023320", "Rene Ketting group|Ketting Lab", "Rene Ketting group", 1, 0.00011, null, 0.0, null, 0.99969, null, 0.7647, null, 84, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2020-01-10", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [55905, "SRR10863045", "SRX7533022", "SRS5972247", "SRP241074", "PRJNA597223", "Danio rerio primordial germ cell expression pofiling", "PRJNA597223", "Whole Genome Sequencing", "Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.", null, null, "The vasa:eGFP line Kr\u00f8vel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200\u00b5l low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 \u00b5m siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85\u00b5m nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80\u00b0C until library preparation was done.", null, "wt PGCs 6dpf rep2", null, "strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:6dpf|dev stage:larval|sex:not applicable|tissue:germline|biological replicate:replicate 2|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "small RNA of Zebrafish: PGCs 6dpf", "imb ketting 2018 03 redl smRNA 11 16 6dpf PGCs rep2 S11.R1", "imb ketting 2018 03 redl smRNA 11 16 6dpf PGCs rep2 S11.R1", "Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.", null, null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP241074", null, null, "imb_ketting_2018_03_redl_smRNA_11_16_6dpf_PGCs_rep2_S11.R1.fastq.gz", "fastq", 3706743516.0, 44127899.0, "imb ketting 2018 03 redl smRNA 11 16 6dpf PGCs rep2 S11.R1.fastq.gz", "0:84 1:0", "A:934342251;C:847639723;G:983363359;T:941363616;N:34567", 84, 0, null, null, 934342251, 847639723, 983363359, 941363616, 34567, "SRX7533022", "SRS5972247", "SRA1023320", "Rene Ketting group|Ketting Lab", "Rene Ketting group", 1, 0.00015, null, 1e-05, null, 0.99969, null, 0.79166, null, 84, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2020-01-10", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [55906, "SRR10863046", "SRX7533021", "SRS5972246", "SRP241074", "PRJNA597223", "Danio rerio primordial germ cell expression pofiling", "PRJNA597223", "Whole Genome Sequencing", "Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.", null, null, "The vasa:eGFP line Kr\u00f8vel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200\u00b5l low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 \u00b5m siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85\u00b5m nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80\u00b0C until library preparation was done.", null, "wt PGCs 6dpf rep1", null, "strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:6dpf|dev stage:larval|sex:not applicable|tissue:germline|biological replicate:replicate 1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "small RNA of Zebrafish: PGCs 6dpf", "imb ketting 2018 03 redl smRNA 10 15 6dpf PGCs rep1 S10.R1", "imb ketting 2018 03 redl smRNA 10 15 6dpf PGCs rep1 S10.R1", "Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.", null, null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP241074", null, null, "imb_ketting_2018_03_redl_smRNA_10_15_6dpf_PGCs_rep1_S10.R1.fastq.gz", "fastq", 4114543692.0, 48982663.0, "imb ketting 2018 03 redl smRNA 10 15 6dpf PGCs rep1 S10.R1.fastq.gz", "0:84 1:0", "A:993905308;C:987610832;G:993056368;T:1139933198;N:37986", 84, 0, null, null, 993905308, 987610832, 993056368, 1139933198, 37986, "SRX7533021", "SRS5972246", "SRA1023320", "Rene Ketting group|Ketting Lab", "Rene Ketting group", 1, 0.00012, null, 1e-05, null, 0.99973, null, 0.61111, null, 84, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2020-01-10", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [55907, "SRR10863048", "SRX7533020", "SRS5972245", "SRP241074", "PRJNA597223", "Danio rerio primordial germ cell expression pofiling", "PRJNA597223", "Whole Genome Sequencing", "Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.", null, null, "The vasa:eGFP line Kr\u00f8vel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200\u00b5l low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 \u00b5m siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85\u00b5m nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80\u00b0C until library preparation was done.", null, "wt PGCs 3dpf rep3", null, "strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:3dpf|dev stage:protruding mouth|sex:not applicable|tissue:germline|biological replicate:replicate 3|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "small RNA of Zebrafish: PGCs 3dpf", "imb ketting 2018 03 redl smRNA 09 52 3dpf PGCs rep3 S9.R1", "imb ketting 2018 03 redl smRNA 09 52 3dpf PGCs rep3 S9.R1", "Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.", null, null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP241074", null, null, "imb_ketting_2018_03_redl_smRNA_09_52_3dpf_PGCs_rep3_S9.R1.fastq.gz", "fastq", 3765506136.0, 44827454.0, "imb ketting 2018 03 redl smRNA 09 52 3dpf PGCs rep3 S9.R1.fastq.gz", "0:84 1:0", "A:958464986;C:904515238;G:945479893;T:957010792;N:35227", 84, 0, null, null, 958464986, 904515238, 945479893, 957010792, 35227, "SRX7533020", "SRS5972245", "SRA1023320", "Rene Ketting group|Ketting Lab", "Rene Ketting group", 1, 0.00026, null, 2e-05, null, 0.99953, null, 0.74418, null, 84, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2020-01-10", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [55908, "SRR10863049", "SRX7533019", "SRS5972242", "SRP241074", "PRJNA597223", "Danio rerio primordial germ cell expression pofiling", "PRJNA597223", "Whole Genome Sequencing", "Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.", null, null, "The vasa:eGFP line Kr\u00f8vel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200\u00b5l low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 \u00b5m siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85\u00b5m nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80\u00b0C until library preparation was done.", null, "wt PGCs 3dpf rep1", null, "strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:3dpf|dev stage:protruding mouth|sex:not applicable|tissue:germline|biological replicate:replicate 1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "small RNA of Zebrafish: PGCs 3dpf", "imb ketting 2018 03 redl smRNA 07 32 3dpf PGCs rep1 S7.R1", "imb ketting 2018 03 redl smRNA 07 32 3dpf PGCs rep1 S7.R1", "Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.", null, null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP241074", null, null, "imb_ketting_2018_03_redl_smRNA_07_32_3dpf_PGCs_rep1_S7.R1.fastq.gz", "fastq", 3698150988.0, 44025607.0, "imb ketting 2018 03 redl smRNA 07 32 3dpf PGCs rep1 S7.R1.fastq.gz", "0:84 1:0", "A:953164627;C:924016680;G:885078395;T:935856295;N:34991", 84, 0, null, null, 953164627, 924016680, 885078395, 935856295, 34991, "SRX7533019", "SRS5972242", "SRA1023320", "Rene Ketting group|Ketting Lab", "Rene Ketting group", 1, 0.0001, null, 1e-05, null, 0.99973, null, 0.57142, null, 84, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2020-01-10", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [55909, "SRR10863051", "SRX7533018", "SRS5972252", "SRP241074", "PRJNA597223", "Danio rerio primordial germ cell expression pofiling", "PRJNA597223", "Whole Genome Sequencing", "Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.", null, null, "The vasa:eGFP line Kr\u00f8vel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200\u00b5l low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 \u00b5m siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85\u00b5m nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80\u00b0C until library preparation was done.", null, "wt PGCs 2dpf rep3", null, "strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:2dpf|dev stage:Long pec stage|sex:not applicable|tissue:germline|biological replicate:replicate 3|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "small RNA of Zebrafish: PGCs 2dpf", "imb ketting 2018 03 redl smRNA 06 61 2dpf PGCs rep3 S6.R1", "imb ketting 2018 03 redl smRNA 06 61 2dpf PGCs rep3 S6.R1", "Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.", null, null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP241074", null, null, "imb_ketting_2018_03_redl_smRNA_06_61_2dpf_PGCs_rep3_S6.R1.fastq.gz", "fastq", 3454014564.0, 41119221.0, "imb ketting 2018 03 redl smRNA 06 61 2dpf PGCs rep3 S6.R1.fastq.gz", "0:84 1:0", "A:806393586;C:867601464;G:910506431;T:869481915;N:31168", 84, 0, null, null, 806393586, 867601464, 910506431, 869481915, 31168, "SRX7533018", "SRS5972252", "SRA1023320", "Rene Ketting group|Ketting Lab", "Rene Ketting group", 1, 0.00017, null, 1e-05, null, 0.99961, null, 0.65384, null, 84, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2020-01-10", "Hatching", "Embryo", "Whole Organism", "All anatomical structures"], [55917, "SRR10863059", "SRX7533010", "SRS5972244", "SRP241074", "PRJNA597223", "Danio rerio primordial germ cell expression pofiling", "PRJNA597223", "Whole Genome Sequencing", "Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation.", null, null, "The vasa:eGFP line Kr\u00f8vel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200\u00b5l low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 \u00b5m siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85\u00b5m nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80\u00b0C until library preparation was done.", null, "wt PGCs 2dpf rep2", null, "strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:2dpf|dev stage:Long pec stage|sex:not applicable|tissue:germline|biological replicate:replicate 2|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "small RNA of Zebrafish: PGCs 2dpf", "imb ketting 2018 03 redl smRNA 05 22 2dpf PGCs rep2 S5.R1", "imb ketting 2018 03 redl smRNA 05 22 2dpf PGCs rep2 S5.R1", "Next Flex small RNA seq kit v3 from BIOO scientific starting from 1ng of total RNA. Followed the protocol version V16.06 diluting the adaptors for ligation and using 25 PCR cycles for library amplification. The library was size selected using an 8% TBE gel and the library fragments of 146 168bp corresponding to insert sizes of 18 40bp were recovered and purified.", null, null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP241074", null, null, "imb_ketting_2018_03_redl_smRNA_05_22_2dpf_PGCs_rep2_S5.R1.fastq.gz", "fastq", 3308645424.0, 39388636.0, "imb ketting 2018 03 redl smRNA 05 22 2dpf PGCs rep2 S5.R1.fastq.gz", "0:84 1:0", "A:854995750;C:785730518;G:836451916;T:831436561;N:30679", 84, 0, null, null, 854995750, 785730518, 836451916, 831436561, 30679, "SRX7533010", "SRS5972244", "SRA1023320", "Rene Ketting group|Ketting Lab", "Rene Ketting group", 1, 0.0004, null, 2e-05, null, 0.99939, null, 0.73846, null, 84, null, "T", null, "under 1.2% mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2020-01-10", "Hatching", "Embryo", "Whole Organism", "All anatomical structures"], [57067, "SRR11214402", "SRX7826914", "SRS6238049", "SRP251256", "PRJNA609696", "Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]", "GSE146200", "Transcriptome Analysis", "Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6\u00b5M for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.", "parent bioproject:PRJNA609691", "pubmed:28962522", null, "JD18 [miRNA seq]", "GSM4368082", null, "source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6\u03bcM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA", "JD18 [miRNA seq]", "The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; \"abundance normalised\" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.", "30 pooled larvae 5dpf triptolide for 6 h", "5 dpf larvae N\u2009=\u200930 were treated per 50\u2009ml dish for 6\u2009h with a TP concentration of 0 \u00b5M 8 dishes or 1.6 \u00b5M 8 dishes", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6\u03bcM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA", "GSM4368082", "GSM4368082: JD18 [miRNA seq]; Danio rerio; ncRNA Seq", "GSM4368082", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4368082", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251256", null, null, "small_JD18.combined.fastq.gz", "fastq", 702201000.0, 14044020.0, "GSM4368082 r1", "0:50 1:0", "A:165610842;C:167169519;G:192886323;T:176528538;N:5778", 50, 0, null, null, 165610842, 167169519, 192886323, 176528538, 5778, "SRX7826914", "SRS6238049", "SRA1049684", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.06331, null, 0.00756, null, 0.99153, null, 0.5451, null, 50, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2020-03-02", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [57068, "SRR11214401", "SRX7826913", "SRS6238048", "SRP251256", "PRJNA609696", "Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]", "GSE146200", "Transcriptome Analysis", "Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6\u00b5M for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.", "parent bioproject:PRJNA609691", "pubmed:28962522", null, "JD17 [miRNA seq]", "GSM4368081", null, "source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6\u03bcM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA", "JD17 [miRNA seq]", "The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; \"abundance normalised\" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.", "30 pooled larvae 5dpf triptolide for 6 h", "5 dpf larvae N\u2009=\u200930 were treated per 50\u2009ml dish for 6\u2009h with a TP concentration of 0 \u00b5M 8 dishes or 1.6 \u00b5M 8 dishes", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6\u03bcM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA", "GSM4368081", "GSM4368081: JD17 [miRNA seq]; Danio rerio; ncRNA Seq", "GSM4368081", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4368081", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251256", null, null, "small_JD17.combined.fastq.gz", "fastq", 429694400.0, 8593888.0, "GSM4368081 r1", "0:50 1:0", "A:105670449;C:101354858;G:115926173;T:106739304;N:3616", 50, 0, null, null, 105670449, 101354858, 115926173, 106739304, 3616, "SRX7826913", "SRS6238048", "SRA1049684", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.04686, null, 0.00437, null, 0.99389, null, 0.53154, null, 50, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2020-03-02", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [57069, "SRR11214400", "SRX7826912", "SRS6238047", "SRP251256", "PRJNA609696", "Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]", "GSE146200", "Transcriptome Analysis", "Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6\u00b5M for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.", "parent bioproject:PRJNA609691", "pubmed:28962522", null, "JD16 [miRNA seq]", "GSM4368080", null, "source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6\u03bcM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA", "JD16 [miRNA seq]", "The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; \"abundance normalised\" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.", "30 pooled larvae 5dpf triptolide for 6 h", "5 dpf larvae N\u2009=\u200930 were treated per 50\u2009ml dish for 6\u2009h with a TP concentration of 0 \u00b5M 8 dishes or 1.6 \u00b5M 8 dishes", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6\u03bcM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA", "GSM4368080", "GSM4368080: JD16 [miRNA seq]; Danio rerio; ncRNA Seq", "GSM4368080", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4368080", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251256", null, null, "small_JD16.combined.fastq.gz", "fastq", 381826650.0, 7636533.0, "GSM4368080 r1", "0:50 1:0", "A:92578473;C:90665066;G:103254018;T:95325823;N:3270", 50, 0, null, null, 92578473, 90665066, 103254018, 95325823, 3270, "SRX7826912", "SRS6238047", "SRA1049684", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.07185, null, 0.00402, null, 0.99419, null, 0.49823, null, 50, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2020-03-02", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [57070, "SRR11214399", "SRX7826911", "SRS6238046", "SRP251256", "PRJNA609696", "Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]", "GSE146200", "Transcriptome Analysis", "Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6\u00b5M for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.", "parent bioproject:PRJNA609691", "pubmed:28962522", null, "JD15 [miRNA seq]", "GSM4368079", null, "source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6\u03bcM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA", "JD15 [miRNA seq]", "The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; \"abundance normalised\" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.", "30 pooled larvae 5dpf triptolide for 6 h", "5 dpf larvae N\u2009=\u200930 were treated per 50\u2009ml dish for 6\u2009h with a TP concentration of 0 \u00b5M 8 dishes or 1.6 \u00b5M 8 dishes", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6\u03bcM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA", "GSM4368079", "GSM4368079: JD15 [miRNA seq]; Danio rerio; ncRNA Seq", "GSM4368079", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4368079", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251256", null, null, "small_JD15.combined.fastq.gz", "fastq", 285535900.0, 5710718.0, "GSM4368079 r1", "0:50 1:0", "A:68624024;C:67839672;G:77291276;T:71778522;N:2406", 50, 0, null, null, 68624024, 67839672, 77291276, 71778522, 2406, "SRX7826911", "SRS6238046", "SRA1049684", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.07651, null, 0.00425, null, 0.99407, null, 0.54635, null, 50, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2020-03-02", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [57071, "SRR11214398", "SRX7826910", "SRS6238045", "SRP251256", "PRJNA609696", "Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]", "GSE146200", "Transcriptome Analysis", "Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6\u00b5M for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.", "parent bioproject:PRJNA609691", "pubmed:28962522", null, "JD14 [miRNA seq]", "GSM4368078", null, "source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6\u03bcM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA", "JD14 [miRNA seq]", "The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; \"abundance normalised\" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.", "30 pooled larvae 5dpf triptolide for 6 h", "5 dpf larvae N\u2009=\u200930 were treated per 50\u2009ml dish for 6\u2009h with a TP concentration of 0 \u00b5M 8 dishes or 1.6 \u00b5M 8 dishes", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6\u03bcM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA", "GSM4368078", "GSM4368078: JD14 [miRNA seq]; Danio rerio; ncRNA Seq", "GSM4368078", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4368078", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251256", null, null, "small_JD14.combined.fastq.gz", "fastq", 363231350.0, 7264627.0, "GSM4368078 r1", "0:50 1:0", "A:87298047;C:86511359;G:98123632;T:91295160;N:3152", 50, 0, null, null, 87298047, 86511359, 98123632, 91295160, 3152, "SRX7826910", "SRS6238045", "SRA1049684", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.07156, null, 0.00417, null, 0.99314, null, 0.49982, null, 50, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2020-03-02", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [57072, "SRR11214397", "SRX7826909", "SRS6238044", "SRP251256", "PRJNA609696", "Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]", "GSE146200", "Transcriptome Analysis", "Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6\u00b5M for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.", "parent bioproject:PRJNA609691", "pubmed:28962522", null, "JD13 [miRNA seq]", "GSM4368077", null, "source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6\u03bcM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA", "JD13 [miRNA seq]", "The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; \"abundance normalised\" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.", "30 pooled larvae 5dpf triptolide for 6 h", "5 dpf larvae N\u2009=\u200930 were treated per 50\u2009ml dish for 6\u2009h with a TP concentration of 0 \u00b5M 8 dishes or 1.6 \u00b5M 8 dishes", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6\u03bcM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA", "GSM4368077", "GSM4368077: JD13 [miRNA seq]; Danio rerio; ncRNA Seq", "GSM4368077", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4368077", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251256", null, null, "small_JD13.combined.fastq.gz", "fastq", 280852650.0, 5617053.0, "GSM4368077 r1", "0:50 1:0", "A:66976453;C:66985314;G:76111707;T:70776819;N:2357", 50, 0, null, null, 66976453, 66985314, 76111707, 70776819, 2357, "SRX7826909", "SRS6238044", "SRA1049684", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.0785, null, 0.00403, null, 0.99454, null, 0.53818, null, 50, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2020-03-02", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [57073, "SRR11214396", "SRX7826908", "SRS6238043", "SRP251256", "PRJNA609696", "Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]", "GSE146200", "Transcriptome Analysis", "Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6\u00b5M for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.", "parent bioproject:PRJNA609691", "pubmed:28962522", null, "JD12 [miRNA seq]", "GSM4368076", null, "source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6\u03bcM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA", "JD12 [miRNA seq]", "The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; \"abundance normalised\" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.", "30 pooled larvae 5dpf triptolide for 6 h", "5 dpf larvae N\u2009=\u200930 were treated per 50\u2009ml dish for 6\u2009h with a TP concentration of 0 \u00b5M 8 dishes or 1.6 \u00b5M 8 dishes", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6\u03bcM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA", "GSM4368076", "GSM4368076: JD12 [miRNA seq]; Danio rerio; ncRNA Seq", "GSM4368076", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4368076", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251256", null, null, "small_JD12.combined.fastq.gz", "fastq", 267278950.0, 5345579.0, "GSM4368076 r1", "0:50 1:0", "A:63524573;C:63700392;G:72574389;T:67477407;N:2189", 50, 0, null, null, 63524573, 63700392, 72574389, 67477407, 2189, "SRX7826908", "SRS6238043", "SRA1049684", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.0867, null, 0.00429, null, 0.99403, null, 0.53048, null, 50, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2020-03-02", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [57074, "SRR11214395", "SRX7826907", "SRS6238042", "SRP251256", "PRJNA609696", "Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]", "GSE146200", "Transcriptome Analysis", "Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6\u00b5M for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.", "parent bioproject:PRJNA609691", "pubmed:28962522", null, "JD11 [miRNA seq]", "GSM4368075", null, "source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6\u03bcM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA", "JD11 [miRNA seq]", "The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; \"abundance normalised\" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.", "30 pooled larvae 5dpf triptolide for 6 h", "5 dpf larvae N\u2009=\u200930 were treated per 50\u2009ml dish for 6\u2009h with a TP concentration of 0 \u00b5M 8 dishes or 1.6 \u00b5M 8 dishes", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6\u03bcM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA", "GSM4368075", "GSM4368075: JD11 [miRNA seq]; Danio rerio; ncRNA Seq", "GSM4368075", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4368075", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251256", null, null, "small_JD11.combined.fastq.gz", "fastq", 323802250.0, 6476045.0, "GSM4368075 r1", "0:50 1:0", "A:78153815;C:77052322;G:87557986;T:81035226;N:2901", 50, 0, null, null, 78153815, 77052322, 87557986, 81035226, 2901, "SRX7826907", "SRS6238042", "SRA1049684", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.06809, null, 0.00424, null, 0.99368, null, 0.52229, null, 50, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2020-03-02", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [57075, "SRR11214394", "SRX7826906", "SRS6238041", "SRP251256", "PRJNA609696", "Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]", "GSE146200", "Transcriptome Analysis", "Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6\u00b5M for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.", "parent bioproject:PRJNA609691", "pubmed:28962522", null, "JD08 [miRNA seq]", "GSM4368074", null, "source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA", "JD08 [miRNA seq]", "The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; \"abundance normalised\" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.", "30 pooled larvae 5dpf vehicle", "5 dpf larvae N\u2009=\u200930 were treated per 50\u2009ml dish for 6\u2009h with a TP concentration of 0 \u00b5M 8 dishes or 1.6 \u00b5M 8 dishes", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA", "GSM4368074", "GSM4368074: JD08 [miRNA seq]; Danio rerio; ncRNA Seq", "GSM4368074", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4368074", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251256", null, null, "small_JD08.combined.fastq.gz", "fastq", 375132100.0, 7502642.0, "GSM4368074 r1", "0:50 1:0", "A:89764502;C:89300619;G:101501695;T:94562105;N:3179", 50, 0, null, null, 89764502, 89300619, 101501695, 94562105, 3179, "SRX7826906", "SRS6238041", "SRA1049684", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.07787, null, 0.0042, null, 0.99338, null, 0.52599, null, 50, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2020-03-02", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [57076, "SRR11214393", "SRX7826905", "SRS6238040", "SRP251256", "PRJNA609696", "Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]", "GSE146200", "Transcriptome Analysis", "Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6\u00b5M for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.", "parent bioproject:PRJNA609691", "pubmed:28962522", null, "JD07 [miRNA seq]", "GSM4368073", null, "source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA", "JD07 [miRNA seq]", "The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; \"abundance normalised\" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.", "30 pooled larvae 5dpf vehicle", "5 dpf larvae N\u2009=\u200930 were treated per 50\u2009ml dish for 6\u2009h with a TP concentration of 0 \u00b5M 8 dishes or 1.6 \u00b5M 8 dishes", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA", "GSM4368073", "GSM4368073: JD07 [miRNA seq]; Danio rerio; ncRNA Seq", "GSM4368073", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4368073", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251256", null, null, "small_JD07.combined.fastq.gz", "fastq", 317528050.0, 6350561.0, "GSM4368073 r1", "0:50 1:0", "A:75643339;C:75642242;G:86133220;T:80106532;N:2717", 50, 0, null, null, 75643339, 75642242, 86133220, 80106532, 2717, "SRX7826905", "SRS6238040", "SRA1049684", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.07711, null, 0.00424, null, 0.9934, null, 0.53196, null, 50, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2020-03-02", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [57077, "SRR11214392", "SRX7826904", "SRS6238039", "SRP251256", "PRJNA609696", "Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]", "GSE146200", "Transcriptome Analysis", "Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6\u00b5M for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.", "parent bioproject:PRJNA609691", "pubmed:28962522", null, "JD06 [miRNA seq]", "GSM4368072", null, "source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA", "JD06 [miRNA seq]", "The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; \"abundance normalised\" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.", "30 pooled larvae 5dpf vehicle", "5 dpf larvae N\u2009=\u200930 were treated per 50\u2009ml dish for 6\u2009h with a TP concentration of 0 \u00b5M 8 dishes or 1.6 \u00b5M 8 dishes", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA", "GSM4368072", "GSM4368072: JD06 [miRNA seq]; Danio rerio; ncRNA Seq", "GSM4368072", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4368072", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251256", null, null, "small_JD06.combined.fastq.gz", "fastq", 313235150.0, 6264703.0, "GSM4368072 r1", "0:50 1:0", "A:74970317;C:74745173;G:84767516;T:78749342;N:2802", 50, 0, null, null, 74970317, 74745173, 84767516, 78749342, 2802, "SRX7826904", "SRS6238039", "SRA1049684", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.07206, null, 0.00403, null, 0.99312, null, 0.52846, null, 50, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2020-03-02", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [57078, "SRR11214391", "SRX7826903", "SRS6238038", "SRP251256", "PRJNA609696", "Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]", "GSE146200", "Transcriptome Analysis", "Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6\u00b5M for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.", "parent bioproject:PRJNA609691", "pubmed:28962522", null, "JD05 [miRNA seq]", "GSM4368071", null, "source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA", "JD05 [miRNA seq]", "The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; \"abundance normalised\" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.", "30 pooled larvae 5dpf vehicle", "5 dpf larvae N\u2009=\u200930 were treated per 50\u2009ml dish for 6\u2009h with a TP concentration of 0 \u00b5M 8 dishes or 1.6 \u00b5M 8 dishes", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA", "GSM4368071", "GSM4368071: JD05 [miRNA seq]; Danio rerio; ncRNA Seq", "GSM4368071", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4368071", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251256", null, null, "small_JD05.combined.fastq.gz", "fastq", 282608400.0, 5652168.0, "GSM4368071 r1", "0:50 1:0", "A:67639670;C:67139768;G:76678815;T:71147790;N:2357", 50, 0, null, null, 67639670, 67139768, 76678815, 71147790, 2357, "SRX7826903", "SRS6238038", "SRA1049684", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.07587, null, 0.00384, null, 0.99299, null, 0.5434, null, 50, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2020-03-02", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [57079, "SRR11214390", "SRX7826902", "SRS6238037", "SRP251256", "PRJNA609696", "Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]", "GSE146200", "Transcriptome Analysis", "Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6\u00b5M for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.", "parent bioproject:PRJNA609691", "pubmed:28962522", null, "JD04 [miRNA seq]", "GSM4368070", null, "source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA", "JD04 [miRNA seq]", "The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; \"abundance normalised\" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.", "30 pooled larvae 5dpf vehicle", "5 dpf larvae N\u2009=\u200930 were treated per 50\u2009ml dish for 6\u2009h with a TP concentration of 0 \u00b5M 8 dishes or 1.6 \u00b5M 8 dishes", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA", "GSM4368070", "GSM4368070: JD04 [miRNA seq]; Danio rerio; ncRNA Seq", "GSM4368070", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4368070", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251256", null, null, "small_JD04.combined.fastq.gz", "fastq", 289767100.0, 5795342.0, "GSM4368070 r1", "0:50 1:0", "A:69580978;C:68900579;G:78340509;T:72942639;N:2395", 50, 0, null, null, 69580978, 68900579, 78340509, 72942639, 2395, "SRX7826902", "SRS6238037", "SRA1049684", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.07492, null, 0.00373, null, 0.99295, null, 0.52294, null, 50, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2020-03-02", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [57080, "SRR11214389", "SRX7826901", "SRS6238036", "SRP251256", "PRJNA609696", "Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]", "GSE146200", "Transcriptome Analysis", "Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6\u00b5M for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.", "parent bioproject:PRJNA609691", "pubmed:28962522", null, "JD03 [miRNA seq]", "GSM4368069", null, "source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA", "JD03 [miRNA seq]", "The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; \"abundance normalised\" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.", "30 pooled larvae 5dpf vehicle", "5 dpf larvae N\u2009=\u200930 were treated per 50\u2009ml dish for 6\u2009h with a TP concentration of 0 \u00b5M 8 dishes or 1.6 \u00b5M 8 dishes", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA", "GSM4368069", "GSM4368069: JD03 [miRNA seq]; Danio rerio; ncRNA Seq", "GSM4368069", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4368069", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251256", null, null, "small_JD03.combined.fastq.gz", "fastq", 230982600.0, 4619652.0, "GSM4368069 r1", "0:50 1:0", "A:55200177;C:55003182;G:62615802;T:58161510;N:1929", 50, 0, null, null, 55200177, 55003182, 62615802, 58161510, 1929, "SRX7826901", "SRS6238036", "SRA1049684", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.07179, null, 0.00361, null, 0.99336, null, 0.47352, null, 50, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2020-03-02", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [57081, "SRR11214388", "SRX7826900", "SRS6238035", "SRP251256", "PRJNA609696", "Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]", "GSE146200", "Transcriptome Analysis", "Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6\u00b5M for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.", "parent bioproject:PRJNA609691", "pubmed:28962522", null, "JD02 [miRNA seq]", "GSM4368068", null, "source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA", "JD02 [miRNA seq]", "The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; \"abundance normalised\" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.", "30 pooled larvae 5dpf vehicle", "5 dpf larvae N\u2009=\u200930 were treated per 50\u2009ml dish for 6\u2009h with a TP concentration of 0 \u00b5M 8 dishes or 1.6 \u00b5M 8 dishes", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA", "GSM4368068", "GSM4368068: JD02 [miRNA seq]; Danio rerio; ncRNA Seq", "GSM4368068", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4368068", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251256", null, null, "small_JD02.combined.fastq.gz", "fastq", 367984500.0, 7359690.0, "GSM4368068 r1", "0:50 1:0", "A:87859797;C:87548819;G:99752643;T:92820007;N:3234", 50, 0, null, null, 87859797, 87548819, 99752643, 92820007, 3234, "SRX7826900", "SRS6238035", "SRA1049684", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.07619, null, 0.00398, null, 0.99403, null, 0.53717, null, 50, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2020-03-02", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [57082, "SRR11214387", "SRX7826899", "SRS6238034", "SRP251256", "PRJNA609696", "Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]", "GSE146200", "Transcriptome Analysis", "Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6\u00b5M for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.", "parent bioproject:PRJNA609691", "pubmed:28962522", null, "JD01 [miRNA seq]", "GSM4368067", null, "source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA", "JD01 [miRNA seq]", "The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw \"tag counts\" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; \"abundance normalised\" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.", "30 pooled larvae 5dpf vehicle", "5 dpf larvae N\u2009=\u200930 were treated per 50\u2009ml dish for 6\u2009h with a TP concentration of 0 \u00b5M 8 dishes or 1.6 \u00b5M 8 dishes", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA", "GSM4368067", "GSM4368067: JD01 [miRNA seq]; Danio rerio; ncRNA Seq", "GSM4368067", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30\u2009\u00b5l RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4368067", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251256", null, null, "small_JD01.combined.fastq.gz", "fastq", 374941900.0, 7498838.0, "GSM4368067 r1", "0:50 1:0", "A:90013932;C:89307034;G:101275933;T:94341753;N:3248", 50, 0, null, null, 90013932, 89307034, 101275933, 94341753, 3248, "SRX7826899", "SRS6238034", "SRA1049684", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.07456, null, 0.00386, null, 0.99399, null, 0.52664, null, 50, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2020-03-02", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [58542, "SRR13652355", "SRX10049118", "SRS8212347", "SRP253438", "PRJNA613601", "five prime half of specific tRNAs feeds back to promote corresponding tRNA gene transcription in vertebrate embryos [small RNA Seq ssDRIP seq]", "GSE147253", "Other", "five primetRFls are small tRNA fragments derived from five prime half of mature tRNAs. However it is unknown whether five primetRFls could feed back to regulate tRNA biogenesis. Here we show that five primetRFlGly/GCC and five primetRFlGlu/CTC function to promote transcription of corresponding tRNA genes and are essential for vertebrate early embryogenesis. During zebrafish embryogenesis dynamics of five primetRFlGly/GCC and five primetRFlGlu/CTC levels correlates with that of tRNAGly/GCC and tRNAGlu/CTC levels. Morpholino mediated knockdown of five primetRFlGly/GCC or five primetRFlGlu/CTC down regulates tRNAGly/GCC or tRNAGlu/CTC levels respectively and causes embryonic lethality that is efficiently rescued by co injection of properly refolded corresponding tRNA. In zebrafish embryos tRNA:DNA and five primetRFl:DNA hybrids commonly exist on the template strand of tRNA genes. Mechanistically unstable five primetRFl:DNA hybrid may prevent the formation of transcriptionally inhibitory stable tRNA:DNA hybrids on the same tRNA loci so as to facilitate tRNA genes transcription. The uncovered mechanism may be implicated in other physiological and pathological processes. Overall design: For small RNA sequencing total RNA were extracted respectively from wildtype zebrafish embryos T\u00fcbingen Strain of 6 chosen stages and then subjected to small RNA library preparation individually. To investigate the distribution and stability of R loop on genome we performed ssDRIP seq with S9.6 antibody which specifically recognize RNA:DNA hybrid. Two replicates from wildtype embryos of 256c sphere and shield stage were collected to perform ssDRIPseq. RNaseH pre treated genome DNA was used as negative control which was also performed the standard ssDRIP seq procedure. Genomic DNA extracted from these samples were fragmentated by restriction enzymes and then immunoprecipitated by S9.6 antibody.The ssDNA strands in RNA:DNA hybrids were purified and subjected to library preparation.", "parent bioproject:PRJNA753013", "pubmed:34797706", null, "24hpf ncRNA seq", "GSM5069285", null, "tissue:embryo|strain:Tubingen|developmental stage:24 hpf stage|treatement:no", "24hpf ncRNA seq", "For data processing reads were quality checked by FastQCVersion 0.11.8 and adaptors were cut off by Cutadapt Version 1.16 and only reads that lay between 18 40 nt were kept. The reads of each sample were first aligned to different database by using Bowtie2 Version 2.3.4.1 count table was generated by featureCounts. Genome build: GRCz11 genome and cDNA tRNA database GtRNAdb GRCz11", "embryo", null, "For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific 15596018. The lysate was centrifuged at 12 000 rpm for 10 min and the supernatant was collected and mixed with 200 \u03bcl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4\u2103 the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at 80\u2103 until all samples were collected. Two pretreatment steps were included: First purified total RNAs were treated with T4 Polynucleotide Kinase NEB M0201S with ATP for 30 min at 37\u2103 then purified by phenol: chloroform extraction. The aim of this step is removing the 2 3\u2019 cyclic phosphate group from the 3\u2019end of 5\u2019tRFls and add phosphate group to the 5\u2019end of 3\u2019tRFs. In the second step total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing: Small RNA libraries using 1 \u03bcg RNA each were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research then bands of 135 160 bp about the length of 15 40 nt RNA ligated with both adaptors were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc pH 4.5 followed by precipitation by adding 2.5 volumes of ethanol.", null, "strain:Tubingen|developmental stage:24 hpf stage|treatement:no", "GSM5069285", "GSM5069285: 24hpf ncRNA seq; Danio rerio; ncRNA Seq", "GSM5069285", null, "1", "For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific 15596018. The lysate was centrifuged at 12 000 rpm for 10 min and the supernatant was collected and mixed with 200 \u03bcl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4\u2103 the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at 80\u2103 until all samples were collected. Two pretreatment steps were included: First purified total RNAs were treated with T4 Polynucleotide Kinase NEB M0201S with ATP for 30 min at 37\u2103 then purified by phenol: chloroform extraction. The aim of this step is removing the 2 three prime cyclic phosphate group from the three primeend of five primetRFls and add phosphate group to the five primeend of three primetRFs. In the second step total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing: Small RNA libraries using 1 \u03bcg RNA each were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research then bands of 135 160 bp about the length of 15 40 nt RNA ligated with both adaptors were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc pH 4.5 followed by precipitation by adding 2.5 volumes of ethanol.", "GEO Accession:GSM5069285", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP253438", null, null, "24hpf-RNA_seq.fq.gz", "fastq", 4887202650.0, 32581351.0, "GSM5069285 r1", "0:150 1:0", "A:821306307;C:893949781;G:2431277343;T:739975843;N:693376", 150, 0, null, null, 821306307, 893949781, 2431277343, 739975843, 693376, "SRX10049118", "SRS8212347", "SRA1056877", "GEO", "Anming Meng Lab, School of Life Science, Tsinghua University", 1, 0.60067, null, 0.12422, null, 0.81132, null, 0.45351, null, 150, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "5prime", "size_fractionation", "nebnext", "bulk", "unknown", "unknown", null, "China", "2021-02-08", "Pharyngula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [58543, "SRR13652354", "SRX10049117", "SRS8212344", "SRP253438", "PRJNA613601", "five prime half of specific tRNAs feeds back to promote corresponding tRNA gene transcription in vertebrate embryos [small RNA Seq ssDRIP seq]", "GSE147253", "Other", "five primetRFls are small tRNA fragments derived from five prime half of mature tRNAs. However it is unknown whether five primetRFls could feed back to regulate tRNA biogenesis. Here we show that five primetRFlGly/GCC and five primetRFlGlu/CTC function to promote transcription of corresponding tRNA genes and are essential for vertebrate early embryogenesis. During zebrafish embryogenesis dynamics of five primetRFlGly/GCC and five primetRFlGlu/CTC levels correlates with that of tRNAGly/GCC and tRNAGlu/CTC levels. Morpholino mediated knockdown of five primetRFlGly/GCC or five primetRFlGlu/CTC down regulates tRNAGly/GCC or tRNAGlu/CTC levels respectively and causes embryonic lethality that is efficiently rescued by co injection of properly refolded corresponding tRNA. In zebrafish embryos tRNA:DNA and five primetRFl:DNA hybrids commonly exist on the template strand of tRNA genes. Mechanistically unstable five primetRFl:DNA hybrid may prevent the formation of transcriptionally inhibitory stable tRNA:DNA hybrids on the same tRNA loci so as to facilitate tRNA genes transcription. The uncovered mechanism may be implicated in other physiological and pathological processes. Overall design: For small RNA sequencing total RNA were extracted respectively from wildtype zebrafish embryos T\u00fcbingen Strain of 6 chosen stages and then subjected to small RNA library preparation individually. To investigate the distribution and stability of R loop on genome we performed ssDRIP seq with S9.6 antibody which specifically recognize RNA:DNA hybrid. Two replicates from wildtype embryos of 256c sphere and shield stage were collected to perform ssDRIPseq. RNaseH pre treated genome DNA was used as negative control which was also performed the standard ssDRIP seq procedure. Genomic DNA extracted from these samples were fragmentated by restriction enzymes and then immunoprecipitated by S9.6 antibody.The ssDNA strands in RNA:DNA hybrids were purified and subjected to library preparation.", "parent bioproject:PRJNA753013", "pubmed:34797706", null, "Shield ncRNA seq", "GSM5069284", null, "tissue:embryo|strain:Tubingen|developmental stage:Shield stage|treatement:no", "Shield ncRNA seq", "For data processing reads were quality checked by FastQCVersion 0.11.8 and adaptors were cut off by Cutadapt Version 1.16 and only reads that lay between 18 40 nt were kept. The reads of each sample were first aligned to different database by using Bowtie2 Version 2.3.4.1 count table was generated by featureCounts. Genome build: GRCz11 genome and cDNA tRNA database GtRNAdb GRCz11", "embryo", null, "For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific 15596018. The lysate was centrifuged at 12 000 rpm for 10 min and the supernatant was collected and mixed with 200 \u03bcl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4\u2103 the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at 80\u2103 until all samples were collected. Two pretreatment steps were included: First purified total RNAs were treated with T4 Polynucleotide Kinase NEB M0201S with ATP for 30 min at 37\u2103 then purified by phenol: chloroform extraction. The aim of this step is removing the 2 3\u2019 cyclic phosphate group from the 3\u2019end of 5\u2019tRFls and add phosphate group to the 5\u2019end of 3\u2019tRFs. In the second step total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing: Small RNA libraries using 1 \u03bcg RNA each were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research then bands of 135 160 bp about the length of 15 40 nt RNA ligated with both adaptors were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc pH 4.5 followed by precipitation by adding 2.5 volumes of ethanol.", null, "strain:Tubingen|developmental stage:Shield stage|treatement:no", "GSM5069284", "GSM5069284: Shield ncRNA seq; Danio rerio; ncRNA Seq", "GSM5069284", null, "1", "For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific 15596018. The lysate was centrifuged at 12 000 rpm for 10 min and the supernatant was collected and mixed with 200 \u03bcl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4\u2103 the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at 80\u2103 until all samples were collected. Two pretreatment steps were included: First purified total RNAs were treated with T4 Polynucleotide Kinase NEB M0201S with ATP for 30 min at 37\u2103 then purified by phenol: chloroform extraction. The aim of this step is removing the 2 three prime cyclic phosphate group from the three primeend of five primetRFls and add phosphate group to the five primeend of three primetRFs. In the second step total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing: Small RNA libraries using 1 \u03bcg RNA each were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research then bands of 135 160 bp about the length of 15 40 nt RNA ligated with both adaptors were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc pH 4.5 followed by precipitation by adding 2.5 volumes of ethanol.", "GEO Accession:GSM5069284", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP253438", null, null, "Shield-RNA_seq.fq.gz", "fastq", 3889055700.0, 25927038.0, "GSM5069284 r1", "0:150 1:0", "A:663037737;C:674378775;G:1956188054;T:594901111;N:550023", 150, 0, null, null, 663037737, 674378775, 1956188054, 594901111, 550023, "SRX10049117", "SRS8212344", "SRA1056877", "GEO", "Anming Meng Lab, School of Life Science, Tsinghua University", 1, 0.64541, null, 0.17034, null, 0.79174, null, 0.59714, null, 150, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "5prime", "size_fractionation", "nebnext", "bulk", "unknown", "unknown", null, "China", "2021-02-08", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [58544, "SRR13652353", "SRX10049116", "SRS8212345", "SRP253438", "PRJNA613601", "five prime half of specific tRNAs feeds back to promote corresponding tRNA gene transcription in vertebrate embryos [small RNA Seq ssDRIP seq]", "GSE147253", "Other", "five primetRFls are small tRNA fragments derived from five prime half of mature tRNAs. However it is unknown whether five primetRFls could feed back to regulate tRNA biogenesis. Here we show that five primetRFlGly/GCC and five primetRFlGlu/CTC function to promote transcription of corresponding tRNA genes and are essential for vertebrate early embryogenesis. During zebrafish embryogenesis dynamics of five primetRFlGly/GCC and five primetRFlGlu/CTC levels correlates with that of tRNAGly/GCC and tRNAGlu/CTC levels. Morpholino mediated knockdown of five primetRFlGly/GCC or five primetRFlGlu/CTC down regulates tRNAGly/GCC or tRNAGlu/CTC levels respectively and causes embryonic lethality that is efficiently rescued by co injection of properly refolded corresponding tRNA. In zebrafish embryos tRNA:DNA and five primetRFl:DNA hybrids commonly exist on the template strand of tRNA genes. Mechanistically unstable five primetRFl:DNA hybrid may prevent the formation of transcriptionally inhibitory stable tRNA:DNA hybrids on the same tRNA loci so as to facilitate tRNA genes transcription. The uncovered mechanism may be implicated in other physiological and pathological processes. Overall design: For small RNA sequencing total RNA were extracted respectively from wildtype zebrafish embryos T\u00fcbingen Strain of 6 chosen stages and then subjected to small RNA library preparation individually. To investigate the distribution and stability of R loop on genome we performed ssDRIP seq with S9.6 antibody which specifically recognize RNA:DNA hybrid. Two replicates from wildtype embryos of 256c sphere and shield stage were collected to perform ssDRIPseq. RNaseH pre treated genome DNA was used as negative control which was also performed the standard ssDRIP seq procedure. Genomic DNA extracted from these samples were fragmentated by restriction enzymes and then immunoprecipitated by S9.6 antibody.The ssDNA strands in RNA:DNA hybrids were purified and subjected to library preparation.", "parent bioproject:PRJNA753013", "pubmed:34797706", null, "Sphere ncRNA seq", "GSM5069283", null, "tissue:embryo|strain:Tubingen|developmental stage:Sphere stage|treatement:no", "Sphere ncRNA seq", "For data processing reads were quality checked by FastQCVersion 0.11.8 and adaptors were cut off by Cutadapt Version 1.16 and only reads that lay between 18 40 nt were kept. The reads of each sample were first aligned to different database by using Bowtie2 Version 2.3.4.1 count table was generated by featureCounts. Genome build: GRCz11 genome and cDNA tRNA database GtRNAdb GRCz11", "embryo", null, "For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific 15596018. The lysate was centrifuged at 12 000 rpm for 10 min and the supernatant was collected and mixed with 200 \u03bcl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4\u2103 the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at 80\u2103 until all samples were collected. Two pretreatment steps were included: First purified total RNAs were treated with T4 Polynucleotide Kinase NEB M0201S with ATP for 30 min at 37\u2103 then purified by phenol: chloroform extraction. The aim of this step is removing the 2 3\u2019 cyclic phosphate group from the 3\u2019end of 5\u2019tRFls and add phosphate group to the 5\u2019end of 3\u2019tRFs. In the second step total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing: Small RNA libraries using 1 \u03bcg RNA each were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research then bands of 135 160 bp about the length of 15 40 nt RNA ligated with both adaptors were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc pH 4.5 followed by precipitation by adding 2.5 volumes of ethanol.", null, "strain:Tubingen|developmental stage:Sphere stage|treatement:no", "GSM5069283", "GSM5069283: Sphere ncRNA seq; Danio rerio; ncRNA Seq", "GSM5069283", null, "1", "For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific 15596018. The lysate was centrifuged at 12 000 rpm for 10 min and the supernatant was collected and mixed with 200 \u03bcl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4\u2103 the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at 80\u2103 until all samples were collected. Two pretreatment steps were included: First purified total RNAs were treated with T4 Polynucleotide Kinase NEB M0201S with ATP for 30 min at 37\u2103 then purified by phenol: chloroform extraction. The aim of this step is removing the 2 three prime cyclic phosphate group from the three primeend of five primetRFls and add phosphate group to the five primeend of three primetRFs. In the second step total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing: Small RNA libraries using 1 \u03bcg RNA each were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research then bands of 135 160 bp about the length of 15 40 nt RNA ligated with both adaptors were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc pH 4.5 followed by precipitation by adding 2.5 volumes of ethanol.", "GEO Accession:GSM5069283", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP253438", null, null, "Sphere-RNA_seq.fq.gz", "fastq", 3717222600.0, 24781484.0, "GSM5069283 r1", "0:150 1:0", "A:624971961;C:648134651;G:1883560788;T:560027159;N:528041", 150, 0, null, null, 624971961, 648134651, 1883560788, 560027159, 528041, "SRX10049116", "SRS8212345", "SRA1056877", "GEO", "Anming Meng Lab, School of Life Science, Tsinghua University", 1, 0.66566, null, 0.17271, null, 0.77378, null, 0.58824, null, 150, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "5prime", "size_fractionation", "nebnext", "bulk", "unknown", "unknown", null, "China", "2021-02-08", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [58545, "SRR13652352", "SRX10049115", "SRS8212343", "SRP253438", "PRJNA613601", "five prime half of specific tRNAs feeds back to promote corresponding tRNA gene transcription in vertebrate embryos [small RNA Seq ssDRIP seq]", "GSE147253", "Other", "five primetRFls are small tRNA fragments derived from five prime half of mature tRNAs. However it is unknown whether five primetRFls could feed back to regulate tRNA biogenesis. Here we show that five primetRFlGly/GCC and five primetRFlGlu/CTC function to promote transcription of corresponding tRNA genes and are essential for vertebrate early embryogenesis. During zebrafish embryogenesis dynamics of five primetRFlGly/GCC and five primetRFlGlu/CTC levels correlates with that of tRNAGly/GCC and tRNAGlu/CTC levels. Morpholino mediated knockdown of five primetRFlGly/GCC or five primetRFlGlu/CTC down regulates tRNAGly/GCC or tRNAGlu/CTC levels respectively and causes embryonic lethality that is efficiently rescued by co injection of properly refolded corresponding tRNA. In zebrafish embryos tRNA:DNA and five primetRFl:DNA hybrids commonly exist on the template strand of tRNA genes. Mechanistically unstable five primetRFl:DNA hybrid may prevent the formation of transcriptionally inhibitory stable tRNA:DNA hybrids on the same tRNA loci so as to facilitate tRNA genes transcription. The uncovered mechanism may be implicated in other physiological and pathological processes. Overall design: For small RNA sequencing total RNA were extracted respectively from wildtype zebrafish embryos T\u00fcbingen Strain of 6 chosen stages and then subjected to small RNA library preparation individually. To investigate the distribution and stability of R loop on genome we performed ssDRIP seq with S9.6 antibody which specifically recognize RNA:DNA hybrid. Two replicates from wildtype embryos of 256c sphere and shield stage were collected to perform ssDRIPseq. RNaseH pre treated genome DNA was used as negative control which was also performed the standard ssDRIP seq procedure. Genomic DNA extracted from these samples were fragmentated by restriction enzymes and then immunoprecipitated by S9.6 antibody.The ssDNA strands in RNA:DNA hybrids were purified and subjected to library preparation.", "parent bioproject:PRJNA753013", "pubmed:34797706", null, "256c ncRNA seq", "GSM5069282", null, "tissue:embryo|strain:Tubingen|developmental stage:256c stage|treatement:no", "256c ncRNA seq", "For data processing reads were quality checked by FastQCVersion 0.11.8 and adaptors were cut off by Cutadapt Version 1.16 and only reads that lay between 18 40 nt were kept. The reads of each sample were first aligned to different database by using Bowtie2 Version 2.3.4.1 count table was generated by featureCounts. Genome build: GRCz11 genome and cDNA tRNA database GtRNAdb GRCz11", "embryo", null, "For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific 15596018. The lysate was centrifuged at 12 000 rpm for 10 min and the supernatant was collected and mixed with 200 \u03bcl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4\u2103 the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at 80\u2103 until all samples were collected. Two pretreatment steps were included: First purified total RNAs were treated with T4 Polynucleotide Kinase NEB M0201S with ATP for 30 min at 37\u2103 then purified by phenol: chloroform extraction. The aim of this step is removing the 2 3\u2019 cyclic phosphate group from the 3\u2019end of 5\u2019tRFls and add phosphate group to the 5\u2019end of 3\u2019tRFs. In the second step total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing: Small RNA libraries using 1 \u03bcg RNA each were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research then bands of 135 160 bp about the length of 15 40 nt RNA ligated with both adaptors were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc pH 4.5 followed by precipitation by adding 2.5 volumes of ethanol.", null, "strain:Tubingen|developmental stage:256c stage|treatement:no", "GSM5069282", "GSM5069282: 256c ncRNA seq; Danio rerio; ncRNA Seq", "GSM5069282", null, "1", "For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific 15596018. The lysate was centrifuged at 12 000 rpm for 10 min and the supernatant was collected and mixed with 200 \u03bcl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4\u2103 the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at 80\u2103 until all samples were collected. Two pretreatment steps were included: First purified total RNAs were treated with T4 Polynucleotide Kinase NEB M0201S with ATP for 30 min at 37\u2103 then purified by phenol: chloroform extraction. The aim of this step is removing the 2 three prime cyclic phosphate group from the three primeend of five primetRFls and add phosphate group to the five primeend of three primetRFs. In the second step total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing: Small RNA libraries using 1 \u03bcg RNA each were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research then bands of 135 160 bp about the length of 15 40 nt RNA ligated with both adaptors were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc pH 4.5 followed by precipitation by adding 2.5 volumes of ethanol.", "GEO Accession:GSM5069282", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP253438", null, null, "256c-RNA_seq.fq.gz", "fastq", 4634985600.0, 30899904.0, "GSM5069282 r1", "0:150 1:0", "A:815670917;C:820280105;G:2237895473;T:760861465;N:277640", 150, 0, null, null, 815670917, 820280105, 2237895473, 760861465, 277640, "SRX10049115", "SRS8212343", "SRA1056877", "GEO", "Anming Meng Lab, School of Life Science, Tsinghua University", 1, 0.67611, null, 0.16429, null, 0.8076, null, 0.58827, null, 150, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "5prime", "size_fractionation", "nebnext", "bulk", "unknown", "unknown", null, "China", "2021-02-08", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"], [58546, "SRR13652351", "SRX10049114", "SRS8212341", "SRP253438", "PRJNA613601", "five prime half of specific tRNAs feeds back to promote corresponding tRNA gene transcription in vertebrate embryos [small RNA Seq ssDRIP seq]", "GSE147253", "Other", "five primetRFls are small tRNA fragments derived from five prime half of mature tRNAs. However it is unknown whether five primetRFls could feed back to regulate tRNA biogenesis. Here we show that five primetRFlGly/GCC and five primetRFlGlu/CTC function to promote transcription of corresponding tRNA genes and are essential for vertebrate early embryogenesis. During zebrafish embryogenesis dynamics of five primetRFlGly/GCC and five primetRFlGlu/CTC levels correlates with that of tRNAGly/GCC and tRNAGlu/CTC levels. Morpholino mediated knockdown of five primetRFlGly/GCC or five primetRFlGlu/CTC down regulates tRNAGly/GCC or tRNAGlu/CTC levels respectively and causes embryonic lethality that is efficiently rescued by co injection of properly refolded corresponding tRNA. In zebrafish embryos tRNA:DNA and five primetRFl:DNA hybrids commonly exist on the template strand of tRNA genes. Mechanistically unstable five primetRFl:DNA hybrid may prevent the formation of transcriptionally inhibitory stable tRNA:DNA hybrids on the same tRNA loci so as to facilitate tRNA genes transcription. The uncovered mechanism may be implicated in other physiological and pathological processes. Overall design: For small RNA sequencing total RNA were extracted respectively from wildtype zebrafish embryos T\u00fcbingen Strain of 6 chosen stages and then subjected to small RNA library preparation individually. To investigate the distribution and stability of R loop on genome we performed ssDRIP seq with S9.6 antibody which specifically recognize RNA:DNA hybrid. Two replicates from wildtype embryos of 256c sphere and shield stage were collected to perform ssDRIPseq. RNaseH pre treated genome DNA was used as negative control which was also performed the standard ssDRIP seq procedure. Genomic DNA extracted from these samples were fragmentated by restriction enzymes and then immunoprecipitated by S9.6 antibody.The ssDNA strands in RNA:DNA hybrids were purified and subjected to library preparation.", "parent bioproject:PRJNA753013", "pubmed:34797706", null, "1cell ncRNA seq", "GSM5069281", null, "tissue:embryo|strain:Tubingen|developmental stage:1cell stage|treatement:no", "1cell ncRNA seq", "For data processing reads were quality checked by FastQCVersion 0.11.8 and adaptors were cut off by Cutadapt Version 1.16 and only reads that lay between 18 40 nt were kept. The reads of each sample were first aligned to different database by using Bowtie2 Version 2.3.4.1 count table was generated by featureCounts. Genome build: GRCz11 genome and cDNA tRNA database GtRNAdb GRCz11", "embryo", null, "For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific 15596018. The lysate was centrifuged at 12 000 rpm for 10 min and the supernatant was collected and mixed with 200 \u03bcl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4\u2103 the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at 80\u2103 until all samples were collected. Two pretreatment steps were included: First purified total RNAs were treated with T4 Polynucleotide Kinase NEB M0201S with ATP for 30 min at 37\u2103 then purified by phenol: chloroform extraction. The aim of this step is removing the 2 3\u2019 cyclic phosphate group from the 3\u2019end of 5\u2019tRFls and add phosphate group to the 5\u2019end of 3\u2019tRFs. In the second step total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing: Small RNA libraries using 1 \u03bcg RNA each were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research then bands of 135 160 bp about the length of 15 40 nt RNA ligated with both adaptors were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc pH 4.5 followed by precipitation by adding 2.5 volumes of ethanol.", null, "strain:Tubingen|developmental stage:1cell stage|treatement:no", "GSM5069281", "GSM5069281: 1cell ncRNA seq; Danio rerio; ncRNA Seq", "GSM5069281", null, "1", "For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific 15596018. The lysate was centrifuged at 12 000 rpm for 10 min and the supernatant was collected and mixed with 200 \u03bcl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4\u2103 the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at 80\u2103 until all samples were collected. Two pretreatment steps were included: First purified total RNAs were treated with T4 Polynucleotide Kinase NEB M0201S with ATP for 30 min at 37\u2103 then purified by phenol: chloroform extraction. The aim of this step is removing the 2 three prime cyclic phosphate group from the three primeend of five primetRFls and add phosphate group to the five primeend of three primetRFs. In the second step total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing: Small RNA libraries using 1 \u03bcg RNA each were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research then bands of 135 160 bp about the length of 15 40 nt RNA ligated with both adaptors were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc pH 4.5 followed by precipitation by adding 2.5 volumes of ethanol.", "GEO Accession:GSM5069281", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP253438", null, null, "1cell-RNA_seq.fq.gz", "fastq", 4393191750.0, 29287945.0, "GSM5069281 r1", "0:150 1:0", "A:767598671;C:783490468;G:2110419912;T:731062034;N:620665", 150, 0, null, null, 767598671, 783490468, 2110419912, 731062034, 620665, "SRX10049114", "SRS8212341", "SRA1056877", "GEO", "Anming Meng Lab, School of Life Science, Tsinghua University", 1, 0.68353, null, 0.17141, null, 0.80338, null, 0.63249, null, 150, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "5prime", "size_fractionation", "nebnext", "bulk", "unknown", "unknown", null, "China", "2021-02-08", "Zygote", "Embryo", "Embryo Imprecise", "All anatomical structures"]], "truncated": false, "filtered_table_rows_count": 60, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"experiment.library_layout\" = :p0 and \"experiment.library_strategy\" = :p1 and \"tissue_curation_coarse\" = :p2 order by rowid limit 101", "params": {"p0": "SINGLE", "p1": "ncRNA-Seq", "p2": "All anatomical structures"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=All+anatomical+structures", "results": [{"value": "ncRNA-Seq", "label": "ncRNA-Seq", "count": 60, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&tissue_curation_coarse=All+anatomical+structures", "selected": true}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=All+anatomical+structures", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 60, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=All+anatomical+structures&experiment.library_source=TRANSCRIPTOMIC", "selected": false}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=All+anatomical+structures", "results": [{"value": "size fractionation", "label": "size fractionation", "count": 60, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=All+anatomical+structures&experiment.library_selection=size+fractionation", "selected": false}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=All+anatomical+structures", "results": [{"value": "SINGLE", "label": "SINGLE", "count": 60, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=All+anatomical+structures", "selected": true}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=All+anatomical+structures", "results": [{"value": "ILLUMINA", "label": "ILLUMINA", "count": 60, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=All+anatomical+structures&experiment.platform=ILLUMINA", "selected": false}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=All+anatomical+structures", "results": [{"value": "Embryo", "label": "Embryo", "count": 35, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=All+anatomical+structures&devstage_curation_coarse=Embryo", "selected": false}, {"value": "Larval", "label": "Larval", "count": 25, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=All+anatomical+structures&devstage_curation_coarse=Larval", "selected": false}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=All+anatomical+structures", "results": [{"value": "Larval", "label": "Larval", "count": 25, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=All+anatomical+structures&devstage_curation=Larval", "selected": false}, {"value": "Blastula", "label": "Blastula", "count": 10, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=All+anatomical+structures&devstage_curation=Blastula", "selected": false}, {"value": "Gastrula", "label": "Gastrula", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=All+anatomical+structures&devstage_curation=Gastrula", "selected": false}, {"value": "Multi-stage", "label": "Multi-stage", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=All+anatomical+structures&devstage_curation=Multi-stage", "selected": false}, {"value": "Pharyngula", "label": "Pharyngula", "count": 5, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=All+anatomical+structures&devstage_curation=Pharyngula", "selected": false}, {"value": "Zygote", "label": "Zygote", "count": 4, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=All+anatomical+structures&devstage_curation=Zygote", "selected": false}, {"value": "Hatching", "label": "Hatching", "count": 3, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=All+anatomical+structures&devstage_curation=Hatching", "selected": false}, {"value": "Undetermined", "label": "Undetermined", "count": 1, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=All+anatomical+structures&devstage_curation=Undetermined", "selected": false}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=All+anatomical+structures", "results": [{"value": "All anatomical structures", "label": "All anatomical structures", "count": 60, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.library_strategy=ncRNA-Seq", "selected": true}], "truncated": false}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=All+anatomical+structures", "results": [{"value": "Whole Organism", "label": "Whole Organism", "count": 49, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=All+anatomical+structures&tissue_curation=Whole+Organism", "selected": false}, {"value": "Embryo Imprecise", "label": "Embryo Imprecise", "count": 11, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=All+anatomical+structures&tissue_curation=Embryo+Imprecise", "selected": false}], "truncated": false}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=All+anatomical+structures", "results": [{"value": "unknown", "label": "unknown", "count": 44, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=All+anatomical+structures&technology=unknown", "selected": false}, {"value": "bulk", "label": "bulk", "count": 16, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=All+anatomical+structures&technology=bulk", "selected": false}], "truncated": false}}, "suggested_facets": [], "next": null, "next_url": null, "private": false, "allow_execute_sql": true, "query_ms": 100.72961800324265}