{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where experiment.library_layout = \"PAIRED\" and technology = \"iclip\"", "rows": [[41262, "SRR4026154", "SRX2018187", "SRS1614128", "SRP081553", "PRJNA338793", "Characterization of genetic loss of function of Fus in zebrafish", "GSE85554", "Transcriptome Analysis", "The RNA binding protein FUS is implicated in transcription  alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3\u2019UTR usage  which could mask the effects of loss of Fus. Unlike published fus morphants  maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus /  genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus /  and WT labeled with the prefix \"Sample imb ketting 2014 13 \" we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that  we performed RNA sequencing a second time  using the same input RNA  except for the Fus knockout replicate #3  because there was not enough input RNA left. Instead  a different Fus knockout replicate #1 was sequenced. However  we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools  and the samples are highly correlated at least 0.97 and 0.95  Spearman and Pearson correlation respectively. Therefore  we considered first \"Sample imb ketting 2014 13 \" and second sequencing runs as technical replicates.", null, "pubmed:27898262", null, "FUS KO 6", "GSM2277123", null, "source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO", "FUS KO 6", "RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR   runMode alignReads   outBAMsortingThreadN 0   outFilterMultimapNmax 20   alignSJoverhangMin 8   alignSJDBoverhangMin 1   outFilterMismatchNmax 2   alignIntronMin 21   outSAMtype BAM SortedByCoordinate   sjdbOverhang 99   outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were:  Q 1  O  T 4  p  P  s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR   runMode alignReads   outFilterMismatchNmax 2   outFilterMultimapNmax 10   alignIntronMin 21   outStd SAM   outSAMattributes Standard   outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR     runMode genomeGenerate     runThreadN 8     genomeDir sjdbStarIndex     sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb    sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples  and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of   outSAMstrandField intronMotif  which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly  reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next  unidentified nucleotides  Ns  were corrected with GenomeAnalysisTK.jar  T SplitNCigarReads  rf ReassignOneMappingQuality  RMQF 255  RMQT 60  U ALLOW N CIGAR READS  improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar  T BaseRecalibrator  knownSites vcf. Finally  variants were called with GenomeAnalysisTK.jar  T HaplotypeCaller  dontUseSoftClippedBases  stand call conf 20.0  stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar  T VariantFiltration  window 35  cluster 3  filterName FS  filter \"FS > 30.0\"  filterName QD  filter \"QD < 2.0\". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout  we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates  thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble  and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads  log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.", "adult female brain", "The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "Zebrafish were maintained in standard conditions. Unless stated otherwise  in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts  23177 07/A 15 5 001 OES tail fin clips.", "tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO", "GSM2277123", "GSM2277123: FUS KO 6; Danio rerio; RNA Seq", "GSM2277123", null, "1", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "GEO Accession:GSM2277123", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP081553", null, null, "Sample_imb_ketting_2014_13_FUS_KO_6_R1.fastq.gz Sample_imb_ketting_2014_13_FUS_KO_6_R2.fastq.gz", "fastq fastq", 7975498532.0, 39482666.0, "GSM2277123 r1", "0:101 1:101", "A:2277361634;C:1708878425;G:1702517993;T:2283731854;N:3008626", 101, 101, null, null, 2277361634, 1708878425, 1702517993, 2283731854, 3008626, "SRX2018187", "SRS1614128", "SRA451974", "GEO", "Rene Ketting, Institute of Molecular Biology", 2, 0.92046, 0.9235, 0.18223, 0.18163, 0.68866, 0.68927, 0.48519, 0.47059, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "3prime", "poly_a", "trueseq", "bulk", "clip", "iclip", null, "Germany", "2016-08-12", "Adult", "Adult", "Brain", "Nervous System"], [41263, "SRR4026155", "SRX2018187", "SRS1614128", "SRP081553", "PRJNA338793", "Characterization of genetic loss of function of Fus in zebrafish", "GSE85554", "Transcriptome Analysis", "The RNA binding protein FUS is implicated in transcription  alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3\u2019UTR usage  which could mask the effects of loss of Fus. Unlike published fus morphants  maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus /  genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus /  and WT labeled with the prefix \"Sample imb ketting 2014 13 \" we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that  we performed RNA sequencing a second time  using the same input RNA  except for the Fus knockout replicate #3  because there was not enough input RNA left. Instead  a different Fus knockout replicate #1 was sequenced. However  we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools  and the samples are highly correlated at least 0.97 and 0.95  Spearman and Pearson correlation respectively. Therefore  we considered first \"Sample imb ketting 2014 13 \" and second sequencing runs as technical replicates.", null, "pubmed:27898262", null, "FUS KO 6", "GSM2277123", null, "source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO", "FUS KO 6", "RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR   runMode alignReads   outBAMsortingThreadN 0   outFilterMultimapNmax 20   alignSJoverhangMin 8   alignSJDBoverhangMin 1   outFilterMismatchNmax 2   alignIntronMin 21   outSAMtype BAM SortedByCoordinate   sjdbOverhang 99   outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were:  Q 1  O  T 4  p  P  s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR   runMode alignReads   outFilterMismatchNmax 2   outFilterMultimapNmax 10   alignIntronMin 21   outStd SAM   outSAMattributes Standard   outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR     runMode genomeGenerate     runThreadN 8     genomeDir sjdbStarIndex     sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb    sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples  and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of   outSAMstrandField intronMotif  which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly  reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next  unidentified nucleotides  Ns  were corrected with GenomeAnalysisTK.jar  T SplitNCigarReads  rf ReassignOneMappingQuality  RMQF 255  RMQT 60  U ALLOW N CIGAR READS  improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar  T BaseRecalibrator  knownSites vcf. Finally  variants were called with GenomeAnalysisTK.jar  T HaplotypeCaller  dontUseSoftClippedBases  stand call conf 20.0  stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar  T VariantFiltration  window 35  cluster 3  filterName FS  filter \"FS > 30.0\"  filterName QD  filter \"QD < 2.0\". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout  we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates  thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble  and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads  log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.", "adult female brain", "The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "Zebrafish were maintained in standard conditions. Unless stated otherwise  in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts  23177 07/A 15 5 001 OES tail fin clips.", "tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO", "GSM2277123", "GSM2277123: FUS KO 6; Danio rerio; RNA Seq", "GSM2277123", null, "1", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "GEO Accession:GSM2277123", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP081553", null, null, "FUS_KO_6_R1.fastq.gz FUS_KO_6_R2.fastq.gz", "fastq fastq", 7173346028.0, 35511614.0, "GSM2277123 r2", "0:101 1:101", "A:1991537753;C:1595400788;G:1586024536;T:1997441866;N:2941085", 101, 101, null, null, 1991537753, 1595400788, 1586024536, 1997441866, 2941085, "SRX2018187", "SRS1614128", "SRA451974", "GEO", "Rene Ketting, Institute of Molecular Biology", 2, 0.93379, 0.93701, 0.16593, 0.1657, 0.68517, 0.68558, 0.49349, 0.49229, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "3prime", "poly_a", "trueseq", "bulk", "clip", "iclip", null, "Germany", "2016-08-12", "Adult", "Adult", "Brain", "Nervous System"], [41264, "SRR4026152", "SRX2018186", "SRS1614129", "SRP081553", "PRJNA338793", "Characterization of genetic loss of function of Fus in zebrafish", "GSE85554", "Transcriptome Analysis", "The RNA binding protein FUS is implicated in transcription  alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3\u2019UTR usage  which could mask the effects of loss of Fus. Unlike published fus morphants  maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus /  genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus /  and WT labeled with the prefix \"Sample imb ketting 2014 13 \" we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that  we performed RNA sequencing a second time  using the same input RNA  except for the Fus knockout replicate #3  because there was not enough input RNA left. Instead  a different Fus knockout replicate #1 was sequenced. However  we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools  and the samples are highly correlated at least 0.97 and 0.95  Spearman and Pearson correlation respectively. Therefore  we considered first \"Sample imb ketting 2014 13 \" and second sequencing runs as technical replicates.", null, "pubmed:27898262", null, "FUS KO 5", "GSM2277122", null, "source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO", "FUS KO 5", "RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR   runMode alignReads   outBAMsortingThreadN 0   outFilterMultimapNmax 20   alignSJoverhangMin 8   alignSJDBoverhangMin 1   outFilterMismatchNmax 2   alignIntronMin 21   outSAMtype BAM SortedByCoordinate   sjdbOverhang 99   outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were:  Q 1  O  T 4  p  P  s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR   runMode alignReads   outFilterMismatchNmax 2   outFilterMultimapNmax 10   alignIntronMin 21   outStd SAM   outSAMattributes Standard   outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR     runMode genomeGenerate     runThreadN 8     genomeDir sjdbStarIndex     sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb    sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples  and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of   outSAMstrandField intronMotif  which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly  reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next  unidentified nucleotides  Ns  were corrected with GenomeAnalysisTK.jar  T SplitNCigarReads  rf ReassignOneMappingQuality  RMQF 255  RMQT 60  U ALLOW N CIGAR READS  improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar  T BaseRecalibrator  knownSites vcf. Finally  variants were called with GenomeAnalysisTK.jar  T HaplotypeCaller  dontUseSoftClippedBases  stand call conf 20.0  stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar  T VariantFiltration  window 35  cluster 3  filterName FS  filter \"FS > 30.0\"  filterName QD  filter \"QD < 2.0\". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout  we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates  thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble  and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads  log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.", "adult female brain", "The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "Zebrafish were maintained in standard conditions. Unless stated otherwise  in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts  23177 07/A 15 5 001 OES tail fin clips.", "tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO", "GSM2277122", "GSM2277122: FUS KO 5; Danio rerio; RNA Seq", "GSM2277122", null, "1", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "GEO Accession:GSM2277122", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP081553", null, null, "Sample_imb_ketting_2014_13_FUS_KO_5_R1.fastq.gz Sample_imb_ketting_2014_13_FUS_KO_5_R2.fastq.gz", "fastq fastq", 7478598328.0, 37022764.0, "GSM2277122 r1", "0:101 1:101", "A:2133855925;C:1603288158;G:1598612742;T:2140065375;N:2776128", 101, 101, null, null, 2133855925, 1603288158, 1598612742, 2140065375, 2776128, "SRX2018186", "SRS1614129", "SRA451974", "GEO", "Rene Ketting, Institute of Molecular Biology", 2, 0.9197, 0.92307, 0.17221, 0.17171, 0.68578, 0.68586, 0.49581, 0.50519, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "3prime", "poly_a", "trueseq", "bulk", "clip", "iclip", null, "Germany", "2016-08-12", "Adult", "Adult", "Brain", "Nervous System"], [41265, "SRR4026153", "SRX2018186", "SRS1614129", "SRP081553", "PRJNA338793", "Characterization of genetic loss of function of Fus in zebrafish", "GSE85554", "Transcriptome Analysis", "The RNA binding protein FUS is implicated in transcription  alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3\u2019UTR usage  which could mask the effects of loss of Fus. Unlike published fus morphants  maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus /  genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus /  and WT labeled with the prefix \"Sample imb ketting 2014 13 \" we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that  we performed RNA sequencing a second time  using the same input RNA  except for the Fus knockout replicate #3  because there was not enough input RNA left. Instead  a different Fus knockout replicate #1 was sequenced. However  we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools  and the samples are highly correlated at least 0.97 and 0.95  Spearman and Pearson correlation respectively. Therefore  we considered first \"Sample imb ketting 2014 13 \" and second sequencing runs as technical replicates.", null, "pubmed:27898262", null, "FUS KO 5", "GSM2277122", null, "source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO", "FUS KO 5", "RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR   runMode alignReads   outBAMsortingThreadN 0   outFilterMultimapNmax 20   alignSJoverhangMin 8   alignSJDBoverhangMin 1   outFilterMismatchNmax 2   alignIntronMin 21   outSAMtype BAM SortedByCoordinate   sjdbOverhang 99   outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were:  Q 1  O  T 4  p  P  s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR   runMode alignReads   outFilterMismatchNmax 2   outFilterMultimapNmax 10   alignIntronMin 21   outStd SAM   outSAMattributes Standard   outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR     runMode genomeGenerate     runThreadN 8     genomeDir sjdbStarIndex     sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb    sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples  and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of   outSAMstrandField intronMotif  which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly  reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next  unidentified nucleotides  Ns  were corrected with GenomeAnalysisTK.jar  T SplitNCigarReads  rf ReassignOneMappingQuality  RMQF 255  RMQT 60  U ALLOW N CIGAR READS  improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar  T BaseRecalibrator  knownSites vcf. Finally  variants were called with GenomeAnalysisTK.jar  T HaplotypeCaller  dontUseSoftClippedBases  stand call conf 20.0  stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar  T VariantFiltration  window 35  cluster 3  filterName FS  filter \"FS > 30.0\"  filterName QD  filter \"QD < 2.0\". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout  we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates  thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble  and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads  log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.", "adult female brain", "The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "Zebrafish were maintained in standard conditions. Unless stated otherwise  in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts  23177 07/A 15 5 001 OES tail fin clips.", "tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO", "GSM2277122", "GSM2277122: FUS KO 5; Danio rerio; RNA Seq", "GSM2277122", null, "1", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "GEO Accession:GSM2277122", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP081553", null, null, "FUS_KO_5_R1.fastq.gz FUS_KO_5_R2.fastq.gz", "fastq fastq", 6719087822.0, 33262811.0, "GSM2277122 r2", "0:101 1:101", "A:1785013612;C:1574089873;G:1572290158;T:1784978560;N:2715619", 101, 101, null, null, 1785013612, 1574089873, 1572290158, 1784978560, 2715619, "SRX2018186", "SRS1614129", "SRA451974", "GEO", "Rene Ketting, Institute of Molecular Biology", 2, 0.94652, 0.94901, 0.12756, 0.12603, 0.67834, 0.6789, 0.50281, 0.50397, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "3prime", "poly_a", "trueseq", "bulk", "clip", "iclip", null, "Germany", "2016-08-12", "Adult", "Adult", "Brain", "Nervous System"], [41266, "SRR4026151", "SRX2018185", "SRS1614126", "SRP081553", "PRJNA338793", "Characterization of genetic loss of function of Fus in zebrafish", "GSE85554", "Transcriptome Analysis", "The RNA binding protein FUS is implicated in transcription  alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3\u2019UTR usage  which could mask the effects of loss of Fus. Unlike published fus morphants  maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus /  genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus /  and WT labeled with the prefix \"Sample imb ketting 2014 13 \" we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that  we performed RNA sequencing a second time  using the same input RNA  except for the Fus knockout replicate #3  because there was not enough input RNA left. Instead  a different Fus knockout replicate #1 was sequenced. However  we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools  and the samples are highly correlated at least 0.97 and 0.95  Spearman and Pearson correlation respectively. Therefore  we considered first \"Sample imb ketting 2014 13 \" and second sequencing runs as technical replicates.", null, "pubmed:27898262", null, "FUS KO 3", "GSM2277121", null, "source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO", "FUS KO 3", "RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR   runMode alignReads   outBAMsortingThreadN 0   outFilterMultimapNmax 20   alignSJoverhangMin 8   alignSJDBoverhangMin 1   outFilterMismatchNmax 2   alignIntronMin 21   outSAMtype BAM SortedByCoordinate   sjdbOverhang 99   outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were:  Q 1  O  T 4  p  P  s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR   runMode alignReads   outFilterMismatchNmax 2   outFilterMultimapNmax 10   alignIntronMin 21   outStd SAM   outSAMattributes Standard   outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR     runMode genomeGenerate     runThreadN 8     genomeDir sjdbStarIndex     sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb    sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples  and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of   outSAMstrandField intronMotif  which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly  reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next  unidentified nucleotides  Ns  were corrected with GenomeAnalysisTK.jar  T SplitNCigarReads  rf ReassignOneMappingQuality  RMQF 255  RMQT 60  U ALLOW N CIGAR READS  improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar  T BaseRecalibrator  knownSites vcf. Finally  variants were called with GenomeAnalysisTK.jar  T HaplotypeCaller  dontUseSoftClippedBases  stand call conf 20.0  stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar  T VariantFiltration  window 35  cluster 3  filterName FS  filter \"FS > 30.0\"  filterName QD  filter \"QD < 2.0\". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout  we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates  thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble  and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads  log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.", "adult female brain", "The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "Zebrafish were maintained in standard conditions. Unless stated otherwise  in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts  23177 07/A 15 5 001 OES tail fin clips.", "tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO", "GSM2277121", "GSM2277121: FUS KO 3; Danio rerio; RNA Seq", "GSM2277121", null, "1", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "GEO Accession:GSM2277121", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP081553", null, null, "Sample_imb_ketting_2014_13_FUS_KO_3_R1.fastq.gz Sample_imb_ketting_2014_13_FUS_KO_3_R2.fastq.gz", "fastq fastq", 7443582840.0, 36849420.0, "GSM2277121 r1", "0:101 1:101", "A:2135476546;C:1584607182;G:1583492766;T:2137210756;N:2795590", 101, 101, null, null, 2135476546, 1584607182, 1583492766, 2137210756, 2795590, "SRX2018185", "SRS1614126", "SRA451974", "GEO", "Rene Ketting, Institute of Molecular Biology", 2, 0.91865, 0.92202, 0.16917, 0.16765, 0.69402, 0.69424, 0.49158, 0.505, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "3prime", "poly_a", "trueseq", "bulk", "clip", "iclip", null, "Germany", "2016-08-12", "Adult", "Adult", "Brain", "Nervous System"], [41267, "SRR4026149", "SRX2018184", "SRS1614127", "SRP081553", "PRJNA338793", "Characterization of genetic loss of function of Fus in zebrafish", "GSE85554", "Transcriptome Analysis", "The RNA binding protein FUS is implicated in transcription  alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3\u2019UTR usage  which could mask the effects of loss of Fus. Unlike published fus morphants  maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus /  genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus /  and WT labeled with the prefix \"Sample imb ketting 2014 13 \" we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that  we performed RNA sequencing a second time  using the same input RNA  except for the Fus knockout replicate #3  because there was not enough input RNA left. Instead  a different Fus knockout replicate #1 was sequenced. However  we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools  and the samples are highly correlated at least 0.97 and 0.95  Spearman and Pearson correlation respectively. Therefore  we considered first \"Sample imb ketting 2014 13 \" and second sequencing runs as technical replicates.", null, "pubmed:27898262", null, "FUS KO 2", "GSM2277120", null, "source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO", "FUS KO 2", "RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR   runMode alignReads   outBAMsortingThreadN 0   outFilterMultimapNmax 20   alignSJoverhangMin 8   alignSJDBoverhangMin 1   outFilterMismatchNmax 2   alignIntronMin 21   outSAMtype BAM SortedByCoordinate   sjdbOverhang 99   outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were:  Q 1  O  T 4  p  P  s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR   runMode alignReads   outFilterMismatchNmax 2   outFilterMultimapNmax 10   alignIntronMin 21   outStd SAM   outSAMattributes Standard   outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR     runMode genomeGenerate     runThreadN 8     genomeDir sjdbStarIndex     sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb    sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples  and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of   outSAMstrandField intronMotif  which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly  reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next  unidentified nucleotides  Ns  were corrected with GenomeAnalysisTK.jar  T SplitNCigarReads  rf ReassignOneMappingQuality  RMQF 255  RMQT 60  U ALLOW N CIGAR READS  improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar  T BaseRecalibrator  knownSites vcf. Finally  variants were called with GenomeAnalysisTK.jar  T HaplotypeCaller  dontUseSoftClippedBases  stand call conf 20.0  stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar  T VariantFiltration  window 35  cluster 3  filterName FS  filter \"FS > 30.0\"  filterName QD  filter \"QD < 2.0\". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout  we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates  thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble  and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads  log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.", "adult female brain", "The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "Zebrafish were maintained in standard conditions. Unless stated otherwise  in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts  23177 07/A 15 5 001 OES tail fin clips.", "tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO", "GSM2277120", "GSM2277120: FUS KO 2; Danio rerio; RNA Seq", "GSM2277120", null, "1", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "GEO Accession:GSM2277120", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP081553", null, null, "Sample_imb_ketting_2014_13_FUS_KO_2_R1.fastq.gz Sample_imb_ketting_2014_13_FUS_KO_2_R2.fastq.gz", "fastq fastq", 7538568694.0, 37319647.0, "GSM2277120 r1", "0:101 1:101", "A:2147431018;C:1618323797;G:1622221747;T:2147775519;N:2816613", 101, 101, null, null, 2147431018, 1618323797, 1622221747, 2147775519, 2816613, "SRX2018184", "SRS1614127", "SRA451974", "GEO", "Rene Ketting, Institute of Molecular Biology", 2, 0.92241, 0.92545, 0.17277, 0.17289, 0.6882, 0.68878, 0.50153, 0.49587, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "3prime", "poly_a", "trueseq", "bulk", "clip", "iclip", null, "Germany", "2016-08-12", "Adult", "Adult", "Brain", "Nervous System"], [41268, "SRR4026150", "SRX2018184", "SRS1614127", "SRP081553", "PRJNA338793", "Characterization of genetic loss of function of Fus in zebrafish", "GSE85554", "Transcriptome Analysis", "The RNA binding protein FUS is implicated in transcription  alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3\u2019UTR usage  which could mask the effects of loss of Fus. Unlike published fus morphants  maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus /  genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus /  and WT labeled with the prefix \"Sample imb ketting 2014 13 \" we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that  we performed RNA sequencing a second time  using the same input RNA  except for the Fus knockout replicate #3  because there was not enough input RNA left. Instead  a different Fus knockout replicate #1 was sequenced. However  we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools  and the samples are highly correlated at least 0.97 and 0.95  Spearman and Pearson correlation respectively. Therefore  we considered first \"Sample imb ketting 2014 13 \" and second sequencing runs as technical replicates.", null, "pubmed:27898262", null, "FUS KO 2", "GSM2277120", null, "source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO", "FUS KO 2", "RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR   runMode alignReads   outBAMsortingThreadN 0   outFilterMultimapNmax 20   alignSJoverhangMin 8   alignSJDBoverhangMin 1   outFilterMismatchNmax 2   alignIntronMin 21   outSAMtype BAM SortedByCoordinate   sjdbOverhang 99   outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were:  Q 1  O  T 4  p  P  s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR   runMode alignReads   outFilterMismatchNmax 2   outFilterMultimapNmax 10   alignIntronMin 21   outStd SAM   outSAMattributes Standard   outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR     runMode genomeGenerate     runThreadN 8     genomeDir sjdbStarIndex     sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb    sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples  and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of   outSAMstrandField intronMotif  which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly  reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next  unidentified nucleotides  Ns  were corrected with GenomeAnalysisTK.jar  T SplitNCigarReads  rf ReassignOneMappingQuality  RMQF 255  RMQT 60  U ALLOW N CIGAR READS  improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar  T BaseRecalibrator  knownSites vcf. Finally  variants were called with GenomeAnalysisTK.jar  T HaplotypeCaller  dontUseSoftClippedBases  stand call conf 20.0  stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar  T VariantFiltration  window 35  cluster 3  filterName FS  filter \"FS > 30.0\"  filterName QD  filter \"QD < 2.0\". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout  we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates  thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble  and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads  log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.", "adult female brain", "The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "Zebrafish were maintained in standard conditions. Unless stated otherwise  in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts  23177 07/A 15 5 001 OES tail fin clips.", "tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO", "GSM2277120", "GSM2277120: FUS KO 2; Danio rerio; RNA Seq", "GSM2277120", null, "1", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "GEO Accession:GSM2277120", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP081553", null, null, "FUS_KO_2_R1.fastq.gz FUS_KO_2_R2.fastq.gz", "fastq fastq", 6447010386.0, 31915893.0, "GSM2277120 r2", "0:101 1:101", "A:1836751010;C:1386222757;G:1379853653;T:1841581040;N:2601926", 101, 101, null, null, 1836751010, 1386222757, 1379853653, 1841581040, 2601926, "SRX2018184", "SRS1614127", "SRA451974", "GEO", "Rene Ketting, Institute of Molecular Biology", 2, 0.92533, 0.92991, 0.17619, 0.17625, 0.69031, 0.69081, 0.49983, 0.50191, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "3prime", "poly_a", "trueseq", "bulk", "clip", "iclip", null, "Germany", "2016-08-12", "Adult", "Adult", "Brain", "Nervous System"], [41269, "SRR4026148", "SRX2018183", "SRS1614125", "SRP081553", "PRJNA338793", "Characterization of genetic loss of function of Fus in zebrafish", "GSE85554", "Transcriptome Analysis", "The RNA binding protein FUS is implicated in transcription  alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3\u2019UTR usage  which could mask the effects of loss of Fus. Unlike published fus morphants  maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus /  genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus /  and WT labeled with the prefix \"Sample imb ketting 2014 13 \" we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that  we performed RNA sequencing a second time  using the same input RNA  except for the Fus knockout replicate #3  because there was not enough input RNA left. Instead  a different Fus knockout replicate #1 was sequenced. However  we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools  and the samples are highly correlated at least 0.97 and 0.95  Spearman and Pearson correlation respectively. Therefore  we considered first \"Sample imb ketting 2014 13 \" and second sequencing runs as technical replicates.", null, "pubmed:27898262", null, "FUS KO 1", "GSM2277119", null, "source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO", "FUS KO 1", "RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR   runMode alignReads   outBAMsortingThreadN 0   outFilterMultimapNmax 20   alignSJoverhangMin 8   alignSJDBoverhangMin 1   outFilterMismatchNmax 2   alignIntronMin 21   outSAMtype BAM SortedByCoordinate   sjdbOverhang 99   outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were:  Q 1  O  T 4  p  P  s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR   runMode alignReads   outFilterMismatchNmax 2   outFilterMultimapNmax 10   alignIntronMin 21   outStd SAM   outSAMattributes Standard   outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR     runMode genomeGenerate     runThreadN 8     genomeDir sjdbStarIndex     sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb    sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples  and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of   outSAMstrandField intronMotif  which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly  reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next  unidentified nucleotides  Ns  were corrected with GenomeAnalysisTK.jar  T SplitNCigarReads  rf ReassignOneMappingQuality  RMQF 255  RMQT 60  U ALLOW N CIGAR READS  improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar  T BaseRecalibrator  knownSites vcf. Finally  variants were called with GenomeAnalysisTK.jar  T HaplotypeCaller  dontUseSoftClippedBases  stand call conf 20.0  stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar  T VariantFiltration  window 35  cluster 3  filterName FS  filter \"FS > 30.0\"  filterName QD  filter \"QD < 2.0\". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout  we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates  thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble  and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads  log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.", "adult female brain", "The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "Zebrafish were maintained in standard conditions. Unless stated otherwise  in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts  23177 07/A 15 5 001 OES tail fin clips.", "tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:FUS KO", "GSM2277119", "GSM2277119: FUS KO 1; Danio rerio; RNA Seq", "GSM2277119", null, "1", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "GEO Accession:GSM2277119", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP081553", null, null, "FUS_KO_1_R1.fastq.gz FUS_KO_1_R2.fastq.gz", "fastq fastq", 7395102840.0, 36609420.0, "GSM2277119 r1", "0:101 1:101", "A:2103771703;C:1595017984;G:1583980946;T:2109307704;N:3024503", 101, 101, null, null, 2103771703, 1595017984, 1583980946, 2109307704, 3024503, "SRX2018183", "SRS1614125", "SRA451974", "GEO", "Rene Ketting, Institute of Molecular Biology", 2, 0.9246, 0.92781, 0.17577, 0.17518, 0.69116, 0.69232, 0.50228, 0.49896, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "3prime", "poly_a", "trueseq", "bulk", "clip", "iclip", null, "Germany", "2016-08-12", "Adult", "Adult", "Brain", "Nervous System"], [41270, "SRR4026146", "SRX2018182", "SRS1614123", "SRP081553", "PRJNA338793", "Characterization of genetic loss of function of Fus in zebrafish", "GSE85554", "Transcriptome Analysis", "The RNA binding protein FUS is implicated in transcription  alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3\u2019UTR usage  which could mask the effects of loss of Fus. Unlike published fus morphants  maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus /  genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus /  and WT labeled with the prefix \"Sample imb ketting 2014 13 \" we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that  we performed RNA sequencing a second time  using the same input RNA  except for the Fus knockout replicate #3  because there was not enough input RNA left. Instead  a different Fus knockout replicate #1 was sequenced. However  we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools  and the samples are highly correlated at least 0.97 and 0.95  Spearman and Pearson correlation respectively. Therefore  we considered first \"Sample imb ketting 2014 13 \" and second sequencing runs as technical replicates.", null, "pubmed:27898262", null, "WT 6", "GSM2277118", null, "source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type", "WT 6", "RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR   runMode alignReads   outBAMsortingThreadN 0   outFilterMultimapNmax 20   alignSJoverhangMin 8   alignSJDBoverhangMin 1   outFilterMismatchNmax 2   alignIntronMin 21   outSAMtype BAM SortedByCoordinate   sjdbOverhang 99   outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were:  Q 1  O  T 4  p  P  s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR   runMode alignReads   outFilterMismatchNmax 2   outFilterMultimapNmax 10   alignIntronMin 21   outStd SAM   outSAMattributes Standard   outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR     runMode genomeGenerate     runThreadN 8     genomeDir sjdbStarIndex     sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb    sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples  and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of   outSAMstrandField intronMotif  which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly  reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next  unidentified nucleotides  Ns  were corrected with GenomeAnalysisTK.jar  T SplitNCigarReads  rf ReassignOneMappingQuality  RMQF 255  RMQT 60  U ALLOW N CIGAR READS  improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar  T BaseRecalibrator  knownSites vcf. Finally  variants were called with GenomeAnalysisTK.jar  T HaplotypeCaller  dontUseSoftClippedBases  stand call conf 20.0  stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar  T VariantFiltration  window 35  cluster 3  filterName FS  filter \"FS > 30.0\"  filterName QD  filter \"QD < 2.0\". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout  we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates  thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble  and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads  log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.", "adult female brain", "The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "Zebrafish were maintained in standard conditions. Unless stated otherwise  in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts  23177 07/A 15 5 001 OES tail fin clips.", "tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type", "GSM2277118", "GSM2277118: WT 6; Danio rerio; RNA Seq", "GSM2277118", null, "1", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "GEO Accession:GSM2277118", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP081553", null, null, "Sample_imb_ketting_2014_13_WT_6_R1.fastq.gz Sample_imb_ketting_2014_13_WT_6_R2.fastq.gz", "fastq fastq", 8334635544.0, 41260572.0, "GSM2277118 r1", "0:101 1:101", "A:2382306534;C:1783081151;G:1778919442;T:2387251408;N:3077009", 101, 101, null, null, 2382306534, 1783081151, 1778919442, 2387251408, 3077009, "SRX2018182", "SRS1614123", "SRA451974", "GEO", "Rene Ketting, Institute of Molecular Biology", 2, 0.91647, 0.9192, 0.1793, 0.17873, 0.69215, 0.69262, 0.50463, 0.50038, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "3prime", "poly_a", "trueseq", "bulk", "clip", "iclip", null, "Germany", "2016-08-12", "Adult", "Adult", "Brain", "Nervous System"], [41271, "SRR4026147", "SRX2018182", "SRS1614123", "SRP081553", "PRJNA338793", "Characterization of genetic loss of function of Fus in zebrafish", "GSE85554", "Transcriptome Analysis", "The RNA binding protein FUS is implicated in transcription  alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3\u2019UTR usage  which could mask the effects of loss of Fus. Unlike published fus morphants  maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus /  genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus /  and WT labeled with the prefix \"Sample imb ketting 2014 13 \" we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that  we performed RNA sequencing a second time  using the same input RNA  except for the Fus knockout replicate #3  because there was not enough input RNA left. Instead  a different Fus knockout replicate #1 was sequenced. However  we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools  and the samples are highly correlated at least 0.97 and 0.95  Spearman and Pearson correlation respectively. Therefore  we considered first \"Sample imb ketting 2014 13 \" and second sequencing runs as technical replicates.", null, "pubmed:27898262", null, "WT 6", "GSM2277118", null, "source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type", "WT 6", "RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR   runMode alignReads   outBAMsortingThreadN 0   outFilterMultimapNmax 20   alignSJoverhangMin 8   alignSJDBoverhangMin 1   outFilterMismatchNmax 2   alignIntronMin 21   outSAMtype BAM SortedByCoordinate   sjdbOverhang 99   outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were:  Q 1  O  T 4  p  P  s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR   runMode alignReads   outFilterMismatchNmax 2   outFilterMultimapNmax 10   alignIntronMin 21   outStd SAM   outSAMattributes Standard   outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR     runMode genomeGenerate     runThreadN 8     genomeDir sjdbStarIndex     sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb    sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples  and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of   outSAMstrandField intronMotif  which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly  reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next  unidentified nucleotides  Ns  were corrected with GenomeAnalysisTK.jar  T SplitNCigarReads  rf ReassignOneMappingQuality  RMQF 255  RMQT 60  U ALLOW N CIGAR READS  improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar  T BaseRecalibrator  knownSites vcf. Finally  variants were called with GenomeAnalysisTK.jar  T HaplotypeCaller  dontUseSoftClippedBases  stand call conf 20.0  stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar  T VariantFiltration  window 35  cluster 3  filterName FS  filter \"FS > 30.0\"  filterName QD  filter \"QD < 2.0\". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout  we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates  thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble  and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads  log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.", "adult female brain", "The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "Zebrafish were maintained in standard conditions. Unless stated otherwise  in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts  23177 07/A 15 5 001 OES tail fin clips.", "tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type", "GSM2277118", "GSM2277118: WT 6; Danio rerio; RNA Seq", "GSM2277118", null, "1", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "GEO Accession:GSM2277118", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP081553", null, null, "WT_6_R1.fastq.gz WT_6_R2.fastq.gz", "fastq fastq", 7239861396.0, 35840898.0, "GSM2277118 r2", "0:101 1:101", "A:1993396411;C:1626521001;G:1620190105;T:1996794482;N:2959397", 101, 101, null, null, 1993396411, 1626521001, 1620190105, 1996794482, 2959397, "SRX2018182", "SRS1614123", "SRA451974", "GEO", "Rene Ketting, Institute of Molecular Biology", 2, 0.93444, 0.93758, 0.15305, 0.15223, 0.68781, 0.6885, 0.5083, 0.50745, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "3prime", "poly_a", "trueseq", "bulk", "clip", "iclip", null, "Germany", "2016-08-12", "Adult", "Adult", "Brain", "Nervous System"], [41272, "SRR4026144", "SRX2018181", "SRS1614122", "SRP081553", "PRJNA338793", "Characterization of genetic loss of function of Fus in zebrafish", "GSE85554", "Transcriptome Analysis", "The RNA binding protein FUS is implicated in transcription  alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3\u2019UTR usage  which could mask the effects of loss of Fus. Unlike published fus morphants  maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus /  genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus /  and WT labeled with the prefix \"Sample imb ketting 2014 13 \" we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that  we performed RNA sequencing a second time  using the same input RNA  except for the Fus knockout replicate #3  because there was not enough input RNA left. Instead  a different Fus knockout replicate #1 was sequenced. However  we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools  and the samples are highly correlated at least 0.97 and 0.95  Spearman and Pearson correlation respectively. Therefore  we considered first \"Sample imb ketting 2014 13 \" and second sequencing runs as technical replicates.", null, "pubmed:27898262", null, "WT 4", "GSM2277117", null, "source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type", "WT 4", "RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR   runMode alignReads   outBAMsortingThreadN 0   outFilterMultimapNmax 20   alignSJoverhangMin 8   alignSJDBoverhangMin 1   outFilterMismatchNmax 2   alignIntronMin 21   outSAMtype BAM SortedByCoordinate   sjdbOverhang 99   outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were:  Q 1  O  T 4  p  P  s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR   runMode alignReads   outFilterMismatchNmax 2   outFilterMultimapNmax 10   alignIntronMin 21   outStd SAM   outSAMattributes Standard   outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR     runMode genomeGenerate     runThreadN 8     genomeDir sjdbStarIndex     sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb    sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples  and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of   outSAMstrandField intronMotif  which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly  reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next  unidentified nucleotides  Ns  were corrected with GenomeAnalysisTK.jar  T SplitNCigarReads  rf ReassignOneMappingQuality  RMQF 255  RMQT 60  U ALLOW N CIGAR READS  improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar  T BaseRecalibrator  knownSites vcf. Finally  variants were called with GenomeAnalysisTK.jar  T HaplotypeCaller  dontUseSoftClippedBases  stand call conf 20.0  stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar  T VariantFiltration  window 35  cluster 3  filterName FS  filter \"FS > 30.0\"  filterName QD  filter \"QD < 2.0\". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout  we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates  thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble  and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads  log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.", "adult female brain", "The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "Zebrafish were maintained in standard conditions. Unless stated otherwise  in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts  23177 07/A 15 5 001 OES tail fin clips.", "tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type", "GSM2277117", "GSM2277117: WT 4; Danio rerio; RNA Seq", "GSM2277117", null, "1", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "GEO Accession:GSM2277117", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP081553", null, null, "Sample_imb_ketting_2014_13_WT_4_R1.fastq.gz Sample_imb_ketting_2014_13_WT_4_R2.fastq.gz", "fastq fastq", 7425010556.0, 36757478.0, "GSM2277117 r1", "0:101 1:101", "A:2145596358;C:1565455511;G:1562345442;T:2148814299;N:2798946", 101, 101, null, null, 2145596358, 1565455511, 1562345442, 2148814299, 2798946, "SRX2018181", "SRS1614122", "SRA451974", "GEO", "Rene Ketting, Institute of Molecular Biology", 2, 0.91897, 0.92157, 0.17645, 0.17633, 0.6981, 0.69948, 0.51038, 0.50544, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "3prime", "poly_a", "trueseq", "bulk", "clip", "iclip", null, "Germany", "2016-08-12", "Adult", "Adult", "Brain", "Nervous System"], [41273, "SRR4026145", "SRX2018181", "SRS1614122", "SRP081553", "PRJNA338793", "Characterization of genetic loss of function of Fus in zebrafish", "GSE85554", "Transcriptome Analysis", "The RNA binding protein FUS is implicated in transcription  alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3\u2019UTR usage  which could mask the effects of loss of Fus. Unlike published fus morphants  maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus /  genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus /  and WT labeled with the prefix \"Sample imb ketting 2014 13 \" we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that  we performed RNA sequencing a second time  using the same input RNA  except for the Fus knockout replicate #3  because there was not enough input RNA left. Instead  a different Fus knockout replicate #1 was sequenced. However  we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools  and the samples are highly correlated at least 0.97 and 0.95  Spearman and Pearson correlation respectively. Therefore  we considered first \"Sample imb ketting 2014 13 \" and second sequencing runs as technical replicates.", null, "pubmed:27898262", null, "WT 4", "GSM2277117", null, "source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type", "WT 4", "RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR   runMode alignReads   outBAMsortingThreadN 0   outFilterMultimapNmax 20   alignSJoverhangMin 8   alignSJDBoverhangMin 1   outFilterMismatchNmax 2   alignIntronMin 21   outSAMtype BAM SortedByCoordinate   sjdbOverhang 99   outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were:  Q 1  O  T 4  p  P  s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR   runMode alignReads   outFilterMismatchNmax 2   outFilterMultimapNmax 10   alignIntronMin 21   outStd SAM   outSAMattributes Standard   outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR     runMode genomeGenerate     runThreadN 8     genomeDir sjdbStarIndex     sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb    sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples  and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of   outSAMstrandField intronMotif  which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly  reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next  unidentified nucleotides  Ns  were corrected with GenomeAnalysisTK.jar  T SplitNCigarReads  rf ReassignOneMappingQuality  RMQF 255  RMQT 60  U ALLOW N CIGAR READS  improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar  T BaseRecalibrator  knownSites vcf. Finally  variants were called with GenomeAnalysisTK.jar  T HaplotypeCaller  dontUseSoftClippedBases  stand call conf 20.0  stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar  T VariantFiltration  window 35  cluster 3  filterName FS  filter \"FS > 30.0\"  filterName QD  filter \"QD < 2.0\". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout  we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates  thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble  and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads  log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.", "adult female brain", "The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "Zebrafish were maintained in standard conditions. Unless stated otherwise  in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts  23177 07/A 15 5 001 OES tail fin clips.", "tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type", "GSM2277117", "GSM2277117: WT 4; Danio rerio; RNA Seq", "GSM2277117", null, "1", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "GEO Accession:GSM2277117", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP081553", null, null, "WT_4_R1.fastq.gz WT_4_R2.fastq.gz", "fastq fastq", 6322186910.0, 31297955.0, "GSM2277117 r2", "0:101 1:101", "A:1808695425;C:1352265448;G:1346884156;T:1811742728;N:2599153", 101, 101, null, null, 1808695425, 1352265448, 1346884156, 1811742728, 2599153, "SRX2018181", "SRS1614122", "SRA451974", "GEO", "Rene Ketting, Institute of Molecular Biology", 2, 0.927, 0.92959, 0.17323, 0.17284, 0.69562, 0.69601, 0.50522, 0.50634, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "3prime", "poly_a", "trueseq", "bulk", "clip", "iclip", null, "Germany", "2016-08-12", "Adult", "Adult", "Brain", "Nervous System"], [41274, "SRR4026142", "SRX2018180", "SRS1614124", "SRP081553", "PRJNA338793", "Characterization of genetic loss of function of Fus in zebrafish", "GSE85554", "Transcriptome Analysis", "The RNA binding protein FUS is implicated in transcription  alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3\u2019UTR usage  which could mask the effects of loss of Fus. Unlike published fus morphants  maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus /  genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus /  and WT labeled with the prefix \"Sample imb ketting 2014 13 \" we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that  we performed RNA sequencing a second time  using the same input RNA  except for the Fus knockout replicate #3  because there was not enough input RNA left. Instead  a different Fus knockout replicate #1 was sequenced. However  we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools  and the samples are highly correlated at least 0.97 and 0.95  Spearman and Pearson correlation respectively. Therefore  we considered first \"Sample imb ketting 2014 13 \" and second sequencing runs as technical replicates.", null, "pubmed:27898262", null, "WT 3", "GSM2277116", null, "source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type", "WT 3", "RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR   runMode alignReads   outBAMsortingThreadN 0   outFilterMultimapNmax 20   alignSJoverhangMin 8   alignSJDBoverhangMin 1   outFilterMismatchNmax 2   alignIntronMin 21   outSAMtype BAM SortedByCoordinate   sjdbOverhang 99   outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were:  Q 1  O  T 4  p  P  s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR   runMode alignReads   outFilterMismatchNmax 2   outFilterMultimapNmax 10   alignIntronMin 21   outStd SAM   outSAMattributes Standard   outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR     runMode genomeGenerate     runThreadN 8     genomeDir sjdbStarIndex     sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb    sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples  and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of   outSAMstrandField intronMotif  which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly  reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next  unidentified nucleotides  Ns  were corrected with GenomeAnalysisTK.jar  T SplitNCigarReads  rf ReassignOneMappingQuality  RMQF 255  RMQT 60  U ALLOW N CIGAR READS  improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar  T BaseRecalibrator  knownSites vcf. Finally  variants were called with GenomeAnalysisTK.jar  T HaplotypeCaller  dontUseSoftClippedBases  stand call conf 20.0  stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar  T VariantFiltration  window 35  cluster 3  filterName FS  filter \"FS > 30.0\"  filterName QD  filter \"QD < 2.0\". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout  we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates  thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble  and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads  log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.", "adult female brain", "The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "Zebrafish were maintained in standard conditions. Unless stated otherwise  in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts  23177 07/A 15 5 001 OES tail fin clips.", "tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type", "GSM2277116", "GSM2277116: WT 3; Danio rerio; RNA Seq", "GSM2277116", null, "1", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "GEO Accession:GSM2277116", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP081553", null, null, "Sample_imb_ketting_2014_13_WT_3_R1.fastq.gz Sample_imb_ketting_2014_13_WT_3_R2.fastq.gz", "fastq fastq", 7556697588.0, 37409394.0, "GSM2277116 r1", "0:101 1:101", "A:2168554402;C:1607788560;G:1605790339;T:2171752391;N:2811896", 101, 101, null, null, 2168554402, 1607788560, 1605790339, 2171752391, 2811896, "SRX2018180", "SRS1614124", "SRA451974", "GEO", "Rene Ketting, Institute of Molecular Biology", 2, 0.91892, 0.92233, 0.17858, 0.17763, 0.69589, 0.69674, 0.50649, 0.50869, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "3prime", "poly_a", "trueseq", "bulk", "clip", "iclip", null, "Germany", "2016-08-12", "Adult", "Adult", "Brain", "Nervous System"], [41275, "SRR4026143", "SRX2018180", "SRS1614124", "SRP081553", "PRJNA338793", "Characterization of genetic loss of function of Fus in zebrafish", "GSE85554", "Transcriptome Analysis", "The RNA binding protein FUS is implicated in transcription  alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3\u2019UTR usage  which could mask the effects of loss of Fus. Unlike published fus morphants  maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus /  genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus /  and WT labeled with the prefix \"Sample imb ketting 2014 13 \" we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that  we performed RNA sequencing a second time  using the same input RNA  except for the Fus knockout replicate #3  because there was not enough input RNA left. Instead  a different Fus knockout replicate #1 was sequenced. However  we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools  and the samples are highly correlated at least 0.97 and 0.95  Spearman and Pearson correlation respectively. Therefore  we considered first \"Sample imb ketting 2014 13 \" and second sequencing runs as technical replicates.", null, "pubmed:27898262", null, "WT 3", "GSM2277116", null, "source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type", "WT 3", "RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR   runMode alignReads   outBAMsortingThreadN 0   outFilterMultimapNmax 20   alignSJoverhangMin 8   alignSJDBoverhangMin 1   outFilterMismatchNmax 2   alignIntronMin 21   outSAMtype BAM SortedByCoordinate   sjdbOverhang 99   outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were:  Q 1  O  T 4  p  P  s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR   runMode alignReads   outFilterMismatchNmax 2   outFilterMultimapNmax 10   alignIntronMin 21   outStd SAM   outSAMattributes Standard   outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR     runMode genomeGenerate     runThreadN 8     genomeDir sjdbStarIndex     sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb    sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples  and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of   outSAMstrandField intronMotif  which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly  reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next  unidentified nucleotides  Ns  were corrected with GenomeAnalysisTK.jar  T SplitNCigarReads  rf ReassignOneMappingQuality  RMQF 255  RMQT 60  U ALLOW N CIGAR READS  improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar  T BaseRecalibrator  knownSites vcf. Finally  variants were called with GenomeAnalysisTK.jar  T HaplotypeCaller  dontUseSoftClippedBases  stand call conf 20.0  stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar  T VariantFiltration  window 35  cluster 3  filterName FS  filter \"FS > 30.0\"  filterName QD  filter \"QD < 2.0\". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout  we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates  thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble  and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads  log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.", "adult female brain", "The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "Zebrafish were maintained in standard conditions. Unless stated otherwise  in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts  23177 07/A 15 5 001 OES tail fin clips.", "tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type", "GSM2277116", "GSM2277116: WT 3; Danio rerio; RNA Seq", "GSM2277116", null, "1", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "GEO Accession:GSM2277116", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP081553", null, null, "WT_3_R1.fastq.gz WT_3_R2.fastq.gz", "fastq fastq", 7898912858.0, 39103529.0, "GSM2277116 r2", "0:101 1:101", "A:2243356257;C:1706636846;G:1702064968;T:2243634692;N:3220095", 101, 101, null, null, 2243356257, 1706636846, 1702064968, 2243634692, 3220095, "SRX2018180", "SRS1614124", "SRA451974", "GEO", "Rene Ketting, Institute of Molecular Biology", 2, 0.92701, 0.93109, 0.17113, 0.17214, 0.69591, 0.69716, 0.50649, 0.51272, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "3prime", "poly_a", "trueseq", "bulk", "clip", "iclip", null, "Germany", "2016-08-12", "Adult", "Adult", "Brain", "Nervous System"], [41276, "SRR4026140", "SRX2018179", "SRS1614121", "SRP081553", "PRJNA338793", "Characterization of genetic loss of function of Fus in zebrafish", "GSE85554", "Transcriptome Analysis", "The RNA binding protein FUS is implicated in transcription  alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3\u2019UTR usage  which could mask the effects of loss of Fus. Unlike published fus morphants  maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus /  genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus /  and WT labeled with the prefix \"Sample imb ketting 2014 13 \" we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that  we performed RNA sequencing a second time  using the same input RNA  except for the Fus knockout replicate #3  because there was not enough input RNA left. Instead  a different Fus knockout replicate #1 was sequenced. However  we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools  and the samples are highly correlated at least 0.97 and 0.95  Spearman and Pearson correlation respectively. Therefore  we considered first \"Sample imb ketting 2014 13 \" and second sequencing runs as technical replicates.", null, "pubmed:27898262", null, "WT 1", "GSM2277115", null, "source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type", "WT 1", "RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR   runMode alignReads   outBAMsortingThreadN 0   outFilterMultimapNmax 20   alignSJoverhangMin 8   alignSJDBoverhangMin 1   outFilterMismatchNmax 2   alignIntronMin 21   outSAMtype BAM SortedByCoordinate   sjdbOverhang 99   outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were:  Q 1  O  T 4  p  P  s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR   runMode alignReads   outFilterMismatchNmax 2   outFilterMultimapNmax 10   alignIntronMin 21   outStd SAM   outSAMattributes Standard   outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR     runMode genomeGenerate     runThreadN 8     genomeDir sjdbStarIndex     sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb    sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples  and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of   outSAMstrandField intronMotif  which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly  reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next  unidentified nucleotides  Ns  were corrected with GenomeAnalysisTK.jar  T SplitNCigarReads  rf ReassignOneMappingQuality  RMQF 255  RMQT 60  U ALLOW N CIGAR READS  improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar  T BaseRecalibrator  knownSites vcf. Finally  variants were called with GenomeAnalysisTK.jar  T HaplotypeCaller  dontUseSoftClippedBases  stand call conf 20.0  stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar  T VariantFiltration  window 35  cluster 3  filterName FS  filter \"FS > 30.0\"  filterName QD  filter \"QD < 2.0\". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout  we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates  thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble  and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads  log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.", "adult female brain", "The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "Zebrafish were maintained in standard conditions. Unless stated otherwise  in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts  23177 07/A 15 5 001 OES tail fin clips.", "tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type", "GSM2277115", "GSM2277115: WT 1; Danio rerio; RNA Seq", "GSM2277115", null, "1", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "GEO Accession:GSM2277115", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP081553", null, null, "Sample_imb_ketting_2014_13_WT_1_R1.fastq.gz Sample_imb_ketting_2014_13_WT_1_R2.fastq.gz", "fastq fastq", 7999392910.0, 39600955.0, "GSM2277115 r1", "0:101 1:101", "A:2287512350;C:1711532349;G:1705616114;T:2291731604;N:3000493", 101, 101, null, null, 2287512350, 1711532349, 1705616114, 2291731604, 3000493, "SRX2018179", "SRS1614121", "SRA451974", "GEO", "Rene Ketting, Institute of Molecular Biology", 2, 0.92291, 0.92474, 0.16701, 0.16646, 0.698, 0.69814, 0.51025, 0.51024, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "3prime", "poly_a", "trueseq", "bulk", "clip", "iclip", null, "Germany", "2016-08-12", "Adult", "Adult", "Brain", "Nervous System"], [41277, "SRR4026141", "SRX2018179", "SRS1614121", "SRP081553", "PRJNA338793", "Characterization of genetic loss of function of Fus in zebrafish", "GSE85554", "Transcriptome Analysis", "The RNA binding protein FUS is implicated in transcription  alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3\u2019UTR usage  which could mask the effects of loss of Fus. Unlike published fus morphants  maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus /  genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus /  and WT labeled with the prefix \"Sample imb ketting 2014 13 \" we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that  we performed RNA sequencing a second time  using the same input RNA  except for the Fus knockout replicate #3  because there was not enough input RNA left. Instead  a different Fus knockout replicate #1 was sequenced. However  we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools  and the samples are highly correlated at least 0.97 and 0.95  Spearman and Pearson correlation respectively. Therefore  we considered first \"Sample imb ketting 2014 13 \" and second sequencing runs as technical replicates.", null, "pubmed:27898262", null, "WT 1", "GSM2277115", null, "source name:adult female brain|tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type", "WT 1", "RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR   runMode alignReads   outBAMsortingThreadN 0   outFilterMultimapNmax 20   alignSJoverhangMin 8   alignSJDBoverhangMin 1   outFilterMismatchNmax 2   alignIntronMin 21   outSAMtype BAM SortedByCoordinate   sjdbOverhang 99   outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were:  Q 1  O  T 4  p  P  s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR   runMode alignReads   outFilterMismatchNmax 2   outFilterMultimapNmax 10   alignIntronMin 21   outStd SAM   outSAMattributes Standard   outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR     runMode genomeGenerate     runThreadN 8     genomeDir sjdbStarIndex     sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb    sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples  and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of   outSAMstrandField intronMotif  which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly  reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next  unidentified nucleotides  Ns  were corrected with GenomeAnalysisTK.jar  T SplitNCigarReads  rf ReassignOneMappingQuality  RMQF 255  RMQT 60  U ALLOW N CIGAR READS  improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar  T BaseRecalibrator  knownSites vcf. Finally  variants were called with GenomeAnalysisTK.jar  T HaplotypeCaller  dontUseSoftClippedBases  stand call conf 20.0  stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar  T VariantFiltration  window 35  cluster 3  filterName FS  filter \"FS > 30.0\"  filterName QD  filter \"QD < 2.0\". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout  we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates  thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble  and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads  log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.", "adult female brain", "The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "Zebrafish were maintained in standard conditions. Unless stated otherwise  in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts  23177 07/A 15 5 001 OES tail fin clips.", "tissue:whole brain|strain:AB x TU|developmental stage:adult|gender:female|genotype:wild type", "GSM2277115", "GSM2277115: WT 1; Danio rerio; RNA Seq", "GSM2277115", null, "1", "Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500\u00b5l RNALater AM7020  Ambion and stored overnight at 4\u00b0C. Subsequently  the brains were homogenized with a plastic pestle on ice in 300\u00b5l iCLIP Lysis buffer 50mM Tris Cl pH 7.5  100mM NaCl  1% Igepal CA 630Sigma I8896  0.1% SDS  0.5% sodium deoxycholate  Protease Inhibitors EDTA free Roche  anti RNase AM2692  Ambion 1:1000. The lysate was further split in two parts: 250\u00b5l of the lysate were immediately transferred to 750\u00b5l Trizol LS 10296028  Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.", "GEO Accession:GSM2277115", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP081553", null, null, "WT_1_R1.fastq.gz WT_1_R2.fastq.gz", "fastq fastq", 6187101026.0, 30629213.0, "GSM2277115 r2", "0:101 1:101", "A:1757769151;C:1333826875;G:1336928364;T:1756068161;N:2508475", 101, 101, null, null, 1757769151, 1333826875, 1336928364, 1756068161, 2508475, "SRX2018179", "SRS1614121", "SRA451974", "GEO", "Rene Ketting, Institute of Molecular Biology", 2, 0.9294, 0.9334, 0.16402, 0.16355, 0.69682, 0.69741, 0.49912, 0.50428, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "3prime", "poly_a", "trueseq", "bulk", "clip", "iclip", null, "Germany", "2016-08-12", "Adult", "Adult", "Brain", "Nervous System"], [41527, "SRR5441898", "SRX2731753", "SRS2119651", "SRP092907", "PRJNA352850", "Transcriptomics analysis of gene expressions  m6A enrichment levels and ythdf2 binding targets in control and mettl3 or ythdf2 morphants zebrafish embryos", "GSE89655", "Other", "RNA was isolated from control and mettl3 or ythdf2 morphants zebrafish cells using the TRIzol Invitrogen reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100. All samples showed a RIN RNA integrity number of higher than 9. Approximately 2.5 \u00b5g of total RNA was then used for library preparation using a TruSeq\u2122 RNA Sample Prep Kit v2 Illumina  San Diego  CA  USA according to the manufacturer\u2019s protocol.The libraries were sequenced using HiSeq2500 or HiSeq 3000 Illumina in paired read mode  creating reads with a length of 101 or 151 bp. Sequencing chemistry v2 Illumina was used. Overall design: Examination of gene expressive levels  m6A enrichment levels  m6A single uncleotide sites and ythdf2 binding targets in normal and mettl3 or ythdf2 morphants zebrafish cells", null, "pubmed:28869969", null, "control zebrafish embryos m6A miCLIP rep2", "GSM2572320", null, "source name:zebrafish embryos|cell type:normal zebrafish embryos cells|age:28hpf|tissue:trunk|enrichment antibody vendor:Abcam", "control zebrafish embryos m6A miCLIP rep2", "library strategy: miCLIP seq Reads were trimmed for adaptor sequence using fastx clipper from FASTX Toolkit fastx clipper  a AGATCGGAAGAGCACACG  n  Q 33. Low quality bases were filtered by fastq filter.pl  a custom perl script from CLIP Tool Kit CTK and reads shorter than 24 nt would be discard. The forward reads were demultiplexed based on 5\u2019 barcodes for individual replicates by fastq2collapse.pl to remove PCR amplified reads. The reverse reads were reversed complemented and processed like their forward mates. And then paired end reads were mixed for downstream analysis. Random barcodes of remained reads were stripped by stripBarcode.pl. Then the barcode sequence was moved to header line for each read. Remained reads were mapped to the zebrafish genomes version zv9 with BWA v0.7.10. The CIMS pipeline https://zhanglab.c2b2.columbia.edu/index.php/CTK Documentation was used to collapse PCR duplicates based on their mapped coordinates and to determine the unique tag coverage k and the number of mutation m for each nucleotide. The filter for the dataset was k >= 15 and m/k <= 50% and only mutation positions within RRACH motif were identified as m6A for downstream analysis to exclude the potential m6Am modification. Genome build: zv9 Supplementary files format and content: Single nucleotide resolution m6A sites identified by CIMS software.", "zebrafish embryos", null, "For miCLIP seq  mRNA was isolate from the trunck region of zebrafish embryos at 28hpf and the RNA integrity was checked using an Agilent Bioanalyzer 2100. 10 ug of mRNA was first fragmented and immunoprecipitated with m6A antibody and thus obtained m6A containing RNA was subjected to cDNA library construction according to previously reported method [Linder et al. 2015; PMID: 26121403]. The libraries were sequenced using HiSeq3000 Illumina in paired read mode  creating reads with a length of 101 bp.", null, "cell type:normal zebrafish embryos cells|age:28hpf|tissue:trunk|enrichment antibody vendor:Abcam", "GSM2572320", "GSM2572320: control zebrafish embryos m6A miCLIP rep2; Danio rerio; OTHER", "GSM2572320", null, "1", "For miCLIP seq  mRNA was isolate from the trunck region of zebrafish embryos at 28hpf and the RNA integrity was checked using an Agilent Bioanalyzer 2100. 10 ug of mRNA was first fragmented and immunoprecipitated with m6A antibody and thus obtained m6A containing RNA was subjected to cDNA library construction according to previously reported method [Linder et al. 2015; PMID: 26121403]. The libraries were sequenced using HiSeq2000 or HiSeq3000 Illumina in single read or paired read mode  creating reads with a length of 101 bp", "GEO Accession:GSM2572320", "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 3000", null, "SRP092907", null, null, "miCLIP_Abcam_rep2_1.fastq.gz miCLIP_Abcam_rep2_2.fastq.gz", "fastq fastq", 5381144865.0, 26771865.0, "GSM2572320 r1", "0:101 1:100", "A:1590037266;C:1121098903;G:1187084038;T:1482144584;N:780074", 101, 100, null, null, 1590037266, 1121098903, 1187084038, 1482144584, 780074, "SRX2731753", "SRS2119651", "SRA491654", "GEO", "Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)", 2, 0.55442, 0.60543, 0.10037, 0.11559, 0.75432, 0.747, 0.55512, 0.44818, 101, 100, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "clip", "iclip", null, "China", "2017-04-10", "Pharyngula", "Embryo", "Trunk", "Surface Structure"], [41528, "SRR5441897", "SRX2731752", "SRS2119650", "SRP092907", "PRJNA352850", "Transcriptomics analysis of gene expressions  m6A enrichment levels and ythdf2 binding targets in control and mettl3 or ythdf2 morphants zebrafish embryos", "GSE89655", "Other", "RNA was isolated from control and mettl3 or ythdf2 morphants zebrafish cells using the TRIzol Invitrogen reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100. All samples showed a RIN RNA integrity number of higher than 9. Approximately 2.5 \u00b5g of total RNA was then used for library preparation using a TruSeq\u2122 RNA Sample Prep Kit v2 Illumina  San Diego  CA  USA according to the manufacturer\u2019s protocol.The libraries were sequenced using HiSeq2500 or HiSeq 3000 Illumina in paired read mode  creating reads with a length of 101 or 151 bp. Sequencing chemistry v2 Illumina was used. Overall design: Examination of gene expressive levels  m6A enrichment levels  m6A single uncleotide sites and ythdf2 binding targets in normal and mettl3 or ythdf2 morphants zebrafish cells", null, "pubmed:28869969", null, "control zebrafish embryos m6A miCLIP rep1", "GSM2572319", null, "source name:zebrafish embryos|cell type:normal zebrafish embryos cells|age:28hpf|tissue:trunk|enrichment antibody vendor:Abcam", "control zebrafish embryos m6A miCLIP rep1", "library strategy: miCLIP seq Reads were trimmed for adaptor sequence using fastx clipper from FASTX Toolkit fastx clipper  a AGATCGGAAGAGCACACG  n  Q 33. Low quality bases were filtered by fastq filter.pl  a custom perl script from CLIP Tool Kit CTK and reads shorter than 24 nt would be discard. The forward reads were demultiplexed based on 5\u2019 barcodes for individual replicates by fastq2collapse.pl to remove PCR amplified reads. The reverse reads were reversed complemented and processed like their forward mates. And then paired end reads were mixed for downstream analysis. Random barcodes of remained reads were stripped by stripBarcode.pl. Then the barcode sequence was moved to header line for each read. Remained reads were mapped to the zebrafish genomes version zv9 with BWA v0.7.10. The CIMS pipeline https://zhanglab.c2b2.columbia.edu/index.php/CTK Documentation was used to collapse PCR duplicates based on their mapped coordinates and to determine the unique tag coverage k and the number of mutation m for each nucleotide. The filter for the dataset was k >= 15 and m/k <= 50% and only mutation positions within RRACH motif were identified as m6A for downstream analysis to exclude the potential m6Am modification. Genome build: zv9 Supplementary files format and content: Single nucleotide resolution m6A sites identified by CIMS software.", "zebrafish embryos", null, "For miCLIP seq  mRNA was isolate from the trunck region of zebrafish embryos at 28hpf and the RNA integrity was checked using an Agilent Bioanalyzer 2100. 10 ug of mRNA was first fragmented and immunoprecipitated with m6A antibody and thus obtained m6A containing RNA was subjected to cDNA library construction according to previously reported method [Linder et al. 2015; PMID: 26121403]. The libraries were sequenced using HiSeq3000 Illumina in paired read mode  creating reads with a length of 101 bp.", null, "cell type:normal zebrafish embryos cells|age:28hpf|tissue:trunk|enrichment antibody vendor:Abcam", "GSM2572319", "GSM2572319: control zebrafish embryos m6A miCLIP rep1; Danio rerio; OTHER", "GSM2572319", null, "1", "For miCLIP seq  mRNA was isolate from the trunck region of zebrafish embryos at 28hpf and the RNA integrity was checked using an Agilent Bioanalyzer 2100. 10 ug of mRNA was first fragmented and immunoprecipitated with m6A antibody and thus obtained m6A containing RNA was subjected to cDNA library construction according to previously reported method [Linder et al. 2015; PMID: 26121403]. The libraries were sequenced using HiSeq2000 or HiSeq3000 Illumina in single read or paired read mode  creating reads with a length of 101 bp", "GEO Accession:GSM2572319", "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 3000", null, "SRP092907", null, null, "miCLIP_Abcam_rep1_1.fastq.gz miCLIP_Abcam_rep1_2.fastq.gz", "fastq fastq", 6036174318.0, 30030718.0, "GSM2572319 r1", "0:101 1:100", "A:1726466495;C:1297674104;G:1364186585;T:1647084426;N:762708", 101, 100, null, null, 1726466495, 1297674104, 1364186585, 1647084426, 762708, "SRX2731752", "SRS2119650", "SRA491654", "GEO", "Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)", 2, 0.5985, 0.66835, 0.09404, 0.1086, 0.74491, 0.73596, 0.54343, 0.45047, 101, 100, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "clip", "iclip", null, "China", "2017-04-10", "Pharyngula", "Embryo", "Trunk", "Surface Structure"], [49537, "SRR8937007", "SRX5717520", "SRS4655940", "SRP162876", "PRJNA493828", "Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample.", "GSE120646", "Other", "The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However  how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein  through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos  we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD  which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a  Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT  highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites  and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u00ce\u00bcl RNasin by rotating at 4\u00c2\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00c2\u00b0C for 1 h. 50 \u00ce\u00bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u00ce\u00bcl Protein A Dynabeads for 4 h at 4\u00c2\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00c2\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00c3\u2014 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00c2\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO\u00e2\u201e\u00a2 DNase Invitrogen  AM2238. iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp. RNA RIP BisSeq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u00ce\u00bcl RNasin by rotating at 4\u00c2\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00c2\u00b0C for 1 h. 50 \u00ce\u00bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u00ce\u00bcl Protein A Dynabeads for 4 h at 4\u00c2\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00c2\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00c3\u2014 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00c2\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The purified mRNA was used for RNA BisSeq library construction. Around 200 ng mRNA premixed with the in vitro transcribed Dhfr mRNA at a ratio of 300:1 Dhfr mRNA serves as methylation conversion control was fragmented to 100 nt fragments for 1 min at 90\u00b0C in 10\u00d7 RNA Fragmentation Reagent Ambion  then stopped by 10\u00d7 RNA stop solution Ambion  and precipitated with 100% ethanol. The RNA pellet was resuspended in 100 \u00b5l bisulfite solution pH 5.1  which is a 100:1 mixture of 40% sodium bisulfite Sigma and 600 \u00b5M hydroquinone Sigma and subjected to heat incubation at 75\u00b0C for 4.5 h. The reaction mixture was desalted by passing through Nanosep with 3K Omega 500/pk columns PALL Corporation with centrifugation. post washed with nuclease free water and centrifuged for five times  the RNA was finally disolved in 75 ?l nuclease free water and then desulfonated by incubation with an equal volume of 1 M Tris HCl pH 9.0 at 75 \u00b0C for 1 h. post ethanol precipitation  the RNA was resuspended in 11 \u00b5l of RNase free water and subjected to library construction. Reverse transcription was carried out with superscript II Reverse Transcriptase Invitrogen and ACT random hexamers. The following procedures were performed with the KAPA Stranded mRNA Seq Kit KAPA according to the manufacturer?s instructions.Libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 125 bp.", "parent bioproject:PRJNA534030", null, null, "RIP BS 3hpf", "GSM3732427", null, "source name:Zebrafish embryo|strain:AB strain|age:3 hpf|tissue:whole embryo|rip antibody:polyclonal anti Ybx1 antibody", "RIP BS 3hpf", "library strategy: RNA RIP BisSeq Reads were aligned to the zv9 genome assembly using meRanTK v1.2.0 m5C sites were called by meRanCall v1.2.0 and annotated by applying BEDTools\u2019 intersectBed. MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools\u2019 intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding m5C sites in one biological replicates.", "Zebrafish embryo", null, "Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol\u00ae Reagent Ambion. mRNA was extracted with using Dynabeads\u00ae mRNA Purification Kit Ambion and subjected to TURBO\u2122 DNase Invitrogen treatment at 37\u00b0C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. Thus purified mRNA was used for RNA BisSeq library construction. Around 200 ng mRNA premixed with the in vitro transcribed Dhfr mRNA at a ratio of 300:1 Dhfr mRNA serves as methylation conversion control was fragmented to 100 nt fragments for 1 min at 90\u00b0C in 10\u00d7 RNA Fragmentation Reagent Ambion  then stopped by 10\u00d7 RNA stop solution Ambion  and precipitated with 100% ethanol. The RNA pellet was resuspended in 100 \u00b5l bisulfite solution pH 5.1  which is a 100:1 mixture of 40% sodium bisulfite Sigma and 600 \u00b5M hydroquinone Sigma and subjected to heat incubation at 75\u00b0C for 4.5 h. The reaction mixture was desalted by passing through Nanosep with 3K Omega 500/pk columns PALL Corporation with centrifugation. post washed with nuclease free water and centrifuged for five times  the RNA was finally disolved in 75 \u03bcl nuclease free water and then desulfonated by incubation with an equal volume of 1 M Tris HCl pH 9.0 at 75 \u00b0C for 1 h. post ethanol precipitation  the RNA was resuspended in 11 \u00b5l of RNase free water and subjected to library construction. Reverse transcription was carried out with superscript II Reverse Transcriptase Invitrogen and ACT random hexamers. The following procedures were performed with the KAPA Stranded mRNA Seq Kit KAPA according to the manufacturer\u2019s instructions.Libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 125 bp.", null, "strain:AB strain|age:3 hpf|tissue:whole embryo|rip antibody:polyclonal anti Ybx1 antibody", "GSM3732427", "GSM3732427: RIP BS 3hpf; Danio rerio; OTHER", "GSM3732427", null, "1", "Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol\u00ae Reagent Ambion. mRNA was extracted with using Dynabeads\u00ae mRNA Purification Kit Ambion and subjected to TURBO\u2122 DNase Invitrogen treatment at 37\u00b0C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. Thus purified mRNA was used for RNA BisSeq library construction. Around 200 ng mRNA premixed with the in vitro transcribed Dhfr mRNA at a ratio of 300:1 Dhfr mRNA serves as methylation conversion control was fragmented to 100 nt fragments for 1 min at 90\u00b0C in 10\u00d7 RNA Fragmentation Reagent Ambion  then stopped by 10\u00d7 RNA stop solution Ambion  and precipitated with 100% ethanol. The RNA pellet was resuspended in 100 \u00b5l bisulfite solution pH 5.1  which is a 100:1 mixture of 40% sodium bisulfite Sigma and 600 \u00b5M hydroquinone Sigma and subjected to heat incubation at 75\u00b0C for 4.5 h. The reaction mixture was desalted by passing through Nanosep with 3K Omega 500/pk columns PALL Corporation with centrifugation. post washed with nuclease free water and centrifuged for five times  the RNA was finally disolved in 75 \u03bcl nuclease free water and then desulfonated by incubation with an equal volume of 1 M Tris HCl pH 9.0 at 75 \u00b0C for 1 h. post ethanol precipitation  the RNA was resuspended in 11 \u00b5l of RNase free water and subjected to library construction. Reverse transcription was carried out with superscript II Reverse Transcriptase Invitrogen and ACT random hexamers. The following procedures were performed with the KAPA Stranded mRNA Seq Kit KAPA according to the manufacturer's instructions.Libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 125 bp.", "GEO Accession:GSM3732427", "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP162876", null, null, "RIP-BS_3hpf_R1.fastq.gz RIP-BS_3hpf_R2.fastq.gz", "fastq fastq", 46222984200.0, 154076614.0, "GSM3732427 r1", "0:150 1:150", "A:13069130635;C:10120441406;G:10858372086;T:12169793951;N:5246122", 150, 150, null, null, 13069130635, 10120441406, 10858372086, 12169793951, 5246122, "SRX5717520", "SRS4655940", "SRA786939", "GEO", "Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)", 2, 0.0063, 0.00488, 0.00135, 0.00112, 0.99736, 0.99801, 0.66703, 0.76167, 150, 150, "T", "T", "mates < 9% mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "smarter", "bulk", "clip", "iclip", null, "China", "2019-04-22", "Blastula", "Embryo", "Whole Organism", "All anatomical structures"], [49538, "SRR8937006", "SRX5717519", "SRS4655939", "SRP162876", "PRJNA493828", "Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample.", "GSE120646", "Other", "The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However  how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein  through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos  we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD  which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a  Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT  highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites  and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u00ce\u00bcl RNasin by rotating at 4\u00c2\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00c2\u00b0C for 1 h. 50 \u00ce\u00bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u00ce\u00bcl Protein A Dynabeads for 4 h at 4\u00c2\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00c2\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00c3\u2014 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00c2\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO\u00e2\u201e\u00a2 DNase Invitrogen  AM2238. iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp. RNA RIP BisSeq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u00ce\u00bcl RNasin by rotating at 4\u00c2\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00c2\u00b0C for 1 h. 50 \u00ce\u00bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u00ce\u00bcl Protein A Dynabeads for 4 h at 4\u00c2\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00c2\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00c3\u2014 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00c2\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The purified mRNA was used for RNA BisSeq library construction. Around 200 ng mRNA premixed with the in vitro transcribed Dhfr mRNA at a ratio of 300:1 Dhfr mRNA serves as methylation conversion control was fragmented to 100 nt fragments for 1 min at 90\u00b0C in 10\u00d7 RNA Fragmentation Reagent Ambion  then stopped by 10\u00d7 RNA stop solution Ambion  and precipitated with 100% ethanol. The RNA pellet was resuspended in 100 \u00b5l bisulfite solution pH 5.1  which is a 100:1 mixture of 40% sodium bisulfite Sigma and 600 \u00b5M hydroquinone Sigma and subjected to heat incubation at 75\u00b0C for 4.5 h. The reaction mixture was desalted by passing through Nanosep with 3K Omega 500/pk columns PALL Corporation with centrifugation. post washed with nuclease free water and centrifuged for five times  the RNA was finally disolved in 75 ?l nuclease free water and then desulfonated by incubation with an equal volume of 1 M Tris HCl pH 9.0 at 75 \u00b0C for 1 h. post ethanol precipitation  the RNA was resuspended in 11 \u00b5l of RNase free water and subjected to library construction. Reverse transcription was carried out with superscript II Reverse Transcriptase Invitrogen and ACT random hexamers. The following procedures were performed with the KAPA Stranded mRNA Seq Kit KAPA according to the manufacturer?s instructions.Libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 125 bp.", "parent bioproject:PRJNA534030", null, null, "RIP BS 0hpf", "GSM3732426", null, "source name:Zebrafish embryo|strain:AB strain|age:0 hpf|tissue:whole embryo|rip antibody:polyclonal anti Ybx1 antibody", "RIP BS 0hpf", "library strategy: RNA RIP BisSeq Reads were aligned to the zv9 genome assembly using meRanTK v1.2.0 m5C sites were called by meRanCall v1.2.0 and annotated by applying BEDTools\u2019 intersectBed. MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools\u2019 intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding m5C sites in one biological replicates.", "Zebrafish embryo", null, "Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol\u00ae Reagent Ambion. mRNA was extracted with using Dynabeads\u00ae mRNA Purification Kit Ambion and subjected to TURBO\u2122 DNase Invitrogen treatment at 37\u00b0C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. Thus purified mRNA was used for RNA BisSeq library construction. Around 200 ng mRNA premixed with the in vitro transcribed Dhfr mRNA at a ratio of 300:1 Dhfr mRNA serves as methylation conversion control was fragmented to 100 nt fragments for 1 min at 90\u00b0C in 10\u00d7 RNA Fragmentation Reagent Ambion  then stopped by 10\u00d7 RNA stop solution Ambion  and precipitated with 100% ethanol. The RNA pellet was resuspended in 100 \u00b5l bisulfite solution pH 5.1  which is a 100:1 mixture of 40% sodium bisulfite Sigma and 600 \u00b5M hydroquinone Sigma and subjected to heat incubation at 75\u00b0C for 4.5 h. The reaction mixture was desalted by passing through Nanosep with 3K Omega 500/pk columns PALL Corporation with centrifugation. post washed with nuclease free water and centrifuged for five times  the RNA was finally disolved in 75 \u03bcl nuclease free water and then desulfonated by incubation with an equal volume of 1 M Tris HCl pH 9.0 at 75 \u00b0C for 1 h. post ethanol precipitation  the RNA was resuspended in 11 \u00b5l of RNase free water and subjected to library construction. Reverse transcription was carried out with superscript II Reverse Transcriptase Invitrogen and ACT random hexamers. The following procedures were performed with the KAPA Stranded mRNA Seq Kit KAPA according to the manufacturer\u2019s instructions.Libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 125 bp.", null, "strain:AB strain|age:0 hpf|tissue:whole embryo|rip antibody:polyclonal anti Ybx1 antibody", "GSM3732426", "GSM3732426: RIP BS 0hpf; Danio rerio; OTHER", "GSM3732426", null, "1", "Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol\u00ae Reagent Ambion. mRNA was extracted with using Dynabeads\u00ae mRNA Purification Kit Ambion and subjected to TURBO\u2122 DNase Invitrogen treatment at 37\u00b0C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. Thus purified mRNA was used for RNA BisSeq library construction. Around 200 ng mRNA premixed with the in vitro transcribed Dhfr mRNA at a ratio of 300:1 Dhfr mRNA serves as methylation conversion control was fragmented to 100 nt fragments for 1 min at 90\u00b0C in 10\u00d7 RNA Fragmentation Reagent Ambion  then stopped by 10\u00d7 RNA stop solution Ambion  and precipitated with 100% ethanol. The RNA pellet was resuspended in 100 \u00b5l bisulfite solution pH 5.1  which is a 100:1 mixture of 40% sodium bisulfite Sigma and 600 \u00b5M hydroquinone Sigma and subjected to heat incubation at 75\u00b0C for 4.5 h. The reaction mixture was desalted by passing through Nanosep with 3K Omega 500/pk columns PALL Corporation with centrifugation. post washed with nuclease free water and centrifuged for five times  the RNA was finally disolved in 75 \u03bcl nuclease free water and then desulfonated by incubation with an equal volume of 1 M Tris HCl pH 9.0 at 75 \u00b0C for 1 h. post ethanol precipitation  the RNA was resuspended in 11 \u00b5l of RNase free water and subjected to library construction. Reverse transcription was carried out with superscript II Reverse Transcriptase Invitrogen and ACT random hexamers. The following procedures were performed with the KAPA Stranded mRNA Seq Kit KAPA according to the manufacturer's instructions.Libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 125 bp.", "GEO Accession:GSM3732426", "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP162876", null, null, "RIP-BS_0hpf_R1.fastq.gz RIP-BS_0hpf_R2.fastq.gz", "fastq fastq", 41224496700.0, 137414989.0, "GSM3732426 r1", "0:150 1:150", "A:11515809359;C:9072060634;G:9856717145;T:10775122637;N:4786925", 150, 150, null, null, 11515809359, 9072060634, 9856717145, 10775122637, 4786925, "SRX5717519", "SRS4655939", "SRA786939", "GEO", "Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)", 2, 0.00575, 0.00421, 0.00122, 0.00083, 0.99738, 0.99801, 0.70652, 0.78053, 150, 150, "T", "T", "mates < 9% mapping rate", "illumina", "hiseq_era", "full_length", "random_priming", "smarter", "bulk", "clip", "iclip", null, "China", "2019-04-22", "Zygote", "Embryo", "Whole Organism", "All anatomical structures"], [49539, "SRR8937005", "SRX5717518", "SRS4655938", "SRP162876", "PRJNA493828", "Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample.", "GSE120646", "Other", "The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However  how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein  through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos  we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD  which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a  Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT  highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites  and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u00ce\u00bcl RNasin by rotating at 4\u00c2\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00c2\u00b0C for 1 h. 50 \u00ce\u00bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u00ce\u00bcl Protein A Dynabeads for 4 h at 4\u00c2\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00c2\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00c3\u2014 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00c2\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO\u00e2\u201e\u00a2 DNase Invitrogen  AM2238. iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp. RNA RIP BisSeq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u00ce\u00bcl RNasin by rotating at 4\u00c2\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00c2\u00b0C for 1 h. 50 \u00ce\u00bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u00ce\u00bcl Protein A Dynabeads for 4 h at 4\u00c2\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00c2\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00c3\u2014 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00c2\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The purified mRNA was used for RNA BisSeq library construction. Around 200 ng mRNA premixed with the in vitro transcribed Dhfr mRNA at a ratio of 300:1 Dhfr mRNA serves as methylation conversion control was fragmented to 100 nt fragments for 1 min at 90\u00b0C in 10\u00d7 RNA Fragmentation Reagent Ambion  then stopped by 10\u00d7 RNA stop solution Ambion  and precipitated with 100% ethanol. The RNA pellet was resuspended in 100 \u00b5l bisulfite solution pH 5.1  which is a 100:1 mixture of 40% sodium bisulfite Sigma and 600 \u00b5M hydroquinone Sigma and subjected to heat incubation at 75\u00b0C for 4.5 h. The reaction mixture was desalted by passing through Nanosep with 3K Omega 500/pk columns PALL Corporation with centrifugation. post washed with nuclease free water and centrifuged for five times  the RNA was finally disolved in 75 ?l nuclease free water and then desulfonated by incubation with an equal volume of 1 M Tris HCl pH 9.0 at 75 \u00b0C for 1 h. post ethanol precipitation  the RNA was resuspended in 11 \u00b5l of RNase free water and subjected to library construction. Reverse transcription was carried out with superscript II Reverse Transcriptase Invitrogen and ACT random hexamers. The following procedures were performed with the KAPA Stranded mRNA Seq Kit KAPA according to the manufacturer?s instructions.Libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 125 bp.", "parent bioproject:PRJNA534030", null, null, "RIP INPUT 2hpf rep2", "GSM3732425", null, "source name:RIP INPUT 2hpf|strain:AB strain|age:2 hpf|tissue:whole embryo", "RIP INPUT 2hpf rep2", "Reads were aligned to the zv9 genome assembly using TopHat v2.1.1. MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools\u2019 intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates.", "RIP INPUT 2hpf", null, "Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol\u00ae Reagent Ambion. mRNA was extracted with using Dynabeads\u00ae mRNA Purification Kit Ambion and subjected to TURBO\u2122 DNase Invitrogen treatment at 37\u00b0C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp.", null, "strain:AB strain|age:2 hpf|tissue:whole embryo", "GSM3732425", "GSM3732425: RIP INPUT 2hpf rep2; Danio rerio; RIP Seq", "GSM3732425", null, "1", "Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol\u00ae Reagent Ambion. mRNA was extracted with using Dynabeads\u00ae mRNA Purification Kit Ambion and subjected to TURBO\u2122 DNase Invitrogen treatment at 37\u00b0C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp.", "GEO Accession:GSM3732425", "RIP-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP162876", null, null, "RIP-INPUT_2hpf_rep2_R1.fastq.gz RIP-INPUT_2hpf_rep2_R2.fastq.gz", "fastq fastq", 16388119500.0, 54627065.0, "GSM3732425 r1", "0:150 1:150", "A:3232127065;C:4976385987;G:5052844082;T:3122288663;N:4473703", 150, 150, null, null, 3232127065, 4976385987, 5052844082, 3122288663, 4473703, "SRX5717518", "SRS4655938", "SRA786939", "GEO", "Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)", 2, 0.98209, 0.9812, 0.33332, 0.33565, 0.93811, 0.94186, 0.95153, 0.95984, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "random_priming", "smarter", "bulk", "clip", "iclip", null, "China", "2019-04-22", "Cleavage", "Embryo", "Whole Organism", "All anatomical structures"], [49540, "SRR8937004", "SRX5717517", "SRS4655937", "SRP162876", "PRJNA493828", "Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample.", "GSE120646", "Other", "The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However  how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein  through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos  we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD  which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a  Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT  highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites  and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u00ce\u00bcl RNasin by rotating at 4\u00c2\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00c2\u00b0C for 1 h. 50 \u00ce\u00bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u00ce\u00bcl Protein A Dynabeads for 4 h at 4\u00c2\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00c2\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00c3\u2014 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00c2\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO\u00e2\u201e\u00a2 DNase Invitrogen  AM2238. iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp. RNA RIP BisSeq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u00ce\u00bcl RNasin by rotating at 4\u00c2\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00c2\u00b0C for 1 h. 50 \u00ce\u00bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u00ce\u00bcl Protein A Dynabeads for 4 h at 4\u00c2\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00c2\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00c3\u2014 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00c2\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The purified mRNA was used for RNA BisSeq library construction. Around 200 ng mRNA premixed with the in vitro transcribed Dhfr mRNA at a ratio of 300:1 Dhfr mRNA serves as methylation conversion control was fragmented to 100 nt fragments for 1 min at 90\u00b0C in 10\u00d7 RNA Fragmentation Reagent Ambion  then stopped by 10\u00d7 RNA stop solution Ambion  and precipitated with 100% ethanol. The RNA pellet was resuspended in 100 \u00b5l bisulfite solution pH 5.1  which is a 100:1 mixture of 40% sodium bisulfite Sigma and 600 \u00b5M hydroquinone Sigma and subjected to heat incubation at 75\u00b0C for 4.5 h. The reaction mixture was desalted by passing through Nanosep with 3K Omega 500/pk columns PALL Corporation with centrifugation. post washed with nuclease free water and centrifuged for five times  the RNA was finally disolved in 75 ?l nuclease free water and then desulfonated by incubation with an equal volume of 1 M Tris HCl pH 9.0 at 75 \u00b0C for 1 h. post ethanol precipitation  the RNA was resuspended in 11 \u00b5l of RNase free water and subjected to library construction. Reverse transcription was carried out with superscript II Reverse Transcriptase Invitrogen and ACT random hexamers. The following procedures were performed with the KAPA Stranded mRNA Seq Kit KAPA according to the manufacturer?s instructions.Libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 125 bp.", "parent bioproject:PRJNA534030", null, null, "RIP INPUT 2hpf rep1", "GSM3732424", null, "source name:RIP INPUT 2hpf|strain:AB strain|age:2 hpf|tissue:whole embryo", "RIP INPUT 2hpf rep1", "Reads were aligned to the zv9 genome assembly using TopHat v2.1.1. MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools\u2019 intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates.", "RIP INPUT 2hpf", null, "Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol\u00ae Reagent Ambion. mRNA was extracted with using Dynabeads\u00ae mRNA Purification Kit Ambion and subjected to TURBO\u2122 DNase Invitrogen treatment at 37\u00b0C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp.", null, "strain:AB strain|age:2 hpf|tissue:whole embryo", "GSM3732424", "GSM3732424: RIP INPUT 2hpf rep1; Danio rerio; RIP Seq", "GSM3732424", null, "1", "Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol\u00ae Reagent Ambion. mRNA was extracted with using Dynabeads\u00ae mRNA Purification Kit Ambion and subjected to TURBO\u2122 DNase Invitrogen treatment at 37\u00b0C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp.", "GEO Accession:GSM3732424", "RIP-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP162876", null, null, "RIP-INPUT_2hpf_rep1_R1.fastq.gz RIP-INPUT_2hpf_rep1_R2.fastq.gz", "fastq fastq", 18857336400.0, 62857788.0, "GSM3732424 r1", "0:150 1:150", "A:3116761123;C:6239715125;G:6450542871;T:3049605751;N:711530", 150, 150, null, null, 3116761123, 6239715125, 6450542871, 3049605751, 711530, "SRX5717517", "SRS4655937", "SRA786939", "GEO", "Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)", 2, 0.97874, 0.96891, 0.03494, 0.03355, 0.92693, 0.93456, 0.9502, 0.94986, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "random_priming", "smarter", "bulk", "clip", "iclip", null, "China", "2019-04-22", "Cleavage", "Embryo", "Whole Organism", "All anatomical structures"], [49541, "SRR8937003", "SRX5717516", "SRS4655936", "SRP162876", "PRJNA493828", "Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample.", "GSE120646", "Other", "The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However  how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein  through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos  we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD  which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a  Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT  highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites  and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u00ce\u00bcl RNasin by rotating at 4\u00c2\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00c2\u00b0C for 1 h. 50 \u00ce\u00bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u00ce\u00bcl Protein A Dynabeads for 4 h at 4\u00c2\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00c2\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00c3\u2014 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00c2\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO\u00e2\u201e\u00a2 DNase Invitrogen  AM2238. iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp. RNA RIP BisSeq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u00ce\u00bcl RNasin by rotating at 4\u00c2\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00c2\u00b0C for 1 h. 50 \u00ce\u00bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u00ce\u00bcl Protein A Dynabeads for 4 h at 4\u00c2\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00c2\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00c3\u2014 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00c2\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The purified mRNA was used for RNA BisSeq library construction. Around 200 ng mRNA premixed with the in vitro transcribed Dhfr mRNA at a ratio of 300:1 Dhfr mRNA serves as methylation conversion control was fragmented to 100 nt fragments for 1 min at 90\u00b0C in 10\u00d7 RNA Fragmentation Reagent Ambion  then stopped by 10\u00d7 RNA stop solution Ambion  and precipitated with 100% ethanol. The RNA pellet was resuspended in 100 \u00b5l bisulfite solution pH 5.1  which is a 100:1 mixture of 40% sodium bisulfite Sigma and 600 \u00b5M hydroquinone Sigma and subjected to heat incubation at 75\u00b0C for 4.5 h. The reaction mixture was desalted by passing through Nanosep with 3K Omega 500/pk columns PALL Corporation with centrifugation. post washed with nuclease free water and centrifuged for five times  the RNA was finally disolved in 75 ?l nuclease free water and then desulfonated by incubation with an equal volume of 1 M Tris HCl pH 9.0 at 75 \u00b0C for 1 h. post ethanol precipitation  the RNA was resuspended in 11 \u00b5l of RNase free water and subjected to library construction. Reverse transcription was carried out with superscript II Reverse Transcriptase Invitrogen and ACT random hexamers. The following procedures were performed with the KAPA Stranded mRNA Seq Kit KAPA according to the manufacturer?s instructions.Libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 125 bp.", "parent bioproject:PRJNA534030", null, null, "RIP INPUT 0hpf rep2", "GSM3732423", null, "source name:RIP INPUT 0hpf|strain:AB strain|age:0 hpf|tissue:whole embryo", "RIP INPUT 0hpf rep2", "Reads were aligned to the zv9 genome assembly using TopHat v2.1.1. MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools\u2019 intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates.", "RIP INPUT 0hpf", null, "Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol\u00ae Reagent Ambion. mRNA was extracted with using Dynabeads\u00ae mRNA Purification Kit Ambion and subjected to TURBO\u2122 DNase Invitrogen treatment at 37\u00b0C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp.", null, "strain:AB strain|age:0 hpf|tissue:whole embryo", "GSM3732423", "GSM3732423: RIP INPUT 0hpf rep2; Danio rerio; RIP Seq", "GSM3732423", null, "1", "Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol\u00ae Reagent Ambion. mRNA was extracted with using Dynabeads\u00ae mRNA Purification Kit Ambion and subjected to TURBO\u2122 DNase Invitrogen treatment at 37\u00b0C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp.", "GEO Accession:GSM3732423", "RIP-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP162876", null, null, "RIP-INPUT_0hpf_rep2_R1.fastq.gz RIP-INPUT_0hpf_rep2_R2.fastq.gz", "fastq fastq", 17402218800.0, 58007396.0, "GSM3732423 r1", "0:150 1:150", "A:3416144403;C:5315174821;G:5345201218;T:3320906221;N:4792137", 150, 150, null, null, 3416144403, 5315174821, 5345201218, 3320906221, 4792137, "SRX5717516", "SRS4655936", "SRA786939", "GEO", "Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)", 2, 0.9819, 0.9814, 0.33605, 0.34016, 0.93458, 0.93963, 0.90172, 0.91272, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "random_priming", "smarter", "bulk", "clip", "iclip", null, "China", "2019-04-22", "Zygote", "Embryo", "Whole Organism", "All anatomical structures"], [49542, "SRR8937002", "SRX5717515", "SRS4655935", "SRP162876", "PRJNA493828", "Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample.", "GSE120646", "Other", "The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However  how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein  through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos  we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD  which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a  Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT  highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites  and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u00ce\u00bcl RNasin by rotating at 4\u00c2\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00c2\u00b0C for 1 h. 50 \u00ce\u00bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u00ce\u00bcl Protein A Dynabeads for 4 h at 4\u00c2\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00c2\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00c3\u2014 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00c2\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO\u00e2\u201e\u00a2 DNase Invitrogen  AM2238. iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp. RNA RIP BisSeq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u00ce\u00bcl RNasin by rotating at 4\u00c2\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00c2\u00b0C for 1 h. 50 \u00ce\u00bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u00ce\u00bcl Protein A Dynabeads for 4 h at 4\u00c2\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00c2\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00c3\u2014 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00c2\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The purified mRNA was used for RNA BisSeq library construction. Around 200 ng mRNA premixed with the in vitro transcribed Dhfr mRNA at a ratio of 300:1 Dhfr mRNA serves as methylation conversion control was fragmented to 100 nt fragments for 1 min at 90\u00b0C in 10\u00d7 RNA Fragmentation Reagent Ambion  then stopped by 10\u00d7 RNA stop solution Ambion  and precipitated with 100% ethanol. The RNA pellet was resuspended in 100 \u00b5l bisulfite solution pH 5.1  which is a 100:1 mixture of 40% sodium bisulfite Sigma and 600 \u00b5M hydroquinone Sigma and subjected to heat incubation at 75\u00b0C for 4.5 h. The reaction mixture was desalted by passing through Nanosep with 3K Omega 500/pk columns PALL Corporation with centrifugation. post washed with nuclease free water and centrifuged for five times  the RNA was finally disolved in 75 ?l nuclease free water and then desulfonated by incubation with an equal volume of 1 M Tris HCl pH 9.0 at 75 \u00b0C for 1 h. post ethanol precipitation  the RNA was resuspended in 11 \u00b5l of RNase free water and subjected to library construction. Reverse transcription was carried out with superscript II Reverse Transcriptase Invitrogen and ACT random hexamers. The following procedures were performed with the KAPA Stranded mRNA Seq Kit KAPA according to the manufacturer?s instructions.Libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 125 bp.", "parent bioproject:PRJNA534030", null, null, "RIP INPUT 0hpf rep1", "GSM3732422", null, "source name:RIP INPUT 0hpf|strain:AB strain|age:0 hpf|tissue:whole embryo", "RIP INPUT 0hpf rep1", "Reads were aligned to the zv9 genome assembly using TopHat v2.1.1. MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools\u2019 intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates.", "RIP INPUT 0hpf", null, "Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol\u00ae Reagent Ambion. mRNA was extracted with using Dynabeads\u00ae mRNA Purification Kit Ambion and subjected to TURBO\u2122 DNase Invitrogen treatment at 37\u00b0C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp.", null, "strain:AB strain|age:0 hpf|tissue:whole embryo", "GSM3732422", "GSM3732422: RIP INPUT 0hpf rep1; Danio rerio; RIP Seq", "GSM3732422", null, "1", "Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol\u00ae Reagent Ambion. mRNA was extracted with using Dynabeads\u00ae mRNA Purification Kit Ambion and subjected to TURBO\u2122 DNase Invitrogen treatment at 37\u00b0C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp.", "GEO Accession:GSM3732422", "RIP-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP162876", null, null, "RIP-INPUT_0hpf_rep1_R1.fastq.gz RIP-INPUT_0hpf_rep1_R2.fastq.gz", "fastq fastq", 16615204800.0, 55384016.0, "GSM3732422 r1", "0:150 1:150", "A:2869477028;C:5392959051;G:5575878422;T:2776252538;N:637761", 150, 150, null, null, 2869477028, 5392959051, 5575878422, 2776252538, 637761, "SRX5717515", "SRS4655935", "SRA786939", "GEO", "Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)", 2, 0.97584, 0.96561, 0.04007, 0.03832, 0.9262, 0.933, 0.94642, 0.94376, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "random_priming", "smarter", "bulk", "clip", "iclip", null, "China", "2019-04-22", "Zygote", "Embryo", "Whole Organism", "All anatomical structures"], [49543, "SRR8937001", "SRX5717514", "SRS4655934", "SRP162876", "PRJNA493828", "Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample.", "GSE120646", "Other", "The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However  how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein  through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos  we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD  which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a  Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT  highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites  and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u00ce\u00bcl RNasin by rotating at 4\u00c2\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00c2\u00b0C for 1 h. 50 \u00ce\u00bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u00ce\u00bcl Protein A Dynabeads for 4 h at 4\u00c2\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00c2\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00c3\u2014 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00c2\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO\u00e2\u201e\u00a2 DNase Invitrogen  AM2238. iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp. RNA RIP BisSeq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u00ce\u00bcl RNasin by rotating at 4\u00c2\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00c2\u00b0C for 1 h. 50 \u00ce\u00bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u00ce\u00bcl Protein A Dynabeads for 4 h at 4\u00c2\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00c2\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00c3\u2014 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00c2\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The purified mRNA was used for RNA BisSeq library construction. Around 200 ng mRNA premixed with the in vitro transcribed Dhfr mRNA at a ratio of 300:1 Dhfr mRNA serves as methylation conversion control was fragmented to 100 nt fragments for 1 min at 90\u00b0C in 10\u00d7 RNA Fragmentation Reagent Ambion  then stopped by 10\u00d7 RNA stop solution Ambion  and precipitated with 100% ethanol. The RNA pellet was resuspended in 100 \u00b5l bisulfite solution pH 5.1  which is a 100:1 mixture of 40% sodium bisulfite Sigma and 600 \u00b5M hydroquinone Sigma and subjected to heat incubation at 75\u00b0C for 4.5 h. The reaction mixture was desalted by passing through Nanosep with 3K Omega 500/pk columns PALL Corporation with centrifugation. post washed with nuclease free water and centrifuged for five times  the RNA was finally disolved in 75 ?l nuclease free water and then desulfonated by incubation with an equal volume of 1 M Tris HCl pH 9.0 at 75 \u00b0C for 1 h. post ethanol precipitation  the RNA was resuspended in 11 \u00b5l of RNase free water and subjected to library construction. Reverse transcription was carried out with superscript II Reverse Transcriptase Invitrogen and ACT random hexamers. The following procedures were performed with the KAPA Stranded mRNA Seq Kit KAPA according to the manufacturer?s instructions.Libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 125 bp.", "parent bioproject:PRJNA534030", null, null, "RIP 2hpf rep2", "GSM3732421", null, "source name:RIP 2hpf|strain:AB strain|age:2 hpf|tissue:whole embryo|rip antibody:rabbit polyclonal anti Ybx1 antibody", "RIP 2hpf rep2", "Reads were aligned to the zv9 genome assembly using TopHat v2.1.1. MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools\u2019 intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates.", "RIP 2hpf", null, "Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol\u00ae Reagent Ambion. mRNA was extracted with using Dynabeads\u00ae mRNA Purification Kit Ambion and subjected to TURBO\u2122 DNase Invitrogen treatment at 37\u00b0C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp.", null, "strain:AB strain|age:2 hpf|tissue:whole embryo|rip antibody:rabbit polyclonal anti Ybx1 antibody", "GSM3732421", "GSM3732421: RIP 2hpf rep2; Danio rerio; RIP Seq", "GSM3732421", null, "1", "Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol\u00ae Reagent Ambion. mRNA was extracted with using Dynabeads\u00ae mRNA Purification Kit Ambion and subjected to TURBO\u2122 DNase Invitrogen treatment at 37\u00b0C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp.", "GEO Accession:GSM3732421", "RIP-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP162876", null, null, "RIP_2hpf_rep2_R1.fastq.gz RIP_2hpf_rep2_R2.fastq.gz", "fastq fastq", 17557024800.0, 58523416.0, "GSM3732421 r1", "0:150 1:150", "A:4454737772;C:4407385601;G:4364085079;T:4328962997;N:1853351", 150, 150, null, null, 4454737772, 4407385601, 4364085079, 4328962997, 1853351, "SRX5717514", "SRS4655934", "SRA786939", "GEO", "Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)", 2, 0.96216, 0.96226, 0.08174, 0.08009, 0.76907, 0.77693, 0.68824, 0.65939, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "random_priming", "smarter", "bulk", "clip", "iclip", null, "China", "2019-04-22", "Cleavage", "Embryo", "Whole Organism", "All anatomical structures"], [49544, "SRR8937000", "SRX5717513", "SRS4655933", "SRP162876", "PRJNA493828", "Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample.", "GSE120646", "Other", "The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However  how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein  through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos  we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD  which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a  Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT  highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites  and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u00ce\u00bcl RNasin by rotating at 4\u00c2\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00c2\u00b0C for 1 h. 50 \u00ce\u00bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u00ce\u00bcl Protein A Dynabeads for 4 h at 4\u00c2\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00c2\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00c3\u2014 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00c2\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO\u00e2\u201e\u00a2 DNase Invitrogen  AM2238. iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp. RNA RIP BisSeq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u00ce\u00bcl RNasin by rotating at 4\u00c2\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00c2\u00b0C for 1 h. 50 \u00ce\u00bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u00ce\u00bcl Protein A Dynabeads for 4 h at 4\u00c2\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00c2\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00c3\u2014 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00c2\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The purified mRNA was used for RNA BisSeq library construction. Around 200 ng mRNA premixed with the in vitro transcribed Dhfr mRNA at a ratio of 300:1 Dhfr mRNA serves as methylation conversion control was fragmented to 100 nt fragments for 1 min at 90\u00b0C in 10\u00d7 RNA Fragmentation Reagent Ambion  then stopped by 10\u00d7 RNA stop solution Ambion  and precipitated with 100% ethanol. The RNA pellet was resuspended in 100 \u00b5l bisulfite solution pH 5.1  which is a 100:1 mixture of 40% sodium bisulfite Sigma and 600 \u00b5M hydroquinone Sigma and subjected to heat incubation at 75\u00b0C for 4.5 h. The reaction mixture was desalted by passing through Nanosep with 3K Omega 500/pk columns PALL Corporation with centrifugation. post washed with nuclease free water and centrifuged for five times  the RNA was finally disolved in 75 ?l nuclease free water and then desulfonated by incubation with an equal volume of 1 M Tris HCl pH 9.0 at 75 \u00b0C for 1 h. post ethanol precipitation  the RNA was resuspended in 11 \u00b5l of RNase free water and subjected to library construction. Reverse transcription was carried out with superscript II Reverse Transcriptase Invitrogen and ACT random hexamers. The following procedures were performed with the KAPA Stranded mRNA Seq Kit KAPA according to the manufacturer?s instructions.Libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 125 bp.", "parent bioproject:PRJNA534030", null, null, "RIP 2hpf rep1", "GSM3732420", null, "source name:RIP 2hpf|strain:AB strain|age:2 hpf|tissue:whole embryo|rip antibody:rabbit polyclonal anti Ybx1 antibody", "RIP 2hpf rep1", "Reads were aligned to the zv9 genome assembly using TopHat v2.1.1. MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools\u2019 intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates.", "RIP 2hpf", null, "Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol\u00ae Reagent Ambion. mRNA was extracted with using Dynabeads\u00ae mRNA Purification Kit Ambion and subjected to TURBO\u2122 DNase Invitrogen treatment at 37\u00b0C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp.", null, "strain:AB strain|age:2 hpf|tissue:whole embryo|rip antibody:rabbit polyclonal anti Ybx1 antibody", "GSM3732420", "GSM3732420: RIP 2hpf rep1; Danio rerio; RIP Seq", "GSM3732420", null, "1", "Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol\u00ae Reagent Ambion. mRNA was extracted with using Dynabeads\u00ae mRNA Purification Kit Ambion and subjected to TURBO\u2122 DNase Invitrogen treatment at 37\u00b0C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp.", "GEO Accession:GSM3732420", "RIP-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP162876", null, null, "RIP_2hpf_rep1_R1.fastq.gz RIP_2hpf_rep1_R2.fastq.gz", "fastq fastq", 5656083600.0, 18853612.0, "GSM3732420 r1", "0:150 1:150", "A:1244757394;C:1581273853;G:1666307178;T:1162885398;N:859777", 150, 150, null, null, 1244757394, 1581273853, 1666307178, 1162885398, 859777, "SRX5717513", "SRS4655933", "SRA786939", "GEO", "Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)", 2, 0.80705, 0.80575, 0.2454, 0.24923, 0.85478, 0.85644, 0.83319, 0.80065, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "random_priming", "smarter", "bulk", "clip", "iclip", null, "China", "2019-04-22", "Cleavage", "Embryo", "Whole Organism", "All anatomical structures"], [49545, "SRR8936999", "SRX5717512", "SRS4655932", "SRP162876", "PRJNA493828", "Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample.", "GSE120646", "Other", "The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However  how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein  through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos  we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD  which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a  Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT  highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites  and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u00ce\u00bcl RNasin by rotating at 4\u00c2\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00c2\u00b0C for 1 h. 50 \u00ce\u00bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u00ce\u00bcl Protein A Dynabeads for 4 h at 4\u00c2\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00c2\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00c3\u2014 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00c2\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO\u00e2\u201e\u00a2 DNase Invitrogen  AM2238. iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp. RNA RIP BisSeq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u00ce\u00bcl RNasin by rotating at 4\u00c2\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00c2\u00b0C for 1 h. 50 \u00ce\u00bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u00ce\u00bcl Protein A Dynabeads for 4 h at 4\u00c2\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00c2\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00c3\u2014 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00c2\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The purified mRNA was used for RNA BisSeq library construction. Around 200 ng mRNA premixed with the in vitro transcribed Dhfr mRNA at a ratio of 300:1 Dhfr mRNA serves as methylation conversion control was fragmented to 100 nt fragments for 1 min at 90\u00b0C in 10\u00d7 RNA Fragmentation Reagent Ambion  then stopped by 10\u00d7 RNA stop solution Ambion  and precipitated with 100% ethanol. The RNA pellet was resuspended in 100 \u00b5l bisulfite solution pH 5.1  which is a 100:1 mixture of 40% sodium bisulfite Sigma and 600 \u00b5M hydroquinone Sigma and subjected to heat incubation at 75\u00b0C for 4.5 h. The reaction mixture was desalted by passing through Nanosep with 3K Omega 500/pk columns PALL Corporation with centrifugation. post washed with nuclease free water and centrifuged for five times  the RNA was finally disolved in 75 ?l nuclease free water and then desulfonated by incubation with an equal volume of 1 M Tris HCl pH 9.0 at 75 \u00b0C for 1 h. post ethanol precipitation  the RNA was resuspended in 11 \u00b5l of RNase free water and subjected to library construction. Reverse transcription was carried out with superscript II Reverse Transcriptase Invitrogen and ACT random hexamers. The following procedures were performed with the KAPA Stranded mRNA Seq Kit KAPA according to the manufacturer?s instructions.Libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 125 bp.", "parent bioproject:PRJNA534030", null, null, "RIP 0hpf rep2", "GSM3732419", null, "source name:RIP 0hpf|strain:AB strain|age:0 hpf|tissue:whole embryo|rip antibody:rabbit polyclonal anti Ybx1 antibody", "RIP 0hpf rep2", "Reads were aligned to the zv9 genome assembly using TopHat v2.1.1. MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools\u2019 intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates.", "RIP 0hpf", null, "Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol\u00ae Reagent Ambion. mRNA was extracted with using Dynabeads\u00ae mRNA Purification Kit Ambion and subjected to TURBO\u2122 DNase Invitrogen treatment at 37\u00b0C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp.", null, "strain:AB strain|age:0 hpf|tissue:whole embryo|rip antibody:rabbit polyclonal anti Ybx1 antibody", "GSM3732419", "GSM3732419: RIP 0hpf rep2; Danio rerio; RIP Seq", "GSM3732419", null, "1", "Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol\u00ae Reagent Ambion. mRNA was extracted with using Dynabeads\u00ae mRNA Purification Kit Ambion and subjected to TURBO\u2122 DNase Invitrogen treatment at 37\u00b0C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp.", "GEO Accession:GSM3732419", "RIP-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP162876", null, null, "RIP_0hpf_rep2_R1.fastq.gz RIP_0hpf_rep2_R2.fastq.gz", "fastq fastq", 14319153300.0, 47730511.0, "GSM3732419 r1", "0:150 1:150", "A:3633266473;C:3581763715;G:3602109377;T:3500497801;N:1515934", 150, 150, null, null, 3633266473, 3581763715, 3602109377, 3500497801, 1515934, "SRX5717512", "SRS4655932", "SRA786939", "GEO", "Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)", 2, 0.96309, 0.96299, 0.09978, 0.09922, 0.80012, 0.80635, 0.7641, 0.76535, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "random_priming", "smarter", "bulk", "clip", "iclip", null, "China", "2019-04-22", "Zygote", "Embryo", "Whole Organism", "All anatomical structures"], [49546, "SRR8936998", "SRX5717511", "SRS4655931", "SRP162876", "PRJNA493828", "Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample.", "GSE120646", "Other", "The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However  how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein  through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos  we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD  which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a  Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT  highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites  and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u00ce\u00bcl RNasin by rotating at 4\u00c2\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00c2\u00b0C for 1 h. 50 \u00ce\u00bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u00ce\u00bcl Protein A Dynabeads for 4 h at 4\u00c2\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00c2\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00c3\u2014 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00c2\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO\u00e2\u201e\u00a2 DNase Invitrogen  AM2238. iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp. RNA RIP BisSeq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u00ce\u00bcl RNasin by rotating at 4\u00c2\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00c2\u00b0C for 1 h. 50 \u00ce\u00bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u00ce\u00bcl Protein A Dynabeads for 4 h at 4\u00c2\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00c2\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00c3\u2014 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00c2\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The purified mRNA was used for RNA BisSeq library construction. Around 200 ng mRNA premixed with the in vitro transcribed Dhfr mRNA at a ratio of 300:1 Dhfr mRNA serves as methylation conversion control was fragmented to 100 nt fragments for 1 min at 90\u00b0C in 10\u00d7 RNA Fragmentation Reagent Ambion  then stopped by 10\u00d7 RNA stop solution Ambion  and precipitated with 100% ethanol. The RNA pellet was resuspended in 100 \u00b5l bisulfite solution pH 5.1  which is a 100:1 mixture of 40% sodium bisulfite Sigma and 600 \u00b5M hydroquinone Sigma and subjected to heat incubation at 75\u00b0C for 4.5 h. The reaction mixture was desalted by passing through Nanosep with 3K Omega 500/pk columns PALL Corporation with centrifugation. post washed with nuclease free water and centrifuged for five times  the RNA was finally disolved in 75 ?l nuclease free water and then desulfonated by incubation with an equal volume of 1 M Tris HCl pH 9.0 at 75 \u00b0C for 1 h. post ethanol precipitation  the RNA was resuspended in 11 \u00b5l of RNase free water and subjected to library construction. Reverse transcription was carried out with superscript II Reverse Transcriptase Invitrogen and ACT random hexamers. The following procedures were performed with the KAPA Stranded mRNA Seq Kit KAPA according to the manufacturer?s instructions.Libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 125 bp.", "parent bioproject:PRJNA534030", null, null, "RIP 0hpf rep1", "GSM3732418", null, "source name:RIP 0hpf|strain:AB strain|age:0 hpf|tissue:whole embryo|rip antibody:rabbit polyclonal anti Ybx1 antibody", "RIP 0hpf rep1", "Reads were aligned to the zv9 genome assembly using TopHat v2.1.1. MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools\u2019 intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates.", "RIP 0hpf", null, "Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol\u00ae Reagent Ambion. mRNA was extracted with using Dynabeads\u00ae mRNA Purification Kit Ambion and subjected to TURBO\u2122 DNase Invitrogen treatment at 37\u00b0C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp.", null, "strain:AB strain|age:0 hpf|tissue:whole embryo|rip antibody:rabbit polyclonal anti Ybx1 antibody", "GSM3732418", "GSM3732418: RIP 0hpf rep1; Danio rerio; RIP Seq", "GSM3732418", null, "1", "Total RNA was isolated from zebrafish embryos harvested at different stages using TRIzol\u00ae Reagent Ambion. mRNA was extracted with using Dynabeads\u00ae mRNA Purification Kit Ambion and subjected to TURBO\u2122 DNase Invitrogen treatment at 37\u00b0C for 30 min and ethanol precipitation. Thus purified mRNA was used for RNA BisSeq library construction. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp.", "GEO Accession:GSM3732418", "RIP-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP162876", null, null, "RIP_0hpf_rep1_R1.fastq.gz RIP_0hpf_rep1_R2.fastq.gz", "fastq fastq", 7807878000.0, 26026260.0, "GSM3732418 r1", "0:150 1:150", "A:1698013251;C:2200605244;G:2305251364;T:1602824248;N:1183893", 150, 150, null, null, 1698013251, 2200605244, 2305251364, 1602824248, 1183893, "SRX5717511", "SRS4655931", "SRA786939", "GEO", "Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)", 2, 0.89154, 0.89105, 0.26373, 0.26886, 0.82477, 0.827, 0.79125, 0.77711, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "random_priming", "smarter", "bulk", "clip", "iclip", null, "China", "2019-04-22", "Zygote", "Embryo", "Whole Organism", "All anatomical structures"], [49547, "SRR7942638", "SRX4776903", "SRS3857464", "SRP162876", "PRJNA493828", "Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample.", "GSE120646", "Other", "The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However  how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein  through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos  we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD  which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a  Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT  highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites  and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u00ce\u00bcl RNasin by rotating at 4\u00c2\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00c2\u00b0C for 1 h. 50 \u00ce\u00bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u00ce\u00bcl Protein A Dynabeads for 4 h at 4\u00c2\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00c2\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00c3\u2014 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00c2\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO\u00e2\u201e\u00a2 DNase Invitrogen  AM2238. iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp. RNA RIP BisSeq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u00ce\u00bcl RNasin by rotating at 4\u00c2\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00c2\u00b0C for 1 h. 50 \u00ce\u00bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u00ce\u00bcl Protein A Dynabeads for 4 h at 4\u00c2\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00c2\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00c3\u2014 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00c2\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The purified mRNA was used for RNA BisSeq library construction. Around 200 ng mRNA premixed with the in vitro transcribed Dhfr mRNA at a ratio of 300:1 Dhfr mRNA serves as methylation conversion control was fragmented to 100 nt fragments for 1 min at 90\u00b0C in 10\u00d7 RNA Fragmentation Reagent Ambion  then stopped by 10\u00d7 RNA stop solution Ambion  and precipitated with 100% ethanol. The RNA pellet was resuspended in 100 \u00b5l bisulfite solution pH 5.1  which is a 100:1 mixture of 40% sodium bisulfite Sigma and 600 \u00b5M hydroquinone Sigma and subjected to heat incubation at 75\u00b0C for 4.5 h. The reaction mixture was desalted by passing through Nanosep with 3K Omega 500/pk columns PALL Corporation with centrifugation. post washed with nuclease free water and centrifuged for five times  the RNA was finally disolved in 75 ?l nuclease free water and then desulfonated by incubation with an equal volume of 1 M Tris HCl pH 9.0 at 75 \u00b0C for 1 h. post ethanol precipitation  the RNA was resuspended in 11 \u00b5l of RNase free water and subjected to library construction. Reverse transcription was carried out with superscript II Reverse Transcriptase Invitrogen and ACT random hexamers. The following procedures were performed with the KAPA Stranded mRNA Seq Kit KAPA according to the manufacturer?s instructions.Libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 125 bp.", "parent bioproject:PRJNA534030", null, null, "iCLIP 4hpf rep2", "GSM3406904", null, "source name:Zebrafish embryo|strain:AB strain|cell type:Zebrafish embryo|age:4 hpf|tissue:whole embryo", "iCLIP 4hpf rep2", "RIP seq and iCLIP seq reads were aligned to the zv9 genome assembly using TopHat v2.1.1 and BWA v0.7.10  respectively. RIP seq: MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools\u2019 intersectBed. iCLIP: To identify the Ybx1 targets\u2019 locus  the mode of truncation calling was performed. For each truncation position  the coverages of unique tag k and truncations m were determined by CIMS.pl program CLIP Tool Kit  CTK. The sites were annotated by applying BEDTools\u2019 intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates.", "Zebrafish embryo", null, "RIP seq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u03bcl RNasin by rotating at 4\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00b0C for 1 h. 50 \u03bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u03bcl Protein A Dynabeads for 4 h at 4\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00d7 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO\u2122 DNase Invitrogen  AM2238.  iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp.", null, "strain:AB strain|cell type:Zebrafish embryo|age:4 hpf|tissue:whole embryo", "GSM3406904", "GSM3406904: iCLIP 4hpf rep2; Danio rerio; OTHER", "GSM3406904", null, "1", "RIP seq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u03bcl RNasin by rotating at 4\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00b0C for 1 h. 50 \u03bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u03bcl Protein A Dynabeads for 4 h at 4\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00d7 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO\u2122 DNase Invitrogen  AM2238.  iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp.", "GEO Accession:GSM3406904", "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP162876", null, null, "iCLIP_4hpf_rep2_R1.fastq.gz iCLIP_4hpf_rep2_R2.fastq.gz", "fastq fastq", 17432004900.0, 58106683.0, "GSM3406904 r1", "0:150 1:150", "A:5027776225;C:3413769313;G:3531157280;T:5459126811;N:175271", 150, 150, null, null, 5027776225, 3413769313, 3531157280, 5459126811, 175271, "SRX4776903", "SRS3857464", "SRA786939", "GEO", "Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)", 2, 0.62059, 0.61563, 0.02838, 0.02072, 0.95298, 0.9628, 0.94729, 0.94715, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "random_priming", "smarter", "bulk", "clip", "iclip", null, "China", "2018-09-28", "Blastula", "Embryo", "Whole Organism", "All anatomical structures"], [49548, "SRR7942637", "SRX4776902", "SRS3857447", "SRP162876", "PRJNA493828", "Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample.", "GSE120646", "Other", "The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However  how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein  through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos  we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD  which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a  Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT  highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites  and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u00ce\u00bcl RNasin by rotating at 4\u00c2\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00c2\u00b0C for 1 h. 50 \u00ce\u00bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u00ce\u00bcl Protein A Dynabeads for 4 h at 4\u00c2\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00c2\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00c3\u2014 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00c2\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO\u00e2\u201e\u00a2 DNase Invitrogen  AM2238. iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp. RNA RIP BisSeq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u00ce\u00bcl RNasin by rotating at 4\u00c2\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00c2\u00b0C for 1 h. 50 \u00ce\u00bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u00ce\u00bcl Protein A Dynabeads for 4 h at 4\u00c2\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00c2\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00c3\u2014 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00c2\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The purified mRNA was used for RNA BisSeq library construction. Around 200 ng mRNA premixed with the in vitro transcribed Dhfr mRNA at a ratio of 300:1 Dhfr mRNA serves as methylation conversion control was fragmented to 100 nt fragments for 1 min at 90\u00b0C in 10\u00d7 RNA Fragmentation Reagent Ambion  then stopped by 10\u00d7 RNA stop solution Ambion  and precipitated with 100% ethanol. The RNA pellet was resuspended in 100 \u00b5l bisulfite solution pH 5.1  which is a 100:1 mixture of 40% sodium bisulfite Sigma and 600 \u00b5M hydroquinone Sigma and subjected to heat incubation at 75\u00b0C for 4.5 h. The reaction mixture was desalted by passing through Nanosep with 3K Omega 500/pk columns PALL Corporation with centrifugation. post washed with nuclease free water and centrifuged for five times  the RNA was finally disolved in 75 ?l nuclease free water and then desulfonated by incubation with an equal volume of 1 M Tris HCl pH 9.0 at 75 \u00b0C for 1 h. post ethanol precipitation  the RNA was resuspended in 11 \u00b5l of RNase free water and subjected to library construction. Reverse transcription was carried out with superscript II Reverse Transcriptase Invitrogen and ACT random hexamers. The following procedures were performed with the KAPA Stranded mRNA Seq Kit KAPA according to the manufacturer?s instructions.Libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 125 bp.", "parent bioproject:PRJNA534030", null, null, "iCLIP 4hpf rep1", "GSM3406903", null, "source name:Zebrafish embryo|strain:AB strain|cell type:Zebrafish embryo|age:4 hpf|tissue:whole embryo", "iCLIP 4hpf rep1", "RIP seq and iCLIP seq reads were aligned to the zv9 genome assembly using TopHat v2.1.1 and BWA v0.7.10  respectively. RIP seq: MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools\u2019 intersectBed. iCLIP: To identify the Ybx1 targets\u2019 locus  the mode of truncation calling was performed. For each truncation position  the coverages of unique tag k and truncations m were determined by CIMS.pl program CLIP Tool Kit  CTK. The sites were annotated by applying BEDTools\u2019 intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates.", "Zebrafish embryo", null, "RIP seq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u03bcl RNasin by rotating at 4\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00b0C for 1 h. 50 \u03bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u03bcl Protein A Dynabeads for 4 h at 4\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00d7 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO\u2122 DNase Invitrogen  AM2238.  iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp.", null, "strain:AB strain|cell type:Zebrafish embryo|age:4 hpf|tissue:whole embryo", "GSM3406903", "GSM3406903: iCLIP 4hpf rep1; Danio rerio; OTHER", "GSM3406903", null, "1", "RIP seq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u03bcl RNasin by rotating at 4\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00b0C for 1 h. 50 \u03bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u03bcl Protein A Dynabeads for 4 h at 4\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00d7 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO\u2122 DNase Invitrogen  AM2238.  iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp.", "GEO Accession:GSM3406903", "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP162876", null, null, "iCLIP_4hpf_rep1_R1.fastq.gz iCLIP_4hpf_rep1_R2.fastq.gz", "fastq fastq", 18547407600.0, 61824692.0, "GSM3406903 r1", "0:150 1:150", "A:5264017245;C:3699523947;G:3688768985;T:5894912242;N:185181", 150, 150, null, null, 5264017245, 3699523947, 3688768985, 5894912242, 185181, "SRX4776902", "SRS3857447", "SRA786939", "GEO", "Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)", 2, 0.68368, 0.67882, 0.0342, 0.02328, 0.95375, 0.96623, 0.962, 0.9572, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "random_priming", "smarter", "bulk", "clip", "iclip", null, "China", "2018-09-28", "Blastula", "Embryo", "Whole Organism", "All anatomical structures"], [49549, "SRR7942636", "SRX4776901", "SRS3857441", "SRP162876", "PRJNA493828", "Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample.", "GSE120646", "Other", "The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However  how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein  through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos  we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD  which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a  Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT  highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites  and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u00ce\u00bcl RNasin by rotating at 4\u00c2\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00c2\u00b0C for 1 h. 50 \u00ce\u00bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u00ce\u00bcl Protein A Dynabeads for 4 h at 4\u00c2\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00c2\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00c3\u2014 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00c2\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO\u00e2\u201e\u00a2 DNase Invitrogen  AM2238. iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp. RNA RIP BisSeq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u00ce\u00bcl RNasin by rotating at 4\u00c2\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00c2\u00b0C for 1 h. 50 \u00ce\u00bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u00ce\u00bcl Protein A Dynabeads for 4 h at 4\u00c2\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00c2\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00c3\u2014 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00c2\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The purified mRNA was used for RNA BisSeq library construction. Around 200 ng mRNA premixed with the in vitro transcribed Dhfr mRNA at a ratio of 300:1 Dhfr mRNA serves as methylation conversion control was fragmented to 100 nt fragments for 1 min at 90\u00b0C in 10\u00d7 RNA Fragmentation Reagent Ambion  then stopped by 10\u00d7 RNA stop solution Ambion  and precipitated with 100% ethanol. The RNA pellet was resuspended in 100 \u00b5l bisulfite solution pH 5.1  which is a 100:1 mixture of 40% sodium bisulfite Sigma and 600 \u00b5M hydroquinone Sigma and subjected to heat incubation at 75\u00b0C for 4.5 h. The reaction mixture was desalted by passing through Nanosep with 3K Omega 500/pk columns PALL Corporation with centrifugation. post washed with nuclease free water and centrifuged for five times  the RNA was finally disolved in 75 ?l nuclease free water and then desulfonated by incubation with an equal volume of 1 M Tris HCl pH 9.0 at 75 \u00b0C for 1 h. post ethanol precipitation  the RNA was resuspended in 11 \u00b5l of RNase free water and subjected to library construction. Reverse transcription was carried out with superscript II Reverse Transcriptase Invitrogen and ACT random hexamers. The following procedures were performed with the KAPA Stranded mRNA Seq Kit KAPA according to the manufacturer?s instructions.Libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 125 bp.", "parent bioproject:PRJNA534030", null, null, "RIP 4hpf rep2", "GSM3406902", null, "source name:Zebrafish embryo|strain:AB strain|cell type:Zebrafish embryo|age:4 hpf|tissue:whole embryo", "RIP 4hpf rep2", "RIP seq and iCLIP seq reads were aligned to the zv9 genome assembly using TopHat v2.1.1 and BWA v0.7.10  respectively. RIP seq: MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools\u2019 intersectBed. iCLIP: To identify the Ybx1 targets\u2019 locus  the mode of truncation calling was performed. For each truncation position  the coverages of unique tag k and truncations m were determined by CIMS.pl program CLIP Tool Kit  CTK. The sites were annotated by applying BEDTools\u2019 intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates.", "Zebrafish embryo", null, "RIP seq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u03bcl RNasin by rotating at 4\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00b0C for 1 h. 50 \u03bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u03bcl Protein A Dynabeads for 4 h at 4\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00d7 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO\u2122 DNase Invitrogen  AM2238.  iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp.", null, "strain:AB strain|cell type:Zebrafish embryo|age:4 hpf|tissue:whole embryo", "GSM3406902", "GSM3406902: RIP 4hpf rep2; Danio rerio; RIP Seq", "GSM3406902", null, "1", "RIP seq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u03bcl RNasin by rotating at 4\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00b0C for 1 h. 50 \u03bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u03bcl Protein A Dynabeads for 4 h at 4\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00d7 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO\u2122 DNase Invitrogen  AM2238.  iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp.", "GEO Accession:GSM3406902", "RIP-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP162876", null, null, "RIP_4hpf_rep2_R1.fastq.gz RIP_4hpf_rep2_R2.fastq.gz", "fastq fastq", 22888305600.0, 76294352.0, "GSM3406902 r1", "0:150 1:150", "A:5927520807;C:4846894836;G:4996844576;T:7111789925;N:5255456", 150, 150, null, null, 5927520807, 4846894836, 4996844576, 7111789925, 5255456, "SRX4776901", "SRS3857441", "SRA786939", "GEO", "Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)", 2, 0.2704, 0.17205, 0.06114, 0.06961, 0.95879, 0.9698, 0.94515, 0.83252, 150, 150, "B", "B", "mate2-mate1 similar by mapping diff", "illumina", "hiseq_era", "full_length", "random_priming", "smarter", "bulk", "clip", "iclip", null, "China", "2018-09-28", "Blastula", "Embryo", "Whole Organism", "All anatomical structures"], [49550, "SRR7942635", "SRX4776900", "SRS3857440", "SRP162876", "PRJNA493828", "Ybx1 binding sites and Ybx1 binding m5C sites in zebrafish embryo sample.", "GSE120646", "Other", "The maternal to zygotic transition MZT is a conserved and fundamental process during which the embryo undergoes dramatic reprogramming to convert maternal environment to embryonic driven programing. However  how the maternally supplied transcripts are dynamically regulated during MZT remains largely unknown. Herein  through genome wide profiling of RNA 5 methylcytosine m5C in zebrafish early embryos  we show that m5C methylated maternal mRNAs display higher stability during MZT. We identify that the Y box binding protein 1 Ybx1 prefers to recognizing m5C modified mRNAs through p p interaction with a key residue Trp45 in its cold shock domain CSD  which plays essential roles in maternal mRNA stability and early embryogenesis of zebrafish. Cooperated with an mRNA stabilizer Pabpc1a  Ybx1 promotes the stability of its target mRNAs in an m5C dependent manner. Our study demonstrates a novel mechanism of RNA m5C methylation regulated maternal mRNA stability during zebrafish MZT  highlighting the critical role of m5C mRNA methylation in early development. Overall design: Examination of Ybx1 binding sites  and Ybx1 binding m5C sites in zebrafish embryo. RIP seq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u00ce\u00bcl RNasin by rotating at 4\u00c2\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00c2\u00b0C for 1 h. 50 \u00ce\u00bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u00ce\u00bcl Protein A Dynabeads for 4 h at 4\u00c2\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00c2\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00c3\u2014 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00c2\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO\u00e2\u201e\u00a2 DNase Invitrogen  AM2238. iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp. RNA RIP BisSeq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u00ce\u00bcl RNasin by rotating at 4\u00c2\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00c2\u00b0C for 1 h. 50 \u00ce\u00bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u00ce\u00bcl Protein A Dynabeads for 4 h at 4\u00c2\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00c2\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00c3\u2014 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00c2\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The purified mRNA was used for RNA BisSeq library construction. Around 200 ng mRNA premixed with the in vitro transcribed Dhfr mRNA at a ratio of 300:1 Dhfr mRNA serves as methylation conversion control was fragmented to 100 nt fragments for 1 min at 90\u00b0C in 10\u00d7 RNA Fragmentation Reagent Ambion  then stopped by 10\u00d7 RNA stop solution Ambion  and precipitated with 100% ethanol. The RNA pellet was resuspended in 100 \u00b5l bisulfite solution pH 5.1  which is a 100:1 mixture of 40% sodium bisulfite Sigma and 600 \u00b5M hydroquinone Sigma and subjected to heat incubation at 75\u00b0C for 4.5 h. The reaction mixture was desalted by passing through Nanosep with 3K Omega 500/pk columns PALL Corporation with centrifugation. post washed with nuclease free water and centrifuged for five times  the RNA was finally disolved in 75 ?l nuclease free water and then desulfonated by incubation with an equal volume of 1 M Tris HCl pH 9.0 at 75 \u00b0C for 1 h. post ethanol precipitation  the RNA was resuspended in 11 \u00b5l of RNase free water and subjected to library construction. Reverse transcription was carried out with superscript II Reverse Transcriptase Invitrogen and ACT random hexamers. The following procedures were performed with the KAPA Stranded mRNA Seq Kit KAPA according to the manufacturer?s instructions.Libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 125 bp.", "parent bioproject:PRJNA534030", null, null, "RIP 4hpf rep1", "GSM3406901", null, "source name:Zebrafish embryo|strain:AB strain|cell type:Zebrafish embryo|age:4 hpf|tissue:whole embryo", "RIP 4hpf rep1", "RIP seq and iCLIP seq reads were aligned to the zv9 genome assembly using TopHat v2.1.1 and BWA v0.7.10  respectively. RIP seq: MACS2 v2.1.1 were used for the peak calling and peaks were annotated by applying BEDTools\u2019 intersectBed. iCLIP: To identify the Ybx1 targets\u2019 locus  the mode of truncation calling was performed. For each truncation position  the coverages of unique tag k and truncations m were determined by CIMS.pl program CLIP Tool Kit  CTK. The sites were annotated by applying BEDTools\u2019 intersectBed. Genome build: zv9 Supplementary files format and content: Ybx1 binding sites in two biological replicates.", "Zebrafish embryo", null, "RIP seq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u03bcl RNasin by rotating at 4\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00b0C for 1 h. 50 \u03bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u03bcl Protein A Dynabeads for 4 h at 4\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00d7 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO\u2122 DNase Invitrogen  AM2238.  iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp.", null, "strain:AB strain|cell type:Zebrafish embryo|age:4 hpf|tissue:whole embryo", "GSM3406901", "GSM3406901: RIP 4hpf rep1; Danio rerio; RIP Seq", "GSM3406901", null, "1", "RIP seq: Briefly  500 zebrafish embryos at shield stage 4 hpf were resuspended with 2 ml lysis buffer 150 mM KCl  10 mM HEPES pH 7.6  2 mM EDTA  0.5% NP 40  0.5 mM DTT  1:100 protease inhibitor cocktail  0.4 U/\u03bcl RNasin by rotating at 4\u00b0C for 30 min and centrifuged at 15 000 g for 15 min. The supernatant was collected and pre cleared with protein A Dynabeads by rotation at 4\u00b0C for 1 h. 50 \u03bcl pre cleared embryo lysate was saved as Input and the left were incubated with affinity purified rabbit polyclonal anti Ybx1 antibody prepared by AbMax  China and 30 \u03bcl Protein A Dynabeads for 4 h at 4\u00b0C or overnight. post washing with1 ml ice cold NT2 buffer 200 mM NaCl  50 mM HEPES pH 7.6  2 mM EDTA  0.05% NP 40  0.5 mM DTT  0.4U/\u00b5l RNasin for eight times and once with 1ml ice cold 1\u00d7 PK buffer 100 mM Tris HCl pH 7.4  50 mM NaCl  10 mM EDTA   0.2% SDS  the beads was treated in 200 ul PK buffer containing 20 ul proteinase K Roche  0311582001 for 1 h at 55\u00b0C. The solution was collected and subjected to RNA extraction with Acid Phenol: ChCl3 pH4.34.7 and ethanol precipitation. The Input RNA was extracted by using TRIzol reagent. Both the Input and IP RNA were treated by TURBO\u2122 DNase Invitrogen  AM2238.  iCLIP seq: 1000 zebrafish embryos at 4 hpf were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed and subjected to mild fragmentation. Crosslinked RNA protein complexes were immunoprecipated using polyclonal Ybx1 antibody Abmax and protein A dynabeads. RNA was extracted and subjected to library construction using Smarter smRNA Seq kit Takara. All the libraries were sequenced using HiSeq2500 Illumina in paired read mode  creating reads with a length of 150 bp.", "GEO Accession:GSM3406901", "RIP-Seq", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP162876", null, null, "RIP_4hpf_rep1_R1.fastq.gz RIP_4hpf_rep1_R2.fastq.gz", "fastq fastq", 19929300600.0, 66431002.0, "GSM3406901 r1", "0:150 1:150", "A:5076575451;C:4235012507;G:4442151234;T:6170975339;N:4586069", 150, 150, null, null, 5076575451, 4235012507, 4442151234, 6170975339, 4586069, "SRX4776900", "SRS3857440", "SRA786939", "GEO", "Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS)", 2, 0.27932, 0.16557, 0.06585, 0.06178, 0.95692, 0.96844, 0.94238, 0.84334, 150, 150, "B", "B", "mate2-mate1 similar by mapping diff", "illumina", "hiseq_era", "full_length", "random_priming", "smarter", "bulk", "clip", "iclip", null, "China", "2018-09-28", "Blastula", "Embryo", "Whole Organism", "All anatomical structures"], [49573, "SRR10434662", "SRX7130632", "SRS5639976", "SRP163087", "PRJNA494251", "Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis", "GSE120724", "Other", "We resolved the RNA secondary structure during zebrafish early embryogenesis based on  in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages.  Also  we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages  including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2  4  6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.", null, "pubmed:32423473", null, "shield Flag Elavl1a iCLIP rep2", "GSM4157939", null, "tissue:zebrafish embryos|strain:zebrafish embryos|cell type:normal zebrafish embryos cells|age:6hpf", "shield Flag Elavl1a iCLIP rep2", "The proceesing procedure is similar to CTK toolhttps://zhanglab.c2b2.columbia.edu/index.php/ICLIP data analysis using CTK. First  we trimmed three prime adaptor from reads by cutadapt collapsed duplicated reads by fastq2collapse.pl in CTK tool stripped  5\u2019 degenerated barcode mapped clean reads to zebrafish reference genomez10 by bwav0.7.17. data from replicates was merged for peak calling We use CTK tool CITS mode to call the peaks. Reads were clustered using tag2cluster.pl with parameters  big  s  maxgap \" 1\" peaks are identified using tag2peak.pl with parameters  big  ss  v   prefix \"CITS\"  gap 25  p 0.05 Genome build: z10 Supplementary files format and content: iCLIP peaks identified by CTK tool were provided in bed file format. The first three columns represent the 0 based location of the peak in the genome and the last column represents the strand.The fourth column reprents the peak ID and describes the gene locus  peak heightPH  expected PH/backgroundPH0 and pvalueP. The fifth  column represents the peak height.", "zebrafish embryos", null, "iCLIP seq was carried out as previously described Despic et al.  2017. Breifly  flag elavl1a mRNA injected embryos were collected at xxx h.p.f. and 6 h.p.f.. 400 zebrafish embryos were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed  and subjected to mild RNA fragmentation. Crosslinked RNA proteins complexes were immunopurified using Anti FLAG M2 Magnetic Beads Merck  M8823 for 4 h.p.f. and 6 h.p.f. at 4 \u00b0C. RNA was extracted Library construction was performed by using Smarter smRNA Seq kit Clontech Laboratories Inc", "Zebrafish wild type strain AB was raised in system water at 28.5\u00b0C under standard conditions.", "strain:zebrafish embryos|cell type:normal zebrafish embryos cells|age:6hpf", "GSM4157939", "GSM4157939: shield Flag Elavl1a iCLIP rep2; Danio rerio; OTHER", "GSM4157939", null, "1", "iCLIP seq was carried out as previously described Despic et al.  2017. Breifly  flag elavl1a mRNA injected embryos were collected at xxx h.p.f. and 6 h.p.f.. 400 zebrafish embryos were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed  and subjected to mild RNA fragmentation. Crosslinked RNA proteins complexes were immunopurified using Anti FLAG M2 Magnetic Beads Merck  M8823 for 4 h.p.f. and 6 h.p.f. at 4 \u00b0C. RNA was extracted Library construction was performed by using Smarter smRNA Seq kit Clontech Laboratories Inc", "GEO Accession:GSM4157939", "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP163087", null, null, "Shield_Elavl1a_iCLIP_rep2.R2.fq.gz Shield_Elavl1a_iCLIP_rep2.R1.fq.gz", "fastq fastq", 23879342400.0, 79597808.0, "GSM4157939 r1", "0:150 1:150", "A:6335254303;C:5166953187;G:6017120995;T:6358132998;N:1880917", 150, 150, null, null, 6335254303, 5166953187, 6017120995, 6358132998, 1880917, "SRX7130632", "SRS5639976", "SRA787572", "GEO", "Life Science, Tsinghua University", 2, 0.14294, 0.15151, 0.03583, 0.08959, 0.99397, 0.98269, 0.96727, 0.75507, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "full_length", "poly_a", "smarter", "bulk", "clip", "iclip", null, "China", "2019-11-12", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [49574, "SRR10434661", "SRX7130631", "SRS5639975", "SRP163087", "PRJNA494251", "Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis", "GSE120724", "Other", "We resolved the RNA secondary structure during zebrafish early embryogenesis based on  in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages.  Also  we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages  including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2  4  6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.", null, "pubmed:32423473", null, "shield Flag Elavl1a iCLIP rep1", "GSM4157938", null, "tissue:zebrafish embryos|strain:zebrafish embryos|cell type:normal zebrafish embryos cells|age:6hpf", "shield Flag Elavl1a iCLIP rep1", "The proceesing procedure is similar to CTK toolhttps://zhanglab.c2b2.columbia.edu/index.php/ICLIP data analysis using CTK. First  we trimmed three prime adaptor from reads by cutadapt collapsed duplicated reads by fastq2collapse.pl in CTK tool stripped  5\u2019 degenerated barcode mapped clean reads to zebrafish reference genomez10 by bwav0.7.17. data from replicates was merged for peak calling We use CTK tool CITS mode to call the peaks. Reads were clustered using tag2cluster.pl with parameters  big  s  maxgap \" 1\" peaks are identified using tag2peak.pl with parameters  big  ss  v   prefix \"CITS\"  gap 25  p 0.05 Genome build: z10 Supplementary files format and content: iCLIP peaks identified by CTK tool were provided in bed file format. The first three columns represent the 0 based location of the peak in the genome and the last column represents the strand.The fourth column reprents the peak ID and describes the gene locus  peak heightPH  expected PH/backgroundPH0 and pvalueP. The fifth  column represents the peak height.", "zebrafish embryos", null, "iCLIP seq was carried out as previously described Despic et al.  2017. Breifly  flag elavl1a mRNA injected embryos were collected at xxx h.p.f. and 6 h.p.f.. 400 zebrafish embryos were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed  and subjected to mild RNA fragmentation. Crosslinked RNA proteins complexes were immunopurified using Anti FLAG M2 Magnetic Beads Merck  M8823 for 4 h.p.f. and 6 h.p.f. at 4 \u00b0C. RNA was extracted Library construction was performed by using Smarter smRNA Seq kit Clontech Laboratories Inc", "Zebrafish wild type strain AB was raised in system water at 28.5\u00b0C under standard conditions.", "strain:zebrafish embryos|cell type:normal zebrafish embryos cells|age:6hpf", "GSM4157938", "GSM4157938: shield Flag Elavl1a iCLIP rep1; Danio rerio; OTHER", "GSM4157938", null, "1", "iCLIP seq was carried out as previously described Despic et al.  2017. Breifly  flag elavl1a mRNA injected embryos were collected at xxx h.p.f. and 6 h.p.f.. 400 zebrafish embryos were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed  and subjected to mild RNA fragmentation. Crosslinked RNA proteins complexes were immunopurified using Anti FLAG M2 Magnetic Beads Merck  M8823 for 4 h.p.f. and 6 h.p.f. at 4 \u00b0C. RNA was extracted Library construction was performed by using Smarter smRNA Seq kit Clontech Laboratories Inc", "GEO Accession:GSM4157938", "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP163087", null, null, "Shield_Elavl1a_iCLIP_rep1.R1.fq.gz Shield_Elavl1a_iCLIP_rep1.R2.fq.gz", "fastq fastq", 22375977600.0, 74586592.0, "GSM4157938 r1", "0:150 1:150", "A:6243025236;C:5008499337;G:5418170547;T:5704514909;N:1767571", 150, 150, null, null, 6243025236, 5008499337, 5418170547, 5704514909, 1767571, "SRX7130631", "SRS5639975", "SRA787572", "GEO", "Life Science, Tsinghua University", 2, 0.05144, 0.12625, 0.01219, 0.09577, 0.99734, 0.98113, 0.8629, 0.52429, 150, 150, "B", "B", "mate1-mate2 similar by mapping diff", "illumina", "hiseq_era", "full_length", "poly_a", "smarter", "bulk", "clip", "iclip", null, "China", "2019-11-12", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [49575, "SRR10434660", "SRX7130630", "SRS5639974", "SRP163087", "PRJNA494251", "Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis", "GSE120724", "Other", "We resolved the RNA secondary structure during zebrafish early embryogenesis based on  in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages.  Also  we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages  including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2  4  6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.", null, "pubmed:32423473", null, "sphere Flag Elavl1a iCLIP rep2", "GSM4157937", null, "tissue:zebrafish embryos|strain:zebrafish embryos|cell type:normal zebrafish embryos cells|age:4hpf", "sphere Flag Elavl1a iCLIP rep2", "The proceesing procedure is similar to CTK toolhttps://zhanglab.c2b2.columbia.edu/index.php/ICLIP data analysis using CTK. First  we trimmed three prime adaptor from reads by cutadapt collapsed duplicated reads by fastq2collapse.pl in CTK tool stripped  5\u2019 degenerated barcode mapped clean reads to zebrafish reference genomez10 by bwav0.7.17. data from replicates was merged for peak calling We use CTK tool CITS mode to call the peaks. Reads were clustered using tag2cluster.pl with parameters  big  s  maxgap \" 1\" peaks are identified using tag2peak.pl with parameters  big  ss  v   prefix \"CITS\"  gap 25  p 0.05 Genome build: z10 Supplementary files format and content: iCLIP peaks identified by CTK tool were provided in bed file format. The first three columns represent the 0 based location of the peak in the genome and the last column represents the strand.The fourth column reprents the peak ID and describes the gene locus  peak heightPH  expected PH/backgroundPH0 and pvalueP. The fifth  column represents the peak height.", "zebrafish embryos", null, "iCLIP seq was carried out as previously described Despic et al.  2017. Breifly  flag elavl1a mRNA injected embryos were collected at xxx h.p.f. and 6 h.p.f.. 400 zebrafish embryos were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed  and subjected to mild RNA fragmentation. Crosslinked RNA proteins complexes were immunopurified using Anti FLAG M2 Magnetic Beads Merck  M8823 for 4 h.p.f. and 6 h.p.f. at 4 \u00b0C. RNA was extracted Library construction was performed by using Smarter smRNA Seq kit Clontech Laboratories Inc", "Zebrafish wild type strain AB was raised in system water at 28.5\u00b0C under standard conditions.", "strain:zebrafish embryos|cell type:normal zebrafish embryos cells|age:4hpf", "GSM4157937", "GSM4157937: sphere Flag Elavl1a iCLIP rep2; Danio rerio; OTHER", "GSM4157937", null, "1", "iCLIP seq was carried out as previously described Despic et al.  2017. Breifly  flag elavl1a mRNA injected embryos were collected at xxx h.p.f. and 6 h.p.f.. 400 zebrafish embryos were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed  and subjected to mild RNA fragmentation. Crosslinked RNA proteins complexes were immunopurified using Anti FLAG M2 Magnetic Beads Merck  M8823 for 4 h.p.f. and 6 h.p.f. at 4 \u00b0C. RNA was extracted Library construction was performed by using Smarter smRNA Seq kit Clontech Laboratories Inc", "GEO Accession:GSM4157937", "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP163087", null, null, "Sphere_Elavl1a_iCLIP_rep2.R1.fq.gz Sphere_Elavl1a_iCLIP_rep2.R2.fq.gz", "fastq fastq", 22090855200.0, 73636184.0, "GSM4157937 r1", "0:150 1:150", "A:5631298996;C:5114935575;G:5742247735;T:5600647498;N:1725396", 150, 150, null, null, 5631298996, 5114935575, 5742247735, 5600647498, 1725396, "SRX7130630", "SRS5639974", "SRA787572", "GEO", "Life Science, Tsinghua University", 2, 0.23476, 0.17586, 0.06861, 0.08859, 0.99563, 0.98873, 0.95465, 0.79994, 150, 150, "B", "B", "mate2-mate1 similar by mapping diff", "illumina", "hiseq_era", "full_length", "poly_a", "smarter", "bulk", "clip", "iclip", null, "China", "2019-11-12", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [49576, "SRR10434659", "SRX7130629", "SRS5639973", "SRP163087", "PRJNA494251", "Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis", "GSE120724", "Other", "We resolved the RNA secondary structure during zebrafish early embryogenesis based on  in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages.  Also  we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages  including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2  4  6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.", null, "pubmed:32423473", null, "sphere Flag Elavl1a iCLIP rep1", "GSM4157936", null, "tissue:zebrafish embryos|strain:zebrafish embryos|cell type:normal zebrafish embryos cells|age:4hpf", "sphere Flag Elavl1a iCLIP rep1", "The proceesing procedure is similar to CTK toolhttps://zhanglab.c2b2.columbia.edu/index.php/ICLIP data analysis using CTK. First  we trimmed three prime adaptor from reads by cutadapt collapsed duplicated reads by fastq2collapse.pl in CTK tool stripped  5\u2019 degenerated barcode mapped clean reads to zebrafish reference genomez10 by bwav0.7.17. data from replicates was merged for peak calling We use CTK tool CITS mode to call the peaks. Reads were clustered using tag2cluster.pl with parameters  big  s  maxgap \" 1\" peaks are identified using tag2peak.pl with parameters  big  ss  v   prefix \"CITS\"  gap 25  p 0.05 Genome build: z10 Supplementary files format and content: iCLIP peaks identified by CTK tool were provided in bed file format. The first three columns represent the 0 based location of the peak in the genome and the last column represents the strand.The fourth column reprents the peak ID and describes the gene locus  peak heightPH  expected PH/backgroundPH0 and pvalueP. The fifth  column represents the peak height.", "zebrafish embryos", null, "iCLIP seq was carried out as previously described Despic et al.  2017. Breifly  flag elavl1a mRNA injected embryos were collected at xxx h.p.f. and 6 h.p.f.. 400 zebrafish embryos were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed  and subjected to mild RNA fragmentation. Crosslinked RNA proteins complexes were immunopurified using Anti FLAG M2 Magnetic Beads Merck  M8823 for 4 h.p.f. and 6 h.p.f. at 4 \u00b0C. RNA was extracted Library construction was performed by using Smarter smRNA Seq kit Clontech Laboratories Inc", "Zebrafish wild type strain AB was raised in system water at 28.5\u00b0C under standard conditions.", "strain:zebrafish embryos|cell type:normal zebrafish embryos cells|age:4hpf", "GSM4157936", "GSM4157936: sphere Flag Elavl1a iCLIP rep1; Danio rerio; OTHER", "GSM4157936", null, "1", "iCLIP seq was carried out as previously described Despic et al.  2017. Breifly  flag elavl1a mRNA injected embryos were collected at xxx h.p.f. and 6 h.p.f.. 400 zebrafish embryos were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed  and subjected to mild RNA fragmentation. Crosslinked RNA proteins complexes were immunopurified using Anti FLAG M2 Magnetic Beads Merck  M8823 for 4 h.p.f. and 6 h.p.f. at 4 \u00b0C. RNA was extracted Library construction was performed by using Smarter smRNA Seq kit Clontech Laboratories Inc", "GEO Accession:GSM4157936", "OTHER", "TRANSCRIPTOMIC", "other", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP163087", null, null, "Sphere_Elavl1a_iCLIP_rep1.R2.fq.gz Sphere_Elavl1a_iCLIP_rep1.R1.fq.gz", "fastq fastq", 15794202300.0, 52647341.0, "GSM4157936 r1", "0:150 1:150", "A:4443931911;C:3527112429;G:3707720167;T:4114188890;N:1248903", 150, 150, null, null, 4443931911, 3527112429, 3707720167, 4114188890, 1248903, "SRX7130629", "SRS5639973", "SRA787572", "GEO", "Life Science, Tsinghua University", 2, 0.06877, 0.10388, 0.02139, 0.07135, 0.99776, 0.98413, 0.87145, 0.57456, 150, 150, "B", "B", "mate1-mate2 similar by mapping diff", "illumina", "hiseq_era", "full_length", "poly_a", "smarter", "bulk", "clip", "iclip", null, "China", "2019-11-12", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [49577, "SRR7947926", "SRX4781875", "SRS3862067", "SRP163087", "PRJNA494251", "Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis", "GSE120724", "Other", "We resolved the RNA secondary structure during zebrafish early embryogenesis based on  in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages.  Also  we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages  including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2  4  6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.", null, "pubmed:32423473", null, "elavl1a morphant 6h rna seq rep2", "GSM3409399", null, "source name:elavl1a morphant 6h rna seq rep2|strain:AB|tissue:zebrafish embryos|genotype/variation:elavl1a morphants zebrafish embryos cells|age:6hpf", "elavl1a morphant 6h rna seq rep2", "trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window  then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID  second is transcript length  third is RPKM  then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID  second is  transcript length  third is the unique mapped reads count  fourth is the mulitple mapped reads count  fifth is the RPKM.", "elavl1a morphant 6h rna seq rep2", "For Elavl1a morphants generation  morpholino oligonucleotides of elavl1a were injected into one cell stage embryos  then embryos were harvested at desired stages", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen.To enrich polyA RNA  the total RNA was subjected to polyA selection. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before 3\u2019 adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M 5\u2019 adenylated and 3\u2019 blocked linker 3\u2019 bio for unmodified  3\u2019 ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l 5\u2019 Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer\u2019s protocol.", "Zebrafish wild type strain AB was raised in system water at 28.5\u00b0C under standard conditions.", "strain:AB|tissue:zebrafish embryos|genotype/variation:elavl1a morphants zebrafish embryos cells|age:6hpf", "GSM3409399", "GSM3409399: elavl1a morphant 6h rna seq rep2; Danio rerio; RNA Seq", "GSM3409399", null, "1", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before three prime adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M five prime adenylated and three prime blocked linker three prime bio for unmodified  three prime ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.", "GEO Accession:GSM3409399", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP163087", null, null, "elavl1a_morphant_6h_rna-seq_rep2.R1.fastq.gz elavl1a_morphant_6h_rna-seq_rep2.R2.fastq.gz", "fastq fastq", 19875464400.0, 66251548.0, "GSM3409399 r1", "0:150 1:150", "A:5352630990;C:4584661408;G:4726300804;T:5209787586;N:2083612", 150, 150, null, null, 5352630990, 4584661408, 4726300804, 5209787586, 2083612, "SRX4781875", "SRS3862067", "SRA787572", "GEO", "Life Science, Tsinghua University", 2, 0.94901, 0.95039, 0.09074, 0.08943, 0.75866, 0.76418, 0.55609, 0.56574, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "clip", "iclip", null, "China", "2018-10-01", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [49578, "SRR7947925", "SRX4781874", "SRS3862066", "SRP163087", "PRJNA494251", "Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis", "GSE120724", "Other", "We resolved the RNA secondary structure during zebrafish early embryogenesis based on  in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages.  Also  we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages  including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2  4  6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.", null, "pubmed:32423473", null, "elavl1a morphant 6h rna seq rep1", "GSM3409398", null, "source name:elavl1a morphant 6h rna seq rep1|strain:AB|tissue:zebrafish embryos|genotype/variation:elavl1a morphants zebrafish embryos cells|age:6hpf", "elavl1a morphant 6h rna seq rep1", "trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window  then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID  second is transcript length  third is RPKM  then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID  second is  transcript length  third is the unique mapped reads count  fourth is the mulitple mapped reads count  fifth is the RPKM.", "elavl1a morphant 6h rna seq rep1", "For Elavl1a morphants generation  morpholino oligonucleotides of elavl1a were injected into one cell stage embryos  then embryos were harvested at desired stages", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen.To enrich polyA RNA  the total RNA was subjected to polyA selection. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before 3\u2019 adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M 5\u2019 adenylated and 3\u2019 blocked linker 3\u2019 bio for unmodified  3\u2019 ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l 5\u2019 Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer\u2019s protocol.", "Zebrafish wild type strain AB was raised in system water at 28.5\u00b0C under standard conditions.", "strain:AB|tissue:zebrafish embryos|genotype/variation:elavl1a morphants zebrafish embryos cells|age:6hpf", "GSM3409398", "GSM3409398: elavl1a morphant 6h rna seq rep1; Danio rerio; RNA Seq", "GSM3409398", null, "1", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before three prime adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M five prime adenylated and three prime blocked linker three prime bio for unmodified  three prime ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.", "GEO Accession:GSM3409398", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP163087", null, null, "elavl1a_morphant_6h_rna-seq_rep1.R2.fastq.gz elavl1a_morphant_6h_rna-seq_rep1.R1.fastq.gz", "fastq fastq", 20202214200.0, 67340714.0, "GSM3409398 r1", "0:150 1:150", "A:5439747248;C:4667041902;G:4805911969;T:5287977733;N:1535348", 150, 150, null, null, 5439747248, 4667041902, 4805911969, 5287977733, 1535348, "SRX4781874", "SRS3862066", "SRA787572", "GEO", "Life Science, Tsinghua University", 2, 0.94586, 0.94757, 0.09031, 0.09016, 0.76019, 0.76493, 0.55951, 0.56185, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "clip", "iclip", null, "China", "2018-10-01", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [49579, "SRR7947924", "SRX4781873", "SRS3862065", "SRP163087", "PRJNA494251", "Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis", "GSE120724", "Other", "We resolved the RNA secondary structure during zebrafish early embryogenesis based on  in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages.  Also  we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages  including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2  4  6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.", null, "pubmed:32423473", null, "elavl1a morphant 4h rna seq rep2", "GSM3409397", null, "source name:elavl1a morphant 4h rna seq rep2|strain:AB|tissue:zebrafish embryos|genotype/variation:elavl1a morphants zebrafish embryos cells|age:4hpf", "elavl1a morphant 4h rna seq rep2", "trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window  then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID  second is transcript length  third is RPKM  then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID  second is  transcript length  third is the unique mapped reads count  fourth is the mulitple mapped reads count  fifth is the RPKM.", "elavl1a morphant 4h rna seq rep2", "For Elavl1a morphants generation  morpholino oligonucleotides of elavl1a were injected into one cell stage embryos  then embryos were harvested at desired stages", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen.To enrich polyA RNA  the total RNA was subjected to polyA selection. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before 3\u2019 adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M 5\u2019 adenylated and 3\u2019 blocked linker 3\u2019 bio for unmodified  3\u2019 ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l 5\u2019 Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer\u2019s protocol.", "Zebrafish wild type strain AB was raised in system water at 28.5\u00b0C under standard conditions.", "strain:AB|tissue:zebrafish embryos|genotype/variation:elavl1a morphants zebrafish embryos cells|age:4hpf", "GSM3409397", "GSM3409397: elavl1a morphant 4h rna seq rep2; Danio rerio; RNA Seq", "GSM3409397", null, "1", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before three prime adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M five prime adenylated and three prime blocked linker three prime bio for unmodified  three prime ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.", "GEO Accession:GSM3409397", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP163087", null, null, "elavl1a_morphant_4h_rna-seq_rep2.R2.fastq.gz elavl1a_morphant_4h_rna-seq_rep2.R1.fastq.gz", "fastq fastq", 38764196400.0, 129213988.0, "GSM3409397 r1", "0:150 1:150", "A:10980499317;C:8394995318;G:8739322914;T:10645637187;N:3741664", 150, 150, null, null, 10980499317, 8394995318, 8739322914, 10645637187, 3741664, "SRX4781873", "SRS3862065", "SRA787572", "GEO", "Life Science, Tsinghua University", 2, 0.94567, 0.94509, 0.06713, 0.06614, 0.76191, 0.76508, 0.73283, 0.74007, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "clip", "iclip", null, "China", "2018-10-01", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [49580, "SRR7947923", "SRX4781872", "SRS3862064", "SRP163087", "PRJNA494251", "Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis", "GSE120724", "Other", "We resolved the RNA secondary structure during zebrafish early embryogenesis based on  in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages.  Also  we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages  including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2  4  6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.", null, "pubmed:32423473", null, "elavl1a morphant 4h rna seq rep1", "GSM3409396", null, "source name:elavl1a morphant 4h rna seq rep1|strain:AB|tissue:zebrafish embryos|genotype/variation:elavl1a morphants zebrafish embryos cells|age:4hpf", "elavl1a morphant 4h rna seq rep1", "trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window  then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID  second is transcript length  third is RPKM  then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID  second is  transcript length  third is the unique mapped reads count  fourth is the mulitple mapped reads count  fifth is the RPKM.", "elavl1a morphant 4h rna seq rep1", "For Elavl1a morphants generation  morpholino oligonucleotides of elavl1a were injected into one cell stage embryos  then embryos were harvested at desired stages", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen.To enrich polyA RNA  the total RNA was subjected to polyA selection. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before 3\u2019 adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M 5\u2019 adenylated and 3\u2019 blocked linker 3\u2019 bio for unmodified  3\u2019 ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l 5\u2019 Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer\u2019s protocol.", "Zebrafish wild type strain AB was raised in system water at 28.5\u00b0C under standard conditions.", "strain:AB|tissue:zebrafish embryos|genotype/variation:elavl1a morphants zebrafish embryos cells|age:4hpf", "GSM3409396", "GSM3409396: elavl1a morphant 4h rna seq rep1; Danio rerio; RNA Seq", "GSM3409396", null, "1", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before three prime adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M five prime adenylated and three prime blocked linker three prime bio for unmodified  three prime ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.", "GEO Accession:GSM3409396", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP163087", null, null, "elavl1a_morphant_4h_rna-seq_rep1.R1.fastq.gz elavl1a_morphant_4h_rna-seq_rep1.R2.fastq.gz", "fastq fastq", 34417602600.0, 114725342.0, "GSM3409396 r1", "0:150 1:150", "A:9798364920;C:7402367067;G:7677976380;T:9534399996;N:4494237", 150, 150, null, null, 9798364920, 7402367067, 7677976380, 9534399996, 4494237, "SRX4781872", "SRS3862064", "SRA787572", "GEO", "Life Science, Tsinghua University", 2, 0.94663, 0.94701, 0.06442, 0.06367, 0.76264, 0.7655, 0.73483, 0.74221, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "clip", "iclip", null, "China", "2018-10-01", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [49581, "SRR7947922", "SRX4781871", "SRS3862063", "SRP163087", "PRJNA494251", "Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis", "GSE120724", "Other", "We resolved the RNA secondary structure during zebrafish early embryogenesis based on  in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages.  Also  we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages  including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2  4  6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.", null, "pubmed:32423473", null, "control 6h rna seq rep2", "GSM3409395", null, "source name:control 6h rna seq rep2|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:6hpf", "control 6h rna seq rep2", "trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window  then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID  second is transcript length  third is RPKM  then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID  second is  transcript length  third is the unique mapped reads count  fourth is the mulitple mapped reads count  fifth is the RPKM.", "control 6h rna seq rep2", "For Elavl1a morphants generation  morpholino oligonucleotides of elavl1a were injected into one cell stage embryos  then embryos were harvested at desired stages", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen.To enrich polyA RNA  the total RNA was subjected to polyA selection. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before 3\u2019 adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M 5\u2019 adenylated and 3\u2019 blocked linker 3\u2019 bio for unmodified  3\u2019 ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l 5\u2019 Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer\u2019s protocol.", "Zebrafish wild type strain AB was raised in system water at 28.5\u00b0C under standard conditions.", "strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:6hpf", "GSM3409395", "GSM3409395: control 6h rna seq rep2; Danio rerio; RNA Seq", "GSM3409395", null, "1", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before three prime adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M five prime adenylated and three prime blocked linker three prime bio for unmodified  three prime ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.", "GEO Accession:GSM3409395", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP163087", null, null, "control_6h_rna-seq_rep2.R1.fastq.gz control_6h_rna-seq_rep2.R2.fastq.gz", "fastq fastq", 39198242400.0, 130660808.0, "GSM3409395 r1", "0:150 1:150", "A:11268897172;C:8355243125;G:8663182840;T:10907160510;N:3758753", 150, 150, null, null, 11268897172, 8355243125, 8663182840, 10907160510, 3758753, "SRX4781871", "SRS3862063", "SRA787572", "GEO", "Life Science, Tsinghua University", 2, 0.94553, 0.94591, 0.09312, 0.09248, 0.78098, 0.78397, 0.73432, 0.73781, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "clip", "iclip", null, "China", "2018-10-01", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [49582, "SRR7947921", "SRX4781870", "SRS3862062", "SRP163087", "PRJNA494251", "Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis", "GSE120724", "Other", "We resolved the RNA secondary structure during zebrafish early embryogenesis based on  in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages.  Also  we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages  including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2  4  6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.", null, "pubmed:32423473", null, "control 6h rna seq rep1", "GSM3409394", null, "source name:control 6h rna seq rep1|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:6hpf", "control 6h rna seq rep1", "trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window  then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID  second is transcript length  third is RPKM  then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID  second is  transcript length  third is the unique mapped reads count  fourth is the mulitple mapped reads count  fifth is the RPKM.", "control 6h rna seq rep1", "For Elavl1a morphants generation  morpholino oligonucleotides of elavl1a were injected into one cell stage embryos  then embryos were harvested at desired stages", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen.To enrich polyA RNA  the total RNA was subjected to polyA selection. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before 3\u2019 adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M 5\u2019 adenylated and 3\u2019 blocked linker 3\u2019 bio for unmodified  3\u2019 ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l 5\u2019 Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer\u2019s protocol.", "Zebrafish wild type strain AB was raised in system water at 28.5\u00b0C under standard conditions.", "strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:6hpf", "GSM3409394", "GSM3409394: control 6h rna seq rep1; Danio rerio; RNA Seq", "GSM3409394", null, "1", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before three prime adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M five prime adenylated and three prime blocked linker three prime bio for unmodified  three prime ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.", "GEO Accession:GSM3409394", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP163087", null, null, "control_6h_rna-seq_rep1.R1.fastq.gz control_6h_rna-seq_rep1.R2.fastq.gz", "fastq fastq", 49781358600.0, 165937862.0, "GSM3409394 r1", "0:150 1:150", "A:14340306167;C:10572507738;G:11006666686;T:13855405563;N:6472446", 150, 150, null, null, 14340306167, 10572507738, 11006666686, 13855405563, 6472446, "SRX4781870", "SRS3862062", "SRA787572", "GEO", "Life Science, Tsinghua University", 2, 0.94466, 0.94506, 0.09485, 0.09402, 0.77782, 0.78303, 0.72367, 0.72791, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "clip", "iclip", null, "China", "2018-10-01", "Gastrula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [49583, "SRR7947920", "SRX4781869", "SRS3862061", "SRP163087", "PRJNA494251", "Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis", "GSE120724", "Other", "We resolved the RNA secondary structure during zebrafish early embryogenesis based on  in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages.  Also  we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages  including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2  4  6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.", null, "pubmed:32423473", null, "control 4h rna seq rep2", "GSM3409393", null, "source name:control 4h rna seq rep2|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:4hpf", "control 4h rna seq rep2", "trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window  then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID  second is transcript length  third is RPKM  then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID  second is  transcript length  third is the unique mapped reads count  fourth is the mulitple mapped reads count  fifth is the RPKM.", "control 4h rna seq rep2", "For Elavl1a morphants generation  morpholino oligonucleotides of elavl1a were injected into one cell stage embryos  then embryos were harvested at desired stages", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen.To enrich polyA RNA  the total RNA was subjected to polyA selection. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before 3\u2019 adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M 5\u2019 adenylated and 3\u2019 blocked linker 3\u2019 bio for unmodified  3\u2019 ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l 5\u2019 Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer\u2019s protocol.", "Zebrafish wild type strain AB was raised in system water at 28.5\u00b0C under standard conditions.", "strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:4hpf", "GSM3409393", "GSM3409393: control 4h rna seq rep2; Danio rerio; RNA Seq", "GSM3409393", null, "1", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before three prime adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M five prime adenylated and three prime blocked linker three prime bio for unmodified  three prime ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.", "GEO Accession:GSM3409393", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP163087", null, null, "control_4h_rna-seq_rep2.R1.fastq.gz control_4h_rna-seq_rep2.R2.fastq.gz", "fastq fastq", 33462197400.0, 111540658.0, "GSM3409393 r1", "0:150 1:150", "A:9246596683;C:7497270682;G:7798285753;T:8916810951;N:3233331", 150, 150, null, null, 9246596683, 7497270682, 7798285753, 8916810951, 3233331, "SRX4781869", "SRS3862061", "SRA787572", "GEO", "Life Science, Tsinghua University", 2, 0.94792, 0.94861, 0.0862, 0.08529, 0.76084, 0.76309, 0.73536, 0.73703, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "clip", "iclip", null, "China", "2018-10-01", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [49584, "SRR7947919", "SRX4781868", "SRS3862060", "SRP163087", "PRJNA494251", "Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis", "GSE120724", "Other", "We resolved the RNA secondary structure during zebrafish early embryogenesis based on  in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages.  Also  we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages  including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2  4  6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.", null, "pubmed:32423473", null, "control 4h rna seq rep1", "GSM3409392", null, "source name:control 4h rna seq rep1|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:4hpf", "control 4h rna seq rep1", "trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window  then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID  second is transcript length  third is RPKM  then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID  second is  transcript length  third is the unique mapped reads count  fourth is the mulitple mapped reads count  fifth is the RPKM.", "control 4h rna seq rep1", "For Elavl1a morphants generation  morpholino oligonucleotides of elavl1a were injected into one cell stage embryos  then embryos were harvested at desired stages", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen.To enrich polyA RNA  the total RNA was subjected to polyA selection. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before 3\u2019 adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M 5\u2019 adenylated and 3\u2019 blocked linker 3\u2019 bio for unmodified  3\u2019 ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l 5\u2019 Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer\u2019s protocol.", "Zebrafish wild type strain AB was raised in system water at 28.5\u00b0C under standard conditions.", "strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:4hpf", "GSM3409392", "GSM3409392: control 4h rna seq rep1; Danio rerio; RNA Seq", "GSM3409392", null, "1", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before three prime adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M five prime adenylated and three prime blocked linker three prime bio for unmodified  three prime ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.", "GEO Accession:GSM3409392", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP163087", null, null, "control_4h_rna-seq_rep1.R1.fastq.gz control_4h_rna-seq_rep1.R2.fastq.gz", "fastq fastq", 38719753500.0, 129065845.0, "GSM3409392 r1", "0:150 1:150", "A:10763970685;C:8606443742;G:8961006857;T:10383272808;N:5059408", 150, 150, null, null, 10763970685, 8606443742, 8961006857, 10383272808, 5059408, "SRX4781868", "SRS3862060", "SRA787572", "GEO", "Life Science, Tsinghua University", 2, 0.94748, 0.948, 0.08608, 0.08505, 0.76023, 0.76357, 0.72873, 0.73242, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "clip", "iclip", null, "China", "2018-10-01", "Blastula", "Embryo", "Embryo Imprecise", "All anatomical structures"], [49585, "SRR7947918", "SRX4781867", "SRS3862059", "SRP163087", "PRJNA494251", "Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis", "GSE120724", "Other", "We resolved the RNA secondary structure during zebrafish early embryogenesis based on  in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages.  Also  we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages  including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2  4  6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.", null, "pubmed:32423473", null, "control 2h rna seq rep2", "GSM3409391", null, "source name:control 2h rna seq rep2|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:2hpf", "control 2h rna seq rep2", "trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window  then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID  second is transcript length  third is RPKM  then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID  second is  transcript length  third is the unique mapped reads count  fourth is the mulitple mapped reads count  fifth is the RPKM.", "control 2h rna seq rep2", "For Elavl1a morphants generation  morpholino oligonucleotides of elavl1a were injected into one cell stage embryos  then embryos were harvested at desired stages", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen.To enrich polyA RNA  the total RNA was subjected to polyA selection. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before 3\u2019 adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M 5\u2019 adenylated and 3\u2019 blocked linker 3\u2019 bio for unmodified  3\u2019 ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l 5\u2019 Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer\u2019s protocol.", "Zebrafish wild type strain AB was raised in system water at 28.5\u00b0C under standard conditions.", "strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:2hpf", "GSM3409391", "GSM3409391: control 2h rna seq rep2; Danio rerio; RNA Seq", "GSM3409391", null, "1", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before three prime adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M five prime adenylated and three prime blocked linker three prime bio for unmodified  three prime ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.", "GEO Accession:GSM3409391", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP163087", null, null, "control_2h_rna-seq_rep2.R1.fastq.gz control_2h_rna-seq_rep2.R2.fastq.gz", "fastq fastq", 39017750100.0, 130059167.0, "GSM3409391 r1", "0:150 1:150", "A:10979134932;C:8549683633;G:8854910977;T:10629254366;N:4766192", 150, 150, null, null, 10979134932, 8549683633, 8854910977, 10629254366, 4766192, "SRX4781867", "SRS3862059", "SRA787572", "GEO", "Life Science, Tsinghua University", 2, 0.94685, 0.94869, 0.03416, 0.03311, 0.76536, 0.76731, 0.65079, 0.65387, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "clip", "iclip", null, "China", "2018-10-01", "Cleavage", "Embryo", "Embryo Imprecise", "All anatomical structures"], [49586, "SRR7947917", "SRX4781866", "SRS3862058", "SRP163087", "PRJNA494251", "Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis", "GSE120724", "Other", "We resolved the RNA secondary structure during zebrafish early embryogenesis based on  in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages.  Also  we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages  including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2  4  6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.", null, "pubmed:32423473", null, "control 2h rna seq rep1", "GSM3409390", null, "source name:control 2h rna seq rep1|strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:2hpf", "control 2h rna seq rep1", "trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window  then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID  second is transcript length  third is RPKM  then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID  second is  transcript length  third is the unique mapped reads count  fourth is the mulitple mapped reads count  fifth is the RPKM.", "control 2h rna seq rep1", "For Elavl1a morphants generation  morpholino oligonucleotides of elavl1a were injected into one cell stage embryos  then embryos were harvested at desired stages", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen.To enrich polyA RNA  the total RNA was subjected to polyA selection. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before 3\u2019 adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M 5\u2019 adenylated and 3\u2019 blocked linker 3\u2019 bio for unmodified  3\u2019 ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l 5\u2019 Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer\u2019s protocol.", "Zebrafish wild type strain AB was raised in system water at 28.5\u00b0C under standard conditions.", "strain:AB|tissue:zebrafish embryos|genotype/variation:normal zebrafish embryos cells|age:2hpf", "GSM3409390", "GSM3409390: control 2h rna seq rep1; Danio rerio; RNA Seq", "GSM3409390", null, "1", "The  RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol\u00ae Reagent invitrogen. For icSHAPE  the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction  followed by fragmentation. The fragmented RNA was end repaired by incubation at 37\u00b0C for 1 hours with the following mix 70 mM Tris 7.0  18mM MgCl2  5mM DTT  4 U/\u00b5l RiboLock  0.1 U/\u00b5l FastAP Life Technology  2 U/\u00b5l T4 PNKNEB before three prime adapter ligation with addition of 10 \u00b5l ligation mix 5mM DTT  0.5\u00b5M five prime adenylated and three prime blocked linker three prime bio for unmodified  three prime ddc for modified  0.66 U/\u00b5l T4 RNA ligase NEB  M0437M  15% PEG8000  1X RNA ligase buffer and incubation at 25\u00b0C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1\u00b5l FastAP  0.2\u00b5l SSB Promega  0.8\u00b5l Ribolock and 1\u00b5l five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30\u00b0C for 90 min. And then 1\u00b5l RecJf NEB was added with another incubation at 37\u00b0C for 1 hour. The following procedures  including reverse transcription  biotin streptavadin enrichment  size selection of cDNA  circularization and PCR amplification  were the same as described in the standard protocol. For RNA seq\uff0c Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.", "GEO Accession:GSM3409390", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP163087", null, null, "control_2h_rna-seq_rep1.R1.fastq.gz control_2h_rna-seq_rep1.R2.fastq.gz", "fastq fastq", 33999089400.0, 113330298.0, "GSM3409390 r1", "0:150 1:150", "A:9602786363;C:7418727808;G:7667052932;T:9305137704;N:5384593", 150, 150, null, null, 9602786363, 7418727808, 7667052932, 9305137704, 5384593, "SRX4781866", "SRS3862058", "SRA787572", "GEO", "Life Science, Tsinghua University", 2, 0.94874, 0.95121, 0.03388, 0.03264, 0.76524, 0.76662, 0.65127, 0.65427, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "clip", "iclip", null, "China", "2018-10-01", "Cleavage", "Embryo", "Embryo Imprecise", "All anatomical structures"]], "truncated": false, "filtered_table_rows_count": 46, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"experiment.library_layout\" = :p0 and \"technology\" = :p1 order by rowid limit 101", "params": {"p0": "PAIRED", "p1": "iclip"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=PAIRED&technology=iclip", "results": [{"value": "RNA-Seq", "label": "RNA-Seq", "count": 26, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=PAIRED&technology=iclip&experiment.library_strategy=RNA-Seq", "selected": false}, {"value": "OTHER", "label": "OTHER", "count": 10, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=PAIRED&technology=iclip&experiment.library_strategy=OTHER", "selected": false}, {"value": "RIP-Seq", "label": "RIP-Seq", "count": 10, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=PAIRED&technology=iclip&experiment.library_strategy=RIP-Seq", "selected": false}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=PAIRED&technology=iclip", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 46, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=PAIRED&technology=iclip&experiment.library_source=TRANSCRIPTOMIC", "selected": false}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=PAIRED&technology=iclip", "results": [{"value": "cDNA", "label": "cDNA", "count": 26, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=PAIRED&technology=iclip&experiment.library_selection=cDNA", "selected": false}, {"value": "other", "label": "other", "count": 20, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=PAIRED&technology=iclip&experiment.library_selection=other", "selected": false}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=PAIRED&technology=iclip", "results": [{"value": "PAIRED", "label": "PAIRED", "count": 46, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?technology=iclip", "selected": true}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=PAIRED&technology=iclip", "results": [{"value": "ILLUMINA", "label": "ILLUMINA", "count": 46, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=PAIRED&technology=iclip&experiment.platform=ILLUMINA", "selected": false}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=PAIRED&technology=iclip", "results": [{"value": "Embryo", "label": "Embryo", "count": 30, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=PAIRED&technology=iclip&devstage_curation_coarse=Embryo", "selected": false}, {"value": "Adult", "label": "Adult", "count": 16, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=PAIRED&technology=iclip&devstage_curation_coarse=Adult", "selected": false}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=PAIRED&technology=iclip", "results": [{"value": "Adult", "label": "Adult", "count": 16, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=PAIRED&technology=iclip&devstage_curation=Adult", "selected": false}, {"value": "Blastula", "label": "Blastula", "count": 11, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=PAIRED&technology=iclip&devstage_curation=Blastula", "selected": false}, {"value": "Cleavage", "label": "Cleavage", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=PAIRED&technology=iclip&devstage_curation=Cleavage", "selected": false}, {"value": "Gastrula", "label": "Gastrula", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=PAIRED&technology=iclip&devstage_curation=Gastrula", "selected": false}, {"value": "Zygote", "label": "Zygote", "count": 5, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=PAIRED&technology=iclip&devstage_curation=Zygote", "selected": false}, {"value": "Pharyngula", "label": "Pharyngula", "count": 2, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=PAIRED&technology=iclip&devstage_curation=Pharyngula", "selected": false}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=PAIRED&technology=iclip", "results": [{"value": "All anatomical structures", "label": "All anatomical structures", "count": 28, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=PAIRED&technology=iclip&tissue_curation_coarse=All+anatomical+structures", "selected": false}, {"value": "Nervous System", "label": "Nervous System", "count": 16, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=PAIRED&technology=iclip&tissue_curation_coarse=Nervous+System", "selected": false}, {"value": "Surface Structure", "label": "Surface Structure", "count": 2, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=PAIRED&technology=iclip&tissue_curation_coarse=Surface+Structure", "selected": false}], "truncated": false}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=PAIRED&technology=iclip", "results": [{"value": "Brain", "label": "Brain", "count": 16, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=PAIRED&technology=iclip&tissue_curation=Brain", "selected": false}, {"value": "Embryo Imprecise", "label": "Embryo Imprecise", "count": 14, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=PAIRED&technology=iclip&tissue_curation=Embryo+Imprecise", "selected": false}, {"value": "Whole Organism", "label": "Whole Organism", "count": 14, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=PAIRED&technology=iclip&tissue_curation=Whole+Organism", "selected": false}, {"value": "Trunk", "label": "Trunk", "count": 2, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=PAIRED&technology=iclip&tissue_curation=Trunk", "selected": false}], "truncated": false}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_layout=PAIRED&technology=iclip", "results": [{"value": "iclip", "label": "iclip", "count": 46, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=PAIRED", "selected": true}], "truncated": false}}, "suggested_facets": [], "next": null, "next_url": null, "private": false, "allow_execute_sql": true, "query_ms": 88.52993899927242}