{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where devstage_curation_coarse = \"Undetermined\" and tissue_curation = \"Gonad\"", "rows": [[5793, "ERR1955208", "ERX2020800", "ERS1697077", "ERP017053", "PRJEB15333", "Transposon driven transcription is a conserved feature of vertebrate spermatogenesis and transcript evolution", "ena-STUDY-EMBL EUROPEAN BIOINFORMATICS INSTITUTE-07-09-2016-10:25:55:499-247", "Other", "In order to better understand the features associated with male germline transcription we profiled the RNA expression in a number of germline cell types. These include spermatogonial stem cells  spermatocytes and round spermatids in mouse and spermatocytes in rat. We also profiled the transcription in zebrafish testes. As a consequence it became apparent that transposable elements are driving considerable lncRNA expression in the later stages of spermatogenesis. This is particularly apparent in the case of endogenous retroviruses in rodents.", "ENA FIRST PUBLIC:2017 01 31|ENA LAST UPDATE:2017 05 08", null, null, "Transcriptional profiling of zebrafish testes for analysis of conserved repeat element associations", "SAMEA104033184", "EMBL EUROPEAN BIOINFORMATICS INSTITUTE", "ENA FIRST PUBLIC:2017 05 10T17:01:28Z|ENA LAST UPDATE:2017 04 28T10:34:37Z|External Id:SAMEA104033184|INSDC center name:EMBL EUROPEAN BIOINFORMATICS INSTITUTE|INSDC first public:2017 05 10T17:01:28Z|INSDC last update:2017 04 28T10:34:37Z|INSDC status:public|Submitter Id:Zebrafish.Testis 2|common name:zebrafish|sample name:Zebrafish.Testis 2|scientific name:Danio rerio|strain:AB|tissue type:testis", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "ena EXPERIMENT EMBL EUROPEAN BIOINFORMATICS INSTITUTE 03 05 2017 17:32:41:660 16", "unspecified", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP017053", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2017 05 10|ENA LAST UPDATE:2018 11 16", "zebrafish_testis_2.conserved.1.fastq.gz zebrafish_testis_2.conserved.2.fastq.gz", "fastq fastq", 46555372886.0, 230472143.0, "ena RUN EMBL EUROPEAN BIOINFORMATICS INSTITUTE 03 05 2017 17:32:41:660 16", "0:101 1:101", "A:12260062264;C:10888457642;G:11605642683;T:11637267744;N:163942553", 101, 101, null, null, 12260062264, 10888457642, 11605642683, 11637267744, 163942553, "ERX2020800", "ERS1697077", "ERA904389", "EMBL EUROPEAN BIOINFORMATICS INSTITUTE|European Nucleotide Archive", "EMBL EUROPEAN BIOINFORMATICS INSTITUTE", 2, 0.93165, 0.92785, 0.29822, 0.32141, 0.71386, 0.71971, 0.66173, 0.63843, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2017-01-31", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [5794, "ERR1955207", "ERX2020799", "ERS1697076", "ERP017053", "PRJEB15333", "Transposon driven transcription is a conserved feature of vertebrate spermatogenesis and transcript evolution", "ena-STUDY-EMBL EUROPEAN BIOINFORMATICS INSTITUTE-07-09-2016-10:25:55:499-247", "Other", "In order to better understand the features associated with male germline transcription we profiled the RNA expression in a number of germline cell types. These include spermatogonial stem cells  spermatocytes and round spermatids in mouse and spermatocytes in rat. We also profiled the transcription in zebrafish testes. As a consequence it became apparent that transposable elements are driving considerable lncRNA expression in the later stages of spermatogenesis. This is particularly apparent in the case of endogenous retroviruses in rodents.", "ENA FIRST PUBLIC:2017 01 31|ENA LAST UPDATE:2017 05 08", null, null, "Transcriptional profiling of zebrafish testes for analysis of conserved repeat element associations", "SAMEA104033183", "EMBL EUROPEAN BIOINFORMATICS INSTITUTE", "ENA FIRST PUBLIC:2017 05 10T17:01:28Z|ENA LAST UPDATE:2017 04 28T10:34:37Z|External Id:SAMEA104033183|INSDC center name:EMBL EUROPEAN BIOINFORMATICS INSTITUTE|INSDC first public:2017 05 10T17:01:28Z|INSDC last update:2017 04 28T10:34:37Z|INSDC status:public|Submitter Id:Zebrafish.Testis 1|common name:zebrafish|sample name:Zebrafish.Testis 1|scientific name:Danio rerio|strain:AB|tissue type:testis", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "ena EXPERIMENT EMBL EUROPEAN BIOINFORMATICS INSTITUTE 03 05 2017 17:32:41:660 15", "unspecified", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP017053", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2017 05 10|ENA LAST UPDATE:2018 11 16", "zebrafish_testis_1.conserved.1.fastq.gz zebrafish_testis_1.conserved.2.fastq.gz", "fastq fastq", 41056086708.0, 203247954.0, "ena RUN EMBL EUROPEAN BIOINFORMATICS INSTITUTE 03 05 2017 17:32:41:660 15", "0:101 1:101", "A:10675591750;C:9672762387;G:10139834713;T:10380949257;N:186948601", 101, 101, null, null, 10675591750, 9672762387, 10139834713, 10380949257, 186948601, "ERX2020799", "ERS1697076", "ERA904389", "EMBL EUROPEAN BIOINFORMATICS INSTITUTE|European Nucleotide Archive", "EMBL EUROPEAN BIOINFORMATICS INSTITUTE", 2, 0.92308, 0.9157, 0.30221, 0.31293, 0.68276, 0.68836, 0.56114, 0.5857, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2017-01-31", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [30556, "SRR27836071", "SRX23499420", "SRS20351177", "SRP487485", "PRJNA1072072", "Rbpms2 promotes female fate upstream of the nutrient sensing Gator2 complex component  Mios", "GSE254850", "Transcriptome Analysis", "Reproductive success relies on proper establishment and maintenance of biological sex. In many animals  including mammals  the primary gonad is initially ovary in character. We previously showed the RNA binding protein RNAbp  Rbpms2  is required for ovary fate in zebrafish. Here  we identified Rbpms2 targets in oocytesRbpms2 bound oocyte RNAs; rboRNAs. We identify Rbpms2 as a translational regulator ofrboRNAs  which include testis factors and ribosome biogenesis factors. Further  genetic analyses indicate that Rbpms2 promotes nucleolar amplification via the mTorc1 signaling pathway  specifically through the mTorc1 activating Gap activity towards Rags 2 Gator2 component  Missing oocyte Mios. Cumulatively  our findings indicate that early gonocytes are in a dual poised  bipotential state in which Rbpms2 acts as a binary fate switch. Specifically  Rbpms2 represses testis factors and promotes oocyte factors to promote oocyte progression through an essential Gator2 mediated checkpoint  thereby integrating regulation of sexual differentiation factors and nutritional availability pathways in zebrafish oogenesis. Overall design: To determine the RNA targets of Rbpms2  we generated wildtype female zebrafish expressing Rbpms2 mApple or mApple alone fusion proteins exclusively in the germline. Immunoprecipitation was performed in 2 adult female ovaries per transgene. Crosslinked and uncrosslinked samples for Rbpms2 mApple expressing fish and crosslined and uncrosslinked samples for mApple expressing fish were sequenced. RNAs found in the Rbpms2 mApple crosslinked and the mApple crosslinked and uncrosslinked datasets that were also present in the Rbpms2 mApple uncrosslinked dataset were excluded. RNAs present only in the uncrosslinked datasets were counted as RNA targets of Rbpms2. To characterize the transcriptional differences of rbpms2 mutants vs wildtype fish prior to sex determination 21 dpf  we performed bulk RNA sequencing on n=3 dpf 21 dpf wildtype and n=3 rbpms2 mutant fish. DESeq was then performed for Differential Gene Expression Analysis.", null, "pubmed:38898112", null, "Rbpms2 mApple crosslinked SR3", "GSM8059038", null, "source name:Gonad|tissue:Gonad|cell type:Germline and somatic|genotype:Wildtype|geo loc name:missing|collection date:missing", "Rbpms2 mApple crosslinked SR3", "Basespace illumina platform was used and reads were mapped using tophate2 aligner. Estimation of reference genes and transcript was done using cufflinks and reads were mapped to the genome GRCz10. Reads were aligned with the TopHat Alignment App. GRCz10 CSV file that compiled includes tracking ids  gene loci  and FPKMs for each samples CSV files include tracking and gene id  gene short name  tss id  locus  and FPKM for each sample", "Gonad", null, "RNA was extracted with an Rneasy Mini Kit Qiagen  74104 Libraries were generated with an Illumina Truseq RNA Library Prep kit Illumina  20020589", null, "tissue:Gonad|cell type:Germline and somatic|genotype:Wildtype", "GSM8059038", "GSM8059038: Rbpms2 mApple crosslinked SR3; Danio rerio; RNA Seq", "GSM8059038 r1", "GSM8059038", "1", "RNA was extracted with an Rneasy Mini Kit Qiagen  74104 Libraries were generated with an Illumina Truseq RNA Library Prep kit Illumina  20020589", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP487485", null, null, "SR-3_S4_L001_R1_001.fastq.gz SR-3_S4_L001_R2_001.fastq.gz", "fastq fastq", 588252864.0, 3949222.0, "GSM8059038 r1", "0:74.42 1:74.53", "A:116383167;C:176622592;G:176850622;T:118306997;N:89486", 74, 74, null, null, 116383167, 176622592, 176850622, 118306997, 89486, "SRX23499420", "SRS20351177", "SRA1796363", "Marlow, CDRB, Icahn School of Medicine Mount Sinai", "Marlow, CDRB, Icahn School of Medicine Mount Sinai", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2024-02-01", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [30557, "SRR27836072", "SRX23499419", "SRS20351178", "SRP487485", "PRJNA1072072", "Rbpms2 promotes female fate upstream of the nutrient sensing Gator2 complex component  Mios", "GSE254850", "Transcriptome Analysis", "Reproductive success relies on proper establishment and maintenance of biological sex. In many animals  including mammals  the primary gonad is initially ovary in character. We previously showed the RNA binding protein RNAbp  Rbpms2  is required for ovary fate in zebrafish. Here  we identified Rbpms2 targets in oocytesRbpms2 bound oocyte RNAs; rboRNAs. We identify Rbpms2 as a translational regulator ofrboRNAs  which include testis factors and ribosome biogenesis factors. Further  genetic analyses indicate that Rbpms2 promotes nucleolar amplification via the mTorc1 signaling pathway  specifically through the mTorc1 activating Gap activity towards Rags 2 Gator2 component  Missing oocyte Mios. Cumulatively  our findings indicate that early gonocytes are in a dual poised  bipotential state in which Rbpms2 acts as a binary fate switch. Specifically  Rbpms2 represses testis factors and promotes oocyte factors to promote oocyte progression through an essential Gator2 mediated checkpoint  thereby integrating regulation of sexual differentiation factors and nutritional availability pathways in zebrafish oogenesis. Overall design: To determine the RNA targets of Rbpms2  we generated wildtype female zebrafish expressing Rbpms2 mApple or mApple alone fusion proteins exclusively in the germline. Immunoprecipitation was performed in 2 adult female ovaries per transgene. Crosslinked and uncrosslinked samples for Rbpms2 mApple expressing fish and crosslined and uncrosslinked samples for mApple expressing fish were sequenced. RNAs found in the Rbpms2 mApple crosslinked and the mApple crosslinked and uncrosslinked datasets that were also present in the Rbpms2 mApple uncrosslinked dataset were excluded. RNAs present only in the uncrosslinked datasets were counted as RNA targets of Rbpms2. To characterize the transcriptional differences of rbpms2 mutants vs wildtype fish prior to sex determination 21 dpf  we performed bulk RNA sequencing on n=3 dpf 21 dpf wildtype and n=3 rbpms2 mutant fish. DESeq was then performed for Differential Gene Expression Analysis.", null, "pubmed:38898112", null, "Rbpms2 mApple uncrosslinked SR2", "GSM8059037", null, "source name:Gonad|tissue:Gonad|cell type:Germline and somatic|genotype:Wildtype|geo loc name:missing|collection date:missing", "Rbpms2 mApple uncrosslinked SR2", "Basespace illumina platform was used and reads were mapped using tophate2 aligner. Estimation of reference genes and transcript was done using cufflinks and reads were mapped to the genome GRCz10. Reads were aligned with the TopHat Alignment App. GRCz10 CSV file that compiled includes tracking ids  gene loci  and FPKMs for each samples CSV files include tracking and gene id  gene short name  tss id  locus  and FPKM for each sample", "Gonad", null, "RNA was extracted with an Rneasy Mini Kit Qiagen  74104 Libraries were generated with an Illumina Truseq RNA Library Prep kit Illumina  20020589", null, "tissue:Gonad|cell type:Germline and somatic|genotype:Wildtype", "GSM8059037", "GSM8059037: Rbpms2 mApple uncrosslinked SR2; Danio rerio; RNA Seq", "GSM8059037 r1", "GSM8059037", "1", "RNA was extracted with an Rneasy Mini Kit Qiagen  74104 Libraries were generated with an Illumina Truseq RNA Library Prep kit Illumina  20020589", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP487485", null, null, "SR-2_S3_L001_R1_001.fastq.gz SR-2_S3_L001_R2_001.fastq.gz", "fastq fastq", 547329260.0, 3670350.0, "GSM8059037 r1", "0:74.51 1:74.61", "A:109193152;C:163365002;G:162344228;T:112378069;N:48809", 74, 74, null, null, 109193152, 163365002, 162344228, 112378069, 48809, "SRX23499419", "SRS20351178", "SRA1796363", "Marlow, CDRB, Icahn School of Medicine Mount Sinai", "Marlow, CDRB, Icahn School of Medicine Mount Sinai", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2024-02-01", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [30558, "SRR27836073", "SRX23499418", "SRS20351176", "SRP487485", "PRJNA1072072", "Rbpms2 promotes female fate upstream of the nutrient sensing Gator2 complex component  Mios", "GSE254850", "Transcriptome Analysis", "Reproductive success relies on proper establishment and maintenance of biological sex. In many animals  including mammals  the primary gonad is initially ovary in character. We previously showed the RNA binding protein RNAbp  Rbpms2  is required for ovary fate in zebrafish. Here  we identified Rbpms2 targets in oocytesRbpms2 bound oocyte RNAs; rboRNAs. We identify Rbpms2 as a translational regulator ofrboRNAs  which include testis factors and ribosome biogenesis factors. Further  genetic analyses indicate that Rbpms2 promotes nucleolar amplification via the mTorc1 signaling pathway  specifically through the mTorc1 activating Gap activity towards Rags 2 Gator2 component  Missing oocyte Mios. Cumulatively  our findings indicate that early gonocytes are in a dual poised  bipotential state in which Rbpms2 acts as a binary fate switch. Specifically  Rbpms2 represses testis factors and promotes oocyte factors to promote oocyte progression through an essential Gator2 mediated checkpoint  thereby integrating regulation of sexual differentiation factors and nutritional availability pathways in zebrafish oogenesis. Overall design: To determine the RNA targets of Rbpms2  we generated wildtype female zebrafish expressing Rbpms2 mApple or mApple alone fusion proteins exclusively in the germline. Immunoprecipitation was performed in 2 adult female ovaries per transgene. Crosslinked and uncrosslinked samples for Rbpms2 mApple expressing fish and crosslined and uncrosslinked samples for mApple expressing fish were sequenced. RNAs found in the Rbpms2 mApple crosslinked and the mApple crosslinked and uncrosslinked datasets that were also present in the Rbpms2 mApple uncrosslinked dataset were excluded. RNAs present only in the uncrosslinked datasets were counted as RNA targets of Rbpms2. To characterize the transcriptional differences of rbpms2 mutants vs wildtype fish prior to sex determination 21 dpf  we performed bulk RNA sequencing on n=3 dpf 21 dpf wildtype and n=3 rbpms2 mutant fish. DESeq was then performed for Differential Gene Expression Analysis.", null, "pubmed:38898112", null, "mApple control crosslinked SR8", "GSM8059036", null, "source name:Gonad|tissue:Gonad|cell type:Germline and somatic|genotype:Wildtype|geo loc name:missing|collection date:missing", "mApple control crosslinked SR8", "Basespace illumina platform was used and reads were mapped using tophate2 aligner. Estimation of reference genes and transcript was done using cufflinks and reads were mapped to the genome GRCz10. Reads were aligned with the TopHat Alignment App. GRCz10 CSV file that compiled includes tracking ids  gene loci  and FPKMs for each samples CSV files include tracking and gene id  gene short name  tss id  locus  and FPKM for each sample", "Gonad", null, "RNA was extracted with an Rneasy Mini Kit Qiagen  74104 Libraries were generated with an Illumina Truseq RNA Library Prep kit Illumina  20020589", null, "tissue:Gonad|cell type:Germline and somatic|genotype:Wildtype", "GSM8059036", "GSM8059036: mApple control crosslinked SR8; Danio rerio; RNA Seq", "GSM8059036 r1", "GSM8059036", "1", "RNA was extracted with an Rneasy Mini Kit Qiagen  74104 Libraries were generated with an Illumina Truseq RNA Library Prep kit Illumina  20020589", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP487485", null, null, "SR-8_S6_L001_R1_001.fastq.gz SR-8_S6_L001_R2_001.fastq.gz", "fastq fastq", 474378287.0, 3180744.0, "GSM8059036 r1", "0:74.52 1:74.62", "A:90310344;C:145884340;G:146185172;T:91942086;N:56345", 74, 74, null, null, 90310344, 145884340, 146185172, 91942086, 56345, "SRX23499418", "SRS20351176", "SRA1796363", "Marlow, CDRB, Icahn School of Medicine Mount Sinai", "Marlow, CDRB, Icahn School of Medicine Mount Sinai", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2024-02-01", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [30559, "SRR27836074", "SRX23499417", "SRS20351175", "SRP487485", "PRJNA1072072", "Rbpms2 promotes female fate upstream of the nutrient sensing Gator2 complex component  Mios", "GSE254850", "Transcriptome Analysis", "Reproductive success relies on proper establishment and maintenance of biological sex. In many animals  including mammals  the primary gonad is initially ovary in character. We previously showed the RNA binding protein RNAbp  Rbpms2  is required for ovary fate in zebrafish. Here  we identified Rbpms2 targets in oocytesRbpms2 bound oocyte RNAs; rboRNAs. We identify Rbpms2 as a translational regulator ofrboRNAs  which include testis factors and ribosome biogenesis factors. Further  genetic analyses indicate that Rbpms2 promotes nucleolar amplification via the mTorc1 signaling pathway  specifically through the mTorc1 activating Gap activity towards Rags 2 Gator2 component  Missing oocyte Mios. Cumulatively  our findings indicate that early gonocytes are in a dual poised  bipotential state in which Rbpms2 acts as a binary fate switch. Specifically  Rbpms2 represses testis factors and promotes oocyte factors to promote oocyte progression through an essential Gator2 mediated checkpoint  thereby integrating regulation of sexual differentiation factors and nutritional availability pathways in zebrafish oogenesis. Overall design: To determine the RNA targets of Rbpms2  we generated wildtype female zebrafish expressing Rbpms2 mApple or mApple alone fusion proteins exclusively in the germline. Immunoprecipitation was performed in 2 adult female ovaries per transgene. Crosslinked and uncrosslinked samples for Rbpms2 mApple expressing fish and crosslined and uncrosslinked samples for mApple expressing fish were sequenced. RNAs found in the Rbpms2 mApple crosslinked and the mApple crosslinked and uncrosslinked datasets that were also present in the Rbpms2 mApple uncrosslinked dataset were excluded. RNAs present only in the uncrosslinked datasets were counted as RNA targets of Rbpms2. To characterize the transcriptional differences of rbpms2 mutants vs wildtype fish prior to sex determination 21 dpf  we performed bulk RNA sequencing on n=3 dpf 21 dpf wildtype and n=3 rbpms2 mutant fish. DESeq was then performed for Differential Gene Expression Analysis.", null, "pubmed:38898112", null, "mApple control uncrosslinked SR6", "GSM8059035", null, "source name:Gonad|tissue:Gonad|cell type:Germline and somatic|genotype:Wildtype|geo loc name:missing|collection date:missing", "mApple control uncrosslinked SR6", "Basespace illumina platform was used and reads were mapped using tophate2 aligner. Estimation of reference genes and transcript was done using cufflinks and reads were mapped to the genome GRCz10. Reads were aligned with the TopHat Alignment App. GRCz10 CSV file that compiled includes tracking ids  gene loci  and FPKMs for each samples CSV files include tracking and gene id  gene short name  tss id  locus  and FPKM for each sample", "Gonad", null, "RNA was extracted with an Rneasy Mini Kit Qiagen  74104 Libraries were generated with an Illumina Truseq RNA Library Prep kit Illumina  20020589", null, "tissue:Gonad|cell type:Germline and somatic|genotype:Wildtype", "GSM8059035", "GSM8059035: mApple control uncrosslinked SR6; Danio rerio; RNA Seq", "GSM8059035 r1", "GSM8059035", "1", "RNA was extracted with an Rneasy Mini Kit Qiagen  74104 Libraries were generated with an Illumina Truseq RNA Library Prep kit Illumina  20020589", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP487485", null, null, "SR-6_S5_L001_R1_001.fastq.gz SR-6_S5_L001_R2_001.fastq.gz", "fastq fastq", 1667210566.0, 11187841.0, "GSM8059035 r1", "0:74.46 1:74.56", "A:348153529;C:480420209;G:474792496;T:363567978;N:276354", 74, 74, null, null, 348153529, 480420209, 474792496, 363567978, 276354, "SRX23499417", "SRS20351175", "SRA1796363", "Marlow, CDRB, Icahn School of Medicine Mount Sinai", "Marlow, CDRB, Icahn School of Medicine Mount Sinai", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "bulk", "bulk", null, "United States", "2024-02-01", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [32476, "SRR29270149", "SRX24787634", "SRS21505104", "SRP511487", "PRJNA1119569", "RNA seq of zebrafish foxl2l mutant", "PRJNA1119569", "Other", "Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.", null, null, null, null, "foxl2l Mut 20 1", null, "strain:AB|age:20|collection date:2023 06 10|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "foxl2l Mut 20 1", "E10", "E10", "50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme  NR604 01", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP511487", null, null, "foxl2l_Mut-20-1_S162_R1.fastq.gz foxl2l_Mut-20-1_S162_R2.fastq.gz", "fastq fastq", 8940963680.0, 29605840.0, "foxl2l Mut 20 1 S162 R1.fastq.gz", "0:151 1:151", "A:2232167098;C:2229744850;G:2271326718;T:2207692629;N:32385", 151, 151, null, null, 2232167098, 2229744850, 2271326718, 2207692629, 32385, "SRX24787634", "SRS21505104", "SRA1887976", "Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology", "Institute of Hydrobiology, Chinese Academy of Sciences", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "bulk", "bulk", null, "China", "2024-06-03", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [32477, "SRR29270150", "SRX24787633", "SRS21505103", "SRP511487", "PRJNA1119569", "RNA seq of zebrafish foxl2l mutant", "PRJNA1119569", "Other", "Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.", null, null, null, null, "foxl2l Het 20 3", null, "strain:AB|age:20|collection date:2023 06 09|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "foxl2l Het 20 3", "E9", "E9", "50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme  NR604 01", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP511487", null, null, "foxl2l_Het-20-3_S161_R1.fastq.gz foxl2l_Het-20-3_S161_R2.fastq.gz", "fastq fastq", 7038409282.0, 23305991.0, "foxl2l Het 20 3 S161 R1.fastq.gz", "0:151 1:151", "A:1766863186;C:1740008639;G:1787471686;T:1744039429;N:26342", 151, 151, null, null, 1766863186, 1740008639, 1787471686, 1744039429, 26342, "SRX24787633", "SRS21505103", "SRA1887976", "Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology", "Institute of Hydrobiology, Chinese Academy of Sciences", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "bulk", "bulk", null, "China", "2024-06-03", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [32478, "SRR29270151", "SRX24787632", "SRS21505102", "SRP511487", "PRJNA1119569", "RNA seq of zebrafish foxl2l mutant", "PRJNA1119569", "Other", "Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.", null, null, null, null, "foxl2l Het 20 2", null, "strain:AB|age:20|collection date:2023 06 08|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "foxl2l Het 20 2", "E8", "E8", "50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme  NR604 01", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP511487", null, null, "foxl2l_Het-20-2_S160_R1.fastq.gz foxl2l_Het-20-2_S160_R2.fastq.gz", "fastq fastq", 6772505832.0, 22425516.0, "foxl2l Het 20 2 S160 R1.fastq.gz", "0:151 1:151", "A:1704124986;C:1673138074;G:1713003931;T:1682214009;N:24832", 151, 151, null, null, 1704124986, 1673138074, 1713003931, 1682214009, 24832, "SRX24787632", "SRS21505102", "SRA1887976", "Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology", "Institute of Hydrobiology, Chinese Academy of Sciences", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "bulk", "bulk", null, "China", "2024-06-03", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [32479, "SRR29270152", "SRX24787631", "SRS21505101", "SRP511487", "PRJNA1119569", "RNA seq of zebrafish foxl2l mutant", "PRJNA1119569", "Other", "Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.", null, null, null, null, "foxl2l Het 20 1", null, "strain:AB|age:20|collection date:2023 06 07|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "foxl2l Het 20 1", "E7", "E7", "50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme  NR604 01", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP511487", null, null, "foxl2l_Het-20-1_S159_R1.fastq.gz foxl2l_Het-20-1_S159_R2.fastq.gz", "fastq fastq", 11685740812.0, 38694506.0, "foxl2l Het 20 1 S159 R1.fastq.gz", "0:151 1:151", "A:2939618668;C:2888861085;G:2958173208;T:2899044704;N:43147", 151, 151, null, null, 2939618668, 2888861085, 2958173208, 2899044704, 43147, "SRX24787631", "SRS21505101", "SRA1887976", "Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology", "Institute of Hydrobiology, Chinese Academy of Sciences", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "bulk", "bulk", null, "China", "2024-06-03", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [32480, "SRR29270153", "SRX24787630", "SRS21505100", "SRP511487", "PRJNA1119569", "RNA seq of zebrafish foxl2l mutant", "PRJNA1119569", "Other", "Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.", null, null, null, null, "foxl2l Mut 15 3", null, "strain:AB|age:15|collection date:2023 06 06|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "foxl2l Mut 15 3", "E6", "E6", "50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme  NR604 01", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP511487", null, null, "foxl2l_Mut-15-3_S158_R1.fastq.gz foxl2l_Mut-15-3_S158_R2.fastq.gz", "fastq fastq", 9503789604.0, 31469502.0, "foxl2l Mut 15 3 S158 R1.fastq.gz", "0:151 1:151", "A:2393052443;C:2340958111;G:2411502428;T:2358240313;N:36309", 151, 151, null, null, 2393052443, 2340958111, 2411502428, 2358240313, 36309, "SRX24787630", "SRS21505100", "SRA1887976", "Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology", "Institute of Hydrobiology, Chinese Academy of Sciences", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "bulk", "bulk", null, "China", "2024-06-03", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [32481, "SRR29270154", "SRX24787629", "SRS21505099", "SRP511487", "PRJNA1119569", "RNA seq of zebrafish foxl2l mutant", "PRJNA1119569", "Other", "Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.", null, null, null, null, "foxl2l Mut 15 2", null, "strain:AB|age:15|collection date:2023 06 05|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "foxl2l Mut 15 2", "E5", "E5", "50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme  NR604 01", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP511487", null, null, "foxl2l_Mut-15-2_S157_R1.fastq.gz foxl2l_Mut-15-2_S157_R2.fastq.gz", "fastq fastq", 7416837026.0, 24559063.0, "foxl2l Mut 15 2 S157 R1.fastq.gz", "0:151 1:151", "A:1865711045;C:1830489703;G:1881612508;T:1838995980;N:27790", 151, 151, null, null, 1865711045, 1830489703, 1881612508, 1838995980, 27790, "SRX24787629", "SRS21505099", "SRA1887976", "Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology", "Institute of Hydrobiology, Chinese Academy of Sciences", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "bulk", "bulk", null, "China", "2024-06-03", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [32482, "SRR29270155", "SRX24787628", "SRS21505098", "SRP511487", "PRJNA1119569", "RNA seq of zebrafish foxl2l mutant", "PRJNA1119569", "Other", "Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.", null, null, null, null, "foxl2l Mut 15 1", null, "strain:AB|age:15|collection date:2023 06 04|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "foxl2l Mut 15 1", "E4", "E4", "50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme  NR604 01", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP511487", null, null, "foxl2l_Mut-15-1_S156_R1.fastq.gz foxl2l_Mut-15-1_S156_R2.fastq.gz", "fastq fastq", 7092721868.0, 23485834.0, "foxl2l Mut 15 1 S156 R1.fastq.gz", "0:151 1:151", "A:1764166761;C:1770534219;G:1820397492;T:1737597123;N:26273", 151, 151, null, null, 1764166761, 1770534219, 1820397492, 1737597123, 26273, "SRX24787628", "SRS21505098", "SRA1887976", "Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology", "Institute of Hydrobiology, Chinese Academy of Sciences", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "bulk", "bulk", null, "China", "2024-06-03", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [32483, "SRR29270156", "SRX24787627", "SRS21505097", "SRP511487", "PRJNA1119569", "RNA seq of zebrafish foxl2l mutant", "PRJNA1119569", "Other", "Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.", null, null, null, null, "foxl2l Het 15 3", null, "strain:AB|age:15|collection date:2023 06 03|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "foxl2l Het 15 3", "E3", "E3", "50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme  NR604 01", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP511487", null, null, "foxl2l_Het-15-3_S155_R1.fastq.gz foxl2l_Het-15-3_S155_R2.fastq.gz", "fastq fastq", 8083606820.0, 26766910.0, "foxl2l Het 15 3 S155 R1.fastq.gz", "0:151 1:151", "A:2028557443;C:2001113164;G:2050610840;T:2003295953;N:29420", 151, 151, null, null, 2028557443, 2001113164, 2050610840, 2003295953, 29420, "SRX24787627", "SRS21505097", "SRA1887976", "Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology", "Institute of Hydrobiology, Chinese Academy of Sciences", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "bulk", "bulk", null, "China", "2024-06-03", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [32484, "SRR29270157", "SRX24787626", "SRS21505096", "SRP511487", "PRJNA1119569", "RNA seq of zebrafish foxl2l mutant", "PRJNA1119569", "Other", "Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.", null, null, null, null, "foxl2l Mut 20 3", null, "strain:AB|age:20|collection date:2023 06 12|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "foxl2l Mut 20 3", "E12", "E12", "50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme  NR604 01", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP511487", null, null, "foxl2l_Mut-20-3_S164_R1.fastq.gz foxl2l_Mut-20-3_S164_R2.fastq.gz", "fastq fastq", 7474861796.0, 24751198.0, "foxl2l Mut 20 3 S164 R1.fastq.gz", "0:151 1:151", "A:1878881650;C:1849512621;G:1891142525;T:1855296720;N:28280", 151, 151, null, null, 1878881650, 1849512621, 1891142525, 1855296720, 28280, "SRX24787626", "SRS21505096", "SRA1887976", "Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology", "Institute of Hydrobiology, Chinese Academy of Sciences", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "bulk", "bulk", null, "China", "2024-06-03", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [32485, "SRR29270158", "SRX24787625", "SRS21505095", "SRP511487", "PRJNA1119569", "RNA seq of zebrafish foxl2l mutant", "PRJNA1119569", "Other", "Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.", null, null, null, null, "foxl2l Mut 20 2", null, "strain:AB|age:20|collection date:2023 06 11|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "foxl2l Mut 20 2", "E11", "E11", "50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme  NR604 01", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP511487", null, null, "foxl2l_Mut-20-2_S163_R1.fastq.gz foxl2l_Mut-20-2_S163_R2.fastq.gz", "fastq fastq", 8203704066.0, 27164583.0, "foxl2l Mut 20 2 S163 R1.fastq.gz", "0:151 1:151", "A:2061693689;C:2030126562;G:2072980952;T:2038873198;N:29665", 151, 151, null, null, 2061693689, 2030126562, 2072980952, 2038873198, 29665, "SRX24787625", "SRS21505095", "SRA1887976", "Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology", "Institute of Hydrobiology, Chinese Academy of Sciences", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "bulk", "bulk", null, "China", "2024-06-03", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [32486, "SRR29270159", "SRX24787624", "SRS21505094", "SRP511487", "PRJNA1119569", "RNA seq of zebrafish foxl2l mutant", "PRJNA1119569", "Other", "Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.", null, null, null, null, "foxl2l Het 15 2", null, "strain:AB|age:15|collection date:2023 06 02|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "foxl2l Het 15 2", "E2", "E2", "50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme  NR604 01", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP511487", null, null, "foxl2l_Het-15-2_S154_R1.fastq.gz foxl2l_Het-15-2_S154_R2.fastq.gz", "fastq fastq", 7868286860.0, 26053930.0, "foxl2l Het 15 2 S154 R1.fastq.gz", "0:151 1:151", "A:1972210357;C:1946891859;G:2008091153;T:1941064817;N:28674", 151, 151, null, null, 1972210357, 1946891859, 2008091153, 1941064817, 28674, "SRX24787624", "SRS21505094", "SRA1887976", "Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology", "Institute of Hydrobiology, Chinese Academy of Sciences", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "bulk", "bulk", null, "China", "2024-06-03", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [32487, "SRR29270160", "SRX24787623", "SRS21505093", "SRP511487", "PRJNA1119569", "RNA seq of zebrafish foxl2l mutant", "PRJNA1119569", "Other", "Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.", null, null, null, null, "foxl2l Het 15 1", null, "strain:AB|age:15|collection date:2023 06 01|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "foxl2l Het 15 1", "E1", "E1", "50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme  NR604 01", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP511487", null, null, "foxl2l_Het-15-1_S153_R1.fastq.gz foxl2l_Het-15-1_S153_R2.fastq.gz", "fastq fastq", 7117391946.0, 23567523.0, "foxl2l Het 15 1 S153 R1.fastq.gz", "0:151 1:151", "A:1795668098;C:1752824783;G:1793720116;T:1775153584;N:25365", 151, 151, null, null, 1795668098, 1752824783, 1793720116, 1775153584, 25365, "SRX24787623", "SRS21505093", "SRA1887976", "Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology", "Institute of Hydrobiology, Chinese Academy of Sciences", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "bulk", "bulk", null, "China", "2024-06-03", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [36285, "SRR363985", "SRX105298", "SRS270141", "SRP009275", "PRJNA148581", "Hen1 analysis in zebrafish", "GSE33582", "Transcriptome Analysis", "small RNA libraries from wild type and Hen1 mutant testes were made with either polyA tailing VASAGFPHen1minus/plus or adapter ligation Hen1Testis and WTTestis and sequenced on an Illumina GAII platform. Overall design: RNA was isolated from total testis tissue of both Hen1 wildtype and Hen1 mutant animals. post size selection from gel  the small RNA libraries wre made.", null, "pubmed:20859253", null, "wildtype ligation", "GSM830247", null, "source name:testis|strain:TL|genotype/variation:Hen1 wildtype|tissue:testis|small rna library prep method:adapter ligation", "wildtype ligation", "three prime adapter sequences were trimmed and inserts longer than 18 nt were mapped to the zebrafish genome Zv8", "testis", null, "Small RNAs in the size range of 19 31 bases were excised from a denaturing gel. Adaptors were ligated to the five prime and three prime ends of the isolated RNA  and the product was converted to cDNA using a primer on the three prime adaptor. post 15 cycles PCR amplification of the library the product was gel purified and sequenced on a Solexa platform.", null, "strain:TL|genotype/variation:Hen1 wildtype|tissue:testis|small rna library prep method:adapter ligation", "GSM830247", "GSM830247: wildtype ligation", "GSM830247: wildtype ligation", "GSM830247: wildtype ligation", "1", null, "GEO Accession:GSM830247", "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer II", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>46</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP009275", null, "read name barcode proc directive:ignore", "WTTESTIS.fastq", "fastq", 395791130.0, 8604155.0, "GSM830247 1", "0:46", "A:79045664;C:90489917;G:99082007;T:127024229;N:149313", 46, null, null, null, 79045664, 90489917, 99082007, 127024229, 149313, "SRX105298", "SRS270141", "SRA047996", "GEO", "European Research Institute for the Biology of Ageing, University Medical Center Groningen", 1, 0.00021, null, 0.00015, null, 0.99989, null, 0.0, null, 46, null, "T", null, "under 1.2% mapping rate", "illumina", "early_illumina", "5prime", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2011-11-09", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [36286, "SRR363984", "SRX105297", "SRS270140", "SRP009275", "PRJNA148581", "Hen1 analysis in zebrafish", "GSE33582", "Transcriptome Analysis", "small RNA libraries from wild type and Hen1 mutant testes were made with either polyA tailing VASAGFPHen1minus/plus or adapter ligation Hen1Testis and WTTestis and sequenced on an Illumina GAII platform. Overall design: RNA was isolated from total testis tissue of both Hen1 wildtype and Hen1 mutant animals. post size selection from gel  the small RNA libraries wre made.", null, "pubmed:20859253", null, "hen1 mutant ligation", "GSM830246", null, "source name:testis|strain:TL|genotype/variation:Hen1 mutant|tissue:testis|small rna library prep method:adapter ligation", "hen1 mutant ligation", "three prime adapter sequences were trimmed and inserts longer than 18 nt were mapped to the zebrafish genome Zv8", "testis", null, "Small RNAs in the size range of 19 31 bases were excised from a denaturing gel. Adaptors were ligated to the five prime and three prime ends of the isolated RNA  and the product was converted to cDNA using a primer on the three prime adaptor. post 15 cycles PCR amplification of the library the product was gel purified and sequenced on a Solexa platform.", null, "strain:TL|genotype/variation:Hen1 mutant|tissue:testis|small rna library prep method:adapter ligation", "GSM830246", "GSM830246: hen1 mutant ligation", "GSM830246: hen1 mutant ligation", "GSM830246: hen1 mutant ligation", "1", null, "GEO Accession:GSM830246", "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer II", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>46</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP009275", null, "read name barcode proc directive:ignore", "HEN1TESTIS.fastq", "fastq", 440876374.0, 9584269.0, "GSM830246 1", "0:46", "A:91693980;C:99515953;G:105634029;T:143841954;N:190458", 46, null, null, null, 91693980, 99515953, 105634029, 143841954, 190458, "SRX105297", "SRS270140", "SRA047996", "GEO", "European Research Institute for the Biology of Ageing, University Medical Center Groningen", 1, 0.00039, null, 0.00033, null, 0.99995, null, 0.0, null, 46, null, "T", null, "under 1.2% mapping rate", "illumina", "early_illumina", "5prime", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2011-11-09", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [36287, "SRR363983", "SRX105296", "SRS270139", "SRP009275", "PRJNA148581", "Hen1 analysis in zebrafish", "GSE33582", "Transcriptome Analysis", "small RNA libraries from wild type and Hen1 mutant testes were made with either polyA tailing VASAGFPHen1minus/plus or adapter ligation Hen1Testis and WTTestis and sequenced on an Illumina GAII platform. Overall design: RNA was isolated from total testis tissue of both Hen1 wildtype and Hen1 mutant animals. post size selection from gel  the small RNA libraries wre made.", null, "pubmed:20859253", null, "wildtype polyA", "GSM830245", null, "source name:testis|strain:TL|genotype/variation:Hen1 wildtype|tissue:testis|small rna library prep method:polyA tailing", "wildtype polyA", "three prime adapter sequences were trimmed and inserts longer than 18 nt were mapped to the zebrafish genome Zv8", "testis", null, "Small RNAs in the size range of 19 31 bases were excised from a denaturing gel. RNA was polyA tailed using polyA polymerase followed by ligation of a RNA adaptor to the five prime phosphate of the small RNAs. First strand cDNA synthesis was performed using an oligodT linker primer and M MLV RNase H  reverse transcriptase. post amplification the cDNA was sent for sequencing on an Illumina/Solexa platform.", null, "strain:TL|genotype/variation:Hen1 wildtype|tissue:testis|small rna library prep method:polyA tailing", "GSM830245", "GSM830245: wildtype polyA", "GSM830245: wildtype polyA", "GSM830245: wildtype polyA", "1", null, "GEO Accession:GSM830245", "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer II", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>44</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP009275", null, "read name barcode proc directive:ignore", "VASAGFPHEN1plusMALE.fastq", "fastq", 167344144.0, 3803276.0, "GSM830245 1", "0:44", "A:87935982;C:21182538;G:19081938;T:34474815;N:4668871", 44, null, null, null, 87935982, 21182538, 19081938, 34474815, 4668871, "SRX105296", "SRS270139", "SRA047996", "GEO", "European Research Institute for the Biology of Ageing, University Medical Center Groningen", 1, 0.06642, null, 0.05042, null, 0.99226, null, 0.38346, null, 44, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2011-11-09", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [36288, "SRR363982", "SRX105295", "SRS270138", "SRP009275", "PRJNA148581", "Hen1 analysis in zebrafish", "GSE33582", "Transcriptome Analysis", "small RNA libraries from wild type and Hen1 mutant testes were made with either polyA tailing VASAGFPHen1minus/plus or adapter ligation Hen1Testis and WTTestis and sequenced on an Illumina GAII platform. Overall design: RNA was isolated from total testis tissue of both Hen1 wildtype and Hen1 mutant animals. post size selection from gel  the small RNA libraries wre made.", null, "pubmed:20859253", null, "hen1 mutant polyA", "GSM830244", null, "source name:testis|strain:TL|genotype/variation:Hen1 mutant|tissue:testis|small rna library prep method:polyA tailing", "hen1 mutant polyA", "three prime adapter sequences were trimmed and inserts longer than 18 nt were mapped to the zebrafish genome Zv8", "testis", null, "Small RNAs in the size range of 19 31 bases were excised from a denaturing gel. RNA was polyA tailed using polyA polymerase followed by ligation of a RNA adaptor to the five prime phosphate of the small RNAs. First strand cDNA synthesis was performed using an oligodT linker primer and M MLV RNase H  reverse transcriptase. post amplification the cDNA was sent for sequencing on an Illumina/Solexa platform.", null, "strain:TL|genotype/variation:Hen1 mutant|tissue:testis|small rna library prep method:polyA tailing", "GSM830244", "GSM830244: hen1 mutant polyA", "GSM830244: hen1 mutant polyA", "GSM830244: hen1 mutant polyA", "1", null, "GEO Accession:GSM830244", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina Genome Analyzer II", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>44</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP009275", null, "read name barcode proc directive:ignore", "VASAGFPHEN1minusMALE.fastq", "fastq", 267208964.0, 6072931.0, "GSM830244 1", "0:44", "A:143478691;C:30051676;G:33682677;T:59883224;N:112696", 44, null, null, null, 143478691, 30051676, 33682677, 59883224, 112696, "SRX105295", "SRS270138", "SRA047996", "GEO", "European Research Institute for the Biology of Ageing, University Medical Center Groningen", 1, 0.01616, null, 0.01033, null, 0.99381, null, 0.76337, null, 44, null, "B", null, "usable mapping rate", "illumina", "early_illumina", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Netherlands", "2011-11-09", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [42465, "SRR5605448", "SRX2858036", "SRS2228760", "SRP108050", "PRJNA388086", "Transcriptomic Analysis for Differentially Expressed Genes in Ovarian Follicle Activation and Puberty Onset in the Zebrafish", "GSE99308", "Transcriptome Analysis", "Puberty is a special transition period in sexual maturation  and it has been extensively studied in vertebrates in the past decades. In mammals  the initiation of puberty involves activation of numerous genes; however  there have been few comprehensive reports in small model teleosts such as the zebrafish. In the zebrafish  the onset of puberty in females is marked by the appearance of the first wave of pre vitellogenic PV follicles in the ovary during sexual maturation.  Using transcriptomics and real time qPCR  this study was undertaken to investigate temporal gene expression differences between the primary growth PG follicles and pre vitellogenic PV follicles  with particular emphasis on oocyte and follicular cell specific genes as well as several closely associated signaling pathways. Our results showed that totally 1082 genes were significantly upregulated and 530 evidently downregulated during the PG PV transition  and among them were some well recognized biomarkers such as cyp19a1a  fshr  inha and inhbaa and some novel genes like notch3  amh  gadd45ga and lpl.  Further gene ontology analysis showed that egg coat formation and steroid hormone mediated signaling pathway might be critical for follicle activation from PG to PV stage. In addition  KEGG identified several signaling pathways that might play pivotal roles in early folliculogenesis  including phosphatidylinositol signaling system  glycolsaminoglycan biosynthesis  RNA transport  and p53 signaling pathways. Overall  this study reported a comprehensive analysis for biomarker genes and potential pathways involved in PG PV transition or follicle activation  which also marks female puberty onset in the zebrafish when occurring for the first time in sexual maturation. Overall design: Examination of gene expression patterns in 2 different stage follicles PG and PV follicles", null, "pubmed:30364302", null, "PV WT3", "GSM2640960", null, "source name:PV WT3|strain:AB|tissue:follice|developmental stage:pre vitellogenin|genotype:WT", "PV WT3", "Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Danio rerio genome version GRCz10 from Ensembl using Tophat2. Parameters:  p 6 StringTie and prepDE.py Python script provided with StringTie tool was used to assemble the alignments into transcripts and extract the raw read counts for reference genomic features respectively. The read count matrix was processed by DeSeq2 package for differential gene expression analysis. Genome build: GRCz10 Ensembl build 84 Supplementary files format and content: PG vs PV rawCounts.csv: Raw read counts for each sample. Supplementary files format and content: PG vs PV normCounts.tab: Normalized read counts for each sample.", "PV WT3", null, "Both PG and PV follicles were isolated and  followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "strain:AB|tissue:follice|developmental stage:pre vitellogenin|genotype:WT", "GSM2640960", "GSM2640960: PV WT3; Danio rerio; RNA Seq", "GSM2640960", null, "1", "Both PG and PV follicles were isolated and  followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM2640960", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP108050", null, null, "PV_WT3_R1.fastq.gz PV_WT3_R2.fastq.gz", "fastq fastq", 2965772270.0, 14976621.0, "GSM2640960 r1", "0:99.03 1:98.99", "A:759343389;C:716154246;G:713466520;T:775995980;N:812135", 99, 98, null, null, 759343389, 716154246, 713466520, 775995980, 812135, "SRX2858036", "SRS2228760", "SRA566530", "GEO", "Genomics and Bioinformatics Core, Faculty of Health Sciences, University of Macau", 2, 0.95025, 0.95484, 0.02351, 0.02292, 0.74403, 0.74566, 0.48148, 0.48254, 100, 98, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "China", "2017-05-25", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [42466, "SRR5605447", "SRX2858035", "SRS2228759", "SRP108050", "PRJNA388086", "Transcriptomic Analysis for Differentially Expressed Genes in Ovarian Follicle Activation and Puberty Onset in the Zebrafish", "GSE99308", "Transcriptome Analysis", "Puberty is a special transition period in sexual maturation  and it has been extensively studied in vertebrates in the past decades. In mammals  the initiation of puberty involves activation of numerous genes; however  there have been few comprehensive reports in small model teleosts such as the zebrafish. In the zebrafish  the onset of puberty in females is marked by the appearance of the first wave of pre vitellogenic PV follicles in the ovary during sexual maturation.  Using transcriptomics and real time qPCR  this study was undertaken to investigate temporal gene expression differences between the primary growth PG follicles and pre vitellogenic PV follicles  with particular emphasis on oocyte and follicular cell specific genes as well as several closely associated signaling pathways. Our results showed that totally 1082 genes were significantly upregulated and 530 evidently downregulated during the PG PV transition  and among them were some well recognized biomarkers such as cyp19a1a  fshr  inha and inhbaa and some novel genes like notch3  amh  gadd45ga and lpl.  Further gene ontology analysis showed that egg coat formation and steroid hormone mediated signaling pathway might be critical for follicle activation from PG to PV stage. In addition  KEGG identified several signaling pathways that might play pivotal roles in early folliculogenesis  including phosphatidylinositol signaling system  glycolsaminoglycan biosynthesis  RNA transport  and p53 signaling pathways. Overall  this study reported a comprehensive analysis for biomarker genes and potential pathways involved in PG PV transition or follicle activation  which also marks female puberty onset in the zebrafish when occurring for the first time in sexual maturation. Overall design: Examination of gene expression patterns in 2 different stage follicles PG and PV follicles", null, "pubmed:30364302", null, "PV WT2", "GSM2640959", null, "source name:PV WT2|strain:AB|tissue:follicle|developmental stage:pre vitellogenin|genotype:WT", "PV WT2", "Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Danio rerio genome version GRCz10 from Ensembl using Tophat2. Parameters:  p 6 StringTie and prepDE.py Python script provided with StringTie tool was used to assemble the alignments into transcripts and extract the raw read counts for reference genomic features respectively. The read count matrix was processed by DeSeq2 package for differential gene expression analysis. Genome build: GRCz10 Ensembl build 84 Supplementary files format and content: PG vs PV rawCounts.csv: Raw read counts for each sample. Supplementary files format and content: PG vs PV normCounts.tab: Normalized read counts for each sample.", "PV WT2", null, "Both PG and PV follicles were isolated and  followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "strain:AB|tissue:follicle|developmental stage:pre vitellogenin|genotype:WT", "GSM2640959", "GSM2640959: PV WT2; Danio rerio; RNA Seq", "GSM2640959", null, "1", "Both PG and PV follicles were isolated and  followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM2640959", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP108050", null, null, "PV_WT2_R2.fastq.gz PV_WT2_R1.fastq.gz", "fastq fastq", 2021387268.0, 10195384.0, "GSM2640959 r1", "0:99.15 1:99.12", "A:517788644;C:487363563;G:485168383;T:530550229;N:516449", 99, 99, null, null, 517788644, 487363563, 485168383, 530550229, 516449, "SRX2858035", "SRS2228759", "SRA566530", "GEO", "Genomics and Bioinformatics Core, Faculty of Health Sciences, University of Macau", 2, 0.95112, 0.95441, 0.02399, 0.02367, 0.74221, 0.74373, 0.47995, 0.47334, 100, 100, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "China", "2017-05-25", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [42467, "SRR5605446", "SRX2858034", "SRS2228758", "SRP108050", "PRJNA388086", "Transcriptomic Analysis for Differentially Expressed Genes in Ovarian Follicle Activation and Puberty Onset in the Zebrafish", "GSE99308", "Transcriptome Analysis", "Puberty is a special transition period in sexual maturation  and it has been extensively studied in vertebrates in the past decades. In mammals  the initiation of puberty involves activation of numerous genes; however  there have been few comprehensive reports in small model teleosts such as the zebrafish. In the zebrafish  the onset of puberty in females is marked by the appearance of the first wave of pre vitellogenic PV follicles in the ovary during sexual maturation.  Using transcriptomics and real time qPCR  this study was undertaken to investigate temporal gene expression differences between the primary growth PG follicles and pre vitellogenic PV follicles  with particular emphasis on oocyte and follicular cell specific genes as well as several closely associated signaling pathways. Our results showed that totally 1082 genes were significantly upregulated and 530 evidently downregulated during the PG PV transition  and among them were some well recognized biomarkers such as cyp19a1a  fshr  inha and inhbaa and some novel genes like notch3  amh  gadd45ga and lpl.  Further gene ontology analysis showed that egg coat formation and steroid hormone mediated signaling pathway might be critical for follicle activation from PG to PV stage. In addition  KEGG identified several signaling pathways that might play pivotal roles in early folliculogenesis  including phosphatidylinositol signaling system  glycolsaminoglycan biosynthesis  RNA transport  and p53 signaling pathways. Overall  this study reported a comprehensive analysis for biomarker genes and potential pathways involved in PG PV transition or follicle activation  which also marks female puberty onset in the zebrafish when occurring for the first time in sexual maturation. Overall design: Examination of gene expression patterns in 2 different stage follicles PG and PV follicles", null, "pubmed:30364302", null, "PV WT1", "GSM2640958", null, "source name:PV WT1|strain:AB|tissue:follicle|developmental stage:pre vitellogenin|genotype:WT", "PV WT1", "Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Danio rerio genome version GRCz10 from Ensembl using Tophat2. Parameters:  p 6 StringTie and prepDE.py Python script provided with StringTie tool was used to assemble the alignments into transcripts and extract the raw read counts for reference genomic features respectively. The read count matrix was processed by DeSeq2 package for differential gene expression analysis. Genome build: GRCz10 Ensembl build 84 Supplementary files format and content: PG vs PV rawCounts.csv: Raw read counts for each sample. Supplementary files format and content: PG vs PV normCounts.tab: Normalized read counts for each sample.", "PV WT1", null, "Both PG and PV follicles were isolated and  followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "strain:AB|tissue:follicle|developmental stage:pre vitellogenin|genotype:WT", "GSM2640958", "GSM2640958: PV WT1; Danio rerio; RNA Seq", "GSM2640958", null, "1", "Both PG and PV follicles were isolated and  followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM2640958", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP108050", null, null, "PV_WT1_R1.fastq.gz PV_WT1_R2.fastq.gz", "fastq fastq", 3244660111.0, 16481925.0, "GSM2640958 r1", "0:98.44 1:98.42", "A:831426044;C:781489498;G:779991004;T:848549246;N:3204319", 98, 98, null, null, 831426044, 781489498, 779991004, 848549246, 3204319, "SRX2858034", "SRS2228758", "SRA566530", "GEO", "Genomics and Bioinformatics Core, Faculty of Health Sciences, University of Macau", 2, 0.94778, 0.95185, 0.02323, 0.02295, 0.7429, 0.74385, 0.48023, 0.47809, 95, 95, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "China", "2017-05-25", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [42468, "SRR5605445", "SRX2858033", "SRS2228757", "SRP108050", "PRJNA388086", "Transcriptomic Analysis for Differentially Expressed Genes in Ovarian Follicle Activation and Puberty Onset in the Zebrafish", "GSE99308", "Transcriptome Analysis", "Puberty is a special transition period in sexual maturation  and it has been extensively studied in vertebrates in the past decades. In mammals  the initiation of puberty involves activation of numerous genes; however  there have been few comprehensive reports in small model teleosts such as the zebrafish. In the zebrafish  the onset of puberty in females is marked by the appearance of the first wave of pre vitellogenic PV follicles in the ovary during sexual maturation.  Using transcriptomics and real time qPCR  this study was undertaken to investigate temporal gene expression differences between the primary growth PG follicles and pre vitellogenic PV follicles  with particular emphasis on oocyte and follicular cell specific genes as well as several closely associated signaling pathways. Our results showed that totally 1082 genes were significantly upregulated and 530 evidently downregulated during the PG PV transition  and among them were some well recognized biomarkers such as cyp19a1a  fshr  inha and inhbaa and some novel genes like notch3  amh  gadd45ga and lpl.  Further gene ontology analysis showed that egg coat formation and steroid hormone mediated signaling pathway might be critical for follicle activation from PG to PV stage. In addition  KEGG identified several signaling pathways that might play pivotal roles in early folliculogenesis  including phosphatidylinositol signaling system  glycolsaminoglycan biosynthesis  RNA transport  and p53 signaling pathways. Overall  this study reported a comprehensive analysis for biomarker genes and potential pathways involved in PG PV transition or follicle activation  which also marks female puberty onset in the zebrafish when occurring for the first time in sexual maturation. Overall design: Examination of gene expression patterns in 2 different stage follicles PG and PV follicles", null, "pubmed:30364302", null, "PG WT3", "GSM2640957", null, "source name:PG WT3|strain:AB|tissue:follicle|developmental stage:primary growth|genotype:WT", "PG WT3", "Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Danio rerio genome version GRCz10 from Ensembl using Tophat2. Parameters:  p 6 StringTie and prepDE.py Python script provided with StringTie tool was used to assemble the alignments into transcripts and extract the raw read counts for reference genomic features respectively. The read count matrix was processed by DeSeq2 package for differential gene expression analysis. Genome build: GRCz10 Ensembl build 84 Supplementary files format and content: PG vs PV rawCounts.csv: Raw read counts for each sample. Supplementary files format and content: PG vs PV normCounts.tab: Normalized read counts for each sample.", "PG WT3", null, "Both PG and PV follicles were isolated and  followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "strain:AB|tissue:follicle|developmental stage:primary growth|genotype:WT", "GSM2640957", "GSM2640957: PG WT3; Danio rerio; RNA Seq", "GSM2640957", null, "1", "Both PG and PV follicles were isolated and  followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM2640957", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP108050", null, null, "PG_WT3_R1.fastq.gz PG_WT3_R2.fastq.gz", "fastq fastq", 1976825713.0, 10028723.0, "GSM2640957 r1", "0:98.57 1:98.54", "A:498115588;C:485653640;G:479542298;T:512706941;N:807246", 98, 98, null, null, 498115588, 485653640, 479542298, 512706941, 807246, "SRX2858033", "SRS2228757", "SRA566530", "GEO", "Genomics and Bioinformatics Core, Faculty of Health Sciences, University of Macau", 2, 0.93604, 0.93923, 0.01349, 0.01322, 0.76921, 0.77029, 0.4746, 0.4742, 100, 100, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "China", "2017-05-25", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [42469, "SRR5605444", "SRX2858032", "SRS2228756", "SRP108050", "PRJNA388086", "Transcriptomic Analysis for Differentially Expressed Genes in Ovarian Follicle Activation and Puberty Onset in the Zebrafish", "GSE99308", "Transcriptome Analysis", "Puberty is a special transition period in sexual maturation  and it has been extensively studied in vertebrates in the past decades. In mammals  the initiation of puberty involves activation of numerous genes; however  there have been few comprehensive reports in small model teleosts such as the zebrafish. In the zebrafish  the onset of puberty in females is marked by the appearance of the first wave of pre vitellogenic PV follicles in the ovary during sexual maturation.  Using transcriptomics and real time qPCR  this study was undertaken to investigate temporal gene expression differences between the primary growth PG follicles and pre vitellogenic PV follicles  with particular emphasis on oocyte and follicular cell specific genes as well as several closely associated signaling pathways. Our results showed that totally 1082 genes were significantly upregulated and 530 evidently downregulated during the PG PV transition  and among them were some well recognized biomarkers such as cyp19a1a  fshr  inha and inhbaa and some novel genes like notch3  amh  gadd45ga and lpl.  Further gene ontology analysis showed that egg coat formation and steroid hormone mediated signaling pathway might be critical for follicle activation from PG to PV stage. In addition  KEGG identified several signaling pathways that might play pivotal roles in early folliculogenesis  including phosphatidylinositol signaling system  glycolsaminoglycan biosynthesis  RNA transport  and p53 signaling pathways. Overall  this study reported a comprehensive analysis for biomarker genes and potential pathways involved in PG PV transition or follicle activation  which also marks female puberty onset in the zebrafish when occurring for the first time in sexual maturation. Overall design: Examination of gene expression patterns in 2 different stage follicles PG and PV follicles", null, "pubmed:30364302", null, "PG WT2", "GSM2640956", null, "source name:PG WT2|strain:AB|tissue:follicle|developmental stage:primary growth|genotype:WT", "PG WT2", "Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Danio rerio genome version GRCz10 from Ensembl using Tophat2. Parameters:  p 6 StringTie and prepDE.py Python script provided with StringTie tool was used to assemble the alignments into transcripts and extract the raw read counts for reference genomic features respectively. The read count matrix was processed by DeSeq2 package for differential gene expression analysis. Genome build: GRCz10 Ensembl build 84 Supplementary files format and content: PG vs PV rawCounts.csv: Raw read counts for each sample. Supplementary files format and content: PG vs PV normCounts.tab: Normalized read counts for each sample.", "PG WT2", null, "Both PG and PV follicles were isolated and  followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "strain:AB|tissue:follicle|developmental stage:primary growth|genotype:WT", "GSM2640956", "GSM2640956: PG WT2; Danio rerio; RNA Seq", "GSM2640956", null, "1", "Both PG and PV follicles were isolated and  followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM2640956", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP108050", null, null, "PG_WT2_R1.fastq.gz PG_WT2_R2.fastq.gz", "fastq fastq", 3961495355.0, 20078542.0, "GSM2640956 r1", "0:98.66 1:98.64", "A:1001026721;C:972147725;G:960699221;T:1026249480;N:1372208", 98, 98, null, null, 1001026721, 972147725, 960699221, 1026249480, 1372208, "SRX2858032", "SRS2228756", "SRA566530", "GEO", "Genomics and Bioinformatics Core, Faculty of Health Sciences, University of Macau", 2, 0.93922, 0.94298, 0.01416, 0.01405, 0.77029, 0.77106, 0.46461, 0.46358, 100, 100, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "China", "2017-05-25", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [42470, "SRR5605443", "SRX2858031", "SRS2228755", "SRP108050", "PRJNA388086", "Transcriptomic Analysis for Differentially Expressed Genes in Ovarian Follicle Activation and Puberty Onset in the Zebrafish", "GSE99308", "Transcriptome Analysis", "Puberty is a special transition period in sexual maturation  and it has been extensively studied in vertebrates in the past decades. In mammals  the initiation of puberty involves activation of numerous genes; however  there have been few comprehensive reports in small model teleosts such as the zebrafish. In the zebrafish  the onset of puberty in females is marked by the appearance of the first wave of pre vitellogenic PV follicles in the ovary during sexual maturation.  Using transcriptomics and real time qPCR  this study was undertaken to investigate temporal gene expression differences between the primary growth PG follicles and pre vitellogenic PV follicles  with particular emphasis on oocyte and follicular cell specific genes as well as several closely associated signaling pathways. Our results showed that totally 1082 genes were significantly upregulated and 530 evidently downregulated during the PG PV transition  and among them were some well recognized biomarkers such as cyp19a1a  fshr  inha and inhbaa and some novel genes like notch3  amh  gadd45ga and lpl.  Further gene ontology analysis showed that egg coat formation and steroid hormone mediated signaling pathway might be critical for follicle activation from PG to PV stage. In addition  KEGG identified several signaling pathways that might play pivotal roles in early folliculogenesis  including phosphatidylinositol signaling system  glycolsaminoglycan biosynthesis  RNA transport  and p53 signaling pathways. Overall  this study reported a comprehensive analysis for biomarker genes and potential pathways involved in PG PV transition or follicle activation  which also marks female puberty onset in the zebrafish when occurring for the first time in sexual maturation. Overall design: Examination of gene expression patterns in 2 different stage follicles PG and PV follicles", null, "pubmed:30364302", null, "PG WT1", "GSM2640955", null, "source name:PG WT1|strain:AB|tissue:follicle|developmental stage:primary growth|genotype:WT", "PG WT1", "Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Danio rerio genome version GRCz10 from Ensembl using Tophat2. Parameters:  p 6 StringTie and prepDE.py Python script provided with StringTie tool was used to assemble the alignments into transcripts and extract the raw read counts for reference genomic features respectively. The read count matrix was processed by DeSeq2 package for differential gene expression analysis. Genome build: GRCz10 Ensembl build 84 Supplementary files format and content: PG vs PV rawCounts.csv: Raw read counts for each sample. Supplementary files format and content: PG vs PV normCounts.tab: Normalized read counts for each sample.", "PG WT1", null, "Both PG and PV follicles were isolated and  followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "strain:AB|tissue:follicle|developmental stage:primary growth|genotype:WT", "GSM2640955", "GSM2640955: PG WT1; Danio rerio; RNA Seq", "GSM2640955", null, "1", "Both PG and PV follicles were isolated and  followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM2640955", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP108050", null, null, "PG_WT1_R1.fastq.gz PG_WT1_R2.fastq.gz", "fastq fastq", 5007411498.0, 25368266.0, "GSM2640955 r1", "0:98.71 1:98.68", "A:1264491896;C:1228178565;G:1216038846;T:1296988060;N:1714131", 98, 98, null, null, 1264491896, 1228178565, 1216038846, 1296988060, 1714131, "SRX2858031", "SRS2228755", "SRA566530", "GEO", "Genomics and Bioinformatics Core, Faculty of Health Sciences, University of Macau", 2, 0.93858, 0.94172, 0.01418, 0.01395, 0.76871, 0.76995, 0.46608, 0.46312, 100, 99, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "China", "2017-05-25", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [44967, "SRR6345660", "SRX3442976", "SRS2733636", "SRP126106", "PRJNA421016", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]", "GSE107682", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "smRNA seq library of ovary from tdrd6a mut fish", "GSM2875719", null, "source name:Ovary from tdrd6a mut fish|tissue:whole ovary|genotype:tdrd6a mutant", "smRNA seq library of ovary from tdrd6a mut fish", "1. Adapter trimming with cutadapt  O 8  m 26  M 38  a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter   q 20  p 100  Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end  using a custom bash script. 4. UMIs were trimmed with seqtk trimfq  b 4  a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq  L 15\u00a0 6. Mapping was done to Zebrafish  Danio rerio  genome assembly Zv9 with bowtie v0.12.8   tryhard   best   strata   chunkmbs 256  v 1  M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed  bg  split  scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.\u00a0 \u00a0 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE  SINE  LTR and DNA downloaded from the UCSC genome browser repeat masker track  Zv9 using bedtools intersect  a reads  b transposons  wa  wb  bed  f 1.0  nonamecheck to keep both the read and the transposon information. The arguments  s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re  start re  end re  repFamily  repName strand re  and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons  and readlength the length of the read that. Sample is the sample name  and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.\u00a0 Supplementary files format and content: Files ending in .bw are bigwig tracks.", "Ovary from tdrd6a mut fish", null, "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", null, "tissue:whole ovary|genotype:tdrd6a mutant", "GSM2875719", "GSM2875719: smRNA seq library of ovary from tdrd6a mut fish; Danio rerio; ncRNA Seq", "GSM2875719", null, "1", "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", "GEO Accession:GSM2875719", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP126106", null, null, "Tdrd6a-mut-ovary-input-Adult.fastq.gz", "fastq", 817885062.0, 16036962.0, "GSM2875719 r1", "0:51", "A:212456064;C:163491733;G:233627239;T:208262707;N:47319", 51, null, null, null, 212456064, 163491733, 233627239, 208262707, 47319, "SRX3442976", "SRS2733636", "SRA636010", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.46308, null, 0.13668, null, 0.83587, null, 0.79104, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "5prime", "size_fractionation", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2017-12-04", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [44968, "SRR6345659", "SRX3442975", "SRS2733637", "SRP126106", "PRJNA421016", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]", "GSE107682", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "smRNA seq library of ovary from tdrd6a het fish", "GSM2875718", null, "source name:Ovary from tdrd6a het fish|tissue:whole ovary|genotype:tdrd6a heterozygous", "smRNA seq library of ovary from tdrd6a het fish", "1. Adapter trimming with cutadapt  O 8  m 26  M 38  a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter   q 20  p 100  Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end  using a custom bash script. 4. UMIs were trimmed with seqtk trimfq  b 4  a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq  L 15\u00a0 6. Mapping was done to Zebrafish  Danio rerio  genome assembly Zv9 with bowtie v0.12.8   tryhard   best   strata   chunkmbs 256  v 1  M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed  bg  split  scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.\u00a0 \u00a0 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE  SINE  LTR and DNA downloaded from the UCSC genome browser repeat masker track  Zv9 using bedtools intersect  a reads  b transposons  wa  wb  bed  f 1.0  nonamecheck to keep both the read and the transposon information. The arguments  s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re  start re  end re  repFamily  repName strand re  and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons  and readlength the length of the read that. Sample is the sample name  and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.\u00a0 Supplementary files format and content: Files ending in .bw are bigwig tracks.", "Ovary from tdrd6a het fish", null, "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", null, "tissue:whole ovary|genotype:tdrd6a heterozygous", "GSM2875718", "GSM2875718: smRNA seq library of ovary from tdrd6a het fish; Danio rerio; ncRNA Seq", "GSM2875718", null, "1", "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", "GEO Accession:GSM2875718", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP126106", null, null, "Tdrd6a-het-ovary-input-Adult.fastq.gz", "fastq", 1452353571.0, 28477521.0, "GSM2875718 r1", "0:51", "A:397993735;C:284194126;G:396142390;T:373939235;N:84085", 51, null, null, null, 397993735, 284194126, 396142390, 373939235, 84085, "SRX3442975", "SRS2733637", "SRA636010", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.3869, null, 0.1369, null, 0.86397, null, 0.77165, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "5prime", "size_fractionation", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2017-12-04", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [47717, "SRR6841472", "SRX3797301", "SRS3049359", "SRP135774", "PRJNA438478", "RNAseq of wild type zebrafish germline ovary  oocyte  testis", "GSE111882", "Transcriptome Analysis", "Goal of this study is the gene expression analysis of the zebrafish adult germline ovary  oocyte  testis Overall design: Three tissue types ovary  oocyte  testis from adult wildtype TLAB zebrafish; two replicates each", null, "pubmed:30190407;pubmed:34556579", null, "testis rep2", "GSM3043290", null, "source name:whole wildtype zebrafish testis dissected from male|tissue:testis|genotype:wild type|strain:TLAB", "testis rep2", "Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10  using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859   strand; CDS = chr18:50858285 50858663    strand. The following command was used to map each sample: \u2018tophat   o <output directory>  p 16\u00a0  library type fr firststrand \u2013no novel juncs\u00a0\u2013g 1\u00a0\u2013G <Custom gene table> <Bowtie2 genome index> <fastq reads>\u201d.\u00a0 Quantification of transcript levels FPKM was determined using cuffnorm\u00a0with the following command \u201ccuffnorm  p 22   library type=fr firststrand  L < labels >  o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs", "whole wildtype zebrafish testis dissected from male", null, "Total RNA was isolated using the standard TRIzol Invitrogen protocol  and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle until point of sample collection.", "tissue:testis|genotype:wild type|strain:TLAB", "GSM3043290", "GSM3043290: testis rep2; Danio rerio; RNA Seq", "GSM3043290", null, "1", "Total RNA was isolated using the standard TRIzol Invitrogen protocol  and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.", "GEO Accession:GSM3043290", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP135774", null, null, "zf_testis_2_5_F.fq.gz zf_testis_2_5_R.fq.gz", "fastq fastq", 5099627816.0, 33550183.0, "GSM3043290 r1", "0:76 1:76", "A:1299059138;C:1244888565;G:1262375980;T:1289309350;N:3994783", 76, 76, null, null, 1299059138, 1244888565, 1262375980, 1289309350, 3994783, "SRX3797301", "SRS3049359", "SRA666799", "GEO", "IMP", 2, 0.95446, 0.95725, 0.13178, 0.13422, 0.73578, 0.74255, 0.50147, 0.50146, 76, 76, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Austria", "2018-03-15", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [47718, "SRR6841473", "SRX3797301", "SRS3049359", "SRP135774", "PRJNA438478", "RNAseq of wild type zebrafish germline ovary  oocyte  testis", "GSE111882", "Transcriptome Analysis", "Goal of this study is the gene expression analysis of the zebrafish adult germline ovary  oocyte  testis Overall design: Three tissue types ovary  oocyte  testis from adult wildtype TLAB zebrafish; two replicates each", null, "pubmed:30190407;pubmed:34556579", null, "testis rep2", "GSM3043290", null, "source name:whole wildtype zebrafish testis dissected from male|tissue:testis|genotype:wild type|strain:TLAB", "testis rep2", "Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10  using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859   strand; CDS = chr18:50858285 50858663    strand. The following command was used to map each sample: \u2018tophat   o <output directory>  p 16\u00a0  library type fr firststrand \u2013no novel juncs\u00a0\u2013g 1\u00a0\u2013G <Custom gene table> <Bowtie2 genome index> <fastq reads>\u201d.\u00a0 Quantification of transcript levels FPKM was determined using cuffnorm\u00a0with the following command \u201ccuffnorm  p 22   library type=fr firststrand  L < labels >  o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs", "whole wildtype zebrafish testis dissected from male", null, "Total RNA was isolated using the standard TRIzol Invitrogen protocol  and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle until point of sample collection.", "tissue:testis|genotype:wild type|strain:TLAB", "GSM3043290", "GSM3043290: testis rep2; Danio rerio; RNA Seq", "GSM3043290", null, "1", "Total RNA was isolated using the standard TRIzol Invitrogen protocol  and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.", "GEO Accession:GSM3043290", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP135774", null, null, "zf_testis_2_6_R.fq.gz zf_testis_2_6_F.fq.gz", "fastq fastq", 4863124784.0, 31994242.0, "GSM3043290 r2", "0:76 1:76", "A:1239366804;C:1186097287;G:1202405036;T:1232271257;N:2984400", 76, 76, null, null, 1239366804, 1186097287, 1202405036, 1232271257, 2984400, "SRX3797301", "SRS3049359", "SRA666799", "GEO", "IMP", 2, 0.94462, 0.95606, 0.13046, 0.13473, 0.73551, 0.74063, 0.50501, 0.50288, 76, 76, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Austria", "2018-03-15", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [47719, "SRR6841474", "SRX3797301", "SRS3049359", "SRP135774", "PRJNA438478", "RNAseq of wild type zebrafish germline ovary  oocyte  testis", "GSE111882", "Transcriptome Analysis", "Goal of this study is the gene expression analysis of the zebrafish adult germline ovary  oocyte  testis Overall design: Three tissue types ovary  oocyte  testis from adult wildtype TLAB zebrafish; two replicates each", null, "pubmed:30190407;pubmed:34556579", null, "testis rep2", "GSM3043290", null, "source name:whole wildtype zebrafish testis dissected from male|tissue:testis|genotype:wild type|strain:TLAB", "testis rep2", "Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10  using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859   strand; CDS = chr18:50858285 50858663    strand. The following command was used to map each sample: \u2018tophat   o <output directory>  p 16\u00a0  library type fr firststrand \u2013no novel juncs\u00a0\u2013g 1\u00a0\u2013G <Custom gene table> <Bowtie2 genome index> <fastq reads>\u201d.\u00a0 Quantification of transcript levels FPKM was determined using cuffnorm\u00a0with the following command \u201ccuffnorm  p 22   library type=fr firststrand  L < labels >  o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs", "whole wildtype zebrafish testis dissected from male", null, "Total RNA was isolated using the standard TRIzol Invitrogen protocol  and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle until point of sample collection.", "tissue:testis|genotype:wild type|strain:TLAB", "GSM3043290", "GSM3043290: testis rep2; Danio rerio; RNA Seq", "GSM3043290", null, "1", "Total RNA was isolated using the standard TRIzol Invitrogen protocol  and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.", "GEO Accession:GSM3043290", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP135774", null, null, "zf_testis_2_7_F.fq.gz zf_testis_2_7_R.fq.gz", "fastq fastq", 5026658088.0, 33070119.0, "GSM3043290 r3", "0:76 1:76", "A:1279542888;C:1226763768;G:1244243364;T:1271608208;N:4499860", 76, 76, null, null, 1279542888, 1226763768, 1244243364, 1271608208, 4499860, "SRX3797301", "SRS3049359", "SRA666799", "GEO", "IMP", 2, 0.94351, 0.95825, 0.12954, 0.1332, 0.73645, 0.7413, 0.50092, 0.49891, 76, 76, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Austria", "2018-03-15", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [47720, "SRR6841469", "SRX3797300", "SRS3049358", "SRP135774", "PRJNA438478", "RNAseq of wild type zebrafish germline ovary  oocyte  testis", "GSE111882", "Transcriptome Analysis", "Goal of this study is the gene expression analysis of the zebrafish adult germline ovary  oocyte  testis Overall design: Three tissue types ovary  oocyte  testis from adult wildtype TLAB zebrafish; two replicates each", null, "pubmed:30190407;pubmed:34556579", null, "testis rep1", "GSM3043289", null, "source name:whole wildtype zebrafish testis dissected from male|tissue:testis|genotype:wild type|strain:TLAB", "testis rep1", "Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10  using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859   strand; CDS = chr18:50858285 50858663    strand. The following command was used to map each sample: \u2018tophat   o <output directory>  p 16\u00a0  library type fr firststrand \u2013no novel juncs\u00a0\u2013g 1\u00a0\u2013G <Custom gene table> <Bowtie2 genome index> <fastq reads>\u201d.\u00a0 Quantification of transcript levels FPKM was determined using cuffnorm\u00a0with the following command \u201ccuffnorm  p 22   library type=fr firststrand  L < labels >  o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs", "whole wildtype zebrafish testis dissected from male", null, "Total RNA was isolated using the standard TRIzol Invitrogen protocol  and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle until point of sample collection.", "tissue:testis|genotype:wild type|strain:TLAB", "GSM3043289", "GSM3043289: testis rep1; Danio rerio; RNA Seq", "GSM3043289", null, "1", "Total RNA was isolated using the standard TRIzol Invitrogen protocol  and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.", "GEO Accession:GSM3043289", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP135774", null, null, "zf_testis_1_5_F.fq.gz zf_testis_1_5_R.fq.gz", "fastq fastq", 5828604008.0, 38346079.0, "GSM3043289 r1", "0:76 1:76", "A:1496363417;C:1405966872;G:1430979231;T:1490547871;N:4746617", 76, 76, null, null, 1496363417, 1405966872, 1430979231, 1490547871, 4746617, "SRX3797300", "SRS3049358", "SRA666799", "GEO", "IMP", 2, 0.95085, 0.95291, 0.13996, 0.1422, 0.70873, 0.71662, 0.5006, 0.50954, 76, 76, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Austria", "2018-03-15", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [47721, "SRR6841470", "SRX3797300", "SRS3049358", "SRP135774", "PRJNA438478", "RNAseq of wild type zebrafish germline ovary  oocyte  testis", "GSE111882", "Transcriptome Analysis", "Goal of this study is the gene expression analysis of the zebrafish adult germline ovary  oocyte  testis Overall design: Three tissue types ovary  oocyte  testis from adult wildtype TLAB zebrafish; two replicates each", null, "pubmed:30190407;pubmed:34556579", null, "testis rep1", "GSM3043289", null, "source name:whole wildtype zebrafish testis dissected from male|tissue:testis|genotype:wild type|strain:TLAB", "testis rep1", "Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10  using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859   strand; CDS = chr18:50858285 50858663    strand. The following command was used to map each sample: \u2018tophat   o <output directory>  p 16\u00a0  library type fr firststrand \u2013no novel juncs\u00a0\u2013g 1\u00a0\u2013G <Custom gene table> <Bowtie2 genome index> <fastq reads>\u201d.\u00a0 Quantification of transcript levels FPKM was determined using cuffnorm\u00a0with the following command \u201ccuffnorm  p 22   library type=fr firststrand  L < labels >  o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs", "whole wildtype zebrafish testis dissected from male", null, "Total RNA was isolated using the standard TRIzol Invitrogen protocol  and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle until point of sample collection.", "tissue:testis|genotype:wild type|strain:TLAB", "GSM3043289", "GSM3043289: testis rep1; Danio rerio; RNA Seq", "GSM3043289", null, "1", "Total RNA was isolated using the standard TRIzol Invitrogen protocol  and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.", "GEO Accession:GSM3043289", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP135774", null, null, "zf_testis_1_6_F.fq.gz zf_testis_1_6_R.fq.gz", "fastq fastq", 5548288344.0, 36501897.0, "GSM3043289 r2", "0:76 1:76", "A:1424701888;C:1337280760;G:1360693266;T:1422058469;N:3553961", 76, 76, null, null, 1424701888, 1337280760, 1360693266, 1422058469, 3553961, "SRX3797300", "SRS3049358", "SRA666799", "GEO", "IMP", 2, 0.93973, 0.95206, 0.13904, 0.14259, 0.70999, 0.7177, 0.49362, 0.50295, 76, 76, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Austria", "2018-03-15", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [47722, "SRR6841471", "SRX3797300", "SRS3049358", "SRP135774", "PRJNA438478", "RNAseq of wild type zebrafish germline ovary  oocyte  testis", "GSE111882", "Transcriptome Analysis", "Goal of this study is the gene expression analysis of the zebrafish adult germline ovary  oocyte  testis Overall design: Three tissue types ovary  oocyte  testis from adult wildtype TLAB zebrafish; two replicates each", null, "pubmed:30190407;pubmed:34556579", null, "testis rep1", "GSM3043289", null, "source name:whole wildtype zebrafish testis dissected from male|tissue:testis|genotype:wild type|strain:TLAB", "testis rep1", "Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10  using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859   strand; CDS = chr18:50858285 50858663    strand. The following command was used to map each sample: \u2018tophat   o <output directory>  p 16\u00a0  library type fr firststrand \u2013no novel juncs\u00a0\u2013g 1\u00a0\u2013G <Custom gene table> <Bowtie2 genome index> <fastq reads>\u201d.\u00a0 Quantification of transcript levels FPKM was determined using cuffnorm\u00a0with the following command \u201ccuffnorm  p 22   library type=fr firststrand  L < labels >  o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs", "whole wildtype zebrafish testis dissected from male", null, "Total RNA was isolated using the standard TRIzol Invitrogen protocol  and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle until point of sample collection.", "tissue:testis|genotype:wild type|strain:TLAB", "GSM3043289", "GSM3043289: testis rep1; Danio rerio; RNA Seq", "GSM3043289", null, "1", "Total RNA was isolated using the standard TRIzol Invitrogen protocol  and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.", "GEO Accession:GSM3043289", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP135774", null, null, "zf_testis_1_7_F.fq.gz zf_testis_1_7_R.fq.gz", "fastq fastq", 5685121784.0, 37402117.0, "GSM3043289 r3", "0:76 1:76", "A:1458152144;C:1370999956;G:1396053726;T:1454648231;N:5267727", 76, 76, null, null, 1458152144, 1370999956, 1396053726, 1454648231, 5267727, "SRX3797300", "SRS3049358", "SRA666799", "GEO", "IMP", 2, 0.9388, 0.95443, 0.13734, 0.14167, 0.70759, 0.71593, 0.49681, 0.50673, 76, 76, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Austria", "2018-03-15", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [47729, "SRR6841460", "SRX3797297", "SRS3049356", "SRP135774", "PRJNA438478", "RNAseq of wild type zebrafish germline ovary  oocyte  testis", "GSE111882", "Transcriptome Analysis", "Goal of this study is the gene expression analysis of the zebrafish adult germline ovary  oocyte  testis Overall design: Three tissue types ovary  oocyte  testis from adult wildtype TLAB zebrafish; two replicates each", null, "pubmed:30190407;pubmed:34556579", null, "ovary rep2", "GSM3043286", null, "source name:whole wildtype zebrafish ovary dissected from female|tissue:ovary|genotype:wild type|strain:TLAB", "ovary rep2", "Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10  using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859   strand; CDS = chr18:50858285 50858663    strand. The following command was used to map each sample: \u2018tophat   o <output directory>  p 16\u00a0  library type fr firststrand \u2013no novel juncs\u00a0\u2013g 1\u00a0\u2013G <Custom gene table> <Bowtie2 genome index> <fastq reads>\u201d.\u00a0 Quantification of transcript levels FPKM was determined using cuffnorm\u00a0with the following command \u201ccuffnorm  p 22   library type=fr firststrand  L < labels >  o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs", "whole wildtype zebrafish ovary dissected from female", null, "Total RNA was isolated using the standard TRIzol Invitrogen protocol  and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle until point of sample collection.", "tissue:ovary|genotype:wild type|strain:TLAB", "GSM3043286", "GSM3043286: ovary rep2; Danio rerio; RNA Seq", "GSM3043286", null, "1", "Total RNA was isolated using the standard TRIzol Invitrogen protocol  and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.", "GEO Accession:GSM3043286", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP135774", null, null, "zf_ovary_2_5_R.fq.gz zf_ovary_2_5_F.fq.gz", "fastq fastq", 5760370600.0, 37897175.0, "GSM3043286 r1", "0:76 1:76", "A:1438701176;C:1432115027;G:1438947886;T:1446014914;N:4591597", 76, 76, null, null, 1438701176, 1432115027, 1438947886, 1446014914, 4591597, "SRX3797297", "SRS3049356", "SRA666799", "GEO", "IMP", 2, 0.93588, 0.94232, 0.0501, 0.05082, 0.79527, 0.79955, 0.49845, 0.49442, 76, 76, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Austria", "2018-03-15", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [47730, "SRR6841461", "SRX3797297", "SRS3049356", "SRP135774", "PRJNA438478", "RNAseq of wild type zebrafish germline ovary  oocyte  testis", "GSE111882", "Transcriptome Analysis", "Goal of this study is the gene expression analysis of the zebrafish adult germline ovary  oocyte  testis Overall design: Three tissue types ovary  oocyte  testis from adult wildtype TLAB zebrafish; two replicates each", null, "pubmed:30190407;pubmed:34556579", null, "ovary rep2", "GSM3043286", null, "source name:whole wildtype zebrafish ovary dissected from female|tissue:ovary|genotype:wild type|strain:TLAB", "ovary rep2", "Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10  using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859   strand; CDS = chr18:50858285 50858663    strand. The following command was used to map each sample: \u2018tophat   o <output directory>  p 16\u00a0  library type fr firststrand \u2013no novel juncs\u00a0\u2013g 1\u00a0\u2013G <Custom gene table> <Bowtie2 genome index> <fastq reads>\u201d.\u00a0 Quantification of transcript levels FPKM was determined using cuffnorm\u00a0with the following command \u201ccuffnorm  p 22   library type=fr firststrand  L < labels >  o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs", "whole wildtype zebrafish ovary dissected from female", null, "Total RNA was isolated using the standard TRIzol Invitrogen protocol  and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle until point of sample collection.", "tissue:ovary|genotype:wild type|strain:TLAB", "GSM3043286", "GSM3043286: ovary rep2; Danio rerio; RNA Seq", "GSM3043286", null, "1", "Total RNA was isolated using the standard TRIzol Invitrogen protocol  and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.", "GEO Accession:GSM3043286", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP135774", null, null, "zf_ovary_2_6_F.fq.gz zf_ovary_2_6_R.fq.gz", "fastq fastq", 5494881168.0, 36150534.0, "GSM3043286 r2", "0:76 1:76", "A:1372809163;C:1365261188;G:1371912460;T:1381448918;N:3449439", 76, 76, null, null, 1372809163, 1365261188, 1371912460, 1381448918, 3449439, "SRX3797297", "SRS3049356", "SRA666799", "GEO", "IMP", 2, 0.93073, 0.94077, 0.04966, 0.05048, 0.79774, 0.80014, 0.49517, 0.49843, 76, 76, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Austria", "2018-03-15", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [47731, "SRR6841462", "SRX3797297", "SRS3049356", "SRP135774", "PRJNA438478", "RNAseq of wild type zebrafish germline ovary  oocyte  testis", "GSE111882", "Transcriptome Analysis", "Goal of this study is the gene expression analysis of the zebrafish adult germline ovary  oocyte  testis Overall design: Three tissue types ovary  oocyte  testis from adult wildtype TLAB zebrafish; two replicates each", null, "pubmed:30190407;pubmed:34556579", null, "ovary rep2", "GSM3043286", null, "source name:whole wildtype zebrafish ovary dissected from female|tissue:ovary|genotype:wild type|strain:TLAB", "ovary rep2", "Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10  using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859   strand; CDS = chr18:50858285 50858663    strand. The following command was used to map each sample: \u2018tophat   o <output directory>  p 16\u00a0  library type fr firststrand \u2013no novel juncs\u00a0\u2013g 1\u00a0\u2013G <Custom gene table> <Bowtie2 genome index> <fastq reads>\u201d.\u00a0 Quantification of transcript levels FPKM was determined using cuffnorm\u00a0with the following command \u201ccuffnorm  p 22   library type=fr firststrand  L < labels >  o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs", "whole wildtype zebrafish ovary dissected from female", null, "Total RNA was isolated using the standard TRIzol Invitrogen protocol  and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle until point of sample collection.", "tissue:ovary|genotype:wild type|strain:TLAB", "GSM3043286", "GSM3043286: ovary rep2; Danio rerio; RNA Seq", "GSM3043286", null, "1", "Total RNA was isolated using the standard TRIzol Invitrogen protocol  and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.", "GEO Accession:GSM3043286", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP135774", null, null, "zf_ovary_2_7_F.fq.gz zf_ovary_2_7_R.fq.gz", "fastq fastq", 5666410584.0, 37279017.0, "GSM3043286 r3", "0:76 1:76", "A:1414483905;C:1408220336;G:1415545424;T:1423029758;N:5131161", 76, 76, null, null, 1414483905, 1408220336, 1415545424, 1423029758, 5131161, "SRX3797297", "SRS3049356", "SRA666799", "GEO", "IMP", 2, 0.9299, 0.94287, 0.04893, 0.04939, 0.7974, 0.80135, 0.49935, 0.49202, 76, 76, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Austria", "2018-03-15", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [47732, "SRR6841457", "SRX3797296", "SRS3049354", "SRP135774", "PRJNA438478", "RNAseq of wild type zebrafish germline ovary  oocyte  testis", "GSE111882", "Transcriptome Analysis", "Goal of this study is the gene expression analysis of the zebrafish adult germline ovary  oocyte  testis Overall design: Three tissue types ovary  oocyte  testis from adult wildtype TLAB zebrafish; two replicates each", null, "pubmed:30190407;pubmed:34556579", null, "ovary rep1", "GSM3043285", null, "source name:whole wildtype zebrafish ovary dissected from female|tissue:ovary|genotype:wild type|strain:TLAB", "ovary rep1", "Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10  using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859   strand; CDS = chr18:50858285 50858663    strand. The following command was used to map each sample: \u2018tophat   o <output directory>  p 16\u00a0  library type fr firststrand \u2013no novel juncs\u00a0\u2013g 1\u00a0\u2013G <Custom gene table> <Bowtie2 genome index> <fastq reads>\u201d.\u00a0 Quantification of transcript levels FPKM was determined using cuffnorm\u00a0with the following command \u201ccuffnorm  p 22   library type=fr firststrand  L < labels >  o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs", "whole wildtype zebrafish ovary dissected from female", null, "Total RNA was isolated using the standard TRIzol Invitrogen protocol  and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle until point of sample collection.", "tissue:ovary|genotype:wild type|strain:TLAB", "GSM3043285", "GSM3043285: ovary rep1; Danio rerio; RNA Seq", "GSM3043285", null, "1", "Total RNA was isolated using the standard TRIzol Invitrogen protocol  and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.", "GEO Accession:GSM3043285", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP135774", null, null, "zf_ovary_1_5_R.fq.gz zf_ovary_1_5_F.fq.gz", "fastq fastq", 6093708728.0, 40090189.0, "GSM3043285 r1", "0:76 1:76", "A:1532089324;C:1504701252;G:1515053503;T:1536814286;N:5050363", 76, 76, null, null, 1532089324, 1504701252, 1515053503, 1536814286, 5050363, "SRX3797296", "SRS3049354", "SRA666799", "GEO", "IMP", 2, 0.93785, 0.9429, 0.0338, 0.03321, 0.78628, 0.7903, 0.48856, 0.47641, 76, 76, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Austria", "2018-03-15", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [47733, "SRR6841458", "SRX3797296", "SRS3049354", "SRP135774", "PRJNA438478", "RNAseq of wild type zebrafish germline ovary  oocyte  testis", "GSE111882", "Transcriptome Analysis", "Goal of this study is the gene expression analysis of the zebrafish adult germline ovary  oocyte  testis Overall design: Three tissue types ovary  oocyte  testis from adult wildtype TLAB zebrafish; two replicates each", null, "pubmed:30190407;pubmed:34556579", null, "ovary rep1", "GSM3043285", null, "source name:whole wildtype zebrafish ovary dissected from female|tissue:ovary|genotype:wild type|strain:TLAB", "ovary rep1", "Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10  using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859   strand; CDS = chr18:50858285 50858663    strand. The following command was used to map each sample: \u2018tophat   o <output directory>  p 16\u00a0  library type fr firststrand \u2013no novel juncs\u00a0\u2013g 1\u00a0\u2013G <Custom gene table> <Bowtie2 genome index> <fastq reads>\u201d.\u00a0 Quantification of transcript levels FPKM was determined using cuffnorm\u00a0with the following command \u201ccuffnorm  p 22   library type=fr firststrand  L < labels >  o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs", "whole wildtype zebrafish ovary dissected from female", null, "Total RNA was isolated using the standard TRIzol Invitrogen protocol  and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle until point of sample collection.", "tissue:ovary|genotype:wild type|strain:TLAB", "GSM3043285", "GSM3043285: ovary rep1; Danio rerio; RNA Seq", "GSM3043285", null, "1", "Total RNA was isolated using the standard TRIzol Invitrogen protocol  and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.", "GEO Accession:GSM3043285", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP135774", null, null, "zf_ovary_1_6_R.fq.gz zf_ovary_1_6_F.fq.gz", "fastq fastq", 5797092432.0, 38138766.0, "GSM3043285 r2", "0:76 1:76", "A:1457841031;C:1430894241;G:1440413370;T:1464148562;N:3795228", 76, 76, null, null, 1457841031, 1430894241, 1440413370, 1464148562, 3795228, "SRX3797296", "SRS3049354", "SRA666799", "GEO", "IMP", 2, 0.93123, 0.94187, 0.03345, 0.03344, 0.78616, 0.78991, 0.48359, 0.48306, 76, 76, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Austria", "2018-03-15", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [47734, "SRR6841459", "SRX3797296", "SRS3049354", "SRP135774", "PRJNA438478", "RNAseq of wild type zebrafish germline ovary  oocyte  testis", "GSE111882", "Transcriptome Analysis", "Goal of this study is the gene expression analysis of the zebrafish adult germline ovary  oocyte  testis Overall design: Three tissue types ovary  oocyte  testis from adult wildtype TLAB zebrafish; two replicates each", null, "pubmed:30190407;pubmed:34556579", null, "ovary rep1", "GSM3043285", null, "source name:whole wildtype zebrafish ovary dissected from female|tissue:ovary|genotype:wild type|strain:TLAB", "ovary rep1", "Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10  using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859   strand; CDS = chr18:50858285 50858663    strand. The following command was used to map each sample: \u2018tophat   o <output directory>  p 16\u00a0  library type fr firststrand \u2013no novel juncs\u00a0\u2013g 1\u00a0\u2013G <Custom gene table> <Bowtie2 genome index> <fastq reads>\u201d.\u00a0 Quantification of transcript levels FPKM was determined using cuffnorm\u00a0with the following command \u201ccuffnorm  p 22   library type=fr firststrand  L < labels >  o <output directory> <Custom gene table> <aligned reads.bam file>. Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs", "whole wildtype zebrafish ovary dissected from female", null, "Total RNA was isolated using the standard TRIzol Invitrogen protocol  and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle until point of sample collection.", "tissue:ovary|genotype:wild type|strain:TLAB", "GSM3043285", "GSM3043285: ovary rep1; Danio rerio; RNA Seq", "GSM3043285", null, "1", "Total RNA was isolated using the standard TRIzol Invitrogen protocol  and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.", "GEO Accession:GSM3043285", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP135774", null, null, "zf_ovary_1_7_R.fq.gz zf_ovary_1_7_F.fq.gz", "fastq fastq", 5924015928.0, 38973789.0, "GSM3043285 r3", "0:76 1:76", "A:1488452513;C:1462498287;G:1473066232;T:1494401585;N:5597311", 76, 76, null, null, 1488452513, 1462498287, 1473066232, 1494401585, 5597311, "SRX3797296", "SRS3049354", "SRA666799", "GEO", "IMP", 2, 0.93218, 0.94439, 0.03341, 0.03312, 0.78715, 0.79172, 0.48512, 0.48267, 76, 76, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Austria", "2018-03-15", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [52326, "SRR9119512", "SRX5893495", "SRS4815090", "SRP199448", "PRJNA544696", "Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells", "GSE131759", "Transcriptome Analysis", "MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus  pituitary  and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH  which in turn  induces the secretion of maturation inducing hormone MIH from the ovary.  It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid  to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature.  To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles  we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing.  It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore  bioinformatics analysis revealed the presence of 214 known  31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated  and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs  dre miR 22a 3p  dre miR 16a  dre miR 181a 3p  and dre miR 29a  was validated by real time PCR. Finally  gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function  including oocyte maturation. Taken together  this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles.  The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.", null, "pubmed:31417497", null, "IIIb 3", "GSM3816534", null, "source name:stage IIIb follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIb", "IIIb 3", "LC Sciences in house program ACGT101 miR program  was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences  Houston  Texas  USA. Adaptor dimers  junk  low complexity  common RNA families and repeats were removed  and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure  whose genomic coordinates should not overlap with known pre miRNAs included in this analysis  were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample", "stage IIIb follicular cells", null, "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:ovary|cell type:follicular cells|developmental stage:IIIb", "GSM3816534", "GSM3816534: IIIb 3; Danio rerio; miRNA Seq", "GSM3816534", null, "1", "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3816534", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP199448", null, null, "HI.2030.005.RPI10.IIIb_3_R1.fastq.gz", "fastq", 1449340900.0, 28986818.0, "GSM3816534 r1", "0:50 1:0", "A:351029701;C:324452324;G:401722902;T:371889768;N:246205", 50, 0, null, null, 351029701, 324452324, 401722902, 371889768, 246205, "SRX5893495", "SRS4815090", "SRA890399", "GEO", "Biology, YorkU", 1, 0.08662, null, 0.01333, null, 0.96213, null, 0.83838, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-05-24", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [52327, "SRR9119513", "SRX5893495", "SRS4815090", "SRP199448", "PRJNA544696", "Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells", "GSE131759", "Transcriptome Analysis", "MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus  pituitary  and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH  which in turn  induces the secretion of maturation inducing hormone MIH from the ovary.  It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid  to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature.  To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles  we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing.  It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore  bioinformatics analysis revealed the presence of 214 known  31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated  and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs  dre miR 22a 3p  dre miR 16a  dre miR 181a 3p  and dre miR 29a  was validated by real time PCR. Finally  gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function  including oocyte maturation. Taken together  this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles.  The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.", null, "pubmed:31417497", null, "IIIb 3", "GSM3816534", null, "source name:stage IIIb follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIb", "IIIb 3", "LC Sciences in house program ACGT101 miR program  was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences  Houston  Texas  USA. Adaptor dimers  junk  low complexity  common RNA families and repeats were removed  and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure  whose genomic coordinates should not overlap with known pre miRNAs included in this analysis  were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample", "stage IIIb follicular cells", null, "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:ovary|cell type:follicular cells|developmental stage:IIIb", "GSM3816534", "GSM3816534: IIIb 3; Danio rerio; miRNA Seq", "GSM3816534", null, "1", "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3816534", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP199448", null, null, "HI.2030.006.RPI10.IIIb_3_R1.fastq", "fastq", 1447621100.0, 28952422.0, "GSM3816534 r2", "0:50 1:0", "A:350650304;C:324162528;G:401055729;T:371582418;N:170121", 50, 0, null, null, 350650304, 324162528, 401055729, 371582418, 170121, "SRX5893495", "SRS4815090", "SRA890399", "GEO", "Biology, YorkU", 1, 0.08676, null, 0.01312, null, 0.96282, null, 0.84604, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-05-24", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [52328, "SRR9119510", "SRX5893494", "SRS4815089", "SRP199448", "PRJNA544696", "Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells", "GSE131759", "Transcriptome Analysis", "MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus  pituitary  and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH  which in turn  induces the secretion of maturation inducing hormone MIH from the ovary.  It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid  to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature.  To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles  we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing.  It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore  bioinformatics analysis revealed the presence of 214 known  31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated  and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs  dre miR 22a 3p  dre miR 16a  dre miR 181a 3p  and dre miR 29a  was validated by real time PCR. Finally  gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function  including oocyte maturation. Taken together  this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles.  The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.", null, "pubmed:31417497", null, "IIIb 2", "GSM3816533", null, "source name:stage IIIb follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIb", "IIIb 2", "LC Sciences in house program ACGT101 miR program  was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences  Houston  Texas  USA. Adaptor dimers  junk  low complexity  common RNA families and repeats were removed  and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure  whose genomic coordinates should not overlap with known pre miRNAs included in this analysis  were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample", "stage IIIb follicular cells", null, "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:ovary|cell type:follicular cells|developmental stage:IIIb", "GSM3816533", "GSM3816533: IIIb 2; Danio rerio; miRNA Seq", "GSM3816533", null, "1", "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3816533", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP199448", null, null, "HI.2030.005.RPI9.IIIb_2_R1.fastq.gz", "fastq", 1012538750.0, 20250775.0, "GSM3816533 r1", "0:50 1:0", "A:242873339;C:228078637;G:287889366;T:253526026;N:171382", 50, 0, null, null, 242873339, 228078637, 287889366, 253526026, 171382, "SRX5893494", "SRS4815089", "SRA890399", "GEO", "Biology, YorkU", 1, 0.04745, null, 0.00802, null, 0.968, null, 0.75298, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-05-24", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [52329, "SRR9119511", "SRX5893494", "SRS4815089", "SRP199448", "PRJNA544696", "Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells", "GSE131759", "Transcriptome Analysis", "MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus  pituitary  and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH  which in turn  induces the secretion of maturation inducing hormone MIH from the ovary.  It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid  to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature.  To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles  we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing.  It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore  bioinformatics analysis revealed the presence of 214 known  31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated  and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs  dre miR 22a 3p  dre miR 16a  dre miR 181a 3p  and dre miR 29a  was validated by real time PCR. Finally  gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function  including oocyte maturation. Taken together  this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles.  The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.", null, "pubmed:31417497", null, "IIIb 2", "GSM3816533", null, "source name:stage IIIb follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIb", "IIIb 2", "LC Sciences in house program ACGT101 miR program  was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences  Houston  Texas  USA. Adaptor dimers  junk  low complexity  common RNA families and repeats were removed  and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure  whose genomic coordinates should not overlap with known pre miRNAs included in this analysis  were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample", "stage IIIb follicular cells", null, "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:ovary|cell type:follicular cells|developmental stage:IIIb", "GSM3816533", "GSM3816533: IIIb 2; Danio rerio; miRNA Seq", "GSM3816533", null, "1", "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3816533", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP199448", null, null, "HI.2030.006.RPI9.IIIb_2_R1.fastq", "fastq", 1010559400.0, 20211188.0, "GSM3816533 r2", "0:50 1:0", "A:242471282;C:227664296;G:287157957;T:253147388;N:118477", 50, 0, null, null, 242471282, 227664296, 287157957, 253147388, 118477, "SRX5893494", "SRS4815089", "SRA890399", "GEO", "Biology, YorkU", 1, 0.04679, null, 0.008, null, 0.96946, null, 0.71268, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-05-24", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [52330, "SRR9119508", "SRX5893493", "SRS4815088", "SRP199448", "PRJNA544696", "Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells", "GSE131759", "Transcriptome Analysis", "MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus  pituitary  and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH  which in turn  induces the secretion of maturation inducing hormone MIH from the ovary.  It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid  to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature.  To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles  we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing.  It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore  bioinformatics analysis revealed the presence of 214 known  31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated  and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs  dre miR 22a 3p  dre miR 16a  dre miR 181a 3p  and dre miR 29a  was validated by real time PCR. Finally  gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function  including oocyte maturation. Taken together  this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles.  The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.", null, "pubmed:31417497", null, "IIIb 1", "GSM3816532", null, "source name:stage IIIb follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIb", "IIIb 1", "LC Sciences in house program ACGT101 miR program  was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences  Houston  Texas  USA. Adaptor dimers  junk  low complexity  common RNA families and repeats were removed  and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure  whose genomic coordinates should not overlap with known pre miRNAs included in this analysis  were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample", "stage IIIb follicular cells", null, "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:ovary|cell type:follicular cells|developmental stage:IIIb", "GSM3816532", "GSM3816532: IIIb 1; Danio rerio; miRNA Seq", "GSM3816532", null, "1", "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3816532", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP199448", null, null, "HI.2030.005.RPI8.IIIb_1_R1.fastq.gz", "fastq", 1443846950.0, 28876939.0, "GSM3816532 r1", "0:50 1:0", "A:350805103;C:319766230;G:407583206;T:365448522;N:243889", 50, 0, null, null, 350805103, 319766230, 407583206, 365448522, 243889, "SRX5893493", "SRS4815088", "SRA890399", "GEO", "Biology, YorkU", 1, 0.02559, null, 0.00389, null, 0.98407, null, 0.82023, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-05-24", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [52331, "SRR9119509", "SRX5893493", "SRS4815088", "SRP199448", "PRJNA544696", "Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells", "GSE131759", "Transcriptome Analysis", "MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus  pituitary  and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH  which in turn  induces the secretion of maturation inducing hormone MIH from the ovary.  It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid  to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature.  To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles  we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing.  It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore  bioinformatics analysis revealed the presence of 214 known  31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated  and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs  dre miR 22a 3p  dre miR 16a  dre miR 181a 3p  and dre miR 29a  was validated by real time PCR. Finally  gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function  including oocyte maturation. Taken together  this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles.  The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.", null, "pubmed:31417497", null, "IIIb 1", "GSM3816532", null, "source name:stage IIIb follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIb", "IIIb 1", "LC Sciences in house program ACGT101 miR program  was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences  Houston  Texas  USA. Adaptor dimers  junk  low complexity  common RNA families and repeats were removed  and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure  whose genomic coordinates should not overlap with known pre miRNAs included in this analysis  were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample", "stage IIIb follicular cells", null, "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:ovary|cell type:follicular cells|developmental stage:IIIb", "GSM3816532", "GSM3816532: IIIb 1; Danio rerio; miRNA Seq", "GSM3816532", null, "1", "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3816532", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP199448", null, null, "HI.2030.006.RPI8.IIIb_1_R1.fastq", "fastq", 1442694250.0, 28853885.0, "GSM3816532 r2", "0:50 1:0", "A:350607715;C:319569609;G:407049947;T:365297986;N:168993", 50, 0, null, null, 350607715, 319569609, 407049947, 365297986, 168993, "SRX5893493", "SRS4815088", "SRA890399", "GEO", "Biology, YorkU", 1, 0.02565, null, 0.00409, null, 0.98417, null, 0.81633, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-05-24", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [52332, "SRR9119506", "SRX5893492", "SRS4815087", "SRP199448", "PRJNA544696", "Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells", "GSE131759", "Transcriptome Analysis", "MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus  pituitary  and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH  which in turn  induces the secretion of maturation inducing hormone MIH from the ovary.  It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid  to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature.  To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles  we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing.  It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore  bioinformatics analysis revealed the presence of 214 known  31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated  and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs  dre miR 22a 3p  dre miR 16a  dre miR 181a 3p  and dre miR 29a  was validated by real time PCR. Finally  gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function  including oocyte maturation. Taken together  this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles.  The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.", null, "pubmed:31417497", null, "IIIa 3", "GSM3816531", null, "source name:stage IIIa follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIa", "IIIa 3", "LC Sciences in house program ACGT101 miR program  was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences  Houston  Texas  USA. Adaptor dimers  junk  low complexity  common RNA families and repeats were removed  and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure  whose genomic coordinates should not overlap with known pre miRNAs included in this analysis  were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample", "stage IIIa follicular cells", null, "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:ovary|cell type:follicular cells|developmental stage:IIIa", "GSM3816531", "GSM3816531: IIIa 3; Danio rerio; miRNA Seq", "GSM3816531", null, "1", "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3816531", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP199448", null, null, "HI.2030.005.RPI4.IIIa_3_R1.fastq.gz", "fastq", 1324489100.0, 26489782.0, "GSM3816531 r1", "0:50 1:0", "A:333465386;C:289207984;G:364882545;T:336711699;N:221486", 50, 0, null, null, 333465386, 289207984, 364882545, 336711699, 221486, "SRX5893492", "SRS4815087", "SRA890399", "GEO", "Biology, YorkU", 1, 0.02703, null, 0.00432, null, 0.98313, null, 0.75385, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-05-24", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [52333, "SRR9119507", "SRX5893492", "SRS4815087", "SRP199448", "PRJNA544696", "Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells", "GSE131759", "Transcriptome Analysis", "MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus  pituitary  and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH  which in turn  induces the secretion of maturation inducing hormone MIH from the ovary.  It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid  to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature.  To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles  we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing.  It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore  bioinformatics analysis revealed the presence of 214 known  31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated  and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs  dre miR 22a 3p  dre miR 16a  dre miR 181a 3p  and dre miR 29a  was validated by real time PCR. Finally  gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function  including oocyte maturation. Taken together  this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles.  The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.", null, "pubmed:31417497", null, "IIIa 3", "GSM3816531", null, "source name:stage IIIa follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIa", "IIIa 3", "LC Sciences in house program ACGT101 miR program  was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences  Houston  Texas  USA. Adaptor dimers  junk  low complexity  common RNA families and repeats were removed  and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure  whose genomic coordinates should not overlap with known pre miRNAs included in this analysis  were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample", "stage IIIa follicular cells", null, "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:ovary|cell type:follicular cells|developmental stage:IIIa", "GSM3816531", "GSM3816531: IIIa 3; Danio rerio; miRNA Seq", "GSM3816531", null, "1", "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3816531", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP199448", null, null, "HI.2030.006.RPI4.IIIa_3_R1.fastq", "fastq", 1322554650.0, 26451093.0, "GSM3816531 r2", "0:50 1:0", "A:333031673;C:288843797;G:364209143;T:336315522;N:154515", 50, 0, null, null, 333031673, 288843797, 364209143, 336315522, 154515, "SRX5893492", "SRS4815087", "SRA890399", "GEO", "Biology, YorkU", 1, 0.02671, null, 0.00422, null, 0.98283, null, 0.76748, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-05-24", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [52334, "SRR9119504", "SRX5893491", "SRS4815086", "SRP199448", "PRJNA544696", "Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells", "GSE131759", "Transcriptome Analysis", "MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus  pituitary  and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH  which in turn  induces the secretion of maturation inducing hormone MIH from the ovary.  It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid  to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature.  To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles  we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing.  It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore  bioinformatics analysis revealed the presence of 214 known  31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated  and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs  dre miR 22a 3p  dre miR 16a  dre miR 181a 3p  and dre miR 29a  was validated by real time PCR. Finally  gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function  including oocyte maturation. Taken together  this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles.  The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.", null, "pubmed:31417497", null, "IIIa 2", "GSM3816530", null, "source name:stage IIIa follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIa", "IIIa 2", "LC Sciences in house program ACGT101 miR program  was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences  Houston  Texas  USA. Adaptor dimers  junk  low complexity  common RNA families and repeats were removed  and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure  whose genomic coordinates should not overlap with known pre miRNAs included in this analysis  were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample", "stage IIIa follicular cells", null, "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:ovary|cell type:follicular cells|developmental stage:IIIa", "GSM3816530", "GSM3816530: IIIa 2; Danio rerio; miRNA Seq", "GSM3816530", null, "1", "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3816530", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP199448", null, null, "HI.2030.005.RPI3.IIIa_2_R1.fastq.gz", "fastq", 1382308600.0, 27646172.0, "GSM3816530 r1", "0:50 1:0", "A:342206537;C:301597185;G:385756857;T:352517232;N:230789", 50, 0, null, null, 342206537, 301597185, 385756857, 352517232, 230789, "SRX5893491", "SRS4815086", "SRA890399", "GEO", "Biology, YorkU", 1, 0.05315, null, 0.00892, null, 0.9643, null, 0.79967, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-05-24", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [52335, "SRR9119505", "SRX5893491", "SRS4815086", "SRP199448", "PRJNA544696", "Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells", "GSE131759", "Transcriptome Analysis", "MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus  pituitary  and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH  which in turn  induces the secretion of maturation inducing hormone MIH from the ovary.  It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid  to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature.  To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles  we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing.  It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore  bioinformatics analysis revealed the presence of 214 known  31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated  and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs  dre miR 22a 3p  dre miR 16a  dre miR 181a 3p  and dre miR 29a  was validated by real time PCR. Finally  gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function  including oocyte maturation. Taken together  this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles.  The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.", null, "pubmed:31417497", null, "IIIa 2", "GSM3816530", null, "source name:stage IIIa follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIa", "IIIa 2", "LC Sciences in house program ACGT101 miR program  was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences  Houston  Texas  USA. Adaptor dimers  junk  low complexity  common RNA families and repeats were removed  and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure  whose genomic coordinates should not overlap with known pre miRNAs included in this analysis  were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample", "stage IIIa follicular cells", null, "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:ovary|cell type:follicular cells|developmental stage:IIIa", "GSM3816530", "GSM3816530: IIIa 2; Danio rerio; miRNA Seq", "GSM3816530", null, "1", "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3816530", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP199448", null, null, "HI.2030.006.RPI3.IIIa_2_R1.fastq", "fastq", 1383050750.0, 27661015.0, "GSM3816530 r2", "0:50 1:0", "A:342441286;C:301828080;G:385820344;T:352800933;N:160107", 50, 0, null, null, 342441286, 301828080, 385820344, 352800933, 160107, "SRX5893491", "SRS4815086", "SRA890399", "GEO", "Biology, YorkU", 1, 0.0533, null, 0.00892, null, 0.96323, null, 0.81292, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-05-24", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [52336, "SRR9119502", "SRX5893490", "SRS4815085", "SRP199448", "PRJNA544696", "Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells", "GSE131759", "Transcriptome Analysis", "MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus  pituitary  and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH  which in turn  induces the secretion of maturation inducing hormone MIH from the ovary.  It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid  to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature.  To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles  we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing.  It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore  bioinformatics analysis revealed the presence of 214 known  31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated  and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs  dre miR 22a 3p  dre miR 16a  dre miR 181a 3p  and dre miR 29a  was validated by real time PCR. Finally  gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function  including oocyte maturation. Taken together  this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles.  The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.", null, "pubmed:31417497", null, "IIIa 1", "GSM3816529", null, "source name:stage IIIa follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIa", "IIIa 1", "LC Sciences in house program ACGT101 miR program  was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences  Houston  Texas  USA. Adaptor dimers  junk  low complexity  common RNA families and repeats were removed  and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure  whose genomic coordinates should not overlap with known pre miRNAs included in this analysis  were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample", "stage IIIa follicular cells", null, "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:ovary|cell type:follicular cells|developmental stage:IIIa", "GSM3816529", "GSM3816529: IIIa 1; Danio rerio; miRNA Seq", "GSM3816529", null, "1", "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3816529", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP199448", null, null, "HI.2030.005.RPI2.IIIa_1_R1.fastq.gz", "fastq", 1333818450.0, 26676369.0, "GSM3816529 r1", "0:50 1:0", "A:320039883;C:296663387;G:380656068;T:336233800;N:225312", 50, 0, null, null, 320039883, 296663387, 380656068, 336233800, 225312, "SRX5893490", "SRS4815085", "SRA890399", "GEO", "Biology, YorkU", 1, 0.0976, null, 0.019, null, 0.93718, null, 0.75404, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-05-24", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [52337, "SRR9119503", "SRX5893490", "SRS4815085", "SRP199448", "PRJNA544696", "Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells", "GSE131759", "Transcriptome Analysis", "MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus  pituitary  and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH  which in turn  induces the secretion of maturation inducing hormone MIH from the ovary.  It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid  to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature.  To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles  we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing.  It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore  bioinformatics analysis revealed the presence of 214 known  31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated  and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs  dre miR 22a 3p  dre miR 16a  dre miR 181a 3p  and dre miR 29a  was validated by real time PCR. Finally  gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function  including oocyte maturation. Taken together  this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles.  The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.", null, "pubmed:31417497", null, "IIIa 1", "GSM3816529", null, "source name:stage IIIa follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIa", "IIIa 1", "LC Sciences in house program ACGT101 miR program  was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences  Houston  Texas  USA. Adaptor dimers  junk  low complexity  common RNA families and repeats were removed  and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure  whose genomic coordinates should not overlap with known pre miRNAs included in this analysis  were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample", "stage IIIa follicular cells", null, "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:ovary|cell type:follicular cells|developmental stage:IIIa", "GSM3816529", "GSM3816529: IIIa 1; Danio rerio; miRNA Seq", "GSM3816529", null, "1", "Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM3816529", "miRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP199448", null, null, "HI.2030.006.RPI2.IIIa_1_R1.fastq", "fastq", 1334152750.0, 26683055.0, "GSM3816529 r2", "0:50 1:0", "A:320194547;C:296827909;G:380547854;T:336424243;N:158197", 50, 0, null, null, 320194547, 296827909, 380547854, 336424243, 158197, "SRX5893490", "SRS4815085", "SRA890399", "GEO", "Biology, YorkU", 1, 0.09727, null, 0.01947, null, 0.93866, null, 0.76527, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Canada", "2019-05-24", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [61505, "SRR12786081", "SRX9255339", "SRS7487541", "SRP286633", "PRJNA667863", "Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs", "GSE159162", "Transcriptome Analysis", "Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated  923 genes were downregulated in sinhcaf mutant FG follicles  compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes  and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis  then the top 30 GO terms with highest  log10P values were screened out  and at least two downregulated genes were included in each biological processes  cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg  four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.", null, "pubmed:35532311", null, "Sample WT FG 4", "GSM4820795", null, "source name:follicles|tissue:Ovary|stage of follicles:FG|genotype:wild type", "Sample WT FG 4", "Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks  and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID   gene name and FPKM values for each Sample", "follicles", null, "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer\u2019s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer\u2019s instructions.", null, "tissue:Ovary|stage of follicles:FG|genotype:wild type", "GSM4820795", "GSM4820795: Sample WT FG 4; Danio rerio; RNA Seq", "GSM4820795", null, "1", "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer's instructions.", "GEO Accession:GSM4820795", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP286633", null, null, "Sample_WT_FG_4.R1.fq.gz Sample_WT_FG_4.R2.fq.gz", "fastq fastq", 6494839649.0, 22379034.0, "GSM4820795 r1", "0:145.94 1:144.28", "A:1649345658;C:1579352648;G:1580948162;T:1685086821;N:106360", 145, 144, null, null, 1649345658, 1579352648, 1580948162, 1685086821, 106360, "SRX9255339", "SRS7487541", "SRA1139682", "GEO", "Institute of Hydrobiology", 2, 0.94646, 0.94736, 0.01915, 0.01888, 0.75554, 0.75566, 0.50735, 0.50347, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "small_rna", "trueseq", "bulk", "unknown", "unknown", null, "China", "2020-10-07", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [61506, "SRR12786080", "SRX9255338", "SRS7487540", "SRP286633", "PRJNA667863", "Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs", "GSE159162", "Transcriptome Analysis", "Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated  923 genes were downregulated in sinhcaf mutant FG follicles  compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes  and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis  then the top 30 GO terms with highest  log10P values were screened out  and at least two downregulated genes were included in each biological processes  cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg  four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.", null, "pubmed:35532311", null, "Sample WT FG 3", "GSM4820794", null, "source name:follicles|tissue:Ovary|stage of follicles:FG|genotype:wild type", "Sample WT FG 3", "Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks  and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID   gene name and FPKM values for each Sample", "follicles", null, "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer\u2019s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer\u2019s instructions.", null, "tissue:Ovary|stage of follicles:FG|genotype:wild type", "GSM4820794", "GSM4820794: Sample WT FG 3; Danio rerio; RNA Seq", "GSM4820794", null, "1", "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer's instructions.", "GEO Accession:GSM4820794", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP286633", null, null, "Sample_WT_FG_3.R1.fq.gz Sample_WT_FG_3.R2.fq.gz", "fastq fastq", 6925670591.0, 23930393.0, "GSM4820794 r1", "0:145.51 1:143.90", "A:1758516170;C:1686214780;G:1687326968;T:1793466364;N:146309", 145, 143, null, null, 1758516170, 1686214780, 1687326968, 1793466364, 146309, "SRX9255338", "SRS7487540", "SRA1139682", "GEO", "Institute of Hydrobiology", 2, 0.94987, 0.95208, 0.01972, 0.01986, 0.75779, 0.75891, 0.49235, 0.49103, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "small_rna", "trueseq", "bulk", "unknown", "unknown", null, "China", "2020-10-07", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [61507, "SRR12786079", "SRX9255337", "SRS7487539", "SRP286633", "PRJNA667863", "Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs", "GSE159162", "Transcriptome Analysis", "Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated  923 genes were downregulated in sinhcaf mutant FG follicles  compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes  and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis  then the top 30 GO terms with highest  log10P values were screened out  and at least two downregulated genes were included in each biological processes  cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg  four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.", null, "pubmed:35532311", null, "Sample WT FG 2", "GSM4820793", null, "source name:follicles|tissue:Ovary|stage of follicles:FG|genotype:wild type", "Sample WT FG 2", "Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks  and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID   gene name and FPKM values for each Sample", "follicles", null, "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer\u2019s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer\u2019s instructions.", null, "tissue:Ovary|stage of follicles:FG|genotype:wild type", "GSM4820793", "GSM4820793: Sample WT FG 2; Danio rerio; RNA Seq", "GSM4820793", null, "1", "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer's instructions.", "GEO Accession:GSM4820793", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP286633", null, null, "Sample_WT_FG_2.R1.fq.gz Sample_WT_FG_2.R2.fq.gz", "fastq fastq", 6937720341.0, 23868543.0, "GSM4820793 r1", "0:146.23 1:144.43", "A:1760323867;C:1687409068;G:1688288208;T:1801543463;N:155735", 146, 144, null, null, 1760323867, 1687409068, 1688288208, 1801543463, 155735, "SRX9255337", "SRS7487539", "SRA1139682", "GEO", "Institute of Hydrobiology", 2, 0.94558, 0.94771, 0.01901, 0.01877, 0.75915, 0.75893, 0.49355, 0.49438, 86, 86, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "small_rna", "trueseq", "bulk", "unknown", "unknown", null, "China", "2020-10-07", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [61508, "SRR12786078", "SRX9255336", "SRS7487538", "SRP286633", "PRJNA667863", "Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs", "GSE159162", "Transcriptome Analysis", "Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated  923 genes were downregulated in sinhcaf mutant FG follicles  compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes  and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis  then the top 30 GO terms with highest  log10P values were screened out  and at least two downregulated genes were included in each biological processes  cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg  four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.", null, "pubmed:35532311", null, "Sample WT FG 1", "GSM4820792", null, "source name:follicles|tissue:Ovary|stage of follicles:FG|genotype:wild type", "Sample WT FG 1", "Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks  and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID   gene name and FPKM values for each Sample", "follicles", null, "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer\u2019s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer\u2019s instructions.", null, "tissue:Ovary|stage of follicles:FG|genotype:wild type", "GSM4820792", "GSM4820792: Sample WT FG 1; Danio rerio; RNA Seq", "GSM4820792", null, "1", "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer's instructions.", "GEO Accession:GSM4820792", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP286633", null, null, "Sample_WT_FG_1.R1.fq.gz Sample_WT_FG_1.R2.fq.gz", "fastq fastq", 6967269048.0, 23937357.0, "GSM4820792 r1", "0:146.29 1:144.78", "A:1778908738;C:1684335965;G:1686285595;T:1817522579;N:216171", 146, 144, null, null, 1778908738, 1684335965, 1686285595, 1817522579, 216171, "SRX9255336", "SRS7487538", "SRA1139682", "GEO", "Institute of Hydrobiology", 2, 0.9478, 0.94904, 0.0209, 0.02072, 0.75653, 0.75716, 0.48347, 0.48235, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "small_rna", "trueseq", "bulk", "unknown", "unknown", null, "China", "2020-10-07", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [61509, "SRR12786077", "SRX9255335", "SRS7487537", "SRP286633", "PRJNA667863", "Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs", "GSE159162", "Transcriptome Analysis", "Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated  923 genes were downregulated in sinhcaf mutant FG follicles  compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes  and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis  then the top 30 GO terms with highest  log10P values were screened out  and at least two downregulated genes were included in each biological processes  cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg  four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.", null, "pubmed:35532311", null, "Sample WT EGG 5", "GSM4820791", null, "source name:follicles|tissue:Ovary|stage of follicles:mature egg|genotype:wild type", "Sample WT EGG 5", "Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks  and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID   gene name and FPKM values for each Sample", "follicles", null, "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer\u2019s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer\u2019s instructions.", null, "tissue:Ovary|stage of follicles:mature egg|genotype:wild type", "GSM4820791", "GSM4820791: Sample WT EGG 5; Danio rerio; RNA Seq", "GSM4820791", null, "1", "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer's instructions.", "GEO Accession:GSM4820791", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP286633", null, null, "Sample_WT_EGG_5.R1.fq.gz Sample_WT_EGG_5.R2.fq.gz", "fastq fastq", 6759669369.0, 23484870.0, "GSM4820791 r1", "0:144.70 1:143.13", "A:1779446270;C:1589997978;G:1589479961;T:1800569943;N:175217", 144, 143, null, null, 1779446270, 1589997978, 1589479961, 1800569943, 175217, "SRX9255335", "SRS7487537", "SRA1139682", "GEO", "Institute of Hydrobiology", 2, 0.93866, 0.94281, 0.02922, 0.02836, 0.81203, 0.81211, 0.50024, 0.50364, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "small_rna", "trueseq", "bulk", "unknown", "unknown", null, "China", "2020-10-07", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [61510, "SRR12786076", "SRX9255334", "SRS7487536", "SRP286633", "PRJNA667863", "Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs", "GSE159162", "Transcriptome Analysis", "Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated  923 genes were downregulated in sinhcaf mutant FG follicles  compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes  and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis  then the top 30 GO terms with highest  log10P values were screened out  and at least two downregulated genes were included in each biological processes  cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg  four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.", null, "pubmed:35532311", null, "Sample WT EGG 4", "GSM4820790", null, "source name:follicles|tissue:Ovary|stage of follicles:mature egg|genotype:wild type", "Sample WT EGG 4", "Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks  and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID   gene name and FPKM values for each Sample", "follicles", null, "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer\u2019s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer\u2019s instructions.", null, "tissue:Ovary|stage of follicles:mature egg|genotype:wild type", "GSM4820790", "GSM4820790: Sample WT EGG 4; Danio rerio; RNA Seq", "GSM4820790", null, "1", "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer's instructions.", "GEO Accession:GSM4820790", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP286633", null, null, "Sample_WT_EGG_4.R1.fq.gz Sample_WT_EGG_4.R2.fq.gz", "fastq fastq", 6507516169.0, 22482048.0, "GSM4820790 r1", "0:145.79 1:143.66", "A:1716909756;C:1525253185;G:1525859003;T:1739392348;N:101877", 145, 143, null, null, 1716909756, 1525253185, 1525859003, 1739392348, 101877, "SRX9255334", "SRS7487536", "SRA1139682", "GEO", "Institute of Hydrobiology", 2, 0.93927, 0.94219, 0.02868, 0.02773, 0.81225, 0.81268, 0.51042, 0.50948, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "small_rna", "trueseq", "bulk", "unknown", "unknown", null, "China", "2020-10-07", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [61511, "SRR12786075", "SRX9255333", "SRS7487535", "SRP286633", "PRJNA667863", "Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs", "GSE159162", "Transcriptome Analysis", "Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated  923 genes were downregulated in sinhcaf mutant FG follicles  compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes  and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis  then the top 30 GO terms with highest  log10P values were screened out  and at least two downregulated genes were included in each biological processes  cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg  four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.", null, "pubmed:35532311", null, "Sample WT EGG 3", "GSM4820789", null, "source name:follicles|tissue:Ovary|stage of follicles:mature egg|genotype:wild type", "Sample WT EGG 3", "Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks  and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID   gene name and FPKM values for each Sample", "follicles", null, "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer\u2019s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer\u2019s instructions.", null, "tissue:Ovary|stage of follicles:mature egg|genotype:wild type", "GSM4820789", "GSM4820789: Sample WT EGG 3; Danio rerio; RNA Seq", "GSM4820789", null, "1", "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer's instructions.", "GEO Accession:GSM4820789", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP286633", null, null, "Sample_WT_EGG_3.R1.fq.gz Sample_WT_EGG_3.R2.fq.gz", "fastq fastq", 6892017136.0, 23794526.0, "GSM4820789 r1", "0:145.73 1:143.92", "A:1860381019;C:1583189044;G:1576215039;T:1872104069;N:127965", 145, 143, null, null, 1860381019, 1583189044, 1576215039, 1872104069, 127965, "SRX9255333", "SRS7487535", "SRA1139682", "GEO", "Institute of Hydrobiology", 2, 0.93308, 0.93454, 0.03385, 0.0331, 0.82836, 0.82862, 0.51253, 0.52212, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "small_rna", "trueseq", "bulk", "unknown", "unknown", null, "China", "2020-10-07", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [61512, "SRR12786074", "SRX9255332", "SRS7487534", "SRP286633", "PRJNA667863", "Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs", "GSE159162", "Transcriptome Analysis", "Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated  923 genes were downregulated in sinhcaf mutant FG follicles  compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes  and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis  then the top 30 GO terms with highest  log10P values were screened out  and at least two downregulated genes were included in each biological processes  cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg  four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.", null, "pubmed:35532311", null, "Sample WT EGG 2", "GSM4820788", null, "source name:follicles|tissue:Ovary|stage of follicles:mature egg|genotype:wild type", "Sample WT EGG 2", "Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks  and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID   gene name and FPKM values for each Sample", "follicles", null, "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer\u2019s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer\u2019s instructions.", null, "tissue:Ovary|stage of follicles:mature egg|genotype:wild type", "GSM4820788", "GSM4820788: Sample WT EGG 2; Danio rerio; RNA Seq", "GSM4820788", null, "1", "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer's instructions.", "GEO Accession:GSM4820788", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP286633", null, null, "Sample_WT_EGG_2.R1.fq.gz Sample_WT_EGG_2.R2.fq.gz", "fastq fastq", 5738534730.0, 20501677.0, "GSM4820788 r1", "0:140.71 1:139.19", "A:1521303459;C:1341529264;G:1344606059;T:1531008879;N:87069", 140, 139, null, null, 1521303459, 1341529264, 1344606059, 1531008879, 87069, "SRX9255332", "SRS7487534", "SRA1139682", "GEO", "Institute of Hydrobiology", 2, 0.93514, 0.93628, 0.03038, 0.02998, 0.82471, 0.82477, 0.51484, 0.52018, 78, 80, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "small_rna", "trueseq", "bulk", "unknown", "unknown", null, "China", "2020-10-07", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [61513, "SRR12786073", "SRX9255331", "SRS7487533", "SRP286633", "PRJNA667863", "Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs", "GSE159162", "Transcriptome Analysis", "Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated  923 genes were downregulated in sinhcaf mutant FG follicles  compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes  and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis  then the top 30 GO terms with highest  log10P values were screened out  and at least two downregulated genes were included in each biological processes  cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg  four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.", null, "pubmed:35532311", null, "Sample WT EGG 1", "GSM4820787", null, "source name:follicles|tissue:Ovary|stage of follicles:mature egg|genotype:wild type", "Sample WT EGG 1", "Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks  and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID   gene name and FPKM values for each Sample", "follicles", null, "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer\u2019s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer\u2019s instructions.", null, "tissue:Ovary|stage of follicles:mature egg|genotype:wild type", "GSM4820787", "GSM4820787: Sample WT EGG 1; Danio rerio; RNA Seq", "GSM4820787", null, "1", "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer's instructions.", "GEO Accession:GSM4820787", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP286633", null, null, "Sample_WT_EGG_1.R1.fq.gz Sample_WT_EGG_1.R2.fq.gz", "fastq fastq", 6682134875.0, 23188787.0, "GSM4820787 r1", "0:144.80 1:143.37", "A:1781938550;C:1551592731;G:1553675983;T:1794734663;N:192948", 144, 143, null, null, 1781938550, 1551592731, 1553675983, 1794734663, 192948, "SRX9255331", "SRS7487533", "SRA1139682", "GEO", "Institute of Hydrobiology", 2, 0.93706, 0.94148, 0.03062, 0.03007, 0.82367, 0.82292, 0.51212, 0.5208, 150, 103, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "small_rna", "trueseq", "bulk", "unknown", "unknown", null, "China", "2020-10-07", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [61514, "SRR12786072", "SRX9255330", "SRS7487532", "SRP286633", "PRJNA667863", "Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs", "GSE159162", "Transcriptome Analysis", "Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated  923 genes were downregulated in sinhcaf mutant FG follicles  compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes  and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis  then the top 30 GO terms with highest  log10P values were screened out  and at least two downregulated genes were included in each biological processes  cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg  four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.", null, "pubmed:35532311", null, "Sample KO FG 4", "GSM4820786", null, "source name:follicles|tissue:Ovary|stage of follicles:FG|genotype:sinhcaf / ", "Sample KO FG 4", "Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks  and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID   gene name and FPKM values for each Sample", "follicles", null, "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer\u2019s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer\u2019s instructions.", null, "tissue:Ovary|stage of follicles:FG|genotype:sinhcaf / ", "GSM4820786", "GSM4820786: Sample KO FG 4; Danio rerio; RNA Seq", "GSM4820786", null, "1", "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer's instructions.", "GEO Accession:GSM4820786", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP286633", null, null, "Sample_KO_FG_4.R1.fq.gz Sample_KO_FG_4.R2.fq.gz", "fastq fastq", 6990246097.0, 24053336.0, "GSM4820786 r1", "0:146.17 1:144.44", "A:1772105090;C:1700647750;G:1704170604;T:1813260899;N:61754", 146, 144, null, null, 1772105090, 1700647750, 1704170604, 1813260899, 61754, "SRX9255330", "SRS7487532", "SRA1139682", "GEO", "Institute of Hydrobiology", 2, 0.93867, 0.93848, 0.02008, 0.02034, 0.75442, 0.75455, 0.48931, 0.48777, 122, 149, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "small_rna", "trueseq", "bulk", "unknown", "unknown", null, "China", "2020-10-07", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [61515, "SRR12786071", "SRX9255329", "SRS7487531", "SRP286633", "PRJNA667863", "Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs", "GSE159162", "Transcriptome Analysis", "Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated  923 genes were downregulated in sinhcaf mutant FG follicles  compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes  and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis  then the top 30 GO terms with highest  log10P values were screened out  and at least two downregulated genes were included in each biological processes  cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg  four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.", null, "pubmed:35532311", null, "Sample KO FG 3", "GSM4820785", null, "source name:follicles|tissue:Ovary|stage of follicles:FG|genotype:sinhcaf / ", "Sample KO FG 3", "Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks  and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID   gene name and FPKM values for each Sample", "follicles", null, "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer\u2019s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer\u2019s instructions.", null, "tissue:Ovary|stage of follicles:FG|genotype:sinhcaf / ", "GSM4820785", "GSM4820785: Sample KO FG 3; Danio rerio; RNA Seq", "GSM4820785", null, "1", "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer's instructions.", "GEO Accession:GSM4820785", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP286633", null, null, "Sample_KO_FG_3.R1.fq.gz Sample_KO_FG_3.R2.fq.gz", "fastq fastq", 6981297857.0, 24046800.0, "GSM4820785 r1", "0:146.06 1:144.26", "A:1766235294;C:1704937924;G:1705984881;T:1804072922;N:66836", 146, 144, null, null, 1766235294, 1704937924, 1705984881, 1804072922, 66836, "SRX9255329", "SRS7487531", "SRA1139682", "GEO", "Institute of Hydrobiology", 2, 0.94371, 0.94296, 0.018, 0.01802, 0.75619, 0.75633, 0.48476, 0.48292, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "small_rna", "trueseq", "bulk", "unknown", "unknown", null, "China", "2020-10-07", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [61516, "SRR12786070", "SRX9255328", "SRS7487530", "SRP286633", "PRJNA667863", "Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs", "GSE159162", "Transcriptome Analysis", "Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated  923 genes were downregulated in sinhcaf mutant FG follicles  compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes  and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis  then the top 30 GO terms with highest  log10P values were screened out  and at least two downregulated genes were included in each biological processes  cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg  four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.", null, "pubmed:35532311", null, "Sample KO FG 2", "GSM4820784", null, "source name:follicles|tissue:Ovary|stage of follicles:FG|genotype:sinhcaf / ", "Sample KO FG 2", "Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks  and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID   gene name and FPKM values for each Sample", "follicles", null, "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer\u2019s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer\u2019s instructions.", null, "tissue:Ovary|stage of follicles:FG|genotype:sinhcaf / ", "GSM4820784", "GSM4820784: Sample KO FG 2; Danio rerio; RNA Seq", "GSM4820784", null, "1", "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer's instructions.", "GEO Accession:GSM4820784", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP286633", null, null, "Sample_KO_FG_2.R1.fq.gz Sample_KO_FG_2.R2.fq.gz", "fastq fastq", 6930598112.0, 23990854.0, "GSM4820784 r1", "0:145.36 1:143.52", "A:1744825506;C:1697507117;G:1702166327;T:1786036969;N:62193", 145, 143, null, null, 1744825506, 1697507117, 1702166327, 1786036969, 62193, "SRX9255328", "SRS7487530", "SRA1139682", "GEO", "Institute of Hydrobiology", 2, 0.93904, 0.93857, 0.02076, 0.02088, 0.74673, 0.74811, 0.48497, 0.48206, 150, 71, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "small_rna", "trueseq", "bulk", "unknown", "unknown", null, "China", "2020-10-07", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [61517, "SRR12786069", "SRX9255327", "SRS7487529", "SRP286633", "PRJNA667863", "Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs", "GSE159162", "Transcriptome Analysis", "Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated  923 genes were downregulated in sinhcaf mutant FG follicles  compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes  and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis  then the top 30 GO terms with highest  log10P values were screened out  and at least two downregulated genes were included in each biological processes  cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg  four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.", null, "pubmed:35532311", null, "Sample KO FG 1", "GSM4820783", null, "source name:follicles|tissue:Ovary|stage of follicles:FG|genotype:sinhcaf / ", "Sample KO FG 1", "Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks  and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID   gene name and FPKM values for each Sample", "follicles", null, "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer\u2019s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer\u2019s instructions.", null, "tissue:Ovary|stage of follicles:FG|genotype:sinhcaf / ", "GSM4820783", "GSM4820783: Sample KO FG 1; Danio rerio; RNA Seq", "GSM4820783", null, "1", "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer's instructions.", "GEO Accession:GSM4820783", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP286633", null, null, "Sample_KO_FG_1.R1.fq.gz Sample_KO_FG_1.R2.fq.gz", "fastq fastq", 6974706218.0, 24022505.0, "GSM4820783 r1", "0:146.20 1:144.14", "A:1764113248;C:1700352581;G:1706722769;T:1803435223;N:82397", 146, 144, null, null, 1764113248, 1700352581, 1706722769, 1803435223, 82397, "SRX9255327", "SRS7487529", "SRA1139682", "GEO", "Institute of Hydrobiology", 2, 0.94176, 0.94125, 0.01946, 0.01953, 0.75712, 0.75812, 0.47734, 0.47441, 91, 97, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "small_rna", "trueseq", "bulk", "unknown", "unknown", null, "China", "2020-10-07", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [61518, "SRR12786068", "SRX9255326", "SRS7487528", "SRP286633", "PRJNA667863", "Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs", "GSE159162", "Transcriptome Analysis", "Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated  923 genes were downregulated in sinhcaf mutant FG follicles  compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes  and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis  then the top 30 GO terms with highest  log10P values were screened out  and at least two downregulated genes were included in each biological processes  cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg  four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.", null, "pubmed:35532311", null, "Sample KO EGG 5", "GSM4820782", null, "source name:follicles|tissue:Ovary|stage of follicles:mature egg|genotype:sinhcaf / ", "Sample KO EGG 5", "Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks  and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID   gene name and FPKM values for each Sample", "follicles", null, "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer\u2019s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer\u2019s instructions.", null, "tissue:Ovary|stage of follicles:mature egg|genotype:sinhcaf / ", "GSM4820782", "GSM4820782: Sample KO EGG 5; Danio rerio; RNA Seq", "GSM4820782", null, "1", "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer's instructions.", "GEO Accession:GSM4820782", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP286633", null, null, "Sample_KO_EGG_5.R1.fq.gz Sample_KO_EGG_5.R2.fq.gz", "fastq fastq", 6749303222.0, 23750320.0, "GSM4820782 r1", "0:142.69 1:141.49", "A:1797588338;C:1567936329;G:1570091501;T:1813621345;N:65709", 142, 141, null, null, 1797588338, 1567936329, 1570091501, 1813621345, 65709, "SRX9255326", "SRS7487528", "SRA1139682", "GEO", "Institute of Hydrobiology", 2, 0.93455, 0.9383, 0.03024, 0.02992, 0.80511, 0.80509, 0.50954, 0.49961, 122, 106, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "small_rna", "trueseq", "bulk", "unknown", "unknown", null, "China", "2020-10-07", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [61519, "SRR12786067", "SRX9255325", "SRS7487527", "SRP286633", "PRJNA667863", "Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs", "GSE159162", "Transcriptome Analysis", "Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated  923 genes were downregulated in sinhcaf mutant FG follicles  compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes  and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis  then the top 30 GO terms with highest  log10P values were screened out  and at least two downregulated genes were included in each biological processes  cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg  four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.", null, "pubmed:35532311", null, "Sample KO EGG 4", "GSM4820781", null, "source name:follicles|tissue:Ovary|stage of follicles:mature egg|genotype:sinhcaf / ", "Sample KO EGG 4", "Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks  and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID   gene name and FPKM values for each Sample", "follicles", null, "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer\u2019s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer\u2019s instructions.", null, "tissue:Ovary|stage of follicles:mature egg|genotype:sinhcaf / ", "GSM4820781", "GSM4820781: Sample KO EGG 4; Danio rerio; RNA Seq", "GSM4820781", null, "1", "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer's instructions.", "GEO Accession:GSM4820781", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP286633", null, null, "Sample_KO_EGG_4.R1.fq.gz Sample_KO_EGG_4.R2.fq.gz", "fastq fastq", 6739134452.0, 23846811.0, "GSM4820781 r1", "0:141.87 1:140.73", "A:1818980107;C:1542920452;G:1542064995;T:1835112669;N:56229", 141, 140, null, null, 1818980107, 1542920452, 1542064995, 1835112669, 56229, "SRX9255325", "SRS7487527", "SRA1139682", "GEO", "Institute of Hydrobiology", 2, 0.93417, 0.93848, 0.03165, 0.03163, 0.80251, 0.80265, 0.52912, 0.52756, 80, 80, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "small_rna", "trueseq", "bulk", "unknown", "unknown", null, "China", "2020-10-07", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [61520, "SRR12786066", "SRX9255324", "SRS7487526", "SRP286633", "PRJNA667863", "Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs", "GSE159162", "Transcriptome Analysis", "Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated  923 genes were downregulated in sinhcaf mutant FG follicles  compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes  and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis  then the top 30 GO terms with highest  log10P values were screened out  and at least two downregulated genes were included in each biological processes  cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg  four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.", null, "pubmed:35532311", null, "Sample KO EGG 3", "GSM4820780", null, "source name:follicles|tissue:Ovary|stage of follicles:mature egg|genotype:sinhcaf / ", "Sample KO EGG 3", "Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks  and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID   gene name and FPKM values for each Sample", "follicles", null, "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer\u2019s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer\u2019s instructions.", null, "tissue:Ovary|stage of follicles:mature egg|genotype:sinhcaf / ", "GSM4820780", "GSM4820780: Sample KO EGG 3; Danio rerio; RNA Seq", "GSM4820780", null, "1", "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer's instructions.", "GEO Accession:GSM4820780", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP286633", null, null, "Sample_KO_EGG_3.R1.fq.gz Sample_KO_EGG_3.R2.fq.gz", "fastq fastq", 6722654601.0, 23651433.0, "GSM4820780 r1", "0:142.85 1:141.39", "A:1779610219;C:1575265248;G:1573997469;T:1793726817;N:54848", 142, 141, null, null, 1779610219, 1575265248, 1573997469, 1793726817, 54848, "SRX9255324", "SRS7487526", "SRA1139682", "GEO", "Institute of Hydrobiology", 2, 0.93308, 0.93506, 0.02946, 0.02904, 0.82493, 0.82515, 0.50828, 0.51094, 117, 141, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "small_rna", "trueseq", "bulk", "unknown", "unknown", null, "China", "2020-10-07", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [61521, "SRR12786065", "SRX9255323", "SRS7487525", "SRP286633", "PRJNA667863", "Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs", "GSE159162", "Transcriptome Analysis", "Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated  923 genes were downregulated in sinhcaf mutant FG follicles  compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes  and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis  then the top 30 GO terms with highest  log10P values were screened out  and at least two downregulated genes were included in each biological processes  cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg  four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.", null, "pubmed:35532311", null, "Sample KO EGG 2", "GSM4820779", null, "source name:follicles|tissue:Ovary|stage of follicles:mature egg|genotype:sinhcaf / ", "Sample KO EGG 2", "Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks  and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID   gene name and FPKM values for each Sample", "follicles", null, "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer\u2019s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer\u2019s instructions.", null, "tissue:Ovary|stage of follicles:mature egg|genotype:sinhcaf / ", "GSM4820779", "GSM4820779: Sample KO EGG 2; Danio rerio; RNA Seq", "GSM4820779", null, "1", "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer's instructions.", "GEO Accession:GSM4820779", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP286633", null, null, "Sample_KO_EGG_2.R1.fq.gz Sample_KO_EGG_2.R2.fq.gz", "fastq fastq", 6869785304.0, 23728899.0, "GSM4820779 r1", "0:145.46 1:144.05", "A:1833413652;C:1591958740;G:1590596059;T:1853754341;N:62512", 145, 144, null, null, 1833413652, 1591958740, 1590596059, 1853754341, 62512, "SRX9255323", "SRS7487525", "SRA1139682", "GEO", "Institute of Hydrobiology", 2, 0.94163, 0.9464, 0.03014, 0.02973, 0.81495, 0.81436, 0.53096, 0.53487, 122, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "small_rna", "trueseq", "bulk", "unknown", "unknown", null, "China", "2020-10-07", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [61522, "SRR12786064", "SRX9255322", "SRS7487524", "SRP286633", "PRJNA667863", "Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs", "GSE159162", "Transcriptome Analysis", "Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated  923 genes were downregulated in sinhcaf mutant FG follicles  compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes  and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis  then the top 30 GO terms with highest  log10P values were screened out  and at least two downregulated genes were included in each biological processes  cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg  four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.", null, "pubmed:35532311", null, "Sample KO EGG 1", "GSM4820778", null, "source name:follicles|tissue:Ovary|stage of follicles:mature egg|genotype:sinhcaf / ", "Sample KO EGG 1", "Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks  and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID   gene name and FPKM values for each Sample", "follicles", null, "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer\u2019s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer\u2019s instructions.", null, "tissue:Ovary|stage of follicles:mature egg|genotype:sinhcaf / ", "GSM4820778", "GSM4820778: Sample KO EGG 1; Danio rerio; RNA Seq", "GSM4820778", null, "1", "Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies  Santa Clara  CA  USA. The samples with RNA Integrity Number RIN \u2265 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina  San Diego  CA  USA according to the manufacturer's instructions.", "GEO Accession:GSM4820778", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP286633", null, null, "Sample_KO_EGG_1.R1.fq.gz Sample_KO_EGG_1.R2.fq.gz", "fastq fastq", 6912723848.0, 23914158.0, "GSM4820778 r1", "0:145.64 1:143.42", "A:1856194412;C:1592279992;G:1587734358;T:1876445540;N:69546", 145, 143, null, null, 1856194412, 1592279992, 1587734358, 1876445540, 69546, "SRX9255322", "SRS7487524", "SRA1139682", "GEO", "Institute of Hydrobiology", 2, 0.94437, 0.94757, 0.02955, 0.0291, 0.82266, 0.82272, 0.53976, 0.54604, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "small_rna", "trueseq", "bulk", "unknown", "unknown", null, "China", "2020-10-07", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [63889, "SRR14213377", "SRX10579922", "SRS8684390", "SRP314470", "PRJNA721381", "RNA Seq from zebrafish adult tissues", "GSE171906", "Transcriptome Analysis", "The goal of this study was to profile transcript expression levels across zebrafish adult tissues. Overall design: Transcriptome profiles of nine zebrafish adult tissues. Every tissue contains triplicates.", null, "pubmed:34556579", null, "Testis3", "GSM5237146", null, "source name:zebrafish testis|genotype:wild type|tissue:testis|strain:TLAB", "Testis3", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 102. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing TPM", "zebrafish testis", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. Strand specific cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:wild type|tissue:testis|strain:TLAB", "GSM5237146", "GSM5237146: Testis3; Danio rerio; RNA Seq", "GSM5237146", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. Strand specific cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM5237146", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP314470", null, null, "Testis3.fastq", "fastq", 16904264700.0, 169042647.0, "GSM5237146 r1", "0:100", "A:4166427594;C:4293244634;G:4116245208;T:4327700322;N:646942", 100, null, null, null, 4166427594, 4293244634, 4116245208, 4327700322, 646942, "SRX10579922", "SRS8684390", "SRA1217576", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.94648, null, 0.14489, null, 0.64329, null, 0.5145, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2021-04-12", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [63890, "SRR14213376", "SRX10579921", "SRS8684389", "SRP314470", "PRJNA721381", "RNA Seq from zebrafish adult tissues", "GSE171906", "Transcriptome Analysis", "The goal of this study was to profile transcript expression levels across zebrafish adult tissues. Overall design: Transcriptome profiles of nine zebrafish adult tissues. Every tissue contains triplicates.", null, "pubmed:34556579", null, "Testis2", "GSM5237145", null, "source name:zebrafish testis|genotype:wild type|tissue:testis|strain:TLAB", "Testis2", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 102. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing TPM", "zebrafish testis", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. Strand specific cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:wild type|tissue:testis|strain:TLAB", "GSM5237145", "GSM5237145: Testis2; Danio rerio; RNA Seq", "GSM5237145", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. Strand specific cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM5237145", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP314470", null, null, "Testis2.fastq", "fastq", 2130746600.0, 21307466.0, "GSM5237145 r1", "0:100", "A:517817182;C:547187586;G:517803772;T:547856602;N:81458", 100, null, null, null, 517817182, 547187586, 517803772, 547856602, 81458, "SRX10579921", "SRS8684389", "SRA1217576", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.95272, null, 0.13195, null, 0.64112, null, 0.50616, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2021-04-12", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [63891, "SRR14213375", "SRX10579920", "SRS8684388", "SRP314470", "PRJNA721381", "RNA Seq from zebrafish adult tissues", "GSE171906", "Transcriptome Analysis", "The goal of this study was to profile transcript expression levels across zebrafish adult tissues. Overall design: Transcriptome profiles of nine zebrafish adult tissues. Every tissue contains triplicates.", null, "pubmed:34556579", null, "Testis1", "GSM5237144", null, "source name:zebrafish testis|genotype:wild type|tissue:testis|strain:TLAB", "Testis1", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 102. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing TPM", "zebrafish testis", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. Strand specific cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:wild type|tissue:testis|strain:TLAB", "GSM5237144", "GSM5237144: Testis1; Danio rerio; RNA Seq", "GSM5237144", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. Strand specific cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM5237144", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP314470", null, null, "Testis1.fastq", "fastq", 1989342600.0, 19893426.0, "GSM5237144 r1", "0:100", "A:511252873;C:487112155;G:465774401;T:525127484;N:75687", 100, null, null, null, 511252873, 487112155, 465774401, 525127484, 75687, "SRX10579920", "SRS8684388", "SRA1217576", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.94514, null, 0.11483, null, 0.63341, null, 0.49832, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2021-04-12", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [71330, "SRR21497238", "SRX17500547", "SRS15052263", "SRP396406", "PRJNA878705", "Effect of chronic stress on zebrafish testicular gene expression", "GSE212999", "Transcriptome Analysis", "To investigate the potential deleterious impact of chronic stress at molecular level in testicular tissue  we exposed zebrafish males to chronic stress during 21 days  covering around three complete cycles of spermatogenesis in the species Overall design: We then performed gene expression profiling in the stress exposed group and the control one.", null, null, null, "Sample 7 AU1015 STRSS3", "GSM6568314", null, "source name:Testicle|tissue:Testicle|genotype:WT|treatment:Chronically stressed", "Sample 7 AU1015 STRSS3", "Alignment using STAR 2.7.8a using ENCODE parameters Quantification using RSEM 1.3.0 Quantification with annotation Ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV file with raw counts", "Testicle", null, "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "tissue:Testicle|genotype:WT|treatment:Chronically stressed", "GSM6568314", "GSM6568314: Sample 7 AU1015 STRSS3; Danio rerio; RNA Seq", "GSM6568314 r1", "GSM6568314", "1", "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP396406", null, "loader:fastq load.py", "AU1015_5714AF_H25T2DMXY_1_219UDI-idt-UMI_1.fastq.gz AU1015_5714AF_H25T2DMXY_1_219UDI-idt-UMI_2.fastq.gz", "fastq fastq", 8390784690.0, 82262595.0, "GSM6568314 r1", "0:51 1:51", "A:1932102650;C:2309972245;G:2240600118;T:1908089771;N:19906", 51, 51, null, null, 1932102650, 2309972245, 2240600118, 1908089771, 19906, "SRX17500547", "SRS15052263", "SRA1494713", "CNAG", "REPROMOL, Molecular Biology, Universidad de Le\u00f3n", 2, 0.942, 0.94653, 0.33089, 0.33002, 0.75168, 0.75546, 0.67992, 0.70376, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Spain", "2022-09-09", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [71331, "SRR21497239", "SRX17500547", "SRS15052263", "SRP396406", "PRJNA878705", "Effect of chronic stress on zebrafish testicular gene expression", "GSE212999", "Transcriptome Analysis", "To investigate the potential deleterious impact of chronic stress at molecular level in testicular tissue  we exposed zebrafish males to chronic stress during 21 days  covering around three complete cycles of spermatogenesis in the species Overall design: We then performed gene expression profiling in the stress exposed group and the control one.", null, null, null, "Sample 7 AU1015 STRSS3", "GSM6568314", null, "source name:Testicle|tissue:Testicle|genotype:WT|treatment:Chronically stressed", "Sample 7 AU1015 STRSS3", "Alignment using STAR 2.7.8a using ENCODE parameters Quantification using RSEM 1.3.0 Quantification with annotation Ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV file with raw counts", "Testicle", null, "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "tissue:Testicle|genotype:WT|treatment:Chronically stressed", "GSM6568314", "GSM6568314: Sample 7 AU1015 STRSS3; Danio rerio; RNA Seq", "GSM6568314 r1", "GSM6568314", "1", "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP396406", null, "loader:fastq load.py", "AU1015_5714AF_H25T2DMXY_2_219UDI-idt-UMI_1.fastq.gz AU1015_5714AF_H25T2DMXY_2_219UDI-idt-UMI_2.fastq.gz", "fastq fastq", 8239869162.0, 80783031.0, "GSM6568314 r2", "0:51 1:51", "A:1901639522;C:2264655998;G:2196001834;T:1877552622;N:19186", 51, 51, null, null, 1901639522, 2264655998, 2196001834, 1877552622, 19186, "SRX17500547", "SRS15052263", "SRA1494713", "CNAG", "REPROMOL, Molecular Biology, Universidad de Le\u00f3n", 2, 0.94714, 0.94834, 0.33142, 0.32934, 0.74884, 0.75179, 0.69759, 0.67569, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Spain", "2022-09-09", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [71332, "SRR21497240", "SRX17500546", "SRS15052262", "SRP396406", "PRJNA878705", "Effect of chronic stress on zebrafish testicular gene expression", "GSE212999", "Transcriptome Analysis", "To investigate the potential deleterious impact of chronic stress at molecular level in testicular tissue  we exposed zebrafish males to chronic stress during 21 days  covering around three complete cycles of spermatogenesis in the species Overall design: We then performed gene expression profiling in the stress exposed group and the control one.", null, null, null, "Sample 6 AU1012 STRSS2", "GSM6568313", null, "source name:Testicle|tissue:Testicle|genotype:WT|treatment:Chronically stressed", "Sample 6 AU1012 STRSS2", "Alignment using STAR 2.7.8a using ENCODE parameters Quantification using RSEM 1.3.0 Quantification with annotation Ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV file with raw counts", "Testicle", null, "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "tissue:Testicle|genotype:WT|treatment:Chronically stressed", "GSM6568313", "GSM6568313: Sample 6 AU1012 STRSS2; Danio rerio; RNA Seq", "GSM6568313 r1", "GSM6568313", "1", "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP396406", null, "loader:fastq load.py", "AU1012_5712AF_H25T2DMXY_1_195UDI-idt-UMI_1.fastq.gz AU1012_5712AF_H25T2DMXY_1_195UDI-idt-UMI_2.fastq.gz", "fastq fastq", 9626813346.0, 94380523.0, "GSM6568313 r1", "0:51 1:51", "A:1984308300;C:2757636814;G:2809501488;T:2075344212;N:22532", 51, 51, null, null, 1984308300, 2757636814, 2809501488, 2075344212, 22532, "SRX17500546", "SRS15052262", "SRA1494713", "CNAG", "REPROMOL, Molecular Biology, Universidad de Le\u00f3n", 2, 0.95878, 0.95625, 0.26355, 0.2585, 0.73659, 0.73671, 0.68833, 0.65567, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Spain", "2022-09-09", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [71333, "SRR21497241", "SRX17500546", "SRS15052262", "SRP396406", "PRJNA878705", "Effect of chronic stress on zebrafish testicular gene expression", "GSE212999", "Transcriptome Analysis", "To investigate the potential deleterious impact of chronic stress at molecular level in testicular tissue  we exposed zebrafish males to chronic stress during 21 days  covering around three complete cycles of spermatogenesis in the species Overall design: We then performed gene expression profiling in the stress exposed group and the control one.", null, null, null, "Sample 6 AU1012 STRSS2", "GSM6568313", null, "source name:Testicle|tissue:Testicle|genotype:WT|treatment:Chronically stressed", "Sample 6 AU1012 STRSS2", "Alignment using STAR 2.7.8a using ENCODE parameters Quantification using RSEM 1.3.0 Quantification with annotation Ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV file with raw counts", "Testicle", null, "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "tissue:Testicle|genotype:WT|treatment:Chronically stressed", "GSM6568313", "GSM6568313: Sample 6 AU1012 STRSS2; Danio rerio; RNA Seq", "GSM6568313 r1", "GSM6568313", "1", "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP396406", null, "loader:fastq load.py", "AU1012_5712AF_H25T2DMXY_2_195UDI-idt-UMI_1.fastq.gz AU1012_5712AF_H25T2DMXY_2_195UDI-idt-UMI_2.fastq.gz", "fastq fastq", 9423267246.0, 92384973.0, "GSM6568313 r2", "0:51 1:51", "A:1950259057;C:2693385806;G:2742401178;T:2037199427;N:21778", 51, 51, null, null, 1950259057, 2693385806, 2742401178, 2037199427, 21778, "SRX17500546", "SRS15052262", "SRA1494713", "CNAG", "REPROMOL, Molecular Biology, Universidad de Le\u00f3n", 2, 0.9593, 0.95562, 0.26632, 0.26197, 0.73539, 0.73626, 0.69745, 0.65719, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Spain", "2022-09-09", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [71334, "SRR21497242", "SRX17500545", "SRS15052261", "SRP396406", "PRJNA878705", "Effect of chronic stress on zebrafish testicular gene expression", "GSE212999", "Transcriptome Analysis", "To investigate the potential deleterious impact of chronic stress at molecular level in testicular tissue  we exposed zebrafish males to chronic stress during 21 days  covering around three complete cycles of spermatogenesis in the species Overall design: We then performed gene expression profiling in the stress exposed group and the control one.", null, null, null, "Sample 5 AU1011 STRSS1", "GSM6568312", null, "source name:Testicle|tissue:Testicle|genotype:WT|treatment:Chronically stressed", "Sample 5 AU1011 STRSS1", "Alignment using STAR 2.7.8a using ENCODE parameters Quantification using RSEM 1.3.0 Quantification with annotation Ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV file with raw counts", "Testicle", null, "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "tissue:Testicle|genotype:WT|treatment:Chronically stressed", "GSM6568312", "GSM6568312: Sample 5 AU1011 STRSS1; Danio rerio; RNA Seq", "GSM6568312 r1", "GSM6568312", "1", "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP396406", null, "loader:fastq load.py", "AU1011_5711AF_H25T2DMXY_1_278UDI-idt-UMI_1.fastq.gz AU1011_5711AF_H25T2DMXY_1_278UDI-idt-UMI_2.fastq.gz", "fastq fastq", 5483838852.0, 53763126.0, "GSM6568312 r1", "0:51 1:51", "A:1253556120;C:1532837524;G:1470940857;T:1226491317;N:13034", 51, 51, null, null, 1253556120, 1532837524, 1470940857, 1226491317, 13034, "SRX17500545", "SRS15052261", "SRA1494713", "CNAG", "REPROMOL, Molecular Biology, Universidad de Le\u00f3n", 2, 0.96516, 0.95624, 0.32358, 0.32348, 0.77433, 0.77674, 0.6857, 0.71998, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Spain", "2022-09-09", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [71335, "SRR21497243", "SRX17500545", "SRS15052261", "SRP396406", "PRJNA878705", "Effect of chronic stress on zebrafish testicular gene expression", "GSE212999", "Transcriptome Analysis", "To investigate the potential deleterious impact of chronic stress at molecular level in testicular tissue  we exposed zebrafish males to chronic stress during 21 days  covering around three complete cycles of spermatogenesis in the species Overall design: We then performed gene expression profiling in the stress exposed group and the control one.", null, null, null, "Sample 5 AU1011 STRSS1", "GSM6568312", null, "source name:Testicle|tissue:Testicle|genotype:WT|treatment:Chronically stressed", "Sample 5 AU1011 STRSS1", "Alignment using STAR 2.7.8a using ENCODE parameters Quantification using RSEM 1.3.0 Quantification with annotation Ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV file with raw counts", "Testicle", null, "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "tissue:Testicle|genotype:WT|treatment:Chronically stressed", "GSM6568312", "GSM6568312: Sample 5 AU1011 STRSS1; Danio rerio; RNA Seq", "GSM6568312 r1", "GSM6568312", "1", "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP396406", null, "loader:fastq load.py", "AU1011_5711AF_H25T2DMXY_2_278UDI-idt-UMI_1.fastq.gz AU1011_5711AF_H25T2DMXY_2_278UDI-idt-UMI_2.fastq.gz", "fastq fastq", 5408414850.0, 53023675.0, "GSM6568312 r2", "0:51 1:51", "A:1239028759;C:1509175771;G:1447989732;T:1212208077;N:12511", 51, 51, null, null, 1239028759, 1509175771, 1447989732, 1212208077, 12511, "SRX17500545", "SRS15052261", "SRA1494713", "CNAG", "REPROMOL, Molecular Biology, Universidad de Le\u00f3n", 2, 0.96493, 0.95575, 0.32376, 0.32336, 0.7726, 0.7763, 0.70883, 0.71826, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Spain", "2022-09-09", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [71336, "SRR21497244", "SRX17500544", "SRS15052260", "SRP396406", "PRJNA878705", "Effect of chronic stress on zebrafish testicular gene expression", "GSE212999", "Transcriptome Analysis", "To investigate the potential deleterious impact of chronic stress at molecular level in testicular tissue  we exposed zebrafish males to chronic stress during 21 days  covering around three complete cycles of spermatogenesis in the species Overall design: We then performed gene expression profiling in the stress exposed group and the control one.", null, null, null, "Sample 4 AU1009 CTRL4", "GSM6568311", null, "source name:Testicle|tissue:Testicle|genotype:WT|treatment:Control", "Sample 4 AU1009 CTRL4", "Alignment using STAR 2.7.8a using ENCODE parameters Quantification using RSEM 1.3.0 Quantification with annotation Ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV file with raw counts", "Testicle", null, "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "tissue:Testicle|genotype:WT|treatment:Control", "GSM6568311", "GSM6568311: Sample 4 AU1009 CTRL4; Danio rerio; RNA Seq", "GSM6568311 r1", "GSM6568311", "1", "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP396406", null, "loader:fastq load.py", "AU1009_6480AF_HFYVNDRXY_1_24UDI-idt-UMI_1.fastq.gz AU1009_6480AF_HFYVNDRXY_1_24UDI-idt-UMI_2.fastq.gz", "fastq fastq", 6509397138.0, 63817619.0, "GSM6568311 r1", "0:51 1:51", "A:1479622143;C:1838294826;G:1757992548;T:1433278489;N:209132", 51, 51, null, null, 1479622143, 1838294826, 1757992548, 1433278489, 209132, "SRX17500544", "SRS15052260", "SRA1494713", "CNAG", "REPROMOL, Molecular Biology, Universidad de Le\u00f3n", 2, 0.97248, 0.97046, 0.30954, 0.31342, 0.81199, 0.81531, 0.72036, 0.73561, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Spain", "2022-09-09", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [71337, "SRR21497245", "SRX17500544", "SRS15052260", "SRP396406", "PRJNA878705", "Effect of chronic stress on zebrafish testicular gene expression", "GSE212999", "Transcriptome Analysis", "To investigate the potential deleterious impact of chronic stress at molecular level in testicular tissue  we exposed zebrafish males to chronic stress during 21 days  covering around three complete cycles of spermatogenesis in the species Overall design: We then performed gene expression profiling in the stress exposed group and the control one.", null, null, null, "Sample 4 AU1009 CTRL4", "GSM6568311", null, "source name:Testicle|tissue:Testicle|genotype:WT|treatment:Control", "Sample 4 AU1009 CTRL4", "Alignment using STAR 2.7.8a using ENCODE parameters Quantification using RSEM 1.3.0 Quantification with annotation Ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV file with raw counts", "Testicle", null, "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "tissue:Testicle|genotype:WT|treatment:Control", "GSM6568311", "GSM6568311: Sample 4 AU1009 CTRL4; Danio rerio; RNA Seq", "GSM6568311 r1", "GSM6568311", "1", "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP396406", null, "loader:fastq load.py", "AU1009_6480AF_HFYVNDRXY_2_24UDI-idt-UMI_1.fastq.gz AU1009_6480AF_HFYVNDRXY_2_24UDI-idt-UMI_2.fastq.gz", "fastq fastq", 6371072184.0, 62461492.0, "GSM6568311 r2", "0:51 1:51", "A:1449600326;C:1798621683;G:1718988370;T:1403637608;N:224197", 51, 51, null, null, 1449600326, 1798621683, 1718988370, 1403637608, 224197, "SRX17500544", "SRS15052260", "SRA1494713", "CNAG", "REPROMOL, Molecular Biology, Universidad de Le\u00f3n", 2, 0.97264, 0.96982, 0.30877, 0.31437, 0.81335, 0.81584, 0.71969, 0.73176, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Spain", "2022-09-09", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [71338, "SRR21497246", "SRX17500543", "SRS15052259", "SRP396406", "PRJNA878705", "Effect of chronic stress on zebrafish testicular gene expression", "GSE212999", "Transcriptome Analysis", "To investigate the potential deleterious impact of chronic stress at molecular level in testicular tissue  we exposed zebrafish males to chronic stress during 21 days  covering around three complete cycles of spermatogenesis in the species Overall design: We then performed gene expression profiling in the stress exposed group and the control one.", null, null, null, "Sample 3 AU1008 CTRL3", "GSM6568310", null, "source name:Testicle|tissue:Testicle|genotype:WT|treatment:Control", "Sample 3 AU1008 CTRL3", "Alignment using STAR 2.7.8a using ENCODE parameters Quantification using RSEM 1.3.0 Quantification with annotation Ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV file with raw counts", "Testicle", null, "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "tissue:Testicle|genotype:WT|treatment:Control", "GSM6568310", "GSM6568310: Sample 3 AU1008 CTRL3; Danio rerio; RNA Seq", "GSM6568310 r1", "GSM6568310", "1", "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP396406", null, "loader:fastq load.py", "AU1008_6479AF_HFYVNDRXY_1_12UDI-idt-UMI_1.fastq.gz AU1008_6479AF_HFYVNDRXY_1_12UDI-idt-UMI_2.fastq.gz", "fastq fastq", 6145653000.0, 60251500.0, "GSM6568310 r1", "0:51 1:51", "A:1412278292;C:1714005085;G:1634673089;T:1384497306;N:199228", 51, 51, null, null, 1412278292, 1714005085, 1634673089, 1384497306, 199228, "SRX17500543", "SRS15052259", "SRA1494713", "CNAG", "REPROMOL, Molecular Biology, Universidad de Le\u00f3n", 2, 0.96952, 0.96837, 0.31965, 0.32353, 0.78287, 0.78742, 0.71968, 0.71522, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Spain", "2022-09-09", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [71339, "SRR21497247", "SRX17500543", "SRS15052259", "SRP396406", "PRJNA878705", "Effect of chronic stress on zebrafish testicular gene expression", "GSE212999", "Transcriptome Analysis", "To investigate the potential deleterious impact of chronic stress at molecular level in testicular tissue  we exposed zebrafish males to chronic stress during 21 days  covering around three complete cycles of spermatogenesis in the species Overall design: We then performed gene expression profiling in the stress exposed group and the control one.", null, null, null, "Sample 3 AU1008 CTRL3", "GSM6568310", null, "source name:Testicle|tissue:Testicle|genotype:WT|treatment:Control", "Sample 3 AU1008 CTRL3", "Alignment using STAR 2.7.8a using ENCODE parameters Quantification using RSEM 1.3.0 Quantification with annotation Ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV file with raw counts", "Testicle", null, "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "tissue:Testicle|genotype:WT|treatment:Control", "GSM6568310", "GSM6568310: Sample 3 AU1008 CTRL3; Danio rerio; RNA Seq", "GSM6568310 r1", "GSM6568310", "1", "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP396406", null, "loader:fastq load.py", "AU1008_6479AF_HFYVNDRXY_2_12UDI-idt-UMI_1.fastq.gz AU1008_6479AF_HFYVNDRXY_2_12UDI-idt-UMI_2.fastq.gz", "fastq fastq", 5986839714.0, 58694507.0, "GSM6568310 r2", "0:51 1:51", "A:1376941205;C:1669376884;G:1591045173;T:1349265748;N:210704", 51, 51, null, null, 1376941205, 1669376884, 1591045173, 1349265748, 210704, "SRX17500543", "SRS15052259", "SRA1494713", "CNAG", "REPROMOL, Molecular Biology, Universidad de Le\u00f3n", 2, 0.96969, 0.9685, 0.32009, 0.32581, 0.7849, 0.7876, 0.71867, 0.72919, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Spain", "2022-09-09", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [71340, "SRR21497248", "SRX17500542", "SRS15052258", "SRP396406", "PRJNA878705", "Effect of chronic stress on zebrafish testicular gene expression", "GSE212999", "Transcriptome Analysis", "To investigate the potential deleterious impact of chronic stress at molecular level in testicular tissue  we exposed zebrafish males to chronic stress during 21 days  covering around three complete cycles of spermatogenesis in the species Overall design: We then performed gene expression profiling in the stress exposed group and the control one.", null, null, null, "Sample 2 AU1007 CTRL2", "GSM6568309", null, "source name:Testicle|tissue:Testicle|genotype:WT|treatment:Control", "Sample 2 AU1007 CTRL2", "Alignment using STAR 2.7.8a using ENCODE parameters Quantification using RSEM 1.3.0 Quantification with annotation Ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV file with raw counts", "Testicle", null, "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "tissue:Testicle|genotype:WT|treatment:Control", "GSM6568309", "GSM6568309: Sample 2 AU1007 CTRL2; Danio rerio; RNA Seq", "GSM6568309 r1", "GSM6568309", "1", "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP396406", null, "loader:fastq load.py", "AU1007_5707AF_H25T2DMXY_1_230UDI-idt-UMI_1.fastq.gz AU1007_5707AF_H25T2DMXY_1_230UDI-idt-UMI_2.fastq.gz", "fastq fastq", 7505020362.0, 73578631.0, "GSM6568309 r1", "0:51 1:51", "A:1994095154;C:1720542284;G:1716052918;T:2074312037;N:17969", 51, 51, null, null, 1994095154, 1720542284, 1716052918, 2074312037, 17969, "SRX17500542", "SRS15052258", "SRA1494713", "CNAG", "REPROMOL, Molecular Biology, Universidad de Le\u00f3n", 2, 0.92058, 0.91439, 0.34835, 0.34788, 0.63867, 0.6392, 0.55075, 0.54397, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Spain", "2022-09-09", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [71341, "SRR21497249", "SRX17500542", "SRS15052258", "SRP396406", "PRJNA878705", "Effect of chronic stress on zebrafish testicular gene expression", "GSE212999", "Transcriptome Analysis", "To investigate the potential deleterious impact of chronic stress at molecular level in testicular tissue  we exposed zebrafish males to chronic stress during 21 days  covering around three complete cycles of spermatogenesis in the species Overall design: We then performed gene expression profiling in the stress exposed group and the control one.", null, null, null, "Sample 2 AU1007 CTRL2", "GSM6568309", null, "source name:Testicle|tissue:Testicle|genotype:WT|treatment:Control", "Sample 2 AU1007 CTRL2", "Alignment using STAR 2.7.8a using ENCODE parameters Quantification using RSEM 1.3.0 Quantification with annotation Ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV file with raw counts", "Testicle", null, "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "tissue:Testicle|genotype:WT|treatment:Control", "GSM6568309", "GSM6568309: Sample 2 AU1007 CTRL2; Danio rerio; RNA Seq", "GSM6568309 r1", "GSM6568309", "1", "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP396406", null, "loader:fastq load.py", "AU1007_5707AF_H25T2DMXY_2_230UDI-idt-UMI_1.fastq.gz AU1007_5707AF_H25T2DMXY_2_230UDI-idt-UMI_2.fastq.gz", "fastq fastq", 7425266766.0, 72796733.0, "GSM6568309 r2", "0:51 1:51", "A:1976937738;C:1698898360;G:1694114006;T:2055299272;N:17390", 51, 51, null, null, 1976937738, 1698898360, 1694114006, 2055299272, 17390, "SRX17500542", "SRS15052258", "SRA1494713", "CNAG", "REPROMOL, Molecular Biology, Universidad de Le\u00f3n", 2, 0.91956, 0.91454, 0.35046, 0.35127, 0.63536, 0.63802, 0.53838, 0.53858, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Spain", "2022-09-09", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [71342, "SRR21497250", "SRX17500541", "SRS15052257", "SRP396406", "PRJNA878705", "Effect of chronic stress on zebrafish testicular gene expression", "GSE212999", "Transcriptome Analysis", "To investigate the potential deleterious impact of chronic stress at molecular level in testicular tissue  we exposed zebrafish males to chronic stress during 21 days  covering around three complete cycles of spermatogenesis in the species Overall design: We then performed gene expression profiling in the stress exposed group and the control one.", null, null, null, "Sample 1 AU1006 CTRL1", "GSM6568308", null, "source name:Testicle|tissue:Testicle|genotype:WT|treatment:Control", "Sample 1 AU1006 CTRL1", "Alignment using STAR 2.7.8a using ENCODE parameters Quantification using RSEM 1.3.0 Quantification with annotation Ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV file with raw counts", "Testicle", null, "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "tissue:Testicle|genotype:WT|treatment:Control", "GSM6568308", "GSM6568308: Sample 1 AU1006 CTRL1; Danio rerio; RNA Seq", "GSM6568308 r1", "GSM6568308", "1", "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP396406", null, "loader:fastq load.py", "AU1006_5706AF_H25T2DMXY_1_218UDI-idt-UMI_1.fastq.gz AU1006_5706AF_H25T2DMXY_1_218UDI-idt-UMI_2.fastq.gz", "fastq fastq", 7688979708.0, 75382154.0, "GSM6568308 r1", "0:51 1:51", "A:2058869304;C:1755298338;G:1745020739;T:2129772865;N:18462", 51, 51, null, null, 2058869304, 1755298338, 1745020739, 2129772865, 18462, "SRX17500541", "SRS15052257", "SRA1494713", "CNAG", "REPROMOL, Molecular Biology, Universidad de Le\u00f3n", 2, 0.91942, 0.91596, 0.3597, 0.358, 0.63832, 0.63984, 0.54181, 0.54518, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Spain", "2022-09-09", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [71343, "SRR21497251", "SRX17500541", "SRS15052257", "SRP396406", "PRJNA878705", "Effect of chronic stress on zebrafish testicular gene expression", "GSE212999", "Transcriptome Analysis", "To investigate the potential deleterious impact of chronic stress at molecular level in testicular tissue  we exposed zebrafish males to chronic stress during 21 days  covering around three complete cycles of spermatogenesis in the species Overall design: We then performed gene expression profiling in the stress exposed group and the control one.", null, null, null, "Sample 1 AU1006 CTRL1", "GSM6568308", null, "source name:Testicle|tissue:Testicle|genotype:WT|treatment:Control", "Sample 1 AU1006 CTRL1", "Alignment using STAR 2.7.8a using ENCODE parameters Quantification using RSEM 1.3.0 Quantification with annotation Ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV file with raw counts", "Testicle", null, "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "tissue:Testicle|genotype:WT|treatment:Control", "GSM6568308", "GSM6568308: Sample 1 AU1006 CTRL1; Danio rerio; RNA Seq", "GSM6568308 r1", "GSM6568308", "1", "RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 \u00b5g of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP396406", null, "loader:fastq load.py", "AU1006_5706AF_H25T2DMXY_2_218UDI-idt-UMI_1.fastq.gz AU1006_5706AF_H25T2DMXY_2_218UDI-idt-UMI_2.fastq.gz", "fastq fastq", 7604731992.0, 74556196.0, "GSM6568308 r2", "0:51 1:51", "A:2040184020;C:1732865855;G:1722331901;T:2109332679;N:17537", 51, 51, null, null, 2040184020, 1732865855, 1722331901, 2109332679, 17537, "SRX17500541", "SRS15052257", "SRA1494713", "CNAG", "REPROMOL, Molecular Biology, Universidad de Le\u00f3n", 2, 0.91853, 0.91507, 0.36358, 0.36043, 0.63832, 0.63968, 0.53976, 0.54937, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Spain", "2022-09-09", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [71390, "SRR21529724", "SRX17532083", "SRS15080530", "SRP396693", "PRJNA879314", "Transcriptome analysis of WT and cdk1 /  zebrafish testis.", "PRJNA879314", "Other", "Transcriptome analysis of WT and cdk1 /  zebrafish testis. To explore the effect of cdk1 deletion on testis development and cell cycle in zebrafish.", null, null, null, "Danio rerio", "zebrafish", null, "strain:Wild population|age:1|sex:male|tissue:testis|geo loc name:China:Wuhan|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "Transcriptome analysis of WT and cdk1 / zebrafish testis", "WT and cdk1 /  zebrafish testis", "WT and cdk1 /  zebrafish testis", "Total RNAs were extracted from the spermatogonia of experimental fish using Trizol. The construction of the cDNA library and sequencing were performed using Illumina NovaSeq 6000 HiSeq", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP396693", null, null, "L1EFK171176--WT_1.R1.raw.fastq.gz L1EFK171176--WT_1.R2.raw.fastq.gz L1EFK171177--WT_2.R1.raw.fastq.gz L1EFK171177--WT_2.R2.raw.fastq.gz L1EFK171178--WT_3.R1.raw.fastq.gz L1EFK171178--WT_3.R2.raw.fastq.gz L1EFK171179--cdk_1.R1.raw.fastq.gz L1EFK171179--cdk_1.R2.raw.fastq.gz L1EFK171180--cdk_2.R1.raw.fastq.gz L1EFK171180--cdk_2.R2.raw.fastq.gz L1EFK171181--cdk_3.R1.raw.fastq.gz L1EFK171181--cdk_3.R2.raw.fastq.gz", "fastq fastq fastq fastq fastq fastq fastq fastq fastq fastq fastq fastq", 42093812772.0, 139383486.0, "L1EFK171176  WT 1.R1.raw.fastq.gz", "0:151 1:151", "A:11032877415;C:9928091970;G:10375381857;T:10756803003;N:658527", 151, 151, null, null, 11032877415, 9928091970, 10375381857, 10756803003, 658527, "SRX17532083", "SRS15080530", "SRA1495115", "Huazhong Agricultural University|College of Fisheries", "Huazhong Agricultural University", 2, 0.93915, 0.93965, 0.06748, 0.06739, 0.65652, 0.65537, 0.49084, 0.49358, 151, 151, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "China", "2022-09-12", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [74613, "SRR23868264", "SRX19680348", "SRS17049789", "SRP427394", "PRJNA944944", "Comparative transcriptome analysis of testes and ovaries reveals sex biased genes and pathways in zebrafish", "GSE227389", "Transcriptome Analysis", "The goals of this study are to compare the differentially expressed genes between testes and ovaries of zebrafish  based on RNA seq data and some of these genes were validated by qRT\u2013PCR.Further  the differentially expressed genes were devided into up regulated and down regulated genes for GO and KEGG analysis. Overall design: Testes and ovaries  mRNA profiles of adult  zebrafish were generated by deep sequencing. Every sample was compose of three  adult individuals.", null, "pubmed:38242380", null, "testes", "GSM7099751", null, "source name:testis|tissue:testis|genotype:WT|geo loc name:missing|collection date:missing", "testes", "Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence  then mapped to GRCz10 whole genome using HISAT  mapped to genes using Bowtie2. fragments per kilo bases per million fragments FPKM were calculated using RSEM. Assembly: GRCz10 Supplementary files format and content: The text files include the Ensembl ID of genes and the FPKM values for each Sample.", "testis", null, "Testes and ovaries were isolated  frozen on dry ice  and RNA was harvested using Trizol reagent. Agilent RNA 6000 nano Reagents Port 1 was used for RNA qualities analysis by Agilent 2100 Bioanalyzer. RNA libraries were prepared for sequencing using standard BGISEQ 500 protocols.", null, "tissue:testis|genotype:WT", "GSM7099751", "GSM7099751: testes; Danio rerio; RNA Seq", "GSM7099751 r1", "GSM7099751", "1", "Testes and ovaries were isolated  frozen on dry ice  and RNA was harvested using Trizol reagent. Agilent RNA 6000 nano Reagents Port 1 was used for RNA qualities analysis by Agilent 2100 Bioanalyzer. RNA libraries were prepared for sequencing using standard BGISEQ 500 protocols.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "BGISEQ", "BGISEQ-500", null, "SRP427394", null, null, "WT-testis.fq.gz", "fastq", 1176068400.0, 23521368.0, "GSM7099751 r1", "0:50", "A:323799672;C:262049848;G:273563529;T:316045968;N:609383", 50, null, null, null, 323799672, 262049848, 273563529, 316045968, 609383, "SRX19680348", "SRS17049789", "SRA1687194", "Wuhan university", "Wuhan university", 1, 0.93023, null, 0.11308, null, 0.6462, null, 0.49784, null, 50, null, "B", null, "usable mapping rate", "bgi", "bgi", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "China", "2023-03-15", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [74614, "SRR23868265", "SRX19680347", "SRS17049788", "SRP427394", "PRJNA944944", "Comparative transcriptome analysis of testes and ovaries reveals sex biased genes and pathways in zebrafish", "GSE227389", "Transcriptome Analysis", "The goals of this study are to compare the differentially expressed genes between testes and ovaries of zebrafish  based on RNA seq data and some of these genes were validated by qRT\u2013PCR.Further  the differentially expressed genes were devided into up regulated and down regulated genes for GO and KEGG analysis. Overall design: Testes and ovaries  mRNA profiles of adult  zebrafish were generated by deep sequencing. Every sample was compose of three  adult individuals.", null, "pubmed:38242380", null, "ovaries", "GSM7099752", null, "source name:ovary|tissue:ovary|genotype:WT|geo loc name:missing|collection date:missing", "ovaries", "Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence  then mapped to GRCz10 whole genome using HISAT  mapped to genes using Bowtie2. fragments per kilo bases per million fragments FPKM were calculated using RSEM. Assembly: GRCz10 Supplementary files format and content: The text files include the Ensembl ID of genes and the FPKM values for each Sample.", "ovary", null, "Testes and ovaries were isolated  frozen on dry ice  and RNA was harvested using Trizol reagent. Agilent RNA 6000 nano Reagents Port 1 was used for RNA qualities analysis by Agilent 2100 Bioanalyzer. RNA libraries were prepared for sequencing using standard BGISEQ 500 protocols.", null, "tissue:ovary|genotype:WT", "GSM7099752", "GSM7099752: ovaries; Danio rerio; RNA Seq", "GSM7099752 r1", "GSM7099752", "1", "Testes and ovaries were isolated  frozen on dry ice  and RNA was harvested using Trizol reagent. Agilent RNA 6000 nano Reagents Port 1 was used for RNA qualities analysis by Agilent 2100 Bioanalyzer. RNA libraries were prepared for sequencing using standard BGISEQ 500 protocols.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "BGISEQ", "BGISEQ-500", null, "SRP427394", null, null, "WT-ovary.fq.gz", "fastq", 1176463600.0, 23529272.0, "GSM7099752 r1", "0:50", "A:311869864;C:270650722;G:289863261;T:303489229;N:590524", 50, null, null, null, 311869864, 270650722, 289863261, 303489229, 590524, "SRX19680347", "SRS17049788", "SRA1687194", "Wuhan university", "Wuhan university", 1, 0.93488, null, 0.02755, null, 0.75601, null, 0.46986, null, 50, null, "B", null, "usable mapping rate", "bgi", "bgi", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "China", "2023-03-15", "Undetermined", "Undetermined", "Gonad", "Reproductive System"]], "truncated": false, "filtered_table_rows_count": 92, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"devstage_curation_coarse\" = :p0 and \"tissue_curation\" = :p1 order by rowid limit 101", "params": {"p0": "Undetermined", "p1": "Gonad"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&tissue_curation=Gonad", "results": [{"value": "RNA-Seq", "label": "RNA-Seq", "count": 78, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&tissue_curation=Gonad&experiment.library_strategy=RNA-Seq", "selected": false}, {"value": "miRNA-Seq", "label": "miRNA-Seq", "count": 12, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&tissue_curation=Gonad&experiment.library_strategy=miRNA-Seq", "selected": false}, {"value": "ncRNA-Seq", "label": "ncRNA-Seq", "count": 2, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&tissue_curation=Gonad&experiment.library_strategy=ncRNA-Seq", "selected": false}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&tissue_curation=Gonad", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 92, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&tissue_curation=Gonad&experiment.library_source=TRANSCRIPTOMIC", "selected": false}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&tissue_curation=Gonad", "results": [{"value": "cDNA", "label": "cDNA", "count": 63, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&tissue_curation=Gonad&experiment.library_selection=cDNA", "selected": false}, {"value": "size fractionation", "label": "size fractionation", "count": 14, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&tissue_curation=Gonad&experiment.library_selection=size+fractionation", "selected": false}, {"value": "PCR", "label": "PCR", "count": 12, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&tissue_curation=Gonad&experiment.library_selection=PCR", "selected": false}, {"value": "other", "label": "other", "count": 3, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&tissue_curation=Gonad&experiment.library_selection=other", "selected": false}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&tissue_curation=Gonad", "results": [{"value": "PAIRED", "label": "PAIRED", "count": 69, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&tissue_curation=Gonad&experiment.library_layout=PAIRED", "selected": false}, {"value": "SINGLE", "label": "SINGLE", "count": 23, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&tissue_curation=Gonad&experiment.library_layout=SINGLE", "selected": false}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&tissue_curation=Gonad", "results": [{"value": "ILLUMINA", "label": "ILLUMINA", "count": 90, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&tissue_curation=Gonad&experiment.platform=ILLUMINA", "selected": false}, {"value": "BGISEQ", "label": "BGISEQ", "count": 2, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&tissue_curation=Gonad&experiment.platform=BGISEQ", "selected": false}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&tissue_curation=Gonad", "results": [{"value": "Undetermined", "label": "Undetermined", "count": 92, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?tissue_curation=Gonad", "selected": true}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&tissue_curation=Gonad", "results": [{"value": "Undetermined", "label": "Undetermined", "count": 92, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&tissue_curation=Gonad&devstage_curation=Undetermined", "selected": false}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&tissue_curation=Gonad", "results": [{"value": "Reproductive System", "label": "Reproductive System", "count": 92, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&tissue_curation=Gonad&tissue_curation_coarse=Reproductive+System", "selected": false}], "truncated": false}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&tissue_curation=Gonad", "results": [{"value": "Gonad", "label": "Gonad", "count": 92, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined", "selected": true}], "truncated": false}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&tissue_curation=Gonad", "results": [{"value": "unknown", "label": "unknown", "count": 74, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&tissue_curation=Gonad&technology=unknown", "selected": false}, {"value": "bulk", "label": "bulk", "count": 16, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&tissue_curation=Gonad&technology=bulk", "selected": false}, {"value": "generic-scrnaseq-only", "label": "generic-scrnaseq-only", "count": 2, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&tissue_curation=Gonad&technology=generic-scrnaseq-only", "selected": false}], "truncated": false}}, "suggested_facets": [], "next": null, "next_url": null, "private": false, "allow_execute_sql": true, "query_ms": 116.50935698708054}