{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where devstage_curation_coarse = \"Undetermined\" and technology = 454", "rows": [[67908, "SRR017341", "SRX003632", "SRS002067", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish N", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishN", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "N_fish.tar", "fastq", 40231384.0, 173756.0, "Zebrafish IgH cDNA FishN", "0:4 1:227.54", "A:10436935;C:8800020;G:9512025;T:11471941;N:10463", 4, 227, null, null, 10436935, 8800020, 9512025, 11471941, 10463, "SRX003632", "SRS002067", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.26487, null, 0.0663, null, 0.99304, null, 0.01389, null, 229, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67909, "SRR017340", "SRX003631", "SRS002066", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish M", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishM", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "M_fish.tar", "fastq", 37492198.0, 161639.0, "Zebrafish IgH cDNA FishM", "0:4 1:227.95", "A:9527141;C:8129088;G:9025760;T:10804127;N:6082", 4, 227, null, null, 9527141, 8129088, 9025760, 10804127, 6082, "SRX003631", "SRS002066", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.31521, null, 0.11394, null, 0.99823, null, 0.00291, null, 208, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67910, "SRR017339", "SRX003630", "SRS002065", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish L", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishL", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "L_fish.tar", "fastq", 37971443.0, 163701.0, "Zebrafish IgH cDNA FishL", "0:4 1:227.96", "A:9544875;C:8363123;G:9094601;T:10963684;N:5160", 4, 227, null, null, 9544875, 8363123, 9094601, 10963684, 5160, "SRX003630", "SRS002065", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.29057, null, 0.07862, null, 0.99636, null, 0.00534, null, 245, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67911, "SRR017338", "SRX003629", "SRS002064", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish K", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishK", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "K_fish.tar", "fastq", 54201403.0, 234266.0, "Zebrafish IgH cDNA FishK", "0:4 1:227.37", "A:13608677;C:11652239;G:12945164;T:15975205;N:20118", 4, 227, null, null, 13608677, 11652239, 12945164, 15975205, 20118, "SRX003629", "SRS002064", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.27218, null, 0.07987, null, 0.99275, null, 0.01242, null, 244, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67912, "SRR017337", "SRX003628", "SRS002063", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish J", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishJ", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "J_fish.tar", "fastq", 51915342.0, 224027.0, "Zebrafish IgH cDNA FishJ", "0:4 1:227.74", "A:12664582;C:12040983;G:12609762;T:14589770;N:10245", 4, 227, null, null, 12664582, 12040983, 12609762, 14589770, 10245, "SRX003628", "SRS002063", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.29028, null, 0.10039, null, 0.9964, null, 0.00625, null, 97, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67913, "SRR017336", "SRX003627", "SRS002062", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish I", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishI", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "I_fish.tar", "fastq", 23436268.0, 100120.0, "Zebrafish IgH cDNA FishI", "0:4 1:230.08", "A:5801823;C:5246438;G:5587169;T:6797624;N:3214", 4, 230, null, null, 5801823, 5246438, 5587169, 6797624, 3214, "SRX003627", "SRS002062", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.34362, null, 0.0757, null, 0.99241, null, 0.02647, null, 232, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67914, "SRR017335", "SRX003626", "SRS002061", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish H", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishH", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "H_fish.tar", "fastq", 48443452.0, 213531.0, "Zebrafish IgH cDNA FishH", "0:4 1:222.87", "A:12720681;C:10490855;G:11923926;T:13303989;N:4001", 4, 222, null, null, 12720681, 10490855, 11923926, 13303989, 4001, "SRX003626", "SRS002061", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.45847, null, 0.04709, null, 0.98754, null, 0.0161, null, 56, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67915, "SRR017334", "SRX003625", "SRS002060", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish G", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishG", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "G_fish.tar", "fastq", 50095821.0, 217866.0, "Zebrafish IgH cDNA FishG", "0:4 1:225.94", "A:13182103;C:11299206;G:11909574;T:13700817;N:4121", 4, 225, null, null, 13182103, 11299206, 11909574, 13700817, 4121, "SRX003625", "SRS002060", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.37294, null, 0.09947, null, 0.99034, null, 0.02245, null, 230, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67916, "SRR017333", "SRX003624", "SRS002059", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish F", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishF", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "F_fish.tar", "fastq", 16577798.0, 83387.0, "Zebrafish IgH cDNA FishF", "0:4 1:194.81", "A:4215316;C:3618457;G:4002690;T:4736893;N:4442", 4, 194, null, null, 4215316, 3618457, 4002690, 4736893, 4442, "SRX003624", "SRS002059", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.57361, null, 0.0727, null, 0.99965, null, 0.00026, null, 62, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67917, "SRR017332", "SRX003623", "SRS002058", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish E", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishE", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "E_fish.tar", "fastq", 29705006.0, 131553.0, "Zebrafish IgH cDNA FishE", "0:4 1:221.80", "A:7474430;C:6417563;G:7115572;T:8693543;N:3898", 4, 221, null, null, 7474430, 6417563, 7115572, 8693543, 3898, "SRX003623", "SRS002058", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.3099, null, 0.09802, null, 0.99904, null, 0.00099, null, 45, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67918, "SRR017331", "SRX003622", "SRS002057", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish D", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishD", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "D_fish.tar", "fastq", 27611909.0, 123468.0, "Zebrafish IgH cDNA FishD", "0:4 1:219.64", "A:6809564;C:6219469;G:6636933;T:7943112;N:2831", 4, 219, null, null, 6809564, 6219469, 6636933, 7943112, 2831, "SRX003622", "SRS002057", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.45962, null, 0.09396, null, 0.99941, null, 0.00026, null, 218, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67919, "SRR017330", "SRX003621", "SRS002056", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish C", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishC", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "C_fish.tar", "fastq", 21845405.0, 95733.0, "Zebrafish IgH cDNA FishC", "0:4 1:224.19", "A:5735195;C:4746747;G:5266352;T:6095066;N:2045", 4, 224, null, null, 5735195, 4746747, 5266352, 6095066, 2045, "SRX003621", "SRS002056", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.38908, null, 0.20497, null, 0.99967, null, 0.00047, null, 145, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67920, "SRR017329", "SRX003620", "SRS002055", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish B", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishB", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "B_fish.tar", "fastq", 26680294.0, 118385.0, "Zebrafish IgH cDNA FishB", "0:4 1:221.37", "A:6380496;C:6168810;G:6541530;T:7587018;N:2440", 4, 221, null, null, 6380496, 6168810, 6541530, 7587018, 2440, "SRX003620", "SRS002055", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.35498, null, 0.14675, null, 0.99906, null, 0.00098, null, 228, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67921, "SRR017328", "SRX003619", "SRS002054", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish A", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishA", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "A_fish.tar", "fastq", 13497752.0, 61111.0, "Zebrafish IgH cDNA FishA", "0:4 1:216.87", "A:3287411;C:3078068;G:3224467;T:3906026;N:1780", 4, 216, null, null, 3287411, 3078068, 3224467, 3906026, 1780, "SRX003619", "SRS002054", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.32333, null, 0.14098, null, 0.99937, null, 0.00169, null, 52, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"]], "truncated": false, "filtered_table_rows_count": 14, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"devstage_curation_coarse\" = :p0 and \"technology\" = :p1 order by rowid limit 101", "params": {"p0": "Undetermined", "p1": "454"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&technology=454", "results": [{"value": "AMPLICON", "label": "AMPLICON", "count": 14, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&technology=454&experiment.library_strategy=AMPLICON", "selected": false}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&technology=454", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 14, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&technology=454&experiment.library_source=TRANSCRIPTOMIC", "selected": false}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&technology=454", "results": [{"value": "PCR", "label": "PCR", "count": 14, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&technology=454&experiment.library_selection=PCR", "selected": false}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&technology=454", "results": [{"value": "SINGLE", "label": "SINGLE", "count": 14, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&technology=454&experiment.library_layout=SINGLE", "selected": false}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&technology=454", "results": [{"value": "LS454", "label": "LS454", "count": 14, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&technology=454&experiment.platform=LS454", "selected": false}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&technology=454", "results": [{"value": "Undetermined", "label": "Undetermined", "count": 14, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?technology=454", "selected": true}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&technology=454", "results": [{"value": "Undetermined", "label": "Undetermined", "count": 14, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&technology=454&devstage_curation=Undetermined", "selected": false}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&technology=454", "results": [{"value": "Hematopoietic System", "label": "Hematopoietic System", "count": 14, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&technology=454&tissue_curation_coarse=Hematopoietic+System", "selected": false}], "truncated": false}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&technology=454", "results": [{"value": "BCR TCR repertoire", "label": "BCR TCR repertoire", "count": 14, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&technology=454&tissue_curation=BCR+TCR+repertoire", "selected": false}], "truncated": false}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&technology=454", "results": [{"value": "454", "label": "454", "count": 14, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined", "selected": true}], "truncated": false}}, "suggested_facets": [], "next": null, "next_url": null, "private": false, "allow_execute_sql": true, "query_ms": 60.85774500024854}