{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where devstage_curation_coarse = \"Undetermined\" and experiment.library_strategy = \"ncRNA-Seq\"", "rows": [[44967, "SRR6345660", "SRX3442976", "SRS2733636", "SRP126106", "PRJNA421016", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]", "GSE107682", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "smRNA seq library of ovary from tdrd6a mut fish", "GSM2875719", null, "source name:Ovary from tdrd6a mut fish|tissue:whole ovary|genotype:tdrd6a mutant", "smRNA seq library of ovary from tdrd6a mut fish", "1. Adapter trimming with cutadapt  O 8  m 26  M 38  a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter   q 20  p 100  Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end  using a custom bash script. 4. UMIs were trimmed with seqtk trimfq  b 4  a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq  L 15\u00a0 6. Mapping was done to Zebrafish  Danio rerio  genome assembly Zv9 with bowtie v0.12.8   tryhard   best   strata   chunkmbs 256  v 1  M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed  bg  split  scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.\u00a0 \u00a0 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE  SINE  LTR and DNA downloaded from the UCSC genome browser repeat masker track  Zv9 using bedtools intersect  a reads  b transposons  wa  wb  bed  f 1.0  nonamecheck to keep both the read and the transposon information. The arguments  s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re  start re  end re  repFamily  repName strand re  and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons  and readlength the length of the read that. Sample is the sample name  and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.\u00a0 Supplementary files format and content: Files ending in .bw are bigwig tracks.", "Ovary from tdrd6a mut fish", null, "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", null, "tissue:whole ovary|genotype:tdrd6a mutant", "GSM2875719", "GSM2875719: smRNA seq library of ovary from tdrd6a mut fish; Danio rerio; ncRNA Seq", "GSM2875719", null, "1", "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", "GEO Accession:GSM2875719", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP126106", null, null, "Tdrd6a-mut-ovary-input-Adult.fastq.gz", "fastq", 817885062.0, 16036962.0, "GSM2875719 r1", "0:51", "A:212456064;C:163491733;G:233627239;T:208262707;N:47319", 51, null, null, null, 212456064, 163491733, 233627239, 208262707, 47319, "SRX3442976", "SRS2733636", "SRA636010", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.46308, null, 0.13668, null, 0.83587, null, 0.79104, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "5prime", "size_fractionation", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2017-12-04", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [44968, "SRR6345659", "SRX3442975", "SRS2733637", "SRP126106", "PRJNA421016", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]", "GSE107682", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "smRNA seq library of ovary from tdrd6a het fish", "GSM2875718", null, "source name:Ovary from tdrd6a het fish|tissue:whole ovary|genotype:tdrd6a heterozygous", "smRNA seq library of ovary from tdrd6a het fish", "1. Adapter trimming with cutadapt  O 8  m 26  M 38  a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter   q 20  p 100  Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end  using a custom bash script. 4. UMIs were trimmed with seqtk trimfq  b 4  a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq  L 15\u00a0 6. Mapping was done to Zebrafish  Danio rerio  genome assembly Zv9 with bowtie v0.12.8   tryhard   best   strata   chunkmbs 256  v 1  M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed  bg  split  scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.\u00a0 \u00a0 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE  SINE  LTR and DNA downloaded from the UCSC genome browser repeat masker track  Zv9 using bedtools intersect  a reads  b transposons  wa  wb  bed  f 1.0  nonamecheck to keep both the read and the transposon information. The arguments  s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re  start re  end re  repFamily  repName strand re  and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons  and readlength the length of the read that. Sample is the sample name  and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.\u00a0 Supplementary files format and content: Files ending in .bw are bigwig tracks.", "Ovary from tdrd6a het fish", null, "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", null, "tissue:whole ovary|genotype:tdrd6a heterozygous", "GSM2875718", "GSM2875718: smRNA seq library of ovary from tdrd6a het fish; Danio rerio; ncRNA Seq", "GSM2875718", null, "1", "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", "GEO Accession:GSM2875718", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP126106", null, null, "Tdrd6a-het-ovary-input-Adult.fastq.gz", "fastq", 1452353571.0, 28477521.0, "GSM2875718 r1", "0:51", "A:397993735;C:284194126;G:396142390;T:373939235;N:84085", 51, null, null, null, 397993735, 284194126, 396142390, 373939235, 84085, "SRX3442975", "SRS2733637", "SRA636010", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.3869, null, 0.1369, null, 0.86397, null, 0.77165, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "5prime", "size_fractionation", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2017-12-04", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [67823, "SRR17335719", "SRX13511115", "SRS11405356", "SRP352585", "PRJNA792582", "circRNA based biomarker candidates for acute cypermethrin and chlorpyrisfos toxication in the brain of Zebrafish Danio rerio", "GSE192669", "Transcriptome Analysis", "Cypermethrin CYP and chlorpyrifos CPF are pesticides which are frequently used in agricultural areas around the world. These chemicals have been shown to cause serious toxicological damage in the brain of fish  which is non target organisms. However  circRNAs associated with acute brain toxicity caused by cypermethrin and chlorpyrifos have not been studied yet. In this study  circRNAs were identified and characterized using RNA seq in Zebrafish brains exposed to acute cypermethrin and chlorpyrifos toxicity. A total of 10375 circRNAs were detected. It was determined that 6 circRNAs were up regulated  10 circRNAs were down regulated in CYP brain samples compared to controls . In addition  it was found that 57 circRNAs are up regulated and 3 circRNAs down regulated in CPF brain samples compared to controls. Moreover  62 circRNAs were down regulated in the CYP samples  when CYP and CPF samples were compared. However  up regulated circRNA could not be detected. It was revealed that the detected circRNAs specifically regulated the MAPK signaling pathway  endocytosis mechanism  apoptosis and p53 signaling pathway. This study  which was conducted for the first time in terms of the subject of the study  could bring a different perspective especially to pesticide toxicity studies. Overall design: Examination of  circRNA related to acute cypermethrin and chlopyrifos toxication in brain of zebrafish", null, "pubmed:35304207", null, "CPF3", "GSM5754470", null, "source name:Brain tissue|tissue:Brain|treatment:CPF toxication|geo loc name:missing|collection date:missing", "CPF3", "Raw data raw reads of FASTQ format were firstly processed through in house scripts. In this step  clean data clean reads were obtained by removing reads containing adapter and poly N sequences and reads with low quality from raw data. At the same time  Q20  Q30 and GC content of the clean data were calculated. All the downstream analyses were based on the clean data with high quality.An upgraded computational pipeline CIRCexplorer2 is applied to detect circRNAs and identify alternative back splicing in back spliced circular RNAs circRNAs The expression of circRNAs is usually represented by the fragments that are mapped to the back spliced exon\u2013exon junction sites. In addition to the raw fragment numbers  normalized RNA seq fragments that are mapped to a specific back spliced exon\u2013exon junction by total mapped fragments is used to quantitate circRNA expression. With FPM Fragments mapped to back  spliced junction Per Million mapped fragments  circRNAs from different samples with distinct sequencing depths can be directly compared. The input data for differential gene expression analysis is read counts from gene expression level analysis. For DESeq2 with biological replicates Differential expression analysis between two conditions/groups three biological replicates per condition was performed using DESeq2 R package. DESeq2 provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting P values were adjusted using the Benjamini and Hochberg\u2019s approach for controlling the False Discovery Rate FDR. Genes with an adjusted P value < 0.05 found by DESeq2 were assigned as differentially expressed. A common way for searching shared functions among genes is to incorporate the biological knowledge provided by biological ontologies. Gene Ontology GO annotates genes to  biological processes  molecular functions  and cellular components in a directed acyclic graph structure  and Kyoto Encyclopedia of Genes and Genomes KEGG annotates genes to  pathways. KEGG is a database resource for understanding high level functions and utilities of the biological system  such as the cell  the organism and the ecosystem  from molecular level  information  especially large  scale molecular datasets generated by genome sequencing and other high  throughput experimental technologies http://www.genome.jp/kegg/. We  used KOBAS software to test the statistical enrichment of differential expression genes or circRNA host genes in KEGG pathways. circRNAs can act as miRNA sponge to inhibit the functioning of miRNAs. To further study the functions of circRNAs  microRNA target site in exons of circRNA loci were identified using miRanda animal species or psRobot plant species. software could be used to construct the circRNA miRNA gene networks. Genome build: UMD3.1", "Brain tissue", null, "Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:Brain|treatment:CPF toxication", "GSM5754470", "GSM5754470: CPF3; Danio rerio; ncRNA Seq", "GSM5754470 r1", "GSM5754470", "1", "Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP352585", null, "loader:fastq load.py", "CPF3_1.fq.gz CPF3_2.fq.gz", "fastq fastq", 12726241500.0, 42420805.0, "GSM5754470 r1", "0:150 1:150", "A:3447613023;C:2896153797;G:2922038320;T:3459698412;N:737948", 150, 150, null, null, 3447613023, 2896153797, 2922038320, 3459698412, 737948, "SRX13511115", "SRS11405356", "SRA1349262", "Atat\u00fcrk University", "Atat\u00fcrk University", 2, 0.89399, 0.89612, 0.38172, 0.37657, 0.66628, 0.66799, 0.53056, 0.53213, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Turkey", "2021-12-27", "Undetermined", "Undetermined", "Brain", "Nervous System"], [67824, "SRR17335720", "SRX13511114", "SRS11405355", "SRP352585", "PRJNA792582", "circRNA based biomarker candidates for acute cypermethrin and chlorpyrisfos toxication in the brain of Zebrafish Danio rerio", "GSE192669", "Transcriptome Analysis", "Cypermethrin CYP and chlorpyrifos CPF are pesticides which are frequently used in agricultural areas around the world. These chemicals have been shown to cause serious toxicological damage in the brain of fish  which is non target organisms. However  circRNAs associated with acute brain toxicity caused by cypermethrin and chlorpyrifos have not been studied yet. In this study  circRNAs were identified and characterized using RNA seq in Zebrafish brains exposed to acute cypermethrin and chlorpyrifos toxicity. A total of 10375 circRNAs were detected. It was determined that 6 circRNAs were up regulated  10 circRNAs were down regulated in CYP brain samples compared to controls . In addition  it was found that 57 circRNAs are up regulated and 3 circRNAs down regulated in CPF brain samples compared to controls. Moreover  62 circRNAs were down regulated in the CYP samples  when CYP and CPF samples were compared. However  up regulated circRNA could not be detected. It was revealed that the detected circRNAs specifically regulated the MAPK signaling pathway  endocytosis mechanism  apoptosis and p53 signaling pathway. This study  which was conducted for the first time in terms of the subject of the study  could bring a different perspective especially to pesticide toxicity studies. Overall design: Examination of  circRNA related to acute cypermethrin and chlopyrifos toxication in brain of zebrafish", null, "pubmed:35304207", null, "CPF2", "GSM5754469", null, "source name:Brain tissue|tissue:Brain|treatment:CPF toxication|geo loc name:missing|collection date:missing", "CPF2", "Raw data raw reads of FASTQ format were firstly processed through in house scripts. In this step  clean data clean reads were obtained by removing reads containing adapter and poly N sequences and reads with low quality from raw data. At the same time  Q20  Q30 and GC content of the clean data were calculated. All the downstream analyses were based on the clean data with high quality.An upgraded computational pipeline CIRCexplorer2 is applied to detect circRNAs and identify alternative back splicing in back spliced circular RNAs circRNAs The expression of circRNAs is usually represented by the fragments that are mapped to the back spliced exon\u2013exon junction sites. In addition to the raw fragment numbers  normalized RNA seq fragments that are mapped to a specific back spliced exon\u2013exon junction by total mapped fragments is used to quantitate circRNA expression. With FPM Fragments mapped to back  spliced junction Per Million mapped fragments  circRNAs from different samples with distinct sequencing depths can be directly compared. The input data for differential gene expression analysis is read counts from gene expression level analysis. For DESeq2 with biological replicates Differential expression analysis between two conditions/groups three biological replicates per condition was performed using DESeq2 R package. DESeq2 provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting P values were adjusted using the Benjamini and Hochberg\u2019s approach for controlling the False Discovery Rate FDR. Genes with an adjusted P value < 0.05 found by DESeq2 were assigned as differentially expressed. A common way for searching shared functions among genes is to incorporate the biological knowledge provided by biological ontologies. Gene Ontology GO annotates genes to  biological processes  molecular functions  and cellular components in a directed acyclic graph structure  and Kyoto Encyclopedia of Genes and Genomes KEGG annotates genes to  pathways. KEGG is a database resource for understanding high level functions and utilities of the biological system  such as the cell  the organism and the ecosystem  from molecular level  information  especially large  scale molecular datasets generated by genome sequencing and other high  throughput experimental technologies http://www.genome.jp/kegg/. We  used KOBAS software to test the statistical enrichment of differential expression genes or circRNA host genes in KEGG pathways. circRNAs can act as miRNA sponge to inhibit the functioning of miRNAs. To further study the functions of circRNAs  microRNA target site in exons of circRNA loci were identified using miRanda animal species or psRobot plant species. software could be used to construct the circRNA miRNA gene networks. Genome build: UMD3.1", "Brain tissue", null, "Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:Brain|treatment:CPF toxication", "GSM5754469", "GSM5754469: CPF2; Danio rerio; ncRNA Seq", "GSM5754469 r1", "GSM5754469", "1", "Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP352585", null, "loader:fastq load.py", "CPF2_1.fq.gz CPF2_2.fq.gz", "fastq fastq", 14881715100.0, 49605717.0, "GSM5754469 r1", "0:150 1:150", "A:4214905088;C:3201163283;G:3225795074;T:4239665352;N:186303", 150, 150, null, null, 4214905088, 3201163283, 3225795074, 4239665352, 186303, "SRX13511114", "SRS11405355", "SRA1349262", "Atat\u00fcrk University", "Atat\u00fcrk University", 2, 0.87491, 0.87638, 0.40844, 0.40479, 0.67123, 0.67018, 0.49174, 0.48952, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Turkey", "2021-12-27", "Undetermined", "Undetermined", "Brain", "Nervous System"], [67825, "SRR17335721", "SRX13511113", "SRS11405354", "SRP352585", "PRJNA792582", "circRNA based biomarker candidates for acute cypermethrin and chlorpyrisfos toxication in the brain of Zebrafish Danio rerio", "GSE192669", "Transcriptome Analysis", "Cypermethrin CYP and chlorpyrifos CPF are pesticides which are frequently used in agricultural areas around the world. These chemicals have been shown to cause serious toxicological damage in the brain of fish  which is non target organisms. However  circRNAs associated with acute brain toxicity caused by cypermethrin and chlorpyrifos have not been studied yet. In this study  circRNAs were identified and characterized using RNA seq in Zebrafish brains exposed to acute cypermethrin and chlorpyrifos toxicity. A total of 10375 circRNAs were detected. It was determined that 6 circRNAs were up regulated  10 circRNAs were down regulated in CYP brain samples compared to controls . In addition  it was found that 57 circRNAs are up regulated and 3 circRNAs down regulated in CPF brain samples compared to controls. Moreover  62 circRNAs were down regulated in the CYP samples  when CYP and CPF samples were compared. However  up regulated circRNA could not be detected. It was revealed that the detected circRNAs specifically regulated the MAPK signaling pathway  endocytosis mechanism  apoptosis and p53 signaling pathway. This study  which was conducted for the first time in terms of the subject of the study  could bring a different perspective especially to pesticide toxicity studies. Overall design: Examination of  circRNA related to acute cypermethrin and chlopyrifos toxication in brain of zebrafish", null, "pubmed:35304207", null, "CPF1", "GSM5754468", null, "source name:Brain tissue|tissue:Brain|treatment:CPF toxication|geo loc name:missing|collection date:missing", "CPF1", "Raw data raw reads of FASTQ format were firstly processed through in house scripts. In this step  clean data clean reads were obtained by removing reads containing adapter and poly N sequences and reads with low quality from raw data. At the same time  Q20  Q30 and GC content of the clean data were calculated. All the downstream analyses were based on the clean data with high quality.An upgraded computational pipeline CIRCexplorer2 is applied to detect circRNAs and identify alternative back splicing in back spliced circular RNAs circRNAs The expression of circRNAs is usually represented by the fragments that are mapped to the back spliced exon\u2013exon junction sites. In addition to the raw fragment numbers  normalized RNA seq fragments that are mapped to a specific back spliced exon\u2013exon junction by total mapped fragments is used to quantitate circRNA expression. With FPM Fragments mapped to back  spliced junction Per Million mapped fragments  circRNAs from different samples with distinct sequencing depths can be directly compared. The input data for differential gene expression analysis is read counts from gene expression level analysis. For DESeq2 with biological replicates Differential expression analysis between two conditions/groups three biological replicates per condition was performed using DESeq2 R package. DESeq2 provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting P values were adjusted using the Benjamini and Hochberg\u2019s approach for controlling the False Discovery Rate FDR. Genes with an adjusted P value < 0.05 found by DESeq2 were assigned as differentially expressed. A common way for searching shared functions among genes is to incorporate the biological knowledge provided by biological ontologies. Gene Ontology GO annotates genes to  biological processes  molecular functions  and cellular components in a directed acyclic graph structure  and Kyoto Encyclopedia of Genes and Genomes KEGG annotates genes to  pathways. KEGG is a database resource for understanding high level functions and utilities of the biological system  such as the cell  the organism and the ecosystem  from molecular level  information  especially large  scale molecular datasets generated by genome sequencing and other high  throughput experimental technologies http://www.genome.jp/kegg/. We  used KOBAS software to test the statistical enrichment of differential expression genes or circRNA host genes in KEGG pathways. circRNAs can act as miRNA sponge to inhibit the functioning of miRNAs. To further study the functions of circRNAs  microRNA target site in exons of circRNA loci were identified using miRanda animal species or psRobot plant species. software could be used to construct the circRNA miRNA gene networks. Genome build: UMD3.1", "Brain tissue", null, "Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:Brain|treatment:CPF toxication", "GSM5754468", "GSM5754468: CPF1; Danio rerio; ncRNA Seq", "GSM5754468 r1", "GSM5754468", "1", "Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP352585", null, "loader:fastq load.py", "CPF1_1.fq.gz CPF1_2.fq.gz", "fastq fastq", 16447798800.0, 54825996.0, "GSM5754468 r1", "0:150 1:150", "A:4454573413;C:3748270411;G:3776995203;T:4467442717;N:517056", 150, 150, null, null, 4454573413, 3748270411, 3776995203, 4467442717, 517056, "SRX13511113", "SRS11405354", "SRA1349262", "Atat\u00fcrk University", "Atat\u00fcrk University", 2, 0.89313, 0.8947, 0.35381, 0.35194, 0.64954, 0.64831, 0.51962, 0.52475, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Turkey", "2021-12-27", "Undetermined", "Undetermined", "Brain", "Nervous System"], [67826, "SRR17335722", "SRX13511112", "SRS11405353", "SRP352585", "PRJNA792582", "circRNA based biomarker candidates for acute cypermethrin and chlorpyrisfos toxication in the brain of Zebrafish Danio rerio", "GSE192669", "Transcriptome Analysis", "Cypermethrin CYP and chlorpyrifos CPF are pesticides which are frequently used in agricultural areas around the world. These chemicals have been shown to cause serious toxicological damage in the brain of fish  which is non target organisms. However  circRNAs associated with acute brain toxicity caused by cypermethrin and chlorpyrifos have not been studied yet. In this study  circRNAs were identified and characterized using RNA seq in Zebrafish brains exposed to acute cypermethrin and chlorpyrifos toxicity. A total of 10375 circRNAs were detected. It was determined that 6 circRNAs were up regulated  10 circRNAs were down regulated in CYP brain samples compared to controls . In addition  it was found that 57 circRNAs are up regulated and 3 circRNAs down regulated in CPF brain samples compared to controls. Moreover  62 circRNAs were down regulated in the CYP samples  when CYP and CPF samples were compared. However  up regulated circRNA could not be detected. It was revealed that the detected circRNAs specifically regulated the MAPK signaling pathway  endocytosis mechanism  apoptosis and p53 signaling pathway. This study  which was conducted for the first time in terms of the subject of the study  could bring a different perspective especially to pesticide toxicity studies. Overall design: Examination of  circRNA related to acute cypermethrin and chlopyrifos toxication in brain of zebrafish", null, "pubmed:35304207", null, "CYP3", "GSM5754467", null, "source name:Brain tissue|tissue:Brain|treatment:CYP toxication|geo loc name:missing|collection date:missing", "CYP3", "Raw data raw reads of FASTQ format were firstly processed through in house scripts. In this step  clean data clean reads were obtained by removing reads containing adapter and poly N sequences and reads with low quality from raw data. At the same time  Q20  Q30 and GC content of the clean data were calculated. All the downstream analyses were based on the clean data with high quality.An upgraded computational pipeline CIRCexplorer2 is applied to detect circRNAs and identify alternative back splicing in back spliced circular RNAs circRNAs The expression of circRNAs is usually represented by the fragments that are mapped to the back spliced exon\u2013exon junction sites. In addition to the raw fragment numbers  normalized RNA seq fragments that are mapped to a specific back spliced exon\u2013exon junction by total mapped fragments is used to quantitate circRNA expression. With FPM Fragments mapped to back  spliced junction Per Million mapped fragments  circRNAs from different samples with distinct sequencing depths can be directly compared. The input data for differential gene expression analysis is read counts from gene expression level analysis. For DESeq2 with biological replicates Differential expression analysis between two conditions/groups three biological replicates per condition was performed using DESeq2 R package. DESeq2 provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting P values were adjusted using the Benjamini and Hochberg\u2019s approach for controlling the False Discovery Rate FDR. Genes with an adjusted P value < 0.05 found by DESeq2 were assigned as differentially expressed. A common way for searching shared functions among genes is to incorporate the biological knowledge provided by biological ontologies. Gene Ontology GO annotates genes to  biological processes  molecular functions  and cellular components in a directed acyclic graph structure  and Kyoto Encyclopedia of Genes and Genomes KEGG annotates genes to  pathways. KEGG is a database resource for understanding high level functions and utilities of the biological system  such as the cell  the organism and the ecosystem  from molecular level  information  especially large  scale molecular datasets generated by genome sequencing and other high  throughput experimental technologies http://www.genome.jp/kegg/. We  used KOBAS software to test the statistical enrichment of differential expression genes or circRNA host genes in KEGG pathways. circRNAs can act as miRNA sponge to inhibit the functioning of miRNAs. To further study the functions of circRNAs  microRNA target site in exons of circRNA loci were identified using miRanda animal species or psRobot plant species. software could be used to construct the circRNA miRNA gene networks. Genome build: UMD3.1", "Brain tissue", null, "Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:Brain|treatment:CYP toxication", "GSM5754467", "GSM5754467: CYP3; Danio rerio; ncRNA Seq", "GSM5754467 r1", "GSM5754467", "1", "Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP352585", null, "loader:fastq load.py", "CYP3_1.fq.gz CYP3_2.fq.gz", "fastq fastq", 13417868100.0, 44726227.0, "GSM5754467 r1", "0:150 1:150", "A:3645134270;C:3041754103;G:3084809543;T:3645750889;N:419295", 150, 150, null, null, 3645134270, 3041754103, 3084809543, 3645750889, 419295, "SRX13511112", "SRS11405353", "SRA1349262", "Atat\u00fcrk University", "Atat\u00fcrk University", 2, 0.86122, 0.8638, 0.4112, 0.40785, 0.68738, 0.68519, 0.54768, 0.44856, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Turkey", "2021-12-27", "Undetermined", "Undetermined", "Brain", "Nervous System"], [67827, "SRR17335723", "SRX13511111", "SRS11405352", "SRP352585", "PRJNA792582", "circRNA based biomarker candidates for acute cypermethrin and chlorpyrisfos toxication in the brain of Zebrafish Danio rerio", "GSE192669", "Transcriptome Analysis", "Cypermethrin CYP and chlorpyrifos CPF are pesticides which are frequently used in agricultural areas around the world. These chemicals have been shown to cause serious toxicological damage in the brain of fish  which is non target organisms. However  circRNAs associated with acute brain toxicity caused by cypermethrin and chlorpyrifos have not been studied yet. In this study  circRNAs were identified and characterized using RNA seq in Zebrafish brains exposed to acute cypermethrin and chlorpyrifos toxicity. A total of 10375 circRNAs were detected. It was determined that 6 circRNAs were up regulated  10 circRNAs were down regulated in CYP brain samples compared to controls . In addition  it was found that 57 circRNAs are up regulated and 3 circRNAs down regulated in CPF brain samples compared to controls. Moreover  62 circRNAs were down regulated in the CYP samples  when CYP and CPF samples were compared. However  up regulated circRNA could not be detected. It was revealed that the detected circRNAs specifically regulated the MAPK signaling pathway  endocytosis mechanism  apoptosis and p53 signaling pathway. This study  which was conducted for the first time in terms of the subject of the study  could bring a different perspective especially to pesticide toxicity studies. Overall design: Examination of  circRNA related to acute cypermethrin and chlopyrifos toxication in brain of zebrafish", null, "pubmed:35304207", null, "CYP2", "GSM5754466", null, "source name:Brain tissue|tissue:Brain|treatment:CYP toxication|geo loc name:missing|collection date:missing", "CYP2", "Raw data raw reads of FASTQ format were firstly processed through in house scripts. In this step  clean data clean reads were obtained by removing reads containing adapter and poly N sequences and reads with low quality from raw data. At the same time  Q20  Q30 and GC content of the clean data were calculated. All the downstream analyses were based on the clean data with high quality.An upgraded computational pipeline CIRCexplorer2 is applied to detect circRNAs and identify alternative back splicing in back spliced circular RNAs circRNAs The expression of circRNAs is usually represented by the fragments that are mapped to the back spliced exon\u2013exon junction sites. In addition to the raw fragment numbers  normalized RNA seq fragments that are mapped to a specific back spliced exon\u2013exon junction by total mapped fragments is used to quantitate circRNA expression. With FPM Fragments mapped to back  spliced junction Per Million mapped fragments  circRNAs from different samples with distinct sequencing depths can be directly compared. The input data for differential gene expression analysis is read counts from gene expression level analysis. For DESeq2 with biological replicates Differential expression analysis between two conditions/groups three biological replicates per condition was performed using DESeq2 R package. DESeq2 provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting P values were adjusted using the Benjamini and Hochberg\u2019s approach for controlling the False Discovery Rate FDR. Genes with an adjusted P value < 0.05 found by DESeq2 were assigned as differentially expressed. A common way for searching shared functions among genes is to incorporate the biological knowledge provided by biological ontologies. Gene Ontology GO annotates genes to  biological processes  molecular functions  and cellular components in a directed acyclic graph structure  and Kyoto Encyclopedia of Genes and Genomes KEGG annotates genes to  pathways. KEGG is a database resource for understanding high level functions and utilities of the biological system  such as the cell  the organism and the ecosystem  from molecular level  information  especially large  scale molecular datasets generated by genome sequencing and other high  throughput experimental technologies http://www.genome.jp/kegg/. We  used KOBAS software to test the statistical enrichment of differential expression genes or circRNA host genes in KEGG pathways. circRNAs can act as miRNA sponge to inhibit the functioning of miRNAs. To further study the functions of circRNAs  microRNA target site in exons of circRNA loci were identified using miRanda animal species or psRobot plant species. software could be used to construct the circRNA miRNA gene networks. Genome build: UMD3.1", "Brain tissue", null, "Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:Brain|treatment:CYP toxication", "GSM5754466", "GSM5754466: CYP2; Danio rerio; ncRNA Seq", "GSM5754466 r1", "GSM5754466", "1", "Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP352585", null, "loader:fastq load.py", "CYP2_1.fq.gz CYP2_2.fq.gz", "fastq fastq", 13096007700.0, 43653359.0, "GSM5754466 r1", "0:150 1:150", "A:3638241155;C:2892284693;G:2925857490;T:3639296449;N:327913", 150, 150, null, null, 3638241155, 2892284693, 2925857490, 3639296449, 327913, "SRX13511111", "SRS11405352", "SRA1349262", "Atat\u00fcrk University", "Atat\u00fcrk University", 2, 0.85953, 0.86247, 0.41975, 0.41734, 0.68174, 0.67862, 0.52504, 0.5324, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Turkey", "2021-12-27", "Undetermined", "Undetermined", "Brain", "Nervous System"], [67828, "SRR17335724", "SRX13511110", "SRS11405351", "SRP352585", "PRJNA792582", "circRNA based biomarker candidates for acute cypermethrin and chlorpyrisfos toxication in the brain of Zebrafish Danio rerio", "GSE192669", "Transcriptome Analysis", "Cypermethrin CYP and chlorpyrifos CPF are pesticides which are frequently used in agricultural areas around the world. These chemicals have been shown to cause serious toxicological damage in the brain of fish  which is non target organisms. However  circRNAs associated with acute brain toxicity caused by cypermethrin and chlorpyrifos have not been studied yet. In this study  circRNAs were identified and characterized using RNA seq in Zebrafish brains exposed to acute cypermethrin and chlorpyrifos toxicity. A total of 10375 circRNAs were detected. It was determined that 6 circRNAs were up regulated  10 circRNAs were down regulated in CYP brain samples compared to controls . In addition  it was found that 57 circRNAs are up regulated and 3 circRNAs down regulated in CPF brain samples compared to controls. Moreover  62 circRNAs were down regulated in the CYP samples  when CYP and CPF samples were compared. However  up regulated circRNA could not be detected. It was revealed that the detected circRNAs specifically regulated the MAPK signaling pathway  endocytosis mechanism  apoptosis and p53 signaling pathway. This study  which was conducted for the first time in terms of the subject of the study  could bring a different perspective especially to pesticide toxicity studies. Overall design: Examination of  circRNA related to acute cypermethrin and chlopyrifos toxication in brain of zebrafish", null, "pubmed:35304207", null, "CYP1", "GSM5754465", null, "source name:Brain tissue|tissue:Brain|treatment:CYP toxication|geo loc name:missing|collection date:missing", "CYP1", "Raw data raw reads of FASTQ format were firstly processed through in house scripts. In this step  clean data clean reads were obtained by removing reads containing adapter and poly N sequences and reads with low quality from raw data. At the same time  Q20  Q30 and GC content of the clean data were calculated. All the downstream analyses were based on the clean data with high quality.An upgraded computational pipeline CIRCexplorer2 is applied to detect circRNAs and identify alternative back splicing in back spliced circular RNAs circRNAs The expression of circRNAs is usually represented by the fragments that are mapped to the back spliced exon\u2013exon junction sites. In addition to the raw fragment numbers  normalized RNA seq fragments that are mapped to a specific back spliced exon\u2013exon junction by total mapped fragments is used to quantitate circRNA expression. With FPM Fragments mapped to back  spliced junction Per Million mapped fragments  circRNAs from different samples with distinct sequencing depths can be directly compared. The input data for differential gene expression analysis is read counts from gene expression level analysis. For DESeq2 with biological replicates Differential expression analysis between two conditions/groups three biological replicates per condition was performed using DESeq2 R package. DESeq2 provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting P values were adjusted using the Benjamini and Hochberg\u2019s approach for controlling the False Discovery Rate FDR. Genes with an adjusted P value < 0.05 found by DESeq2 were assigned as differentially expressed. A common way for searching shared functions among genes is to incorporate the biological knowledge provided by biological ontologies. Gene Ontology GO annotates genes to  biological processes  molecular functions  and cellular components in a directed acyclic graph structure  and Kyoto Encyclopedia of Genes and Genomes KEGG annotates genes to  pathways. KEGG is a database resource for understanding high level functions and utilities of the biological system  such as the cell  the organism and the ecosystem  from molecular level  information  especially large  scale molecular datasets generated by genome sequencing and other high  throughput experimental technologies http://www.genome.jp/kegg/. We  used KOBAS software to test the statistical enrichment of differential expression genes or circRNA host genes in KEGG pathways. circRNAs can act as miRNA sponge to inhibit the functioning of miRNAs. To further study the functions of circRNAs  microRNA target site in exons of circRNA loci were identified using miRanda animal species or psRobot plant species. software could be used to construct the circRNA miRNA gene networks. Genome build: UMD3.1", "Brain tissue", null, "Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:Brain|treatment:CYP toxication", "GSM5754465", "GSM5754465: CYP1; Danio rerio; ncRNA Seq", "GSM5754465 r1", "GSM5754465", "1", "Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP352585", null, "loader:fastq load.py", "CYP1_1.fq.gz CYP1_2.fq.gz", "fastq fastq", 16372872000.0, 54576240.0, "GSM5754465 r1", "0:150 1:150", "A:4747286217;C:3417115980;G:3453793026;T:4754530080;N:146697", 150, 150, null, null, 4747286217, 3417115980, 3453793026, 4754530080, 146697, "SRX13511110", "SRS11405351", "SRA1349262", "Atat\u00fcrk University", "Atat\u00fcrk University", 2, 0.85322, 0.85414, 0.46298, 0.45901, 0.68016, 0.67866, 0.47694, 0.47897, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Turkey", "2021-12-27", "Undetermined", "Undetermined", "Brain", "Nervous System"], [67829, "SRR17335725", "SRX13511109", "SRS11405350", "SRP352585", "PRJNA792582", "circRNA based biomarker candidates for acute cypermethrin and chlorpyrisfos toxication in the brain of Zebrafish Danio rerio", "GSE192669", "Transcriptome Analysis", "Cypermethrin CYP and chlorpyrifos CPF are pesticides which are frequently used in agricultural areas around the world. These chemicals have been shown to cause serious toxicological damage in the brain of fish  which is non target organisms. However  circRNAs associated with acute brain toxicity caused by cypermethrin and chlorpyrifos have not been studied yet. In this study  circRNAs were identified and characterized using RNA seq in Zebrafish brains exposed to acute cypermethrin and chlorpyrifos toxicity. A total of 10375 circRNAs were detected. It was determined that 6 circRNAs were up regulated  10 circRNAs were down regulated in CYP brain samples compared to controls . In addition  it was found that 57 circRNAs are up regulated and 3 circRNAs down regulated in CPF brain samples compared to controls. Moreover  62 circRNAs were down regulated in the CYP samples  when CYP and CPF samples were compared. However  up regulated circRNA could not be detected. It was revealed that the detected circRNAs specifically regulated the MAPK signaling pathway  endocytosis mechanism  apoptosis and p53 signaling pathway. This study  which was conducted for the first time in terms of the subject of the study  could bring a different perspective especially to pesticide toxicity studies. Overall design: Examination of  circRNA related to acute cypermethrin and chlopyrifos toxication in brain of zebrafish", null, "pubmed:35304207", null, "Cont3", "GSM5754464", null, "source name:Brain tissue|tissue:Brain|treatment:No toxication|geo loc name:missing|collection date:missing", "Cont3", "Raw data raw reads of FASTQ format were firstly processed through in house scripts. In this step  clean data clean reads were obtained by removing reads containing adapter and poly N sequences and reads with low quality from raw data. At the same time  Q20  Q30 and GC content of the clean data were calculated. All the downstream analyses were based on the clean data with high quality.An upgraded computational pipeline CIRCexplorer2 is applied to detect circRNAs and identify alternative back splicing in back spliced circular RNAs circRNAs The expression of circRNAs is usually represented by the fragments that are mapped to the back spliced exon\u2013exon junction sites. In addition to the raw fragment numbers  normalized RNA seq fragments that are mapped to a specific back spliced exon\u2013exon junction by total mapped fragments is used to quantitate circRNA expression. With FPM Fragments mapped to back  spliced junction Per Million mapped fragments  circRNAs from different samples with distinct sequencing depths can be directly compared. The input data for differential gene expression analysis is read counts from gene expression level analysis. For DESeq2 with biological replicates Differential expression analysis between two conditions/groups three biological replicates per condition was performed using DESeq2 R package. DESeq2 provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting P values were adjusted using the Benjamini and Hochberg\u2019s approach for controlling the False Discovery Rate FDR. Genes with an adjusted P value < 0.05 found by DESeq2 were assigned as differentially expressed. A common way for searching shared functions among genes is to incorporate the biological knowledge provided by biological ontologies. Gene Ontology GO annotates genes to  biological processes  molecular functions  and cellular components in a directed acyclic graph structure  and Kyoto Encyclopedia of Genes and Genomes KEGG annotates genes to  pathways. KEGG is a database resource for understanding high level functions and utilities of the biological system  such as the cell  the organism and the ecosystem  from molecular level  information  especially large  scale molecular datasets generated by genome sequencing and other high  throughput experimental technologies http://www.genome.jp/kegg/. We  used KOBAS software to test the statistical enrichment of differential expression genes or circRNA host genes in KEGG pathways. circRNAs can act as miRNA sponge to inhibit the functioning of miRNAs. To further study the functions of circRNAs  microRNA target site in exons of circRNA loci were identified using miRanda animal species or psRobot plant species. software could be used to construct the circRNA miRNA gene networks. Genome build: UMD3.1", "Brain tissue", null, "Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:Brain|treatment:No toxication", "GSM5754464", "GSM5754464: Cont3; Danio rerio; ncRNA Seq", "GSM5754464 r1", "GSM5754464", "1", "Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP352585", null, "loader:fastq load.py", "Cont3_1.fq.gz Cont3_2.fq.gz", "fastq fastq", 15202443900.0, 50674813.0, "GSM5754464 r1", "0:150 1:150", "A:4400470018;C:3173803928;G:3218623722;T:4409335756;N:210476", 150, 150, null, null, 4400470018, 3173803928, 3218623722, 4409335756, 210476, "SRX13511109", "SRS11405350", "SRA1349262", "Atat\u00fcrk University", "Atat\u00fcrk University", 2, 0.86129, 0.84677, 0.45657, 0.44799, 0.67884, 0.68083, 0.48291, 0.4763, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Turkey", "2021-12-27", "Undetermined", "Undetermined", "Brain", "Nervous System"], [67830, "SRR17335726", "SRX13511108", "SRS11405349", "SRP352585", "PRJNA792582", "circRNA based biomarker candidates for acute cypermethrin and chlorpyrisfos toxication in the brain of Zebrafish Danio rerio", "GSE192669", "Transcriptome Analysis", "Cypermethrin CYP and chlorpyrifos CPF are pesticides which are frequently used in agricultural areas around the world. These chemicals have been shown to cause serious toxicological damage in the brain of fish  which is non target organisms. However  circRNAs associated with acute brain toxicity caused by cypermethrin and chlorpyrifos have not been studied yet. In this study  circRNAs were identified and characterized using RNA seq in Zebrafish brains exposed to acute cypermethrin and chlorpyrifos toxicity. A total of 10375 circRNAs were detected. It was determined that 6 circRNAs were up regulated  10 circRNAs were down regulated in CYP brain samples compared to controls . In addition  it was found that 57 circRNAs are up regulated and 3 circRNAs down regulated in CPF brain samples compared to controls. Moreover  62 circRNAs were down regulated in the CYP samples  when CYP and CPF samples were compared. However  up regulated circRNA could not be detected. It was revealed that the detected circRNAs specifically regulated the MAPK signaling pathway  endocytosis mechanism  apoptosis and p53 signaling pathway. This study  which was conducted for the first time in terms of the subject of the study  could bring a different perspective especially to pesticide toxicity studies. Overall design: Examination of  circRNA related to acute cypermethrin and chlopyrifos toxication in brain of zebrafish", null, "pubmed:35304207", null, "Cont2", "GSM5754463", null, "source name:Brain tissue|tissue:Brain|treatment:No toxication|geo loc name:missing|collection date:missing", "Cont2", "Raw data raw reads of FASTQ format were firstly processed through in house scripts. In this step  clean data clean reads were obtained by removing reads containing adapter and poly N sequences and reads with low quality from raw data. At the same time  Q20  Q30 and GC content of the clean data were calculated. All the downstream analyses were based on the clean data with high quality.An upgraded computational pipeline CIRCexplorer2 is applied to detect circRNAs and identify alternative back splicing in back spliced circular RNAs circRNAs The expression of circRNAs is usually represented by the fragments that are mapped to the back spliced exon\u2013exon junction sites. In addition to the raw fragment numbers  normalized RNA seq fragments that are mapped to a specific back spliced exon\u2013exon junction by total mapped fragments is used to quantitate circRNA expression. With FPM Fragments mapped to back  spliced junction Per Million mapped fragments  circRNAs from different samples with distinct sequencing depths can be directly compared. The input data for differential gene expression analysis is read counts from gene expression level analysis. For DESeq2 with biological replicates Differential expression analysis between two conditions/groups three biological replicates per condition was performed using DESeq2 R package. DESeq2 provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting P values were adjusted using the Benjamini and Hochberg\u2019s approach for controlling the False Discovery Rate FDR. Genes with an adjusted P value < 0.05 found by DESeq2 were assigned as differentially expressed. A common way for searching shared functions among genes is to incorporate the biological knowledge provided by biological ontologies. Gene Ontology GO annotates genes to  biological processes  molecular functions  and cellular components in a directed acyclic graph structure  and Kyoto Encyclopedia of Genes and Genomes KEGG annotates genes to  pathways. KEGG is a database resource for understanding high level functions and utilities of the biological system  such as the cell  the organism and the ecosystem  from molecular level  information  especially large  scale molecular datasets generated by genome sequencing and other high  throughput experimental technologies http://www.genome.jp/kegg/. We  used KOBAS software to test the statistical enrichment of differential expression genes or circRNA host genes in KEGG pathways. circRNAs can act as miRNA sponge to inhibit the functioning of miRNAs. To further study the functions of circRNAs  microRNA target site in exons of circRNA loci were identified using miRanda animal species or psRobot plant species. software could be used to construct the circRNA miRNA gene networks. Genome build: UMD3.1", "Brain tissue", null, "Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:Brain|treatment:No toxication", "GSM5754463", "GSM5754463: Cont2; Danio rerio; ncRNA Seq", "GSM5754463 r1", "GSM5754463", "1", "Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP352585", null, "loader:fastq load.py", "Cont2_1.fq.gz Cont2_2.fq.gz", "fastq fastq", 12927267600.0, 43090892.0, "GSM5754463 r1", "0:150 1:150", "A:3474574877;C:2959326086;G:3006553706;T:3486600752;N:212179", 150, 150, null, null, 3474574877, 2959326086, 3006553706, 3486600752, 212179, "SRX13511108", "SRS11405349", "SRA1349262", "Atat\u00fcrk University", "Atat\u00fcrk University", 2, 0.87695, 0.87907, 0.41673, 0.41416, 0.69266, 0.69266, 0.53339, 0.58145, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Turkey", "2021-12-27", "Undetermined", "Undetermined", "Brain", "Nervous System"], [67831, "SRR17335727", "SRX13511107", "SRS11405348", "SRP352585", "PRJNA792582", "circRNA based biomarker candidates for acute cypermethrin and chlorpyrisfos toxication in the brain of Zebrafish Danio rerio", "GSE192669", "Transcriptome Analysis", "Cypermethrin CYP and chlorpyrifos CPF are pesticides which are frequently used in agricultural areas around the world. These chemicals have been shown to cause serious toxicological damage in the brain of fish  which is non target organisms. However  circRNAs associated with acute brain toxicity caused by cypermethrin and chlorpyrifos have not been studied yet. In this study  circRNAs were identified and characterized using RNA seq in Zebrafish brains exposed to acute cypermethrin and chlorpyrifos toxicity. A total of 10375 circRNAs were detected. It was determined that 6 circRNAs were up regulated  10 circRNAs were down regulated in CYP brain samples compared to controls . In addition  it was found that 57 circRNAs are up regulated and 3 circRNAs down regulated in CPF brain samples compared to controls. Moreover  62 circRNAs were down regulated in the CYP samples  when CYP and CPF samples were compared. However  up regulated circRNA could not be detected. It was revealed that the detected circRNAs specifically regulated the MAPK signaling pathway  endocytosis mechanism  apoptosis and p53 signaling pathway. This study  which was conducted for the first time in terms of the subject of the study  could bring a different perspective especially to pesticide toxicity studies. Overall design: Examination of  circRNA related to acute cypermethrin and chlopyrifos toxication in brain of zebrafish", null, "pubmed:35304207", null, "Cont1", "GSM5754462", null, "source name:Brain tissue|tissue:Brain|treatment:No toxication|geo loc name:missing|collection date:missing", "Cont1", "Raw data raw reads of FASTQ format were firstly processed through in house scripts. In this step  clean data clean reads were obtained by removing reads containing adapter and poly N sequences and reads with low quality from raw data. At the same time  Q20  Q30 and GC content of the clean data were calculated. All the downstream analyses were based on the clean data with high quality.An upgraded computational pipeline CIRCexplorer2 is applied to detect circRNAs and identify alternative back splicing in back spliced circular RNAs circRNAs The expression of circRNAs is usually represented by the fragments that are mapped to the back spliced exon\u2013exon junction sites. In addition to the raw fragment numbers  normalized RNA seq fragments that are mapped to a specific back spliced exon\u2013exon junction by total mapped fragments is used to quantitate circRNA expression. With FPM Fragments mapped to back  spliced junction Per Million mapped fragments  circRNAs from different samples with distinct sequencing depths can be directly compared. The input data for differential gene expression analysis is read counts from gene expression level analysis. For DESeq2 with biological replicates Differential expression analysis between two conditions/groups three biological replicates per condition was performed using DESeq2 R package. DESeq2 provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting P values were adjusted using the Benjamini and Hochberg\u2019s approach for controlling the False Discovery Rate FDR. Genes with an adjusted P value < 0.05 found by DESeq2 were assigned as differentially expressed. A common way for searching shared functions among genes is to incorporate the biological knowledge provided by biological ontologies. Gene Ontology GO annotates genes to  biological processes  molecular functions  and cellular components in a directed acyclic graph structure  and Kyoto Encyclopedia of Genes and Genomes KEGG annotates genes to  pathways. KEGG is a database resource for understanding high level functions and utilities of the biological system  such as the cell  the organism and the ecosystem  from molecular level  information  especially large  scale molecular datasets generated by genome sequencing and other high  throughput experimental technologies http://www.genome.jp/kegg/. We  used KOBAS software to test the statistical enrichment of differential expression genes or circRNA host genes in KEGG pathways. circRNAs can act as miRNA sponge to inhibit the functioning of miRNAs. To further study the functions of circRNAs  microRNA target site in exons of circRNA loci were identified using miRanda animal species or psRobot plant species. software could be used to construct the circRNA miRNA gene networks. Genome build: UMD3.1", "Brain tissue", null, "Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:Brain|treatment:No toxication", "GSM5754462", "GSM5754462: Cont1; Danio rerio; ncRNA Seq", "GSM5754462 r1", "GSM5754462", "1", "Total RNA was isolated with Trizol from brain tissues RNA libraries were prepared for sequencing using standard Illumina protocols", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP352585", null, "loader:fastq load.py", "Cont1_1.fq.gz Cont1_2.fq.gz", "fastq fastq", 18395362500.0, 61317875.0, "GSM5754462 r1", "0:150 1:150", "A:5379624768;C:3792463355;G:3842313235;T:5380702187;N:258955", 150, 150, null, null, 5379624768, 3792463355, 3842313235, 5380702187, 258955, "SRX13511107", "SRS11405348", "SRA1349262", "Atat\u00fcrk University", "Atat\u00fcrk University", 2, 0.83439, 0.83446, 0.45703, 0.44894, 0.68828, 0.68578, 0.4957, 0.49639, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Turkey", "2021-12-27", "Undetermined", "Undetermined", "Brain", "Nervous System"]], "truncated": false, "filtered_table_rows_count": 11, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"devstage_curation_coarse\" = :p0 and \"experiment.library_strategy\" = :p1 order by rowid limit 101", "params": {"p0": "Undetermined", "p1": "ncRNA-Seq"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&experiment.library_strategy=ncRNA-Seq", "results": [{"value": "ncRNA-Seq", "label": "ncRNA-Seq", "count": 11, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined", "selected": true}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&experiment.library_strategy=ncRNA-Seq", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 11, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&experiment.library_strategy=ncRNA-Seq&experiment.library_source=TRANSCRIPTOMIC", "selected": false}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&experiment.library_strategy=ncRNA-Seq", "results": [{"value": "size fractionation", "label": "size fractionation", "count": 11, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&experiment.library_strategy=ncRNA-Seq&experiment.library_selection=size+fractionation", "selected": false}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&experiment.library_strategy=ncRNA-Seq", "results": [{"value": "PAIRED", "label": "PAIRED", "count": 9, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&experiment.library_strategy=ncRNA-Seq&experiment.library_layout=PAIRED", "selected": false}, {"value": "SINGLE", "label": "SINGLE", "count": 2, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&experiment.library_strategy=ncRNA-Seq&experiment.library_layout=SINGLE", "selected": false}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&experiment.library_strategy=ncRNA-Seq", "results": [{"value": "ILLUMINA", "label": "ILLUMINA", "count": 11, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&experiment.library_strategy=ncRNA-Seq&experiment.platform=ILLUMINA", "selected": false}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&experiment.library_strategy=ncRNA-Seq", "results": [{"value": "Undetermined", "label": "Undetermined", "count": 11, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=ncRNA-Seq", "selected": true}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&experiment.library_strategy=ncRNA-Seq", "results": [{"value": "Undetermined", "label": "Undetermined", "count": 11, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&experiment.library_strategy=ncRNA-Seq&devstage_curation=Undetermined", "selected": false}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&experiment.library_strategy=ncRNA-Seq", "results": [{"value": "Nervous System", "label": "Nervous System", "count": 9, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=Nervous+System", "selected": false}, {"value": "Reproductive System", "label": "Reproductive System", "count": 2, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&experiment.library_strategy=ncRNA-Seq&tissue_curation_coarse=Reproductive+System", "selected": false}], "truncated": false}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&experiment.library_strategy=ncRNA-Seq", "results": [{"value": "Brain", "label": "Brain", "count": 9, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&experiment.library_strategy=ncRNA-Seq&tissue_curation=Brain", "selected": false}, {"value": "Gonad", "label": "Gonad", "count": 2, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&experiment.library_strategy=ncRNA-Seq&tissue_curation=Gonad", "selected": false}], "truncated": false}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&experiment.library_strategy=ncRNA-Seq", "results": [{"value": "unknown", "label": "unknown", "count": 9, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&experiment.library_strategy=ncRNA-Seq&technology=unknown", "selected": false}, {"value": "generic-scrnaseq-only", "label": "generic-scrnaseq-only", "count": 2, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Undetermined&experiment.library_strategy=ncRNA-Seq&technology=generic-scrnaseq-only", "selected": false}], "truncated": false}}, "suggested_facets": [], "next": null, "next_url": null, "private": false, "allow_execute_sql": true, "query_ms": 66.78976400144165}