{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where devstage_curation_coarse = \"Larval\" and experiment.library_layout = \"SINGLE\"", "rows": [[35, "DRR408239", "DRX393845", "DRS407003", "DRP012035", "PRJDB14274", "Zebrafish Gut RNA seq.", "DRP012035", "Transcriptome Analysis", "A project to find differential expressed genes between larval and adult zebrafish gut. We dissected guts of wild type AB line  and prepared three duplicates for each of larval and adult gut. Libraries for NGS are prepared using illumina TruSeq standard mRNA sample prep kit.", null, null, "zebrafish wild type AB larval gut replicate 3", "zebrafish larval gut replicate 3", "SAMD00529459", null, "sample name:zebrafish larval gut replicate 3|biological replicate:larval 3|strain:AB", null, null, null, null, null, null, null, null, "Illumina HiSeq 1500 sequencing of SAMD00529459", "DRX393845", "AR012 gut 5  5 dpf 6 dpf larvae", "1", "1", null, "RNA-Seq", "TRANSCRIPTOMIC", "RANDOM", "SINGLE", "ILLUMINA", "Illumina HiSeq 1500", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>126</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP012035", "Illumina HiSeq 1500 sequencing of SAMD00529459", null, null, null, 3463982046.0, 27491921.0, "DRR408239", "0:126 1:0", "A:842552557;C:849757648;G:837664725;T:933942026;N:65090", 126, 0, null, null, 842552557, 849757648, 837664725, 933942026, 65090, "DRX393845", "DRS407003", "DRA014885", "NIBB|NIBB core research facilities, National Institute for Basic Biology", "University of Hyogo", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2024-09-20", "Larval", "Larval", "Gut", "Digestive System"], [36, "DRR408238", "DRX393844", "DRS407002", "DRP012035", "PRJDB14274", "Zebrafish Gut RNA seq.", "DRP012035", "Transcriptome Analysis", "A project to find differential expressed genes between larval and adult zebrafish gut. We dissected guts of wild type AB line  and prepared three duplicates for each of larval and adult gut. Libraries for NGS are prepared using illumina TruSeq standard mRNA sample prep kit.", null, null, "zebrafish wild type AB larval gut replicate 2", "zebrafish larval gut replicate 2", "SAMD00529458", null, "sample name:zebrafish larval gut replicate 2|biological replicate:larval 2|strain:AB", null, null, null, null, null, null, null, null, "Illumina HiSeq 1500 sequencing of SAMD00529458", "DRX393844", "AR005 gut 3  5 dpf 6 dpf larvae", "1", "1", null, "RNA-Seq", "TRANSCRIPTOMIC", "RANDOM", "SINGLE", "ILLUMINA", "Illumina HiSeq 1500", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>126</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP012035", "Illumina HiSeq 1500 sequencing of SAMD00529458", null, null, null, 3782320416.0, 30018416.0, "DRR408238", "0:126 1:0", "A:930337206;C:920645770;G:906559955;T:1024704277;N:73208", 126, 0, null, null, 930337206, 920645770, 906559955, 1024704277, 73208, "DRX393844", "DRS407002", "DRA014885", "NIBB|NIBB core research facilities, National Institute for Basic Biology", "University of Hyogo", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2024-09-20", "Larval", "Larval", "Gut", "Digestive System"], [37, "DRR408237", "DRX393843", "DRS407001", "DRP012035", "PRJDB14274", "Zebrafish Gut RNA seq.", "DRP012035", "Transcriptome Analysis", "A project to find differential expressed genes between larval and adult zebrafish gut. We dissected guts of wild type AB line  and prepared three duplicates for each of larval and adult gut. Libraries for NGS are prepared using illumina TruSeq standard mRNA sample prep kit.", null, null, "zebrafish wild type AB larval gut replicate 1", "zebrafish larval gut replicate 1", "SAMD00529457", null, "sample name:zebrafish larval gut replicate 1|biological replicate:larval 1|strain:AB", null, null, null, null, null, null, null, null, "Illumina HiSeq 1500 sequencing of SAMD00529457", "DRX393843", "AR002 gut 1  5 dpf 6 dpf larvae", "1", "1", null, "RNA-Seq", "TRANSCRIPTOMIC", "RANDOM", "SINGLE", "ILLUMINA", "Illumina HiSeq 1500", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>126</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP012035", "Illumina HiSeq 1500 sequencing of SAMD00529457", null, null, null, 3606885828.0, 28626078.0, "DRR408237", "0:126 1:0", "A:879148446;C:885673723;G:870330963;T:971663212;N:69484", 126, 0, null, null, 879148446, 885673723, 870330963, 971663212, 69484, "DRX393843", "DRS407001", "DRA014885", "NIBB|NIBB core research facilities, National Institute for Basic Biology", "University of Hyogo", null, null, null, null, null, null, null, null, null, null, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2024-09-20", "Larval", "Larval", "Gut", "Digestive System"], [75, "DRR032749", "DRX029555", "DRS049954", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 50 individuals", "Dr 72h 2", "SAMD00028146", null, "sample name:Dr 72h 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:72h Protruding mouth|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028146", "DRX029555", "Dr 72h 2", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028146", null, null, null, 3429795800.0, 34297958.0, "DRR032749", "0:100 1:0", "A:928062015;C:792470305;G:786930881;T:922296289;N:36310", 100, 0, null, null, 928062015, 792470305, 786930881, 922296289, 36310, "DRX029555", "DRS049954", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.91821, null, 0.09774, null, 0.65437, null, 0.46443, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [76, "DRR032748", "DRX029554", "DRS049953", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 50 individuals", "Dr 72h 1", "SAMD00028145", null, "sample name:Dr 72h 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:72h Protruding mouth|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028145", "DRX029554", "Dr 72h 1", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028145", null, null, null, 3897194500.0, 38971945.0, "DRR032748", "0:100 1:0", "A:1050989414;C:903225496;G:895783177;T:1047153493;N:42920", 100, 0, null, null, 1050989414, 903225496, 895783177, 1047153493, 42920, "DRX029554", "DRS049953", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.92211, null, 0.09393, null, 0.65486, null, 0.45971, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [81, "DRR032743", "DRX029549", "DRS049948", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 50 individuals", "Dr 5day 3", "SAMD00028140", null, "sample name:Dr 5day 3|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:5day|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028140", "DRX029549", "Dr 5day 3", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028140", null, null, null, 3884716000.0, 38847160.0, "DRR032743", "0:100 1:0", "A:1040550584;C:905663425;G:904247323;T:1034215019;N:39649", 100, 0, null, null, 1040550584, 905663425, 904247323, 1034215019, 39649, "DRX029549", "DRS049948", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.92219, null, 0.08287, null, 0.65863, null, 0.47377, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [82, "DRR032742", "DRX029548", "DRS049947", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 50 individuals", "Dr 5day 2", "SAMD00028139", null, "sample name:Dr 5day 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:5day|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028139", "DRX029548", "Dr 5day 2", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028139", null, null, null, 3893708700.0, 38937087.0, "DRR032742", "0:100 1:0", "A:1050850168;C:899863467;G:897224776;T:1045729184;N:41105", 100, 0, null, null, 1050850168, 899863467, 897224776, 1045729184, 41105, "DRX029548", "DRS049947", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.91671, null, 0.0991, null, 0.65161, null, 0.47454, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [83, "DRR032741", "DRX029547", "DRS049946", "DRP003810", "PRJDB3785", "EXPANDE project", "DRP003810", "Other", "EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief  taking advantages of Illumina sequencing  RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.", null, null, "mRNA extracted from pooled embryos of 50 individuals", "Dr 5day 1", "SAMD00028138", null, "sample name:Dr 5day 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:5day|genotype:wild type|phenotype:wild type|sex:male  female  and mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing of SAMD00028138", "DRX029547", "Dr 5day 1", "1", "Total RNA QIAGEN RNeasy followed by TruSeq", null, "RNA-Seq", "TRANSCRIPTOMIC", "other", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003810", "Illumina HiSeq 2000 sequencing of SAMD00028138", null, null, null, 3807570600.0, 38075706.0, "DRR032741", "0:100 1:0", "A:1022590228;C:884655401;G:882546091;T:1017737883;N:40997", 100, 0, null, null, 1022590228, 884655401, 882546091, 1017737883, 40997, "DRX029547", "DRS049946", "DRA003460", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", "UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo", 1, 0.9182, null, 0.09442, null, 0.65525, null, 0.46661, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "other", "trueseq", "bulk", "unknown", "unknown", null, "Japan", "2017-09-20", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [101, "DRR189403", "DRX179868", "DRS200418", "DRP003977", "PRJDB4470", "Gene expression analysis of the zebrafish brain", "DRP003977", "Other", "Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.", null, null, null, "Telencephalon of adult zebrafrish  30 min post test session of 2 weeks memory test in non trace 2 Way Active Avoidance coditioning 3", "SAMD00182246", null, "sample name:CSUS Tel 30 2w memory 3|genotype:wild type|tissue:brain", null, null, null, null, null, null, null, null, "Illumina HiSeq 3000 sequencing of SAMD00182246", "DRX179868", "CSUS Tel 30 2w memory 3", "1", "SureSelect Strand Specific RNA Library Prep Kit", null, "RNA-Seq", "TRANSCRIPTOMIC", "PolyA", "SINGLE", "ILLUMINA", "Illumina HiSeq 3000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003977", "Illumina HiSeq 3000 sequencing of SAMD00182246", null, null, null, 2791119960.0, 77531110.0, "DRR189403", "0:36", "A:685050951;C:641519684;G:664655385;T:799677669;N:216271", 36, null, null, null, 685050951, 641519684, 664655385, 799677669, 216271, "DRX179868", "DRS200418", "DRA008865", "NIG|National Institute of Genetics (Japan)", "National Institute of Genetics (Japan)", 1, 0.89653, null, 0.1773, null, 0.70725, null, 0.49873, null, 36, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Japan", "2021-08-08", "Larval", "Larval", "Brain", "Nervous System"], [102, "DRR189402", "DRX179867", "DRS200417", "DRP003977", "PRJDB4470", "Gene expression analysis of the zebrafish brain", "DRP003977", "Other", "Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.", null, null, null, "Telencephalon of adult zebrafrish  30 min post test session of 2 weeks memory test in non trace 2 Way Active Avoidance coditioning 2", "SAMD00182245", null, "sample name:CSUS Tel 30 2w memory 2|genotype:wild type|tissue:brain", null, null, null, null, null, null, null, null, "Illumina HiSeq 3000 sequencing of SAMD00182245", "DRX179867", "CSUS Tel 30 2w memory 2", "1", "SureSelect Strand Specific RNA Library Prep Kit", null, "RNA-Seq", "TRANSCRIPTOMIC", "PolyA", "SINGLE", "ILLUMINA", "Illumina HiSeq 3000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003977", "Illumina HiSeq 3000 sequencing of SAMD00182245", null, null, null, 1505449224.0, 41818034.0, "DRR189402", "0:36", "A:369895057;C:346914787;G:358624651;T:429897489;N:117240", 36, null, null, null, 369895057, 346914787, 358624651, 429897489, 117240, "DRX179867", "DRS200417", "DRA008865", "NIG|National Institute of Genetics (Japan)", "National Institute of Genetics (Japan)", 1, 0.89514, null, 0.17677, null, 0.7025, null, 0.49571, null, 36, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Japan", "2021-08-08", "Larval", "Larval", "Brain", "Nervous System"], [103, "DRR189401", "DRX179866", "DRS200416", "DRP003977", "PRJDB4470", "Gene expression analysis of the zebrafish brain", "DRP003977", "Other", "Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.", null, null, null, "Telencephalon of adult zebrafrish  30 min post test session of 2 weeks memory test in non trace 2 Way Active Avoidance coditioning 1", "SAMD00182244", null, "sample name:CSUS Tel 30 2w memory 1|genotype:wild type|tissue:brain", null, null, null, null, null, null, null, null, "Illumina HiSeq 3000 sequencing of SAMD00182244", "DRX179866", "CSUS Tel 30 2w memory 1", "1", "SureSelect Strand Specific RNA Library Prep Kit", null, "RNA-Seq", "TRANSCRIPTOMIC", "PolyA", "SINGLE", "ILLUMINA", "Illumina HiSeq 3000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003977", "Illumina HiSeq 3000 sequencing of SAMD00182244", null, null, null, 2088507024.0, 58014084.0, "DRR189401", "0:36", "A:516255405;C:478036869;G:496415722;T:597637091;N:161937", 36, null, null, null, 516255405, 478036869, 496415722, 597637091, 161937, "DRX179866", "DRS200416", "DRA008865", "NIG|National Institute of Genetics (Japan)", "National Institute of Genetics (Japan)", 1, 0.89533, null, 0.18553, null, 0.70981, null, 0.49554, null, 36, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Japan", "2021-08-08", "Larval", "Larval", "Brain", "Nervous System"], [125, "DRR189379", "DRX179844", "DRS200410", "DRP003977", "PRJDB4470", "Gene expression analysis of the zebrafish brain", "DRP003977", "Other", "Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.", null, null, null, "Whole body of EMX3  /  larval zebrafish 5dpf 3", "SAMD00182222", null, "sample name:Emx3     Larva body 3|genotype:Emx3 / |tissue:whole body", null, null, null, null, null, null, null, null, "Illumina HiSeq 3000 sequencing of SAMD00182222", "DRX179844", "Emx3 /  Larva body 3", "1", "SureSelect Strand Specific RNA Library Prep Kit", null, "RNA-Seq", "TRANSCRIPTOMIC", "PolyA", "SINGLE", "ILLUMINA", "Illumina HiSeq 3000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003977", "Illumina HiSeq 3000 sequencing of SAMD00182222", null, null, null, 1759409208.0, 48872478.0, "DRR189379", "0:36", "A:401147348;C:424523813;G:426350919;T:507310828;N:76300", 36, null, null, null, 401147348, 424523813, 426350919, 507310828, 76300, "DRX179844", "DRS200410", "DRA008857", "NIG|National Institute of Genetics (Japan)", "National Institute of Genetics (Japan)", 1, 0.90975, null, 0.11439, null, 0.66076, null, 0.47775, null, 36, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Japan", "2021-08-08", "Larval", "Larval", "Trunk", "Surface Structure"], [126, "DRR189378", "DRX179843", "DRS200409", "DRP003977", "PRJDB4470", "Gene expression analysis of the zebrafish brain", "DRP003977", "Other", "Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.", null, null, null, "Whole body of EMX3  /  larval zebrafish 5dpf 2", "SAMD00182221", null, "sample name:Emx3     Larva body 2|genotype:Emx3 / |tissue:whole body", null, null, null, null, null, null, null, null, "Illumina HiSeq 3000 sequencing of SAMD00182221", "DRX179843", "Emx3 /  Larva body 2", "1", "SureSelect Strand Specific RNA Library Prep Kit", null, "RNA-Seq", "TRANSCRIPTOMIC", "PolyA", "SINGLE", "ILLUMINA", "Illumina HiSeq 3000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003977", "Illumina HiSeq 3000 sequencing of SAMD00182221", null, null, null, 1318201020.0, 36616695.0, "DRR189378", "0:36", "A:297850068;C:316786585;G:323717530;T:379789606;N:57231", 36, null, null, null, 297850068, 316786585, 323717530, 379789606, 57231, "DRX179843", "DRS200409", "DRA008857", "NIG|National Institute of Genetics (Japan)", "National Institute of Genetics (Japan)", 1, 0.9116, null, 0.11269, null, 0.65837, null, 0.46733, null, 36, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Japan", "2021-08-08", "Larval", "Larval", "Trunk", "Surface Structure"], [127, "DRR189377", "DRX179842", "DRS200408", "DRP003977", "PRJDB4470", "Gene expression analysis of the zebrafish brain", "DRP003977", "Other", "Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.", null, null, null, "Whole body of EMX3  /  larval zebrafish 5dpf 1", "SAMD00182220", null, "sample name:Emx3     Larva body 1|genotype:Emx3 / |tissue:whole body", null, null, null, null, null, null, null, null, "Illumina HiSeq 3000 sequencing of SAMD00182220", "DRX179842", "Emx3 /  Larva body 1", "1", "SureSelect Strand Specific RNA Library Prep Kit", null, "RNA-Seq", "TRANSCRIPTOMIC", "PolyA", "SINGLE", "ILLUMINA", "Illumina HiSeq 3000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003977", "Illumina HiSeq 3000 sequencing of SAMD00182220", null, null, null, 812483964.0, 22568999.0, "DRR189377", "0:36", "A:185173338;C:197790160;G:197482964;T:232000884;N:36618", 36, null, null, null, 185173338, 197790160, 197482964, 232000884, 36618, "DRX179842", "DRS200408", "DRA008857", "NIG|National Institute of Genetics (Japan)", "National Institute of Genetics (Japan)", 1, 0.91107, null, 0.1171, null, 0.65981, null, 0.47458, null, 36, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Japan", "2021-08-08", "Larval", "Larval", "Trunk", "Surface Structure"], [128, "DRR189376", "DRX179841", "DRS200449", "DRP003977", "PRJDB4470", "Gene expression analysis of the zebrafish brain", "DRP003977", "Other", "Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.", null, null, null, "Whole body of wild type larval zebrafish 5dpf 3", "SAMD00182219", null, "sample name:WT Larva body 3|genotype:wild type|tissue:whole body", null, null, null, null, null, null, null, null, "Illumina HiSeq 3000 sequencing of SAMD00182219", "DRX179841", "WT Larva body 3", "1", "SureSelect Strand Specific RNA Library Prep Kit", null, "RNA-Seq", "TRANSCRIPTOMIC", "PolyA", "SINGLE", "ILLUMINA", "Illumina HiSeq 3000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003977", "Illumina HiSeq 3000 sequencing of SAMD00182219", null, null, null, 4030038144.0, 111945504.0, "DRR189376", "0:36", "A:943709984;C:971756680;G:977594500;T:1136798448;N:178532", 36, null, null, null, 943709984, 971756680, 977594500, 1136798448, 178532, "DRX179841", "DRS200449", "DRA008856", "NIG|National Institute of Genetics (Japan)", "National Institute of Genetics (Japan)", 1, 0.89574, null, 0.12331, null, 0.65831, null, 0.48096, null, 36, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Japan", "2021-08-08", "Larval", "Larval", "Trunk", "Surface Structure"], [129, "DRR189375", "DRX179840", "DRS200448", "DRP003977", "PRJDB4470", "Gene expression analysis of the zebrafish brain", "DRP003977", "Other", "Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.", null, null, null, "Whole body of wild type larval zebrafish 5dpf 2", "SAMD00182218", null, "sample name:WT Larva body 2|genotype:wild type|tissue:whole body", null, null, null, null, null, null, null, null, "Illumina HiSeq 3000 sequencing of SAMD00182218", "DRX179840", "WT Larva body 2", "1", "SureSelect Strand Specific RNA Library Prep Kit", null, "RNA-Seq", "TRANSCRIPTOMIC", "PolyA", "SINGLE", "ILLUMINA", "Illumina HiSeq 3000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003977", "Illumina HiSeq 3000 sequencing of SAMD00182218", null, null, null, 1991670804.0, 55324189.0, "DRR189375", "0:36", "A:454367176;C:479012055;G:488407231;T:569793674;N:90668", 36, null, null, null, 454367176, 479012055, 488407231, 569793674, 90668, "DRX179840", "DRS200448", "DRA008856", "NIG|National Institute of Genetics (Japan)", "National Institute of Genetics (Japan)", 1, 0.90911, null, 0.12455, null, 0.65494, null, 0.47971, null, 36, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Japan", "2021-08-08", "Larval", "Larval", "Trunk", "Surface Structure"], [130, "DRR189374", "DRX179839", "DRS200447", "DRP003977", "PRJDB4470", "Gene expression analysis of the zebrafish brain", "DRP003977", "Other", "Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.", null, null, null, "Whole body of wild type larval zebrafish 5dpf 1", "SAMD00182217", null, "sample name:WT Larva body 1|genotype:wild type|tissue:whole body", null, null, null, null, null, null, null, null, "Illumina HiSeq 3000 sequencing of SAMD00182217", "DRX179839", "WT Larva body 1", "1", "SureSelect Strand Specific RNA Library Prep Kit", null, "RNA-Seq", "TRANSCRIPTOMIC", "PolyA", "SINGLE", "ILLUMINA", "Illumina HiSeq 3000", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP003977", "Illumina HiSeq 3000 sequencing of SAMD00182217", null, null, null, 1018340100.0, 28287225.0, "DRR189374", "0:36", "A:233370050;C:244140659;G:247795084;T:292989542;N:44765", 36, null, null, null, 233370050, 244140659, 247795084, 292989542, 44765, "DRX179839", "DRS200447", "DRA008856", "NIG|National Institute of Genetics (Japan)", "National Institute of Genetics (Japan)", 1, 0.91078, null, 0.12578, null, 0.6524, null, 0.48016, null, 36, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Japan", "2021-08-08", "Larval", "Larval", "Trunk", "Surface Structure"], [168, "DRR075402", "DRX069316", "DRS075497", "DRP004473", "PRJDB5226", "Effects of local gut tumor on whole organismal gene expressions in zebrafish", "DRP004473", "Other", "How tumors affects whole organismal physiology remains largely unknown. To address this  we established the novel gut tumor model in zebrafish  Danio rerio. This model develops tumor at an early stage of juvenile development  when zebrafish larvae are small <4mm  enabling us to perform whole organismal RNA seq experiments. Control or tumor bearing zebrafish were dissected into the three parts under microscope: the liver  the gut/gut tumor  and others. Tissues from >10 individuals were pooled and RNA extracted. Analyses on these RNA seq samples identified a set of host genes affected by the gut tumor  contributing to discovering novel tumor organ interactions and their mediators in zebrafish.", null, null, "The liver of tumor fish 7dpf", "Tumor liver", "SAMD00065416", null, "sample name:6 Tumor liver 150701 Hiseq3A l3 022|tissue type:Liver", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing of SAMD00065416", "DRX069316", "Tumor liver", "1", "Agilent SureSelect Strand Specific RNA Prep Kit", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP004473", "Illumina HiSeq 2500 sequencing of SAMD00065416", null, null, null, 1091167236.0, 30310201.0, "DRR075402", "0:36", "A:272216839;C:257523620;G:259746158;T:301642763;N:37856", 36, null, null, null, 272216839, 257523620, 259746158, 301642763, 37856, "DRX069316", "DRS075497", "DRA005199", "ATR|The Thomas N. Sato BioMEC-X Laboratories, Advanced Telecommunications Research Institute International", "The Thomas N. Sato BioMEC-X Laboratories, Advanced Telecommunications Research Institute International", 1, 0.90443, null, 0.08935, null, 0.71863, null, 0.51145, null, 36, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Japan", "2018-09-19", "Larval", "Larval", "Multi-tissue", "Multi-system"], [169, "DRR075401", "DRX069315", "DRS075496", "DRP004473", "PRJDB5226", "Effects of local gut tumor on whole organismal gene expressions in zebrafish", "DRP004473", "Other", "How tumors affects whole organismal physiology remains largely unknown. To address this  we established the novel gut tumor model in zebrafish  Danio rerio. This model develops tumor at an early stage of juvenile development  when zebrafish larvae are small <4mm  enabling us to perform whole organismal RNA seq experiments. Control or tumor bearing zebrafish were dissected into the three parts under microscope: the liver  the gut/gut tumor  and others. Tissues from >10 individuals were pooled and RNA extracted. Analyses on these RNA seq samples identified a set of host genes affected by the gut tumor  contributing to discovering novel tumor organ interactions and their mediators in zebrafish.", null, null, "The gut of tumor fish 7dpf", "Tumor gut", "SAMD00065415", null, "sample name:5 Tumor gut 150701 Hiseq3A l3 021|tissue type:Gut", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing of SAMD00065415", "DRX069315", "Tumor gut", "1", "Agilent SureSelect Strand Specific RNA Prep Kit", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP004473", "Illumina HiSeq 2500 sequencing of SAMD00065415", null, null, null, 1423792872.0, 39549802.0, "DRR075401", "0:36", "A:342328685;C:346616167;G:341519547;T:393278536;N:49937", 36, null, null, null, 342328685, 346616167, 341519547, 393278536, 49937, "DRX069315", "DRS075496", "DRA005199", "ATR|The Thomas N. Sato BioMEC-X Laboratories, Advanced Telecommunications Research Institute International", "The Thomas N. Sato BioMEC-X Laboratories, Advanced Telecommunications Research Institute International", 1, 0.91303, null, 0.0869, null, 0.70494, null, 0.44332, null, 36, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Japan", "2018-09-19", "Larval", "Larval", "Multi-tissue", "Multi-system"], [170, "DRR075400", "DRX069314", "DRS075495", "DRP004473", "PRJDB5226", "Effects of local gut tumor on whole organismal gene expressions in zebrafish", "DRP004473", "Other", "How tumors affects whole organismal physiology remains largely unknown. To address this  we established the novel gut tumor model in zebrafish  Danio rerio. This model develops tumor at an early stage of juvenile development  when zebrafish larvae are small <4mm  enabling us to perform whole organismal RNA seq experiments. Control or tumor bearing zebrafish were dissected into the three parts under microscope: the liver  the gut/gut tumor  and others. Tissues from >10 individuals were pooled and RNA extracted. Analyses on these RNA seq samples identified a set of host genes affected by the gut tumor  contributing to discovering novel tumor organ interactions and their mediators in zebrafish.", null, null, "The remaining part of body of tumor fish 7dpf", "Tumor body", "SAMD00065414", null, "sample name:4 Tumor body 150701 Hiseq3A l3 020|tissue type:Body", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing of SAMD00065414", "DRX069314", "Tumor body", "1", "Agilent SureSelect Strand Specific RNA Prep Kit", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP004473", "Illumina HiSeq 2500 sequencing of SAMD00065414", null, null, null, 1168514964.0, 32458749.0, "DRR075400", "0:36", "A:286579925;C:275496498;G:278133055;T:328265078;N:40408", 36, null, null, null, 286579925, 275496498, 278133055, 328265078, 40408, "DRX069314", "DRS075495", "DRA005199", "ATR|The Thomas N. Sato BioMEC-X Laboratories, Advanced Telecommunications Research Institute International", "The Thomas N. Sato BioMEC-X Laboratories, Advanced Telecommunications Research Institute International", 1, 0.89927, null, 0.15051, null, 0.66714, null, 0.47579, null, 36, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Japan", "2018-09-19", "Larval", "Larval", "Multi-tissue", "Multi-system"], [171, "DRR075399", "DRX069313", "DRS075494", "DRP004473", "PRJDB5226", "Effects of local gut tumor on whole organismal gene expressions in zebrafish", "DRP004473", "Other", "How tumors affects whole organismal physiology remains largely unknown. To address this  we established the novel gut tumor model in zebrafish  Danio rerio. This model develops tumor at an early stage of juvenile development  when zebrafish larvae are small <4mm  enabling us to perform whole organismal RNA seq experiments. Control or tumor bearing zebrafish were dissected into the three parts under microscope: the liver  the gut/gut tumor  and others. Tissues from >10 individuals were pooled and RNA extracted. Analyses on these RNA seq samples identified a set of host genes affected by the gut tumor  contributing to discovering novel tumor organ interactions and their mediators in zebrafish.", null, null, "The liver of control fish 7dpf", "Control liver", "SAMD00065413", null, "sample name:3 control liver 150701 Hiseq3A l3 019|tissue type:Liver", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing of SAMD00065413", "DRX069313", "Control liver", "1", "Agilent SureSelect Strand Specific RNA Prep Kit", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP004473", "Illumina HiSeq 2500 sequencing of SAMD00065413", null, null, null, 951579036.0, 26432751.0, "DRR075399", "0:36", "A:231570583;C:228182815;G:227223430;T:264569214;N:32994", 36, null, null, null, 231570583, 228182815, 227223430, 264569214, 32994, "DRX069313", "DRS075494", "DRA005199", "ATR|The Thomas N. Sato BioMEC-X Laboratories, Advanced Telecommunications Research Institute International", "The Thomas N. Sato BioMEC-X Laboratories, Advanced Telecommunications Research Institute International", 1, 0.8903, null, 0.08667, null, 0.7236, null, 0.51557, null, 36, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Japan", "2018-09-19", "Larval", "Larval", "Liver", "Liver and Biliary System"], [172, "DRR075398", "DRX069312", "DRS075493", "DRP004473", "PRJDB5226", "Effects of local gut tumor on whole organismal gene expressions in zebrafish", "DRP004473", "Other", "How tumors affects whole organismal physiology remains largely unknown. To address this  we established the novel gut tumor model in zebrafish  Danio rerio. This model develops tumor at an early stage of juvenile development  when zebrafish larvae are small <4mm  enabling us to perform whole organismal RNA seq experiments. Control or tumor bearing zebrafish were dissected into the three parts under microscope: the liver  the gut/gut tumor  and others. Tissues from >10 individuals were pooled and RNA extracted. Analyses on these RNA seq samples identified a set of host genes affected by the gut tumor  contributing to discovering novel tumor organ interactions and their mediators in zebrafish.", null, null, "The gut of control fish 7dpf", "Control gut", "SAMD00065412", null, "sample name:2 control gut 150701 Hiseq3A l3 018|tissue type:Gut", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing of SAMD00065412", "DRX069312", "Control gut", "1", "Agilent SureSelect Strand Specific RNA Prep Kit", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP004473", "Illumina HiSeq 2500 sequencing of SAMD00065412", null, null, null, 1008093492.0, 28002597.0, "DRR075398", "0:36", "A:230431417;C:251640901;G:244174255;T:281811580;N:35339", 36, null, null, null, 230431417, 251640901, 244174255, 281811580, 35339, "DRX069312", "DRS075493", "DRA005199", "ATR|The Thomas N. Sato BioMEC-X Laboratories, Advanced Telecommunications Research Institute International", "The Thomas N. Sato BioMEC-X Laboratories, Advanced Telecommunications Research Institute International", 1, 0.9173, null, 0.07181, null, 0.72017, null, 0.45193, null, 36, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Japan", "2018-09-19", "Larval", "Larval", "Gut", "Digestive System"], [173, "DRR075397", "DRX069311", "DRS075492", "DRP004473", "PRJDB5226", "Effects of local gut tumor on whole organismal gene expressions in zebrafish", "DRP004473", "Other", "How tumors affects whole organismal physiology remains largely unknown. To address this  we established the novel gut tumor model in zebrafish  Danio rerio. This model develops tumor at an early stage of juvenile development  when zebrafish larvae are small <4mm  enabling us to perform whole organismal RNA seq experiments. Control or tumor bearing zebrafish were dissected into the three parts under microscope: the liver  the gut/gut tumor  and others. Tissues from >10 individuals were pooled and RNA extracted. Analyses on these RNA seq samples identified a set of host genes affected by the gut tumor  contributing to discovering novel tumor organ interactions and their mediators in zebrafish.", null, null, "The remaining part of body of control fish 7dpf", "Control body", "SAMD00065411", null, "sample name:1 control body 150701 Hiseq3A l3 017|tissue type:Body", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing of SAMD00065411", "DRX069311", "Control body", "1", "Agilent SureSelect Strand Specific RNA Prep Kit", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "DRP004473", "Illumina HiSeq 2500 sequencing of SAMD00065411", null, null, null, 2653100352.0, 73697232.0, "DRR075397", "0:36", "A:656791658;C:620507513;G:625038612;T:750671135;N:91434", 36, null, null, null, 656791658, 620507513, 625038612, 750671135, 91434, "DRX069311", "DRS075492", "DRA005199", "ATR|The Thomas N. Sato BioMEC-X Laboratories, Advanced Telecommunications Research Institute International", "The Thomas N. Sato BioMEC-X Laboratories, Advanced Telecommunications Research Institute International", 1, 0.89666, null, 0.15749, null, 0.67048, null, 0.47755, null, 36, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Japan", "2018-09-19", "Larval", "Larval", "Trunk", "Surface Structure"], [3015, "ERR1396841", "ERX1468100", "ERS1051448", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph230 dgcr8 C7", "SAMEA3864314", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864314|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:35Z|INSDC status:public|Submitter Id:2a85d100 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dgcr8  allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a85d100 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 2#24", "15616955", "Illumina sequencing of library 15616955  constructed from sample accession ERS1051448 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 2.  This submission includes reads tagged with the sequence ATTCCT.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_2#24.cram", "cram", 252742350.0, 5054847.0, "SC RUN 18732 2#24", "0:50", "A:72444190;C:64568625;G:62796637;T:52911792;N:21106", 50, null, null, null, 72444190, 64568625, 62796637, 52911792, 21106, "ERX1468100", "ERS1051448", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.61824, null, 0.09608, null, 0.8842, null, 0.56978, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [3016, "ERR1396840", "ERX1468099", "ERS1051447", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph230 dgcr8 B12", "SAMEA3864313", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864313|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:35Z|INSDC status:public|Submitter Id:2a7dbab0 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dgcr8  allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a7dbab0 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 2#23", "15616943", "Illumina sequencing of library 15616943  constructed from sample accession ERS1051447 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 2.  This submission includes reads tagged with the sequence ACTGAT.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_2#23.cram", "cram", 911394150.0, 18227883.0, "SC RUN 18732 2#23", "0:50", "A:264591252;C:227216187;G:236072241;T:183438530;N:75940", 50, null, null, null, 264591252, 227216187, 236072241, 183438530, 75940, "ERX1468099", "ERS1051447", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.58273, null, 0.09754, null, 0.87448, null, 0.55833, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3017, "ERR1396839", "ERX1468098", "ERS1051446", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph230 dgcr8 B10", "SAMEA3864312", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864312|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:34Z|INSDC status:public|Submitter Id:2a70e970 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dgcr8  allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a70e970 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 2#22", "15616931", "Illumina sequencing of library 15616931  constructed from sample accession ERS1051446 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 2.  This submission includes reads tagged with the sequence GAGTGG.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_2#22.cram", "cram", 242466400.0, 4849328.0, "SC RUN 18732 2#22", "0:50", "A:69326734;C:60104801;G:65507097;T:47507301;N:20467", 50, null, null, null, 69326734, 60104801, 65507097, 47507301, 20467, "ERX1468098", "ERS1051446", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.60819, null, 0.09544, null, 0.87864, null, 0.58472, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3018, "ERR1396838", "ERX1468097", "ERS1051445", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph230 dgcr8 B3", "SAMEA3864311", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864311|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:34Z|INSDC status:public|Submitter Id:2a6aa7e0 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dgcr8  allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a6aa7e0 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 2#21", "15616919", "Illumina sequencing of library 15616919  constructed from sample accession ERS1051445 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 2.  This submission includes reads tagged with the sequence CGTACG.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_2#21.cram", "cram", 630737800.0, 12614756.0, "SC RUN 18732 2#21", "0:50", "A:180007611;C:161281943;G:164376347;T:125019243;N:52656", 50, null, null, null, 180007611, 161281943, 164376347, 125019243, 52656, "ERX1468097", "ERS1051445", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.62407, null, 0.10189, null, 0.87825, null, 0.57526, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3019, "ERR1396837", "ERX1468096", "ERS1051444", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph230 dgcr8 A4", "SAMEA3864310", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864310|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:33Z|INSDC status:public|Submitter Id:2a61a730 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for dgcr8  allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a61a730 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 2#20", "15616907", "Illumina sequencing of library 15616907  constructed from sample accession ERS1051444 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 2.  This submission includes reads tagged with the sequence GTTTCG.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_2#20.cram", "cram", 488336450.0, 9766729.0, "SC RUN 18732 2#20", "0:50", "A:137910201;C:123586221;G:128373512;T:98425645;N:40871", 50, null, null, null, 137910201, 123586221, 128373512, 98425645, 40871, "ERX1468096", "ERS1051444", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.5453, null, 0.11361, null, 0.86594, null, 0.58106, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3020, "ERR1396836", "ERX1468095", "ERS1051443", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph230 dgcr8 A3", "SAMEA3864309", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864309|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:32Z|INSDC status:public|Submitter Id:2a5a0610 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for dgcr8  allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a5a0610 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 2#19", "15616895", "Illumina sequencing of library 15616895  constructed from sample accession ERS1051443 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 2.  This submission includes reads tagged with the sequence GTGGCC.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_2#19.cram", "cram", 502748050.0, 10054961.0, "SC RUN 18732 2#19", "0:50", "A:140684190;C:129525504;G:133998850;T:98497819;N:41687", 50, null, null, null, 140684190, 129525504, 133998850, 98497819, 41687, "ERX1468095", "ERS1051443", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.55085, null, 0.11739, null, 0.87077, null, 0.6012, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3021, "ERR1396835", "ERX1468094", "ERS1051442", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph230 dgcr8 A2", "SAMEA3864308", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864308|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:32Z|INSDC status:public|Submitter Id:2a537660 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for dgcr8  allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a537660 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 2#18", "15616883", "Illumina sequencing of library 15616883  constructed from sample accession ERS1051442 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 2.  This submission includes reads tagged with the sequence GTGAAA.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_2#18.cram", "cram", 512343000.0, 10246860.0, "SC RUN 18732 2#18", "0:50", "A:149660992;C:130013834;G:134888430;T:97736324;N:43420", 50, null, null, null, 149660992, 130013834, 134888430, 97736324, 43420, "ERX1468094", "ERS1051442", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.54809, null, 0.11505, null, 0.88254, null, 0.5985, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3022, "ERR1396834", "ERX1468093", "ERS1051441", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph230 dgcr8 A1", "SAMEA3864307", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864307|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:31Z|INSDC status:public|Submitter Id:2a4c4a70 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for dgcr8  allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a4c4a70 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 2#17", "15616871", "Illumina sequencing of library 15616871  constructed from sample accession ERS1051441 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 2.  This submission includes reads tagged with the sequence GTCCGC.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_2#17.cram", "cram", 296362850.0, 5927257.0, "SC RUN 18732 2#17", "0:50", "A:84251830;C:79653531;G:76748992;T:55683722;N:24775", 50, null, null, null, 84251830, 79653531, 76748992, 55683722, 24775, "ERX1468093", "ERS1051441", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.50115, null, 0.10395, null, 0.90185, null, 0.6019, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3023, "ERR1396833", "ERX1468092", "ERS1051440", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph229 dicer C3", "SAMEA3864306", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864306|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:31Z|INSDC status:public|Submitter Id:2a3ba8a0 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dicer  allele sa9205. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a3ba8a0 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 2#16", "15616954", "Illumina sequencing of library 15616954  constructed from sample accession ERS1051440 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 2.  This submission includes reads tagged with the sequence CCGTCC.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_2#16.cram", "cram", 247427250.0, 4948545.0, "SC RUN 18732 2#16", "0:50", "A:69477894;C:64165990;G:64753499;T:49009156;N:20711", 50, null, null, null, 69477894, 64165990, 64753499, 49009156, 20711, "ERX1468092", "ERS1051440", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.66601, null, 0.10439, null, 0.88156, null, 0.5519, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3024, "ERR1396832", "ERX1468091", "ERS1051439", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph229 dicer B4", "SAMEA3864305", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864305|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:30Z|INSDC status:public|Submitter Id:2a319680 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dicer  allele sa9205. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a319680 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 2#15", "15616942", "Illumina sequencing of library 15616942  constructed from sample accession ERS1051439 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 2.  This submission includes reads tagged with the sequence ATGTCA.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_2#15.cram", "cram", 268495550.0, 5369911.0, "SC RUN 18732 2#15", "0:50", "A:78316008;C:67311837;G:69086954;T:53758238;N:22513", 50, null, null, null, 78316008, 67311837, 69086954, 53758238, 22513, "ERX1468091", "ERS1051439", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.61927, null, 0.0935, null, 0.89745, null, 0.55698, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3025, "ERR1396831", "ERX1468090", "ERS1051438", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph229 dicer A7", "SAMEA3864304", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864304|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:29Z|INSDC status:public|Submitter Id:2a2a6a90 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dicer  allele sa9205. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a2a6a90 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 2#14", "15616930", "Illumina sequencing of library 15616930  constructed from sample accession ERS1051438 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 2.  This submission includes reads tagged with the sequence AGTTCC.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_2#14.cram", "cram", 457637200.0, 9152744.0, "SC RUN 18732 2#14", "0:50", "A:131304805;C:115755054;G:118778813;T:91760838;N:37690", 50, null, null, null, 131304805, 115755054, 118778813, 91760838, 37690, "ERX1468090", "ERS1051438", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.64717, null, 0.09607, null, 0.89832, null, 0.56732, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3026, "ERR1396830", "ERX1468089", "ERS1051437", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph229 dicer A1", "SAMEA3864303", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864303|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:29Z|INSDC status:public|Submitter Id:2a238cc0 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dicer  allele sa9205. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a238cc0 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 2#13", "15616918", "Illumina sequencing of library 15616918  constructed from sample accession ERS1051437 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 2.  This submission includes reads tagged with the sequence AGTCAA.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_2#13.cram", "cram", 156613950.0, 3132279.0, "SC RUN 18732 2#13", "0:50", "A:45659102;C:39445557;G:40495414;T:31000827;N:13050", 50, null, null, null, 45659102, 39445557, 40495414, 31000827, 13050, "ERX1468089", "ERS1051437", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.65923, null, 0.09289, null, 0.90096, null, 0.52171, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3027, "ERR1396829", "ERX1468088", "ERS1051436", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph229 dicer C1", "SAMEA3864302", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864302|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:28Z|INSDC status:public|Submitter Id:2a1b9d80 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for dicer  allele sa9205. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a1b9d80 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 2#12", "15616906", "Illumina sequencing of library 15616906  constructed from sample accession ERS1051436 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 2.  This submission includes reads tagged with the sequence CTTGTA.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_2#12.cram", "cram", 370496150.0, 7409923.0, "SC RUN 18732 2#12", "0:50", "A:104657486;C:92274677;G:97465315;T:76068240;N:30432", 50, null, null, null, 104657486, 92274677, 97465315, 76068240, 30432, "ERX1468088", "ERS1051436", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.64244, null, 0.11811, null, 0.86578, null, 0.55798, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3028, "ERR1396828", "ERX1468087", "ERS1051435", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph229 dicer B3", "SAMEA3864301", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864301|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:55Z|INSDC last update:2016 02 03T09:48:28Z|INSDC status:public|Submitter Id:2a0d93c0 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for dicer  allele sa9205. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a0d93c0 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 2#11", "15616894", "Illumina sequencing of library 15616894  constructed from sample accession ERS1051435 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 2.  This submission includes reads tagged with the sequence GGCTAC.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_2#11.cram", "cram", 136326100.0, 2726522.0, "SC RUN 18732 2#11", "0:50", "A:38914874;C:34737645;G:36229387;T:26432631;N:11563", 50, null, null, null, 38914874, 34737645, 36229387, 26432631, 11563, "ERX1468087", "ERS1051435", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.60295, null, 0.10315, null, 0.89092, null, 0.58169, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3029, "ERR1396827", "ERX1468086", "ERS1051434", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph229 dicer A12", "SAMEA3864300", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864300|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:27Z|INSDC status:public|Submitter Id:2a075230 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for dicer  allele sa9205. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a075230 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 2#10", "15616882", "Illumina sequencing of library 15616882  constructed from sample accession ERS1051434 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 2.  This submission includes reads tagged with the sequence TAGCTT.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_2#10.cram", "cram", 257740250.0, 5154805.0, "SC RUN 18732 2#10", "0:50", "A:73736881;C:64681440;G:67096497;T:52203988;N:21444", 50, null, null, null, 73736881, 64681440, 67096497, 52203988, 21444, "ERX1468086", "ERS1051434", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.62041, null, 0.10196, null, 0.89706, null, 0.55474, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3030, "ERR1396826", "ERX1468085", "ERS1051433", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph229 dicer A10", "SAMEA3864299", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864299|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:26Z|INSDC status:public|Submitter Id:29ffff30 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for dicer  allele sa9205. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29ffff30 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 2#9", "15616870", "Illumina sequencing of library 15616870  constructed from sample accession ERS1051433 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 2.  This submission includes reads tagged with the sequence GATCAG.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_2#9.cram", "cram", 7356000.0, 147120.0, "SC RUN 18732 2#9", "0:50", "A:2152284;C:1844982;G:1920243;T:1437897;N:594", 50, null, null, null, 2152284, 1844982, 1920243, 1437897, 594, "ERX1468085", "ERS1051433", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.60239, null, 0.10502, null, 0.91084, null, 0.55869, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3031, "ERR1396825", "ERX1468084", "ERS1051432", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph228 drosha C1", "SAMEA3864298", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864298|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:26Z|INSDC status:public|Submitter Id:29f306e0 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for drosha  allele sa191. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29f306e0 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 2#8", "15616953", "Illumina sequencing of library 15616953  constructed from sample accession ERS1051432 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 2.  This submission includes reads tagged with the sequence ACTTGA.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_2#8.cram", "cram", 454519900.0, 9090398.0, "SC RUN 18732 2#8", "0:50", "A:133717355;C:117574792;G:114940340;T:88249706;N:37707", 50, null, null, null, 133717355, 117574792, 114940340, 88249706, 37707, "ERX1468084", "ERS1051432", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.51063, null, 0.10053, null, 0.88572, null, 0.60434, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3032, "ERR1396824", "ERX1468083", "ERS1051431", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph228 drosha A9", "SAMEA3864297", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864297|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:25Z|INSDC status:public|Submitter Id:29e942e0 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for drosha  allele sa191. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29e942e0 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 2#7", "15616941", "Illumina sequencing of library 15616941  constructed from sample accession ERS1051431 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 2.  This submission includes reads tagged with the sequence CAGATC.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_2#7.cram", "cram", 288165650.0, 5763313.0, "SC RUN 18732 2#7", "0:50", "A:83874531;C:74578491;G:74739497;T:54949008;N:24123", 50, null, null, null, 83874531, 74578491, 74739497, 54949008, 24123, "ERX1468083", "ERS1051431", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.56561, null, 0.10234, null, 0.88278, null, 0.59066, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3033, "ERR1396823", "ERX1468082", "ERS1051430", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph228 drosha A6", "SAMEA3864296", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864296|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:25Z|INSDC status:public|Submitter Id:29e06940 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for drosha  allele sa191. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29e06940 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 2#6", "15616929", "Illumina sequencing of library 15616929  constructed from sample accession ERS1051430 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 2.  This submission includes reads tagged with the sequence GCCAAT.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_2#6.cram", "cram", 234507600.0, 4690152.0, "SC RUN 18732 2#6", "0:50", "A:67284766;C:59565829;G:61407599;T:46229970;N:19436", 50, null, null, null, 67284766, 59565829, 61407599, 46229970, 19436, "ERX1468082", "ERS1051430", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.64334, null, 0.10252, null, 0.88905, null, 0.5695, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3034, "ERR1396822", "ERX1468081", "ERS1051429", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph228 drosha A1", "SAMEA3864295", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864295|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:24Z|INSDC status:public|Submitter Id:29d74180 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for drosha  allele sa191. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29d74180 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 2#5", "15616917", "Illumina sequencing of library 15616917  constructed from sample accession ERS1051429 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 2.  This submission includes reads tagged with the sequence ACAGTG.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_2#5.cram", "cram", 161797350.0, 3235947.0, "SC RUN 18732 2#5", "0:50", "A:46711991;C:40739475;G:42456048;T:31876390;N:13446", 50, null, null, null, 46711991, 40739475, 42456048, 31876390, 13446, "ERX1468081", "ERS1051429", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.64666, null, 0.09851, null, 0.90508, null, 0.56607, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3035, "ERR1396821", "ERX1468080", "ERS1051428", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph228 drosha B12", "SAMEA3864294", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864294|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:23Z|INSDC status:public|Submitter Id:29cf7950 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for drosha  allele sa191. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29cf7950 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 2#4", "15616905", "Illumina sequencing of library 15616905  constructed from sample accession ERS1051428 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 2.  This submission includes reads tagged with the sequence TGACCA.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_2#4.cram", "cram", 393377600.0, 7867552.0, "SC RUN 18732 2#4", "0:50", "A:115292812;C:103803007;G:98535312;T:75713409;N:33060", 50, null, null, null, 115292812, 103803007, 98535312, 75713409, 33060, "ERX1468080", "ERS1051428", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.51888, null, 0.1037, null, 0.89948, null, 0.59445, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3036, "ERR1396820", "ERX1468079", "ERS1051427", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph228 drosha B10", "SAMEA3864293", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864293|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:22Z|INSDC status:public|Submitter Id:29c84d60 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for drosha  allele sa191. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29c84d60 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 2#3", "15616893", "Illumina sequencing of library 15616893  constructed from sample accession ERS1051427 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 2.  This submission includes reads tagged with the sequence TTAGGC.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_2#3.cram", "cram", 211138300.0, 4222766.0, "SC RUN 18732 2#3", "0:50", "A:60487130;C:53019786;G:55472125;T:42141858;N:17401", 50, null, null, null, 60487130, 53019786, 55472125, 42141858, 17401, "ERX1468079", "ERS1051427", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.57434, null, 0.11571, null, 0.88633, null, 0.6058, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3037, "ERR1396819", "ERX1468078", "ERS1051426", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph228 drosha B7", "SAMEA3864292", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864292|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:22Z|INSDC status:public|Submitter Id:29b1df30 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for drosha  allele sa191. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29b1df30 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 2#2", "15616881", "Illumina sequencing of library 15616881  constructed from sample accession ERS1051426 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 2.  This submission includes reads tagged with the sequence CGATGT.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_2#2.cram", "cram", 318903600.0, 6378072.0, "SC RUN 18732 2#2", "0:50", "A:91235181;C:80984947;G:84861359;T:61795663;N:26450", 50, null, null, null, 91235181, 80984947, 84861359, 61795663, 26450, "ERX1468078", "ERS1051426", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.57408, null, 0.11398, null, 0.87629, null, 0.60954, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3038, "ERR1396818", "ERX1468077", "ERS1051425", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph228 drosha B1", "SAMEA3864291", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864291|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:55Z|INSDC last update:2016 02 03T09:48:20Z|INSDC status:public|Submitter Id:29904d70 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for drosha  allele sa191. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29904d70 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 2#1", "15616869", "Illumina sequencing of library 15616869  constructed from sample accession ERS1051425 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 2.  This submission includes reads tagged with the sequence ATCACG.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_2#1.cram", "cram", 411180300.0, 8223606.0, "SC RUN 18732 2#1", "0:50", "A:118946374;C:103897659;G:107565667;T:80736319;N:34281", 50, null, null, null, 118946374, 103897659, 107565667, 80736319, 34281, "ERX1468077", "ERS1051425", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.60674, null, 0.11483, null, 0.90258, null, 0.54833, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3039, "ERR1396817", "ERX1468076", "ERS1051448", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph230 dgcr8 C7", "SAMEA3864314", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864314|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:35Z|INSDC status:public|Submitter Id:2a85d100 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dgcr8  allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a85d100 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 1#24", "15616955", "Illumina sequencing of library 15616955  constructed from sample accession ERS1051448 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 1.  This submission includes reads tagged with the sequence ATTCCT.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_1#24.cram", "cram", 258624300.0, 5172486.0, "SC RUN 18732 1#24", "0:50", "A:74123846;C:66047722;G:64286422;T:54141623;N:24687", 50, null, null, null, 74123846, 66047722, 64286422, 54141623, 24687, "ERX1468076", "ERS1051448", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.62009, null, 0.09612, null, 0.88434, null, 0.55718, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [3040, "ERR1396816", "ERX1468075", "ERS1051447", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph230 dgcr8 B12", "SAMEA3864313", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864313|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:35Z|INSDC status:public|Submitter Id:2a7dbab0 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dgcr8  allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a7dbab0 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 1#23", "15616943", "Illumina sequencing of library 15616943  constructed from sample accession ERS1051447 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 1.  This submission includes reads tagged with the sequence ACTGAT.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_1#23.cram", "cram", 932669450.0, 18653389.0, "SC RUN 18732 1#23", "0:50", "A:270743929;C:232449590;G:241669732;T:187716399;N:89800", 50, null, null, null, 270743929, 232449590, 241669732, 187716399, 89800, "ERX1468075", "ERS1051447", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.58314, null, 0.09813, null, 0.87373, null, 0.55534, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3041, "ERR1396815", "ERX1468074", "ERS1051446", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph230 dgcr8 B10", "SAMEA3864312", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864312|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:34Z|INSDC status:public|Submitter Id:2a70e970 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dgcr8  allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a70e970 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 1#22", "15616931", "Illumina sequencing of library 15616931  constructed from sample accession ERS1051446 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 1.  This submission includes reads tagged with the sequence GAGTGG.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_1#22.cram", "cram", 247740600.0, 4954812.0, "SC RUN 18732 1#22", "0:50", "A:70832472;C:61402287;G:66930146;T:48552217;N:23478", 50, null, null, null, 70832472, 61402287, 66930146, 48552217, 23478, "ERX1468074", "ERS1051446", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.60866, null, 0.09645, null, 0.87842, null, 0.56581, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3042, "ERR1396814", "ERX1468073", "ERS1051445", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph230 dgcr8 B3", "SAMEA3864311", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864311|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:34Z|INSDC status:public|Submitter Id:2a6aa7e0 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dgcr8  allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a6aa7e0 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 1#21", "15616919", "Illumina sequencing of library 15616919  constructed from sample accession ERS1051445 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 1.  This submission includes reads tagged with the sequence CGTACG.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_1#21.cram", "cram", 644730800.0, 12894616.0, "SC RUN 18732 1#21", "0:50", "A:183986486;C:164794735;G:168072875;T:127815308;N:61396", 50, null, null, null, 183986486, 164794735, 168072875, 127815308, 61396, "ERX1468073", "ERS1051445", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.62529, null, 0.10255, null, 0.87673, null, 0.58496, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3043, "ERR1396813", "ERX1468072", "ERS1051444", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph230 dgcr8 A4", "SAMEA3864310", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864310|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:33Z|INSDC status:public|Submitter Id:2a61a730 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for dgcr8  allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a61a730 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 1#20", "15616907", "Illumina sequencing of library 15616907  constructed from sample accession ERS1051444 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 1.  This submission includes reads tagged with the sequence GTTTCG.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_1#20.cram", "cram", 498997400.0, 9979948.0, "SC RUN 18732 1#20", "0:50", "A:140918075;C:126256924;G:131206962;T:100567098;N:48341", 50, null, null, null, 140918075, 126256924, 131206962, 100567098, 48341, "ERX1468072", "ERS1051444", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.54672, null, 0.11372, null, 0.8659, null, 0.58386, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3044, "ERR1396812", "ERX1468071", "ERS1051443", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph230 dgcr8 A3", "SAMEA3864309", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864309|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:32Z|INSDC status:public|Submitter Id:2a5a0610 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for dgcr8  allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a5a0610 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 1#19", "15616895", "Illumina sequencing of library 15616895  constructed from sample accession ERS1051443 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 1.  This submission includes reads tagged with the sequence GTGGCC.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_1#19.cram", "cram", 513060400.0, 10261208.0, "SC RUN 18732 1#19", "0:50", "A:143572990;C:132143361;G:136785883;T:100508957;N:49209", 50, null, null, null, 143572990, 132143361, 136785883, 100508957, 49209, "ERX1468071", "ERS1051443", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.55168, null, 0.11683, null, 0.86868, null, 0.59303, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3045, "ERR1396811", "ERX1468070", "ERS1051442", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph230 dgcr8 A2", "SAMEA3864308", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864308|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:32Z|INSDC status:public|Submitter Id:2a537660 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for dgcr8  allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a537660 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 1#18", "15616883", "Illumina sequencing of library 15616883  constructed from sample accession ERS1051442 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 1.  This submission includes reads tagged with the sequence GTGAAA.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_1#18.cram", "cram", 522864750.0, 10457295.0, "SC RUN 18732 1#18", "0:50", "A:152695334;C:132665110;G:137681171;T:99772629;N:50506", 50, null, null, null, 152695334, 132665110, 137681171, 99772629, 50506, "ERX1468070", "ERS1051442", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.54885, null, 0.11528, null, 0.88176, null, 0.60373, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3046, "ERR1396810", "ERX1468069", "ERS1051441", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph230 dgcr8 A1", "SAMEA3864307", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864307|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:31Z|INSDC status:public|Submitter Id:2a4c4a70 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for dgcr8  allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a4c4a70 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 1#17", "15616871", "Illumina sequencing of library 15616871  constructed from sample accession ERS1051441 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 1.  This submission includes reads tagged with the sequence GTCCGC.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_1#17.cram", "cram", 302165250.0, 6043305.0, "SC RUN 18732 1#17", "0:50", "A:85905345;C:81184773;G:78275206;T:56770744;N:29182", 50, null, null, null, 85905345, 81184773, 78275206, 56770744, 29182, "ERX1468069", "ERS1051441", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.50199, null, 0.10346, null, 0.90118, null, 0.59572, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3047, "ERR1396809", "ERX1468068", "ERS1051440", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph229 dicer C3", "SAMEA3864306", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864306|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:31Z|INSDC status:public|Submitter Id:2a3ba8a0 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dicer  allele sa9205. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a3ba8a0 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 1#16", "15616954", "Illumina sequencing of library 15616954  constructed from sample accession ERS1051440 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 1.  This submission includes reads tagged with the sequence CCGTCC.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_1#16.cram", "cram", 252866050.0, 5057321.0, "SC RUN 18732 1#16", "0:50", "A:71001103;C:65550329;G:66199420;T:50091388;N:23810", 50, null, null, null, 71001103, 65550329, 66199420, 50091388, 23810, "ERX1468068", "ERS1051440", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.66563, null, 0.10454, null, 0.88239, null, 0.53964, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3048, "ERR1396808", "ERX1468067", "ERS1051439", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph229 dicer B4", "SAMEA3864305", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864305|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:30Z|INSDC status:public|Submitter Id:2a319680 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dicer  allele sa9205. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a319680 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 1#15", "15616942", "Illumina sequencing of library 15616942  constructed from sample accession ERS1051439 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 1.  This submission includes reads tagged with the sequence ATGTCA.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_1#15.cram", "cram", 274471250.0, 5489425.0, "SC RUN 18732 1#15", "0:50", "A:80060226;C:68799356;G:70635515;T:54950129;N:26024", 50, null, null, null, 80060226, 68799356, 70635515, 54950129, 26024, "ERX1468067", "ERS1051439", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.61964, null, 0.09406, null, 0.89402, null, 0.55473, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3049, "ERR1396807", "ERX1468066", "ERS1051438", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph229 dicer A7", "SAMEA3864304", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864304|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:29Z|INSDC status:public|Submitter Id:2a2a6a90 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dicer  allele sa9205. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a2a6a90 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 1#14", "15616930", "Illumina sequencing of library 15616930  constructed from sample accession ERS1051438 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 1.  This submission includes reads tagged with the sequence AGTTCC.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_1#14.cram", "cram", 467847600.0, 9356952.0, "SC RUN 18732 1#14", "0:50", "A:134225837;C:118320475;G:121443773;T:93812243;N:45272", 50, null, null, null, 134225837, 118320475, 121443773, 93812243, 45272, "ERX1468066", "ERS1051438", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.64705, null, 0.096, null, 0.8983, null, 0.56022, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3050, "ERR1396806", "ERX1468065", "ERS1051437", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph229 dicer A1", "SAMEA3864303", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864303|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:29Z|INSDC status:public|Submitter Id:2a238cc0 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dicer  allele sa9205. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a238cc0 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 1#13", "15616918", "Illumina sequencing of library 15616918  constructed from sample accession ERS1051437 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 1.  This submission includes reads tagged with the sequence AGTCAA.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_1#13.cram", "cram", 160243100.0, 3204862.0, "SC RUN 18732 1#13", "0:50", "A:46708835;C:40347424;G:41434539;T:31737029;N:15273", 50, null, null, null, 46708835, 40347424, 41434539, 31737029, 15273, "ERX1468065", "ERS1051437", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.65975, null, 0.09405, null, 0.90065, null, 0.54178, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3051, "ERR1396805", "ERX1468064", "ERS1051436", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph229 dicer C1", "SAMEA3864302", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864302|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:28Z|INSDC status:public|Submitter Id:2a1b9d80 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for dicer  allele sa9205. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a1b9d80 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 1#12", "15616906", "Illumina sequencing of library 15616906  constructed from sample accession ERS1051436 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 1.  This submission includes reads tagged with the sequence CTTGTA.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_1#12.cram", "cram", 378715650.0, 7574313.0, "SC RUN 18732 1#12", "0:50", "A:106991982;C:94292878;G:99663404;T:77730801;N:36585", 50, null, null, null, 106991982, 94292878, 99663404, 77730801, 36585, "ERX1468064", "ERS1051436", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.64513, null, 0.11804, null, 0.86525, null, 0.55346, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3052, "ERR1396804", "ERX1468063", "ERS1051435", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph229 dicer B3", "SAMEA3864301", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864301|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:55Z|INSDC last update:2016 02 03T09:48:28Z|INSDC status:public|Submitter Id:2a0d93c0 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for dicer  allele sa9205. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a0d93c0 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 1#11", "15616894", "Illumina sequencing of library 15616894  constructed from sample accession ERS1051435 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 1.  This submission includes reads tagged with the sequence GGCTAC.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_1#11.cram", "cram", 139094000.0, 2781880.0, "SC RUN 18732 1#11", "0:50", "A:39702275;C:35436377;G:36969525;T:26972594;N:13229", 50, null, null, null, 39702275, 35436377, 36969525, 26972594, 13229, "ERX1468063", "ERS1051435", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.60357, null, 0.10386, null, 0.88872, null, 0.5774, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3053, "ERR1396803", "ERX1468062", "ERS1051434", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph229 dicer A12", "SAMEA3864300", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864300|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:27Z|INSDC status:public|Submitter Id:2a075230 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for dicer  allele sa9205. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a075230 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 1#10", "15616882", "Illumina sequencing of library 15616882  constructed from sample accession ERS1051434 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 1.  This submission includes reads tagged with the sequence TAGCTT.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_1#10.cram", "cram", 263295150.0, 5265903.0, "SC RUN 18732 1#10", "0:50", "A:75332297;C:66059671;G:68562462;T:53315439;N:25281", 50, null, null, null, 75332297, 66059671, 68562462, 53315439, 25281, "ERX1468062", "ERS1051434", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.61939, null, 0.10112, null, 0.89613, null, 0.55542, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3054, "ERR1396802", "ERX1468061", "ERS1051433", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph229 dicer A10", "SAMEA3864299", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864299|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:26Z|INSDC status:public|Submitter Id:29ffff30 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for dicer  allele sa9205. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29ffff30 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 1#9", "15616870", "Illumina sequencing of library 15616870  constructed from sample accession ERS1051433 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 1.  This submission includes reads tagged with the sequence GATCAG.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_1#9.cram", "cram", 7506900.0, 150138.0, "SC RUN 18732 1#9", "0:50", "A:2194276;C:1883363;G:1959471;T:1468994;N:796", 50, null, null, null, 2194276, 1883363, 1959471, 1468994, 796, "ERX1468061", "ERS1051433", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.60026, null, 0.10518, null, 0.91106, null, 0.55508, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3055, "ERR1396801", "ERX1468060", "ERS1051432", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph228 drosha C1", "SAMEA3864298", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864298|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:26Z|INSDC status:public|Submitter Id:29f306e0 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for drosha  allele sa191. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29f306e0 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 1#8", "15616953", "Illumina sequencing of library 15616953  constructed from sample accession ERS1051432 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 1.  This submission includes reads tagged with the sequence ACTTGA.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_1#8.cram", "cram", 464447300.0, 9288946.0, "SC RUN 18732 1#8", "0:50", "A:136629424;C:120103988;G:117495447;T:90173901;N:44540", 50, null, null, null, 136629424, 120103988, 117495447, 90173901, 44540, "ERX1468060", "ERS1051432", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.51298, null, 0.10188, null, 0.88434, null, 0.6034, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3056, "ERR1396800", "ERX1468059", "ERS1051431", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph228 drosha A9", "SAMEA3864297", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864297|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:25Z|INSDC status:public|Submitter Id:29e942e0 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for drosha  allele sa191. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29e942e0 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 1#7", "15616941", "Illumina sequencing of library 15616941  constructed from sample accession ERS1051431 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 1.  This submission includes reads tagged with the sequence CAGATC.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_1#7.cram", "cram", 294666500.0, 5893330.0, "SC RUN 18732 1#7", "0:50", "A:85765921;C:76239559;G:76452231;T:56180868;N:27921", 50, null, null, null, 85765921, 76239559, 76452231, 56180868, 27921, "ERX1468059", "ERS1051431", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.56455, null, 0.10217, null, 0.88286, null, 0.60374, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3057, "ERR1396799", "ERX1468058", "ERS1051430", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph228 drosha A6", "SAMEA3864296", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864296|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:25Z|INSDC status:public|Submitter Id:29e06940 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for drosha  allele sa191. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29e06940 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 1#6", "15616929", "Illumina sequencing of library 15616929  constructed from sample accession ERS1051430 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 1.  This submission includes reads tagged with the sequence GCCAAT.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_1#6.cram", "cram", 239549350.0, 4790987.0, "SC RUN 18732 1#6", "0:50", "A:68726161;C:60828350;G:62739441;T:47232484;N:22914", 50, null, null, null, 68726161, 60828350, 62739441, 47232484, 22914, "ERX1468058", "ERS1051430", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.64469, null, 0.1021, null, 0.88878, null, 0.58044, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3058, "ERR1396798", "ERX1468057", "ERS1051429", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph228 drosha A1", "SAMEA3864295", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864295|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:24Z|INSDC status:public|Submitter Id:29d74180 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for drosha  allele sa191. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29d74180 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 1#5", "15616917", "Illumina sequencing of library 15616917  constructed from sample accession ERS1051429 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 1.  This submission includes reads tagged with the sequence ACAGTG.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_1#5.cram", "cram", 165341300.0, 3306826.0, "SC RUN 18732 1#5", "0:50", "A:47735538;C:41622088;G:43392205;T:32575765;N:15704", 50, null, null, null, 47735538, 41622088, 43392205, 32575765, 15704, "ERX1468057", "ERS1051429", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.64704, null, 0.09836, null, 0.90534, null, 0.56172, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3059, "ERR1396797", "ERX1468056", "ERS1051428", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph228 drosha B12", "SAMEA3864294", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864294|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:23Z|INSDC status:public|Submitter Id:29cf7950 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for drosha  allele sa191. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29cf7950 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 1#4", "15616905", "Illumina sequencing of library 15616905  constructed from sample accession ERS1051428 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 1.  This submission includes reads tagged with the sequence TGACCA.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_1#4.cram", "cram", 401336200.0, 8026724.0, "SC RUN 18732 1#4", "0:50", "A:117609087;C:105872656;G:100576681;T:77238881;N:38895", 50, null, null, null, 117609087, 105872656, 100576681, 77238881, 38895, "ERX1468056", "ERS1051428", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.51741, null, 0.10352, null, 0.89749, null, 0.58497, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3060, "ERR1396796", "ERX1468055", "ERS1051427", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph228 drosha B10", "SAMEA3864293", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864293|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:22Z|INSDC status:public|Submitter Id:29c84d60 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for drosha  allele sa191. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29c84d60 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 1#3", "15616893", "Illumina sequencing of library 15616893  constructed from sample accession ERS1051427 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 1.  This submission includes reads tagged with the sequence TTAGGC.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_1#3.cram", "cram", 214767600.0, 4295352.0, "SC RUN 18732 1#3", "0:50", "A:61527319;C:53911904;G:56445139;T:42862938;N:20300", 50, null, null, null, 61527319, 53911904, 56445139, 42862938, 20300, "ERX1468055", "ERS1051427", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.57363, null, 0.11614, null, 0.88487, null, 0.61011, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3061, "ERR1396795", "ERX1468054", "ERS1051426", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph228 drosha B7", "SAMEA3864292", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864292|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:22Z|INSDC status:public|Submitter Id:29b1df30 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for drosha  allele sa191. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29b1df30 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 1#2", "15616881", "Illumina sequencing of library 15616881  constructed from sample accession ERS1051426 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 1.  This submission includes reads tagged with the sequence CGATGT.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_1#2.cram", "cram", 326025150.0, 6520503.0, "SC RUN 18732 1#2", "0:50", "A:93261648;C:82767834;G:86798075;T:63166259;N:31334", 50, null, null, null, 93261648, 82767834, 86798075, 63166259, 31334, "ERX1468054", "ERS1051426", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.57333, null, 0.11365, null, 0.87422, null, 0.60838, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [3062, "ERR1396794", "ERX1468053", "ERS1051425", "ERP013615", "PRJEB12173", "Transcriptome profiling of zebrafish small RNA from drosha  dgcr8 or dicer knockouts", "Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011", "Transcriptome Analysis", "Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha  dicer or dgcr8b to identify wild type  heterozygous and homozygous knockout embryos.", "ArrayExpress:E ERAD 449", null, null, "zmp ph228 drosha B1", "SAMEA3864291", "Wellcome Sanger Institute", "ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864291|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:55Z|INSDC last update:2016 02 03T09:48:20Z|INSDC status:public|Submitter Id:29904d70 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for drosha  allele sa191. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29904d70 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed", null, null, null, null, null, null, null, null, "Illumina HiSeq 2500 sequencing", "SC EXP 18732 1#1", "15616869", "Illumina sequencing of library 15616869  constructed from sample accession ERS1051425 for study accession ERP013615.  This is part of an Illumina multiplexed sequencing run 18732 1.  This submission includes reads tagged with the sequence ATCACG.", "Small RNA miRNA", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "ERP013615", "Illumina HiSeq 2500 sequencing", "ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16", "18732_1#1.cram", "cram", 419669000.0, 8393380.0, "SC RUN 18732 1#1", "0:50", "A:121378853;C:106010609;G:109826454;T:82412717;N:40367", 50, null, null, null, 121378853, 106010609, 109826454, 82412717, 40367, "ERX1468053", "ERS1051425", "ERA612385", "European Nucleotide Archive", "Wellcome Sanger Institute", 1, 0.60815, null, 0.11567, null, 0.90289, null, 0.5657, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "small_rna", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2016-02-03", "Larval", "Larval", "Whole Organism", "All anatomical structures"], [5879, "ERR1759701", "ERX1826022", "ERS1474296", "ERP020578", "PRJEB18632", "RNA Seq analyses of zebrafish cardiomyocytes at 72 hpf", "E-MTAB-5323", "Transcriptome Analysis", "The aim of this analysis is to uncover novel  molecules synthesized and secreted from cardiomyocytes.", "ENA FIRST PUBLIC:2016 12 20|ENA LAST UPDATE:2016 12 15|ArrayExpress:E MTAB 5323", null, "Protocols: To obtain only cardiomyocytes from the heart  two transgenic zebrafish lines were established; Tgmyl7:NLS mCherry and Tgmyl7:actn2 tdEos. Using cardiac myosin light chain myl7 promoter  nuclear localization signal conjugated monomeric Cherry or actinin alpha 2 conjugated tandem Eos was expressed in cardiomyocytes. Hearts resected from Tgmyl7:NLS mCherry or Tgmyl7:actn2 tdEos larvae at 72 hpf were collected and digested with protease solution PBS with 5 mg/ml trypsin and 1 mM EDTA  pH 8.0 for 1 h. Digestion was terminated with stop solution PBS with 30% fetal bovine serum and 6 mL calcium chloride. mCherry  or tdEos positive cells were collected as cardiomyocytes using a FACS Aria III cell sorter BD Bioscience Total RNAs were prepared from mCherry  or tdEos positive cells using a NucleoSpin XS kit Macherey Nagel according to the manufacture's instruction. Reverse transcription RT and cDNA library preparation were performed with a SMARTer Ultra Low RNA kit Clontech. cDNA was fragmented with a Covaris S 220 instrument Covaris. Subsequently  the sample was end repaired  dA tailed  adaptor ligated  and then subjected to PCR by using a NEBNext DNA Library Preparation and NEBNext Multiplex oligos for Illumina New England BioLabs.", "Sample2", "SAMEA27136168", "Department of Cell Biology National Cerebral and Cardiovascular Center Research Institute", "ENA first public:2016 12 20|ENA last update:2016 12 15|External Id:SAMEA27136168|INSDC center alias:Department of Cell Biology National Cerebral and Cardiovascular Center Research Institute|INSDC center name:Department of Cell Biology National Cerebral and Cardiovascular Center Research Institute|INSDC first public:2016 12 20T17:02:09Z|INSDC last update:2016 12 15T11:23:10Z|INSDC status:public|Submitter Id:E MTAB 5323:Sample2|broker name:ArrayExpress|cell type:cardiac myocyte|common name:zebrafish|developmental stage:72 hpf|genotype:Tgmyl7:actn2 tdEodncv44Tg|sample name:E MTAB 5323:Sample2", null, null, null, null, null, null, null, null, "Illumina MiSeq sequencing; RNA Seq analyses of zebrafish cardiomyocytes at 72 hpf", "E MTAB 5323:Sample2 s", "Sample2 s", "RNA Seq analyses of zebrafish cardiomyocytes at 72 hpf", "To obtain only cardiomyocytes from the heart  two transgenic zebrafish lines were established; Tgmyl7:NLS mCherry and Tgmyl7:actn2 tdEos. Using cardiac myosin light chain myl7 promoter  nuclear localization signal conjugated monomeric Cherry or actinin alpha 2 conjugated tandem Eos was expressed in cardiomyocytes.   Hearts resected from Tgmyl7:NLS mCherry or Tgmyl7:actn2 tdEos larvae at 72 hpf were collected and digested with protease solution PBS with 5 mg/ml trypsin and 1 mM EDTA  pH 8.0 for 1 h. Digestion was terminated with stop solution PBS with 30% fetal bovine serum and 6 mL calcium chloride. mCherry  or tdEos positive cells were collected as cardiomyocytes using a FACS Aria III cell sorter BD Bioscience Total RNAs were prepared from mCherry  or tdEos positive cells using a NucleoSpin XS kit Macherey Nagel according to the manufacture\u2019s instruction. Reverse transcription RT and cDNA library preparation were performed with a SMARTer Ultra Low RNA kit Clontech. cDNA was fragmented with a Covaris S 220 instrument Covaris. Subsequently  the sample was end repaired  dA tailed  adaptor ligated  and then subjected to PCR by using a NEBNext DNA Library Preparation and NEBNext Multiplex oligos for Illumina New England BioLabs.", "Experimental Factor: Tgmyl7:actn2 tdEodncv44Tg:genotype", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina MiSeq", null, "ERP020578", "Illumina MiSeq sequencing; RNA Seq analyses of zebrafish cardiomyocytes at 72 hpf", "ENA FIRST PUBLIC:2016 12 20|ENA LAST UPDATE:2018 11 16", "mochizukis_lab_myl7_actn2tdEos_72h_01.fastq.gz", "fastq", 448234901.0, 6016977.0, "E MTAB 5323:Sample2", "0:74.50 1:0", "A:118923409;C:100586009;G:99987046;T:126071553;N:2666884", 74, 0, null, null, 118923409, 100586009, 99987046, 126071553, 2666884, "ERX1826022", "ERS1474296", "ERA776061", "Department of Cell Biology National Cerebral and Cardiovascular Center Research Institute|European Nucleotide Archive", "Department of Cell Biology National Cerebral and Cardiovascular Center Research Institute|European Nucleotide Archive", 1, 0.88465, null, 0.27583, null, 0.75398, null, 0.55917, null, 75, null, "B", null, "usable mapping rate", "illumina", "miseq", "full_length", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Japan", "2016-12-15", "Larval", "Larval", "Heart", "Cardiovascular System"], [5880, "ERR1759702", "ERX1826022", "ERS1474296", "ERP020578", "PRJEB18632", "RNA Seq analyses of zebrafish cardiomyocytes at 72 hpf", "E-MTAB-5323", "Transcriptome Analysis", "The aim of this analysis is to uncover novel  molecules synthesized and secreted from cardiomyocytes.", "ENA FIRST PUBLIC:2016 12 20|ENA LAST UPDATE:2016 12 15|ArrayExpress:E MTAB 5323", null, "Protocols: To obtain only cardiomyocytes from the heart  two transgenic zebrafish lines were established; Tgmyl7:NLS mCherry and Tgmyl7:actn2 tdEos. Using cardiac myosin light chain myl7 promoter  nuclear localization signal conjugated monomeric Cherry or actinin alpha 2 conjugated tandem Eos was expressed in cardiomyocytes. Hearts resected from Tgmyl7:NLS mCherry or Tgmyl7:actn2 tdEos larvae at 72 hpf were collected and digested with protease solution PBS with 5 mg/ml trypsin and 1 mM EDTA  pH 8.0 for 1 h. Digestion was terminated with stop solution PBS with 30% fetal bovine serum and 6 mL calcium chloride. mCherry  or tdEos positive cells were collected as cardiomyocytes using a FACS Aria III cell sorter BD Bioscience Total RNAs were prepared from mCherry  or tdEos positive cells using a NucleoSpin XS kit Macherey Nagel according to the manufacture's instruction. Reverse transcription RT and cDNA library preparation were performed with a SMARTer Ultra Low RNA kit Clontech. cDNA was fragmented with a Covaris S 220 instrument Covaris. Subsequently  the sample was end repaired  dA tailed  adaptor ligated  and then subjected to PCR by using a NEBNext DNA Library Preparation and NEBNext Multiplex oligos for Illumina New England BioLabs.", "Sample2", "SAMEA27136168", "Department of Cell Biology National Cerebral and Cardiovascular Center Research Institute", "ENA first public:2016 12 20|ENA last update:2016 12 15|External Id:SAMEA27136168|INSDC center alias:Department of Cell Biology National Cerebral and Cardiovascular Center Research Institute|INSDC center name:Department of Cell Biology National Cerebral and Cardiovascular Center Research Institute|INSDC first public:2016 12 20T17:02:09Z|INSDC last update:2016 12 15T11:23:10Z|INSDC status:public|Submitter Id:E MTAB 5323:Sample2|broker name:ArrayExpress|cell type:cardiac myocyte|common name:zebrafish|developmental stage:72 hpf|genotype:Tgmyl7:actn2 tdEodncv44Tg|sample name:E MTAB 5323:Sample2", null, null, null, null, null, null, null, null, "Illumina MiSeq sequencing; RNA Seq analyses of zebrafish cardiomyocytes at 72 hpf", "E MTAB 5323:Sample2 s", "Sample2 s", "RNA Seq analyses of zebrafish cardiomyocytes at 72 hpf", "To obtain only cardiomyocytes from the heart  two transgenic zebrafish lines were established; Tgmyl7:NLS mCherry and Tgmyl7:actn2 tdEos. Using cardiac myosin light chain myl7 promoter  nuclear localization signal conjugated monomeric Cherry or actinin alpha 2 conjugated tandem Eos was expressed in cardiomyocytes.   Hearts resected from Tgmyl7:NLS mCherry or Tgmyl7:actn2 tdEos larvae at 72 hpf were collected and digested with protease solution PBS with 5 mg/ml trypsin and 1 mM EDTA  pH 8.0 for 1 h. Digestion was terminated with stop solution PBS with 30% fetal bovine serum and 6 mL calcium chloride. mCherry  or tdEos positive cells were collected as cardiomyocytes using a FACS Aria III cell sorter BD Bioscience Total RNAs were prepared from mCherry  or tdEos positive cells using a NucleoSpin XS kit Macherey Nagel according to the manufacture\u2019s instruction. Reverse transcription RT and cDNA library preparation were performed with a SMARTer Ultra Low RNA kit Clontech. cDNA was fragmented with a Covaris S 220 instrument Covaris. Subsequently  the sample was end repaired  dA tailed  adaptor ligated  and then subjected to PCR by using a NEBNext DNA Library Preparation and NEBNext Multiplex oligos for Illumina New England BioLabs.", "Experimental Factor: Tgmyl7:actn2 tdEodncv44Tg:genotype", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina MiSeq", null, "ERP020578", "Illumina MiSeq sequencing; RNA Seq analyses of zebrafish cardiomyocytes at 72 hpf", "ENA FIRST PUBLIC:2016 12 20|ENA LAST UPDATE:2018 11 16", "mochizukis_lab_myl7_actn2tdEos_72h_02.fastq.gz", "fastq", 448116860.0, 6016977.0, "E MTAB 5323:Sample2 1", "0:0 1:74.48", "A:127811460;C:99875207;G:106561979;T:113792335;N:75879", 0, 74, null, null, 127811460, 99875207, 106561979, 113792335, 75879, "ERX1826022", "ERS1474296", "ERA776061", "Department of Cell Biology National Cerebral and Cardiovascular Center Research Institute|European Nucleotide Archive", "Department of Cell Biology National Cerebral and Cardiovascular Center Research Institute|European Nucleotide Archive", 1, 0.91589, null, 0.2509, null, 0.79005, null, 0.54852, null, 75, null, "B", null, "usable mapping rate", "illumina", "miseq", "full_length", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Japan", "2016-12-15", "Larval", "Larval", "Heart", "Cardiovascular System"], [5881, "ERR1759699", "ERX1826021", "ERS1474295", "ERP020578", "PRJEB18632", "RNA Seq analyses of zebrafish cardiomyocytes at 72 hpf", "E-MTAB-5323", "Transcriptome Analysis", "The aim of this analysis is to uncover novel  molecules synthesized and secreted from cardiomyocytes.", "ENA FIRST PUBLIC:2016 12 20|ENA LAST UPDATE:2016 12 15|ArrayExpress:E MTAB 5323", null, "Protocols: To obtain only cardiomyocytes from the heart  two transgenic zebrafish lines were established; Tgmyl7:NLS mCherry and Tgmyl7:actn2 tdEos. Using cardiac myosin light chain myl7 promoter  nuclear localization signal conjugated monomeric Cherry or actinin alpha 2 conjugated tandem Eos was expressed in cardiomyocytes. Hearts resected from Tgmyl7:NLS mCherry or Tgmyl7:actn2 tdEos larvae at 72 hpf were collected and digested with protease solution PBS with 5 mg/ml trypsin and 1 mM EDTA  pH 8.0 for 1 h. Digestion was terminated with stop solution PBS with 30% fetal bovine serum and 6 mL calcium chloride. mCherry  or tdEos positive cells were collected as cardiomyocytes using a FACS Aria III cell sorter BD Bioscience Total RNAs were prepared from mCherry  or tdEos positive cells using a NucleoSpin XS kit Macherey Nagel according to the manufacture's instruction. Reverse transcription RT and cDNA library preparation were performed with a SMARTer Ultra Low RNA kit Clontech. cDNA was fragmented with a Covaris S 220 instrument Covaris. Subsequently  the sample was end repaired  dA tailed  adaptor ligated  and then subjected to PCR by using a NEBNext DNA Library Preparation and NEBNext Multiplex oligos for Illumina New England BioLabs.", "Sample1", "SAMEA27135418", "Department of Cell Biology National Cerebral and Cardiovascular Center Research Institute", "ENA first public:2016 12 20|ENA last update:2016 12 15|External Id:SAMEA27135418|INSDC center alias:Department of Cell Biology National Cerebral and Cardiovascular Center Research Institute|INSDC center name:Department of Cell Biology National Cerebral and Cardiovascular Center Research Institute|INSDC first public:2016 12 20T17:02:09Z|INSDC last update:2016 12 15T11:23:10Z|INSDC status:public|Submitter Id:E MTAB 5323:Sample1|broker name:ArrayExpress|cell type:cardiac myocyte|common name:zebrafish|developmental stage:72 hpf|genotype:Tgmyl7:Nls mCherryncv11Tg|sample name:E MTAB 5323:Sample1", null, null, null, null, null, null, null, null, "Illumina MiSeq sequencing; RNA Seq analyses of zebrafish cardiomyocytes at 72 hpf", "E MTAB 5323:Sample1 s", "Sample1 s", "RNA Seq analyses of zebrafish cardiomyocytes at 72 hpf", "To obtain only cardiomyocytes from the heart  two transgenic zebrafish lines were established; Tgmyl7:NLS mCherry and Tgmyl7:actn2 tdEos. Using cardiac myosin light chain myl7 promoter  nuclear localization signal conjugated monomeric Cherry or actinin alpha 2 conjugated tandem Eos was expressed in cardiomyocytes.   Hearts resected from Tgmyl7:NLS mCherry or Tgmyl7:actn2 tdEos larvae at 72 hpf were collected and digested with protease solution PBS with 5 mg/ml trypsin and 1 mM EDTA  pH 8.0 for 1 h. Digestion was terminated with stop solution PBS with 30% fetal bovine serum and 6 mL calcium chloride. mCherry  or tdEos positive cells were collected as cardiomyocytes using a FACS Aria III cell sorter BD Bioscience Total RNAs were prepared from mCherry  or tdEos positive cells using a NucleoSpin XS kit Macherey Nagel according to the manufacture\u2019s instruction. Reverse transcription RT and cDNA library preparation were performed with a SMARTer Ultra Low RNA kit Clontech. cDNA was fragmented with a Covaris S 220 instrument Covaris. Subsequently  the sample was end repaired  dA tailed  adaptor ligated  and then subjected to PCR by using a NEBNext DNA Library Preparation and NEBNext Multiplex oligos for Illumina New England BioLabs.", "Experimental Factor: Tgmyl7:Nls mCherryncv11Tg:genotype", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina MiSeq", null, "ERP020578", "Illumina MiSeq sequencing; RNA Seq analyses of zebrafish cardiomyocytes at 72 hpf", "ENA FIRST PUBLIC:2016 12 20|ENA LAST UPDATE:2018 11 16", "mochizukis_lab_myl7_NLSmCherry_72h_01.fastq.gz", "fastq", 766363334.0, 10284347.0, "E MTAB 5323:Sample1", "0:74.52 1:0", "A:201960096;C:174999154;G:173403690;T:211341998;N:4658396", 74, 0, null, null, 201960096, 174999154, 173403690, 211341998, 4658396, "ERX1826021", "ERS1474295", "ERA776061", "Department of Cell Biology National Cerebral and Cardiovascular Center Research Institute|European Nucleotide Archive", "Department of Cell Biology National Cerebral and Cardiovascular Center Research Institute|European Nucleotide Archive", 1, 0.86003, null, 0.20554, null, 0.76301, null, 0.55753, null, 74, null, "B", null, "usable mapping rate", "illumina", "miseq", "full_length", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Japan", "2016-12-15", "Larval", "Larval", "Heart", "Cardiovascular System"], [5882, "ERR1759700", "ERX1826021", "ERS1474295", "ERP020578", "PRJEB18632", "RNA Seq analyses of zebrafish cardiomyocytes at 72 hpf", "E-MTAB-5323", "Transcriptome Analysis", "The aim of this analysis is to uncover novel  molecules synthesized and secreted from cardiomyocytes.", "ENA FIRST PUBLIC:2016 12 20|ENA LAST UPDATE:2016 12 15|ArrayExpress:E MTAB 5323", null, "Protocols: To obtain only cardiomyocytes from the heart  two transgenic zebrafish lines were established; Tgmyl7:NLS mCherry and Tgmyl7:actn2 tdEos. Using cardiac myosin light chain myl7 promoter  nuclear localization signal conjugated monomeric Cherry or actinin alpha 2 conjugated tandem Eos was expressed in cardiomyocytes. Hearts resected from Tgmyl7:NLS mCherry or Tgmyl7:actn2 tdEos larvae at 72 hpf were collected and digested with protease solution PBS with 5 mg/ml trypsin and 1 mM EDTA  pH 8.0 for 1 h. Digestion was terminated with stop solution PBS with 30% fetal bovine serum and 6 mL calcium chloride. mCherry  or tdEos positive cells were collected as cardiomyocytes using a FACS Aria III cell sorter BD Bioscience Total RNAs were prepared from mCherry  or tdEos positive cells using a NucleoSpin XS kit Macherey Nagel according to the manufacture's instruction. Reverse transcription RT and cDNA library preparation were performed with a SMARTer Ultra Low RNA kit Clontech. cDNA was fragmented with a Covaris S 220 instrument Covaris. Subsequently  the sample was end repaired  dA tailed  adaptor ligated  and then subjected to PCR by using a NEBNext DNA Library Preparation and NEBNext Multiplex oligos for Illumina New England BioLabs.", "Sample1", "SAMEA27135418", "Department of Cell Biology National Cerebral and Cardiovascular Center Research Institute", "ENA first public:2016 12 20|ENA last update:2016 12 15|External Id:SAMEA27135418|INSDC center alias:Department of Cell Biology National Cerebral and Cardiovascular Center Research Institute|INSDC center name:Department of Cell Biology National Cerebral and Cardiovascular Center Research Institute|INSDC first public:2016 12 20T17:02:09Z|INSDC last update:2016 12 15T11:23:10Z|INSDC status:public|Submitter Id:E MTAB 5323:Sample1|broker name:ArrayExpress|cell type:cardiac myocyte|common name:zebrafish|developmental stage:72 hpf|genotype:Tgmyl7:Nls mCherryncv11Tg|sample name:E MTAB 5323:Sample1", null, null, null, null, null, null, null, null, "Illumina MiSeq sequencing; RNA Seq analyses of zebrafish cardiomyocytes at 72 hpf", "E MTAB 5323:Sample1 s", "Sample1 s", "RNA Seq analyses of zebrafish cardiomyocytes at 72 hpf", "To obtain only cardiomyocytes from the heart  two transgenic zebrafish lines were established; Tgmyl7:NLS mCherry and Tgmyl7:actn2 tdEos. Using cardiac myosin light chain myl7 promoter  nuclear localization signal conjugated monomeric Cherry or actinin alpha 2 conjugated tandem Eos was expressed in cardiomyocytes.   Hearts resected from Tgmyl7:NLS mCherry or Tgmyl7:actn2 tdEos larvae at 72 hpf were collected and digested with protease solution PBS with 5 mg/ml trypsin and 1 mM EDTA  pH 8.0 for 1 h. Digestion was terminated with stop solution PBS with 30% fetal bovine serum and 6 mL calcium chloride. mCherry  or tdEos positive cells were collected as cardiomyocytes using a FACS Aria III cell sorter BD Bioscience Total RNAs were prepared from mCherry  or tdEos positive cells using a NucleoSpin XS kit Macherey Nagel according to the manufacture\u2019s instruction. Reverse transcription RT and cDNA library preparation were performed with a SMARTer Ultra Low RNA kit Clontech. cDNA was fragmented with a Covaris S 220 instrument Covaris. Subsequently  the sample was end repaired  dA tailed  adaptor ligated  and then subjected to PCR by using a NEBNext DNA Library Preparation and NEBNext Multiplex oligos for Illumina New England BioLabs.", "Experimental Factor: Tgmyl7:Nls mCherryncv11Tg:genotype", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "Illumina MiSeq", null, "ERP020578", "Illumina MiSeq sequencing; RNA Seq analyses of zebrafish cardiomyocytes at 72 hpf", "ENA FIRST PUBLIC:2016 12 20|ENA LAST UPDATE:2018 11 16", "mochizukis_lab_myl7_NLSmCHerry_72h_02.fastq.gz", "fastq", 766251339.0, 10284347.0, "E MTAB 5323:Sample1 1", "0:0 1:74.51", "A:214234414;C:174215653;G:180382062;T:197361982;N:57228", 0, 74, null, null, 214234414, 174215653, 180382062, 197361982, 57228, "ERX1826021", "ERS1474295", "ERA776061", "Department of Cell Biology National Cerebral and Cardiovascular Center Research Institute|European Nucleotide Archive", "Department of Cell Biology National Cerebral and Cardiovascular Center Research Institute|European Nucleotide Archive", 1, 0.87766, null, 0.21561, null, 0.77477, null, 0.53919, null, 73, null, "B", null, "usable mapping rate", "illumina", "miseq", "full_length", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Japan", "2016-12-15", "Larval", "Larval", "Heart", "Cardiovascular System"], [8104, "ERR2455366", "ERX2474426", "ERS2327331", "ERP107743", "PRJEB25789", "RNA seq of zebrafish larvae fed with different diets", "E-MTAB-6636", "Transcriptome Analysis", "We aim to establish NAFLD model of Zebrafish.  Zebrafish larvae fed with high cholesterol diet high fructose diet and overfeed diet to induce liver steatosis. RNA seq was employed to analyze the effects of different diets on NAFLD development.", "ENA FIRST PUBLIC:2018 12 01|ENA LAST UPDATE:2018 03 29", null, "Protocols: Total RNAs were extracted from liver tissues of zebrafish larvae. A total amount of 1.5\u03bcg RNA per sample was used as input material for the RNA sample preparations. Briefly  mRNA was purified from total RNA using poly T oligo attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in NEB. Sequencing libraries were generated using NEBNext\u00ae UltraTM RNA Library Prep Kit for Illumina\u00ae NEB  USA following manufacturer's recommendations and index codes were added to attribute sequences to each sample.", "Sample 4", "SAMEA104725948", "Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College", "ENA FIRST PUBLIC:2018 12 01T17:02:09Z|ENA LAST UPDATE:2018 03 29T12:32:24Z|External Id:SAMEA104725948|INSDC center name:Institute of Medicinal Biotechnology  Chinese Academy of Medical Sciences and Peking Union Medical College|INSDC first public:2018 12 01T17:02:09Z|INSDC last update:2018 03 29T12:32:24Z|INSDC status:public|Submitter Id:E MTAB 6636:Sample 4|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval stage|diet:overfeeding|organism part:liver|sample name:E MTAB 6636:Sample 4|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "Illumina HiSeq 4000 sequencing; RNA seq of zebrafish larvae fed with different diets", "E MTAB 6636:Sample 4 s", "Sample 4 s", "RNA seq of zebrafish larvae fed with different diets", "Total RNAs were extracted from liver tissues of zebrafish larvae. A total amount of 1.5\u03bcg RNA per sample was used as input material for the RNA sample preparations. Briefly  mRNA was purified from total RNA using poly T oligo attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in NEB.   Sequencing libraries were generated using NEBNext\u00ae UltraTM RNA Library Prep Kit for Illumina\u00ae NEB  USA following manufacturer's recommendations and index codes were added to attribute sequences to each sample.", "Experimental Factor: diet:overfeeding", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 4000", null, "ERP107743", "Illumina HiSeq 4000 sequencing; RNA seq of zebrafish larvae fed with different diets", "ENA FIRST PUBLIC:2018 12 01|ENA LAST UPDATE:2018 11 16", "OF-4_H7MWNALXX_L6_1.fq.gz", "fastq", 4961276550.0, 33075177.0, "E MTAB 6636:Sample 4", "0:150 1:0", "A:1349413168;C:1135314970;G:1137935563;T:1338034716;N:578133", 150, 0, null, null, 1349413168, 1135314970, 1137935563, 1338034716, 578133, "ERX2474426", "ERS2327331", "ERA1259907", "Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College|European Nucleotide Archive", "Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College|European Nucleotide Archive", 1, 0.90787, null, 0.11999, null, 0.66123, null, 0.49072, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "nebnext", "bulk", "unknown", "unknown", null, "China", "2018-03-29", "Larval", "Larval", "Liver", "Liver and Biliary System"], [8105, "ERR2455365", "ERX2474425", "ERS2327330", "ERP107743", "PRJEB25789", "RNA seq of zebrafish larvae fed with different diets", "E-MTAB-6636", "Transcriptome Analysis", "We aim to establish NAFLD model of Zebrafish.  Zebrafish larvae fed with high cholesterol diet high fructose diet and overfeed diet to induce liver steatosis. RNA seq was employed to analyze the effects of different diets on NAFLD development.", "ENA FIRST PUBLIC:2018 12 01|ENA LAST UPDATE:2018 03 29", null, "Protocols: Total RNAs were extracted from liver tissues of zebrafish larvae. A total amount of 1.5\u03bcg RNA per sample was used as input material for the RNA sample preparations. Briefly  mRNA was purified from total RNA using poly T oligo attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in NEB. Sequencing libraries were generated using NEBNext\u00ae UltraTM RNA Library Prep Kit for Illumina\u00ae NEB  USA following manufacturer's recommendations and index codes were added to attribute sequences to each sample.", "Sample 3", "SAMEA104725947", "Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College", "ENA FIRST PUBLIC:2018 12 01T17:02:09Z|ENA LAST UPDATE:2018 03 29T12:32:24Z|External Id:SAMEA104725947|INSDC center name:Institute of Medicinal Biotechnology  Chinese Academy of Medical Sciences and Peking Union Medical College|INSDC first public:2018 12 01T17:02:09Z|INSDC last update:2018 03 29T12:32:24Z|INSDC status:public|Submitter Id:E MTAB 6636:Sample 3|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval stage|diet:fructose|organism part:liver|sample name:E MTAB 6636:Sample 3|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "Illumina HiSeq 4000 sequencing; RNA seq of zebrafish larvae fed with different diets", "E MTAB 6636:Sample 3 s", "Sample 3 s", "RNA seq of zebrafish larvae fed with different diets", "Total RNAs were extracted from liver tissues of zebrafish larvae. A total amount of 1.5\u03bcg RNA per sample was used as input material for the RNA sample preparations. Briefly  mRNA was purified from total RNA using poly T oligo attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in NEB.   Sequencing libraries were generated using NEBNext\u00ae UltraTM RNA Library Prep Kit for Illumina\u00ae NEB  USA following manufacturer's recommendations and index codes were added to attribute sequences to each sample.", "Experimental Factor: diet:fructose", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 4000", null, "ERP107743", "Illumina HiSeq 4000 sequencing; RNA seq of zebrafish larvae fed with different diets", "ENA FIRST PUBLIC:2018 12 01|ENA LAST UPDATE:2018 11 16", "Fru-3_H7MWNALXX_L5_1.fq.gz", "fastq", 5858273250.0, 39055155.0, "E MTAB 6636:Sample 3", "0:150 1:0", "A:1580150663;C:1353221682;G:1355865524;T:1568428138;N:607243", 150, 0, null, null, 1580150663, 1353221682, 1355865524, 1568428138, 607243, "ERX2474425", "ERS2327330", "ERA1259907", "Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College|European Nucleotide Archive", "Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College|European Nucleotide Archive", 1, 0.91505, null, 0.11036, null, 0.65985, null, 0.48443, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "nebnext", "bulk", "unknown", "unknown", null, "China", "2018-03-29", "Larval", "Larval", "Liver", "Liver and Biliary System"], [8106, "ERR2455364", "ERX2474424", "ERS2327329", "ERP107743", "PRJEB25789", "RNA seq of zebrafish larvae fed with different diets", "E-MTAB-6636", "Transcriptome Analysis", "We aim to establish NAFLD model of Zebrafish.  Zebrafish larvae fed with high cholesterol diet high fructose diet and overfeed diet to induce liver steatosis. RNA seq was employed to analyze the effects of different diets on NAFLD development.", "ENA FIRST PUBLIC:2018 12 01|ENA LAST UPDATE:2018 03 29", null, "Protocols: Total RNAs were extracted from liver tissues of zebrafish larvae. A total amount of 1.5\u03bcg RNA per sample was used as input material for the RNA sample preparations. Briefly  mRNA was purified from total RNA using poly T oligo attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in NEB. Sequencing libraries were generated using NEBNext\u00ae UltraTM RNA Library Prep Kit for Illumina\u00ae NEB  USA following manufacturer's recommendations and index codes were added to attribute sequences to each sample.", "Sample 2", "SAMEA104725946", "Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College", "ENA FIRST PUBLIC:2018 12 01T17:02:09Z|ENA LAST UPDATE:2018 03 29T12:32:24Z|External Id:SAMEA104725946|INSDC center name:Institute of Medicinal Biotechnology  Chinese Academy of Medical Sciences and Peking Union Medical College|INSDC first public:2018 12 01T17:02:09Z|INSDC last update:2018 03 29T12:32:24Z|INSDC status:public|Submitter Id:E MTAB 6636:Sample 2|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval stage|diet:cholesterol|organism part:liver|sample name:E MTAB 6636:Sample 2|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "Illumina HiSeq 4000 sequencing; RNA seq of zebrafish larvae fed with different diets", "E MTAB 6636:Sample 2 s", "Sample 2 s", "RNA seq of zebrafish larvae fed with different diets", "Total RNAs were extracted from liver tissues of zebrafish larvae. A total amount of 1.5\u03bcg RNA per sample was used as input material for the RNA sample preparations. Briefly  mRNA was purified from total RNA using poly T oligo attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in NEB.   Sequencing libraries were generated using NEBNext\u00ae UltraTM RNA Library Prep Kit for Illumina\u00ae NEB  USA following manufacturer's recommendations and index codes were added to attribute sequences to each sample.", "Experimental Factor: diet:cholesterol", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 4000", null, "ERP107743", "Illumina HiSeq 4000 sequencing; RNA seq of zebrafish larvae fed with different diets", "ENA FIRST PUBLIC:2018 12 01|ENA LAST UPDATE:2018 11 16", "Cho-2_H7MWNALXX_L5_1.fq.gz", "fastq", 5636304900.0, 37575366.0, "E MTAB 6636:Sample 2", "0:150 1:0", "A:1526862069;C:1295343770;G:1298751994;T:1514766898;N:580169", 150, 0, null, null, 1526862069, 1295343770, 1298751994, 1514766898, 580169, "ERX2474424", "ERS2327329", "ERA1259907", "Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College|European Nucleotide Archive", "Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College|European Nucleotide Archive", 1, 0.91032, null, 0.11644, null, 0.66649, null, 0.47766, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "nebnext", "bulk", "unknown", "unknown", null, "China", "2018-03-29", "Larval", "Larval", "Liver", "Liver and Biliary System"], [8107, "ERR2455363", "ERX2474423", "ERS2327328", "ERP107743", "PRJEB25789", "RNA seq of zebrafish larvae fed with different diets", "E-MTAB-6636", "Transcriptome Analysis", "We aim to establish NAFLD model of Zebrafish.  Zebrafish larvae fed with high cholesterol diet high fructose diet and overfeed diet to induce liver steatosis. RNA seq was employed to analyze the effects of different diets on NAFLD development.", "ENA FIRST PUBLIC:2018 12 01|ENA LAST UPDATE:2018 03 29", null, "Protocols: Total RNAs were extracted from liver tissues of zebrafish larvae. A total amount of 1.5\u03bcg RNA per sample was used as input material for the RNA sample preparations. Briefly  mRNA was purified from total RNA using poly T oligo attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in NEB. Sequencing libraries were generated using NEBNext\u00ae UltraTM RNA Library Prep Kit for Illumina\u00ae NEB  USA following manufacturer's recommendations and index codes were added to attribute sequences to each sample.", "Sample 1", "SAMEA104725945", "Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College", "ENA FIRST PUBLIC:2018 12 01T17:02:09Z|ENA LAST UPDATE:2018 03 29T12:32:24Z|External Id:SAMEA104725945|INSDC center name:Institute of Medicinal Biotechnology  Chinese Academy of Medical Sciences and Peking Union Medical College|INSDC first public:2018 12 01T17:02:09Z|INSDC last update:2018 03 29T12:32:24Z|INSDC status:public|Submitter Id:E MTAB 6636:Sample 1|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval stage|diet:control|organism part:liver|sample name:E MTAB 6636:Sample 1|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "Illumina HiSeq 4000 sequencing; RNA seq of zebrafish larvae fed with different diets", "E MTAB 6636:Sample 1 s", "Sample 1 s", "RNA seq of zebrafish larvae fed with different diets", "Total RNAs were extracted from liver tissues of zebrafish larvae. A total amount of 1.5\u03bcg RNA per sample was used as input material for the RNA sample preparations. Briefly  mRNA was purified from total RNA using poly T oligo attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in NEB.   Sequencing libraries were generated using NEBNext\u00ae UltraTM RNA Library Prep Kit for Illumina\u00ae NEB  USA following manufacturer's recommendations and index codes were added to attribute sequences to each sample.", "Experimental Factor: diet:control", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 4000", null, "ERP107743", "Illumina HiSeq 4000 sequencing; RNA seq of zebrafish larvae fed with different diets", "ENA FIRST PUBLIC:2018 12 01|ENA LAST UPDATE:2018 11 16", "ND-1_H7MWNALXX_L5_1.fq.gz", "fastq", 5197165350.0, 34647769.0, "E MTAB 6636:Sample 1", "0:150 1:0", "A:1430911816;C:1174811274;G:1175616551;T:1415284019;N:541690", 150, 0, null, null, 1430911816, 1174811274, 1175616551, 1415284019, 541690, "ERX2474423", "ERS2327328", "ERA1259907", "Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College|European Nucleotide Archive", "Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College|European Nucleotide Archive", 1, 0.89838, null, 0.13883, null, 0.66129, null, 0.48467, null, 150, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "nebnext", "bulk", "unknown", "unknown", null, "China", "2018-03-29", "Larval", "Larval", "Liver", "Liver and Biliary System"], [9361, "ERR3011947", "ERX3014407", "ERS2994081", "ERP112907", "PRJEB30451", "Effects of anti androgenic compounds on zebrafish insulin mutants", "E-MTAB-7283", "Transcriptome Analysis", "Aiming to identify insulin independent modulators of glucose homeostasis  we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists.  To investigate how AR antagonism mediates glucose level reduction in ins mutants  we evaluated the effects of antagonist treatment using transcriptomic studies.  RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants.", "ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18", null, "Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled  water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set  Promega to avoid contamination by genomic DNA. 3\u00b5g of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina", "Flutamide 2", "SAMEA5186582", "Max Planck Institute for Heart and Lung Research", "ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186582|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:Flutamide 2|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:Flutamide 2|scientific name:Danio rerio|strain:ins bns102", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants", "E MTAB 7283:Flutamide 2 s", "Flutamide 2 s", "Effects of anti androgenic compounds on zebrafish insulin mutants", "insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water.  10 animals per sample were pooled  water was removed and Trizol was added.  Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf.  Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set  Promega to avoid contamination by genomic DNA. 3\u00b5g of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina", "Experimental Factor: compound:flutamide|Experimental Factor: dose:10", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP112907", "NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants", "ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18", "Teja_Flutamide_2_R1.fastq.gz", "fastq", 1754963940.0, 23552243.0, "E MTAB 7283:Flutamide 2", "0:74.51 1:0", "A:455444321;C:410713896;G:385640226;T:503155736;N:9761", 74, 0, null, null, 455444321, 410713896, 385640226, 503155736, 9761, "ERX3014407", "ERS2994081", "ERA1697296", "European Nucleotide Archive", "European Nucleotide Archive", 1, 0.94351, null, 0.11595, null, 0.67483, null, 0.48762, null, 73, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "poly_a", "trueseq", "bulk", "unknown", "unknown", null, "Unknown", "2018-12-18", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [9362, "ERR3011946", "ERX3014406", "ERS2994080", "ERP112907", "PRJEB30451", "Effects of anti androgenic compounds on zebrafish insulin mutants", "E-MTAB-7283", "Transcriptome Analysis", "Aiming to identify insulin independent modulators of glucose homeostasis  we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists.  To investigate how AR antagonism mediates glucose level reduction in ins mutants  we evaluated the effects of antagonist treatment using transcriptomic studies.  RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants.", "ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18", null, "Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled  water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set  Promega to avoid contamination by genomic DNA. 3\u00b5g of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina", "Flutamide 1", "SAMEA5186581", "Max Planck Institute for Heart and Lung Research", "ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186581|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:Flutamide 1|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:Flutamide 1|scientific name:Danio rerio|strain:ins bns102", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants", "E MTAB 7283:Flutamide 1 s", "Flutamide 1 s", "Effects of anti androgenic compounds on zebrafish insulin mutants", "insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water.  10 animals per sample were pooled  water was removed and Trizol was added.  Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf.  Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set  Promega to avoid contamination by genomic DNA. 3\u00b5g of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina", "Experimental Factor: compound:flutamide|Experimental Factor: dose:10", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP112907", "NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants", "ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18", "Teja_Flutamide_1_R1.fastq.gz", "fastq", 1631102863.0, 21898245.0, "E MTAB 7283:Flutamide 1", "0:74.49 1:0", "A:424378341;C:380806325;G:358128992;T:467779945;N:9260", 74, 0, null, null, 424378341, 380806325, 358128992, 467779945, 9260, "ERX3014406", "ERS2994080", "ERA1697296", "European Nucleotide Archive", "European Nucleotide Archive", 1, 0.94332, null, 0.11797, null, 0.67596, null, 0.48847, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "poly_a", "trueseq", "bulk", "unknown", "unknown", null, "Unknown", "2018-12-18", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [9363, "ERR3011945", "ERX3014405", "ERS2994079", "ERP112907", "PRJEB30451", "Effects of anti androgenic compounds on zebrafish insulin mutants", "E-MTAB-7283", "Transcriptome Analysis", "Aiming to identify insulin independent modulators of glucose homeostasis  we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists.  To investigate how AR antagonism mediates glucose level reduction in ins mutants  we evaluated the effects of antagonist treatment using transcriptomic studies.  RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants.", "ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18", null, "Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled  water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set  Promega to avoid contamination by genomic DNA. 3\u00b5g of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina", "DMSO 2", "SAMEA5186580", "Max Planck Institute for Heart and Lung Research", "ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186580|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:DMSO 2|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:DMSO 2|scientific name:Danio rerio|strain:ins bns102", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants", "E MTAB 7283:DMSO 2 s", "DMSO 2 s", "Effects of anti androgenic compounds on zebrafish insulin mutants", "insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water.  10 animals per sample were pooled  water was removed and Trizol was added.  Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf.  Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set  Promega to avoid contamination by genomic DNA. 3\u00b5g of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina", "Experimental Factor: compound:dimethyl sulfoxide|Experimental Factor: dose:1", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP112907", "NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants", "ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18", "Teja_DMSO_2_R1.fastq.gz", "fastq", 1811573293.0, 24316929.0, "E MTAB 7283:DMSO 2", "0:74.50 1:0", "A:470888315;C:423635861;G:396796840;T:520242179;N:10098", 74, 0, null, null, 470888315, 423635861, 396796840, 520242179, 10098, "ERX3014405", "ERS2994079", "ERA1697296", "European Nucleotide Archive", "European Nucleotide Archive", 1, 0.94219, null, 0.12305, null, 0.67184, null, 0.47704, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "poly_a", "trueseq", "bulk", "unknown", "unknown", null, "Unknown", "2018-12-18", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [9364, "ERR3011944", "ERX3014404", "ERS2994078", "ERP112907", "PRJEB30451", "Effects of anti androgenic compounds on zebrafish insulin mutants", "E-MTAB-7283", "Transcriptome Analysis", "Aiming to identify insulin independent modulators of glucose homeostasis  we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists.  To investigate how AR antagonism mediates glucose level reduction in ins mutants  we evaluated the effects of antagonist treatment using transcriptomic studies.  RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants.", "ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18", null, "Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled  water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set  Promega to avoid contamination by genomic DNA. 3\u00b5g of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina", "DMSO 1", "SAMEA5186579", "Max Planck Institute for Heart and Lung Research", "ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186579|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:DMSO 1|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:DMSO 1|scientific name:Danio rerio|strain:ins bns102", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants", "E MTAB 7283:DMSO 1 s", "DMSO 1 s", "Effects of anti androgenic compounds on zebrafish insulin mutants", "insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water.  10 animals per sample were pooled  water was removed and Trizol was added.  Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf.  Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set  Promega to avoid contamination by genomic DNA. 3\u00b5g of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina", "Experimental Factor: compound:dimethyl sulfoxide|Experimental Factor: dose:1", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP112907", "NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants", "ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18", "Teja_DMSO_1_R1.fastq.gz", "fastq", 1609807409.0, 21611475.0, "E MTAB 7283:DMSO 1", "0:74.49 1:0", "A:420253680;C:374436301;G:352526427;T:462581933;N:9068", 74, 0, null, null, 420253680, 374436301, 352526427, 462581933, 9068, "ERX3014404", "ERS2994078", "ERA1697296", "European Nucleotide Archive", "European Nucleotide Archive", 1, 0.94094, null, 0.12292, null, 0.67006, null, 0.48442, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "poly_a", "trueseq", "bulk", "unknown", "unknown", null, "Unknown", "2018-12-18", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [9365, "ERR3011943", "ERX3014403", "ERS2994077", "ERP112907", "PRJEB30451", "Effects of anti androgenic compounds on zebrafish insulin mutants", "E-MTAB-7283", "Transcriptome Analysis", "Aiming to identify insulin independent modulators of glucose homeostasis  we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists.  To investigate how AR antagonism mediates glucose level reduction in ins mutants  we evaluated the effects of antagonist treatment using transcriptomic studies.  RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants.", "ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18", null, "Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled  water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set  Promega to avoid contamination by genomic DNA. 3\u00b5g of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina", "Cyproter1 2", "SAMEA5186578", "Max Planck Institute for Heart and Lung Research", "ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186578|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:Cyproter1 2|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:Cyproter1 2|scientific name:Danio rerio|strain:ins bns102", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants", "E MTAB 7283:Cyproterone 2 s", "Cyproterone 2 s", "Effects of anti androgenic compounds on zebrafish insulin mutants", "insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water.  10 animals per sample were pooled  water was removed and Trizol was added.  Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf.  Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set  Promega to avoid contamination by genomic DNA. 3\u00b5g of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina", "Experimental Factor: compound:cyproter1|Experimental Factor: dose:10", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP112907", "NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants", "ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18", "Teja_Cyproterone_2_R1.fastq.gz", "fastq", 1823142918.0, 24468337.0, "E MTAB 7283:Cyproterone 2", "0:74.51 1:0", "A:469387174;C:428783310;G:403791044;T:521171021;N:10369", 74, 0, null, null, 469387174, 428783310, 403791044, 521171021, 10369, "ERX3014403", "ERS2994077", "ERA1697296", "European Nucleotide Archive", "European Nucleotide Archive", 1, 0.9432, null, 0.11718, null, 0.67389, null, 0.4768, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "poly_a", "trueseq", "bulk", "unknown", "unknown", null, "Unknown", "2018-12-18", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [9366, "ERR3011942", "ERX3014402", "ERS2994076", "ERP112907", "PRJEB30451", "Effects of anti androgenic compounds on zebrafish insulin mutants", "E-MTAB-7283", "Transcriptome Analysis", "Aiming to identify insulin independent modulators of glucose homeostasis  we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists.  To investigate how AR antagonism mediates glucose level reduction in ins mutants  we evaluated the effects of antagonist treatment using transcriptomic studies.  RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants.", "ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18", null, "Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled  water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set  Promega to avoid contamination by genomic DNA. 3\u00b5g of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina", "Cyproter1 1", "SAMEA5186577", "Max Planck Institute for Heart and Lung Research", "ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186577|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:Cyproter1 1|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:Cyproter1 1|scientific name:Danio rerio|strain:ins bns102", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants", "E MTAB 7283:Cyproterone 1 s", "Cyproterone 1 s", "Effects of anti androgenic compounds on zebrafish insulin mutants", "insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water.  10 animals per sample were pooled  water was removed and Trizol was added.  Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf.  Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set  Promega to avoid contamination by genomic DNA. 3\u00b5g of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina", "Experimental Factor: compound:cyproter1|Experimental Factor: dose:10", "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP112907", "NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants", "ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18", "Teja_Cyproterone_1_R1.fastq.gz", "fastq", 1901027130.0, 25512731.0, "E MTAB 7283:Cyproterone 1", "0:74.51 1:0", "A:487302419;C:449208827;G:422183780;T:542321577;N:10527", 74, 0, null, null, 487302419, 449208827, 422183780, 542321577, 10527, "ERX3014402", "ERS2994076", "ERA1697296", "European Nucleotide Archive", "European Nucleotide Archive", 1, 0.94427, null, 0.11318, null, 0.67294, null, 0.47183, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "poly_a", "trueseq", "bulk", "unknown", "unknown", null, "Unknown", "2018-12-18", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [9651, "ERR3266392", "ERX3293003", "ERS3358386", "ERP114712", "PRJEB32081", "RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "E-MTAB-7846", "Transcriptome Analysis", "To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs  the evolution of enhancers has been difficult to trace because of their fast evolution. Here  we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed  three were located in conserved syntenic gene regions that are unique to animals Islet\u2013Scaper  Ccne1\u2013Uri  Tdrd3\u2013Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity  sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse  which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.", "ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08", null, "Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28\u00b0C for 5 minutes and a single cell solution was prepared by passing through a 40\u03bcm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies  respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/\u00b5L was combined with 1 \u00b5L of 10 \u00b5M oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 \u00b5L of dNTP mix 10 mM each; Invitrogen  y02256  then the protocol was continued as described ref. 2. Briefly  the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  Integrated DNA Technologies  followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol  except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 \u00b5M. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina  FC 131 1096  with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer  CLS760672. Libraries were pooled in equimolar ratios.", "sponge tdr gfp positive rep2", "SAMEA5556346", "UQ", "ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "E MTAB 7846:sponge tdr gfp positive rep2 s", "sponge tdr gfp positive rep2 s", "RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28\u00b0C for 5 minutes and a single cell solution was prepared by passing through a 40\u03bcm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies  respectively with a BD FACSAria Cell Sorter BD Biosciences.  RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/\u00b5L was combined with 1 \u00b5L of 10 \u00b5M oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 \u00b5L of dNTP mix 10 mM each; Invitrogen  y02256  then the protocol was continued as described ref. 2. Briefly  the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  Integrated DNA Technologies  followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol  except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 \u00b5M. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina  FC 131 1096  with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer  CLS760672. Libraries were pooled in equimolar ratios.", "Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive", "RNA-Seq", "TRANSCRIPTOMIC", "PolyA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP114712", "NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08", "E9_9pos_S2_L001_R1_001.fastq.gz", "fastq", 603238067.0, 8014716.0, "E MTAB 7846:sponge tdr gfp positive rep2 lane1", "0:75.27 1:0", "A:164797697;C:136552121;G:141138007;T:160737152;N:13090", 75, 0, null, null, 164797697, 136552121, 141138007, 160737152, 13090, "ERX3293003", "ERS3358386", "ERA1822647", "European Nucleotide Archive", "European Nucleotide Archive", 1, 0.95083, null, 0.06432, null, 0.71532, null, 0.50098, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Unknown", "2019-04-08", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [9652, "ERR3266393", "ERX3293003", "ERS3358386", "ERP114712", "PRJEB32081", "RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "E-MTAB-7846", "Transcriptome Analysis", "To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs  the evolution of enhancers has been difficult to trace because of their fast evolution. Here  we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed  three were located in conserved syntenic gene regions that are unique to animals Islet\u2013Scaper  Ccne1\u2013Uri  Tdrd3\u2013Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity  sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse  which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.", "ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08", null, "Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28\u00b0C for 5 minutes and a single cell solution was prepared by passing through a 40\u03bcm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies  respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/\u00b5L was combined with 1 \u00b5L of 10 \u00b5M oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 \u00b5L of dNTP mix 10 mM each; Invitrogen  y02256  then the protocol was continued as described ref. 2. Briefly  the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  Integrated DNA Technologies  followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol  except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 \u00b5M. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina  FC 131 1096  with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer  CLS760672. Libraries were pooled in equimolar ratios.", "sponge tdr gfp positive rep2", "SAMEA5556346", "UQ", "ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "E MTAB 7846:sponge tdr gfp positive rep2 s", "sponge tdr gfp positive rep2 s", "RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28\u00b0C for 5 minutes and a single cell solution was prepared by passing through a 40\u03bcm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies  respectively with a BD FACSAria Cell Sorter BD Biosciences.  RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/\u00b5L was combined with 1 \u00b5L of 10 \u00b5M oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 \u00b5L of dNTP mix 10 mM each; Invitrogen  y02256  then the protocol was continued as described ref. 2. Briefly  the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  Integrated DNA Technologies  followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol  except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 \u00b5M. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina  FC 131 1096  with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer  CLS760672. Libraries were pooled in equimolar ratios.", "Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive", "RNA-Seq", "TRANSCRIPTOMIC", "PolyA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP114712", "NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08", "E9_9pos_S2_L002_R1_001.fastq.gz", "fastq", 603749720.0, 8021069.0, "E MTAB 7846:sponge tdr gfp positive rep2 lane2", "0:75.27 1:0", "A:164972969;C:136661417;G:141205792;T:160896264;N:13278", 75, 0, null, null, 164972969, 136661417, 141205792, 160896264, 13278, "ERX3293003", "ERS3358386", "ERA1822647", "European Nucleotide Archive", "European Nucleotide Archive", 1, 0.951, null, 0.06542, null, 0.71768, null, 0.50051, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Unknown", "2019-04-08", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [9653, "ERR3266394", "ERX3293003", "ERS3358386", "ERP114712", "PRJEB32081", "RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "E-MTAB-7846", "Transcriptome Analysis", "To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs  the evolution of enhancers has been difficult to trace because of their fast evolution. Here  we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed  three were located in conserved syntenic gene regions that are unique to animals Islet\u2013Scaper  Ccne1\u2013Uri  Tdrd3\u2013Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity  sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse  which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.", "ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08", null, "Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28\u00b0C for 5 minutes and a single cell solution was prepared by passing through a 40\u03bcm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies  respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/\u00b5L was combined with 1 \u00b5L of 10 \u00b5M oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 \u00b5L of dNTP mix 10 mM each; Invitrogen  y02256  then the protocol was continued as described ref. 2. Briefly  the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  Integrated DNA Technologies  followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol  except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 \u00b5M. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina  FC 131 1096  with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer  CLS760672. Libraries were pooled in equimolar ratios.", "sponge tdr gfp positive rep2", "SAMEA5556346", "UQ", "ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "E MTAB 7846:sponge tdr gfp positive rep2 s", "sponge tdr gfp positive rep2 s", "RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28\u00b0C for 5 minutes and a single cell solution was prepared by passing through a 40\u03bcm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies  respectively with a BD FACSAria Cell Sorter BD Biosciences.  RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/\u00b5L was combined with 1 \u00b5L of 10 \u00b5M oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 \u00b5L of dNTP mix 10 mM each; Invitrogen  y02256  then the protocol was continued as described ref. 2. Briefly  the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  Integrated DNA Technologies  followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol  except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 \u00b5M. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina  FC 131 1096  with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer  CLS760672. Libraries were pooled in equimolar ratios.", "Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive", "RNA-Seq", "TRANSCRIPTOMIC", "PolyA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP114712", "NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08", "E9_9pos_S2_L003_R1_001.fastq.gz", "fastq", 608154053.0, 8079704.0, "E MTAB 7846:sponge tdr gfp positive rep2 lane3", "0:75.27 1:0", "A:166117918;C:137731172;G:142320339;T:161970092;N:14532", 75, 0, null, null, 166117918, 137731172, 142320339, 161970092, 14532, "ERX3293003", "ERS3358386", "ERA1822647", "European Nucleotide Archive", "European Nucleotide Archive", 1, 0.95155, null, 0.0657, null, 0.71634, null, 0.49493, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Unknown", "2019-04-08", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [9654, "ERR3266395", "ERX3293003", "ERS3358386", "ERP114712", "PRJEB32081", "RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "E-MTAB-7846", "Transcriptome Analysis", "To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs  the evolution of enhancers has been difficult to trace because of their fast evolution. Here  we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed  three were located in conserved syntenic gene regions that are unique to animals Islet\u2013Scaper  Ccne1\u2013Uri  Tdrd3\u2013Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity  sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse  which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.", "ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08", null, "Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28\u00b0C for 5 minutes and a single cell solution was prepared by passing through a 40\u03bcm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies  respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/\u00b5L was combined with 1 \u00b5L of 10 \u00b5M oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 \u00b5L of dNTP mix 10 mM each; Invitrogen  y02256  then the protocol was continued as described ref. 2. Briefly  the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  Integrated DNA Technologies  followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol  except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 \u00b5M. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina  FC 131 1096  with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer  CLS760672. Libraries were pooled in equimolar ratios.", "sponge tdr gfp positive rep2", "SAMEA5556346", "UQ", "ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "E MTAB 7846:sponge tdr gfp positive rep2 s", "sponge tdr gfp positive rep2 s", "RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28\u00b0C for 5 minutes and a single cell solution was prepared by passing through a 40\u03bcm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies  respectively with a BD FACSAria Cell Sorter BD Biosciences.  RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/\u00b5L was combined with 1 \u00b5L of 10 \u00b5M oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 \u00b5L of dNTP mix 10 mM each; Invitrogen  y02256  then the protocol was continued as described ref. 2. Briefly  the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  Integrated DNA Technologies  followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol  except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 \u00b5M. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina  FC 131 1096  with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer  CLS760672. Libraries were pooled in equimolar ratios.", "Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive", "RNA-Seq", "TRANSCRIPTOMIC", "PolyA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP114712", "NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08", "E9_9pos_S2_L004_R1_001.fastq.gz", "fastq", 599143392.0, 7959897.0, "E MTAB 7846:sponge tdr gfp positive rep2 lane4", "0:75.27 1:0", "A:163706904;C:135622453;G:140192351;T:159605249;N:16435", 75, 0, null, null, 163706904, 135622453, 140192351, 159605249, 16435, "ERX3293003", "ERS3358386", "ERA1822647", "European Nucleotide Archive", "European Nucleotide Archive", 1, 0.95061, null, 0.06431, null, 0.71764, null, 0.50166, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Unknown", "2019-04-08", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [9655, "ERR3266388", "ERX3293002", "ERS3358385", "ERP114712", "PRJEB32081", "RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "E-MTAB-7846", "Transcriptome Analysis", "To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs  the evolution of enhancers has been difficult to trace because of their fast evolution. Here  we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed  three were located in conserved syntenic gene regions that are unique to animals Islet\u2013Scaper  Ccne1\u2013Uri  Tdrd3\u2013Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity  sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse  which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.", "ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08", null, "Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28\u00b0C for 5 minutes and a single cell solution was prepared by passing through a 40\u03bcm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies  respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/\u00b5L was combined with 1 \u00b5L of 10 \u00b5M oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 \u00b5L of dNTP mix 10 mM each; Invitrogen  y02256  then the protocol was continued as described ref. 2. Briefly  the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  Integrated DNA Technologies  followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol  except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 \u00b5M. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina  FC 131 1096  with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer  CLS760672. Libraries were pooled in equimolar ratios.", "sponge tdr gfp positive rep1", "SAMEA5556345", "UQ", "ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "E MTAB 7846:sponge tdr gfp positive rep1 s", "sponge tdr gfp positive rep1 s", "RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28\u00b0C for 5 minutes and a single cell solution was prepared by passing through a 40\u03bcm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies  respectively with a BD FACSAria Cell Sorter BD Biosciences.  RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/\u00b5L was combined with 1 \u00b5L of 10 \u00b5M oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 \u00b5L of dNTP mix 10 mM each; Invitrogen  y02256  then the protocol was continued as described ref. 2. Briefly  the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  Integrated DNA Technologies  followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol  except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 \u00b5M. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina  FC 131 1096  with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer  CLS760672. Libraries were pooled in equimolar ratios.", "Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive", "RNA-Seq", "TRANSCRIPTOMIC", "PolyA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP114712", "NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08", "E9_6pos_S4_L001_R1_001.fastq.gz", "fastq", 616761505.0, 8202480.0, "E MTAB 7846:sponge tdr gfp positive rep1 lane1", "0:75.19 1:0", "A:168679238;C:139548565;G:143969797;T:164545362;N:18543", 75, 0, null, null, 168679238, 139548565, 143969797, 164545362, 18543, "ERX3293002", "ERS3358385", "ERA1822647", "European Nucleotide Archive", "European Nucleotide Archive", 1, 0.95019, null, 0.06806, null, 0.7097, null, 0.50337, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Unknown", "2019-04-08", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [9656, "ERR3266389", "ERX3293002", "ERS3358385", "ERP114712", "PRJEB32081", "RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "E-MTAB-7846", "Transcriptome Analysis", "To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs  the evolution of enhancers has been difficult to trace because of their fast evolution. Here  we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed  three were located in conserved syntenic gene regions that are unique to animals Islet\u2013Scaper  Ccne1\u2013Uri  Tdrd3\u2013Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity  sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse  which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.", "ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08", null, "Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28\u00b0C for 5 minutes and a single cell solution was prepared by passing through a 40\u03bcm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies  respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/\u00b5L was combined with 1 \u00b5L of 10 \u00b5M oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 \u00b5L of dNTP mix 10 mM each; Invitrogen  y02256  then the protocol was continued as described ref. 2. Briefly  the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  Integrated DNA Technologies  followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol  except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 \u00b5M. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina  FC 131 1096  with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer  CLS760672. Libraries were pooled in equimolar ratios.", "sponge tdr gfp positive rep1", "SAMEA5556345", "UQ", "ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "E MTAB 7846:sponge tdr gfp positive rep1 s", "sponge tdr gfp positive rep1 s", "RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28\u00b0C for 5 minutes and a single cell solution was prepared by passing through a 40\u03bcm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies  respectively with a BD FACSAria Cell Sorter BD Biosciences.  RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/\u00b5L was combined with 1 \u00b5L of 10 \u00b5M oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 \u00b5L of dNTP mix 10 mM each; Invitrogen  y02256  then the protocol was continued as described ref. 2. Briefly  the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  Integrated DNA Technologies  followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol  except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 \u00b5M. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina  FC 131 1096  with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer  CLS760672. Libraries were pooled in equimolar ratios.", "Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive", "RNA-Seq", "TRANSCRIPTOMIC", "PolyA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP114712", "NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08", "E9_6pos_S4_L002_R1_001.fastq.gz", "fastq", 617529482.0, 8212485.0, "E MTAB 7846:sponge tdr gfp positive rep1 lane2", "0:75.19 1:0", "A:168925757;C:139655387;G:144096837;T:164831236;N:20265", 75, 0, null, null, 168925757, 139655387, 144096837, 164831236, 20265, "ERX3293002", "ERS3358385", "ERA1822647", "European Nucleotide Archive", "European Nucleotide Archive", 1, 0.9492, null, 0.06753, null, 0.712, null, 0.49881, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Unknown", "2019-04-08", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [9657, "ERR3266390", "ERX3293002", "ERS3358385", "ERP114712", "PRJEB32081", "RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "E-MTAB-7846", "Transcriptome Analysis", "To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs  the evolution of enhancers has been difficult to trace because of their fast evolution. Here  we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed  three were located in conserved syntenic gene regions that are unique to animals Islet\u2013Scaper  Ccne1\u2013Uri  Tdrd3\u2013Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity  sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse  which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.", "ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08", null, "Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28\u00b0C for 5 minutes and a single cell solution was prepared by passing through a 40\u03bcm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies  respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/\u00b5L was combined with 1 \u00b5L of 10 \u00b5M oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 \u00b5L of dNTP mix 10 mM each; Invitrogen  y02256  then the protocol was continued as described ref. 2. Briefly  the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  Integrated DNA Technologies  followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol  except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 \u00b5M. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina  FC 131 1096  with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer  CLS760672. Libraries were pooled in equimolar ratios.", "sponge tdr gfp positive rep1", "SAMEA5556345", "UQ", "ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "E MTAB 7846:sponge tdr gfp positive rep1 s", "sponge tdr gfp positive rep1 s", "RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28\u00b0C for 5 minutes and a single cell solution was prepared by passing through a 40\u03bcm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies  respectively with a BD FACSAria Cell Sorter BD Biosciences.  RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/\u00b5L was combined with 1 \u00b5L of 10 \u00b5M oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 \u00b5L of dNTP mix 10 mM each; Invitrogen  y02256  then the protocol was continued as described ref. 2. Briefly  the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  Integrated DNA Technologies  followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol  except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 \u00b5M. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina  FC 131 1096  with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer  CLS760672. Libraries were pooled in equimolar ratios.", "Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive", "RNA-Seq", "TRANSCRIPTOMIC", "PolyA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP114712", "NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08", "E9_6pos_S4_L003_R1_001.fastq.gz", "fastq", 624156883.0, 8300861.0, "E MTAB 7846:sponge tdr gfp positive rep1 lane3", "0:75.19 1:0", "A:170696950;C:141302376;G:145759286;T:166377781;N:20490", 75, 0, null, null, 170696950, 141302376, 145759286, 166377781, 20490, "ERX3293002", "ERS3358385", "ERA1822647", "European Nucleotide Archive", "European Nucleotide Archive", 1, 0.94917, null, 0.06724, null, 0.71291, null, 0.50783, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Unknown", "2019-04-08", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [9658, "ERR3266391", "ERX3293002", "ERS3358385", "ERP114712", "PRJEB32081", "RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "E-MTAB-7846", "Transcriptome Analysis", "To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs  the evolution of enhancers has been difficult to trace because of their fast evolution. Here  we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed  three were located in conserved syntenic gene regions that are unique to animals Islet\u2013Scaper  Ccne1\u2013Uri  Tdrd3\u2013Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity  sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse  which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.", "ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08", null, "Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28\u00b0C for 5 minutes and a single cell solution was prepared by passing through a 40\u03bcm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies  respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/\u00b5L was combined with 1 \u00b5L of 10 \u00b5M oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 \u00b5L of dNTP mix 10 mM each; Invitrogen  y02256  then the protocol was continued as described ref. 2. Briefly  the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  Integrated DNA Technologies  followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol  except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 \u00b5M. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina  FC 131 1096  with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer  CLS760672. Libraries were pooled in equimolar ratios.", "sponge tdr gfp positive rep1", "SAMEA5556345", "UQ", "ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "E MTAB 7846:sponge tdr gfp positive rep1 s", "sponge tdr gfp positive rep1 s", "RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28\u00b0C for 5 minutes and a single cell solution was prepared by passing through a 40\u03bcm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies  respectively with a BD FACSAria Cell Sorter BD Biosciences.  RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/\u00b5L was combined with 1 \u00b5L of 10 \u00b5M oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 \u00b5L of dNTP mix 10 mM each; Invitrogen  y02256  then the protocol was continued as described ref. 2. Briefly  the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  Integrated DNA Technologies  followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol  except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 \u00b5M. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina  FC 131 1096  with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer  CLS760672. Libraries were pooled in equimolar ratios.", "Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive", "RNA-Seq", "TRANSCRIPTOMIC", "PolyA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP114712", "NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08", "E9_6pos_S4_L004_R1_001.fastq.gz", "fastq", 615013615.0, 8179180.0, "E MTAB 7846:sponge tdr gfp positive rep1 lane4", "0:75.19 1:0", "A:168237742;C:139106952;G:143535658;T:164110735;N:22528", 75, 0, null, null, 168237742, 139106952, 143535658, 164110735, 22528, "ERX3293002", "ERS3358385", "ERA1822647", "European Nucleotide Archive", "European Nucleotide Archive", 1, 0.94892, null, 0.06723, null, 0.71206, null, 0.50775, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Unknown", "2019-04-08", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [9659, "ERR3266384", "ERX3293001", "ERS3358384", "ERP114712", "PRJEB32081", "RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "E-MTAB-7846", "Transcriptome Analysis", "To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs  the evolution of enhancers has been difficult to trace because of their fast evolution. Here  we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed  three were located in conserved syntenic gene regions that are unique to animals Islet\u2013Scaper  Ccne1\u2013Uri  Tdrd3\u2013Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity  sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse  which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.", "ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08", null, "Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28\u00b0C for 5 minutes and a single cell solution was prepared by passing through a 40\u03bcm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies  respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/\u00b5L was combined with 1 \u00b5L of 10 \u00b5M oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 \u00b5L of dNTP mix 10 mM each; Invitrogen  y02256  then the protocol was continued as described ref. 2. Briefly  the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  Integrated DNA Technologies  followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol  except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 \u00b5M. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina  FC 131 1096  with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer  CLS760672. Libraries were pooled in equimolar ratios.", "sponge tdr gfp negative rep2", "SAMEA5556344", "UQ", "ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "E MTAB 7846:sponge tdr gfp negative rep2 s", "sponge tdr gfp negative rep2 s", "RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28\u00b0C for 5 minutes and a single cell solution was prepared by passing through a 40\u03bcm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies  respectively with a BD FACSAria Cell Sorter BD Biosciences.  RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/\u00b5L was combined with 1 \u00b5L of 10 \u00b5M oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 \u00b5L of dNTP mix 10 mM each; Invitrogen  y02256  then the protocol was continued as described ref. 2. Briefly  the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  Integrated DNA Technologies  followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol  except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 \u00b5M. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina  FC 131 1096  with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer  CLS760672. Libraries were pooled in equimolar ratios.", "Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative", "RNA-Seq", "TRANSCRIPTOMIC", "PolyA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP114712", "NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08", "E9_9neg_S1_L001_R1_001.fastq.gz", "fastq", 659562366.0, 8762947.0, "E MTAB 7846:sponge tdr gfp negative rep2 lane1", "0:75.27 1:0", "A:178744772;C:150091912;G:155092318;T:175619332;N:14032", 75, 0, null, null, 178744772, 150091912, 155092318, 175619332, 14032, "ERX3293001", "ERS3358384", "ERA1822647", "European Nucleotide Archive", "European Nucleotide Archive", 1, 0.9517, null, 0.06908, null, 0.70822, null, 0.48025, null, 73, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Unknown", "2019-04-08", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [9660, "ERR3266385", "ERX3293001", "ERS3358384", "ERP114712", "PRJEB32081", "RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "E-MTAB-7846", "Transcriptome Analysis", "To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs  the evolution of enhancers has been difficult to trace because of their fast evolution. Here  we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed  three were located in conserved syntenic gene regions that are unique to animals Islet\u2013Scaper  Ccne1\u2013Uri  Tdrd3\u2013Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity  sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse  which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.", "ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08", null, "Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28\u00b0C for 5 minutes and a single cell solution was prepared by passing through a 40\u03bcm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies  respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/\u00b5L was combined with 1 \u00b5L of 10 \u00b5M oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 \u00b5L of dNTP mix 10 mM each; Invitrogen  y02256  then the protocol was continued as described ref. 2. Briefly  the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  Integrated DNA Technologies  followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol  except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 \u00b5M. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina  FC 131 1096  with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer  CLS760672. Libraries were pooled in equimolar ratios.", "sponge tdr gfp negative rep2", "SAMEA5556344", "UQ", "ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "E MTAB 7846:sponge tdr gfp negative rep2 s", "sponge tdr gfp negative rep2 s", "RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28\u00b0C for 5 minutes and a single cell solution was prepared by passing through a 40\u03bcm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies  respectively with a BD FACSAria Cell Sorter BD Biosciences.  RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/\u00b5L was combined with 1 \u00b5L of 10 \u00b5M oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 \u00b5L of dNTP mix 10 mM each; Invitrogen  y02256  then the protocol was continued as described ref. 2. Briefly  the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  Integrated DNA Technologies  followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol  except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 \u00b5M. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina  FC 131 1096  with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer  CLS760672. Libraries were pooled in equimolar ratios.", "Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative", "RNA-Seq", "TRANSCRIPTOMIC", "PolyA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP114712", "NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08", "E9_9neg_S1_L002_R1_001.fastq.gz", "fastq", 658688825.0, 8751176.0, "E MTAB 7846:sponge tdr gfp negative rep2 lane2", "0:75.27 1:0", "A:178540155;C:149844100;G:154850294;T:175438757;N:15519", 75, 0, null, null, 178540155, 149844100, 154850294, 175438757, 15519, "ERX3293001", "ERS3358384", "ERA1822647", "European Nucleotide Archive", "European Nucleotide Archive", 1, 0.95059, null, 0.06748, null, 0.70806, null, 0.48177, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Unknown", "2019-04-08", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [9661, "ERR3266386", "ERX3293001", "ERS3358384", "ERP114712", "PRJEB32081", "RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "E-MTAB-7846", "Transcriptome Analysis", "To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs  the evolution of enhancers has been difficult to trace because of their fast evolution. Here  we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed  three were located in conserved syntenic gene regions that are unique to animals Islet\u2013Scaper  Ccne1\u2013Uri  Tdrd3\u2013Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity  sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse  which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.", "ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08", null, "Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28\u00b0C for 5 minutes and a single cell solution was prepared by passing through a 40\u03bcm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies  respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/\u00b5L was combined with 1 \u00b5L of 10 \u00b5M oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 \u00b5L of dNTP mix 10 mM each; Invitrogen  y02256  then the protocol was continued as described ref. 2. Briefly  the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  Integrated DNA Technologies  followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol  except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 \u00b5M. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina  FC 131 1096  with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer  CLS760672. Libraries were pooled in equimolar ratios.", "sponge tdr gfp negative rep2", "SAMEA5556344", "UQ", "ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "E MTAB 7846:sponge tdr gfp negative rep2 s", "sponge tdr gfp negative rep2 s", "RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28\u00b0C for 5 minutes and a single cell solution was prepared by passing through a 40\u03bcm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies  respectively with a BD FACSAria Cell Sorter BD Biosciences.  RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/\u00b5L was combined with 1 \u00b5L of 10 \u00b5M oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 \u00b5L of dNTP mix 10 mM each; Invitrogen  y02256  then the protocol was continued as described ref. 2. Briefly  the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  Integrated DNA Technologies  followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol  except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 \u00b5M. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina  FC 131 1096  with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer  CLS760672. Libraries were pooled in equimolar ratios.", "Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative", "RNA-Seq", "TRANSCRIPTOMIC", "PolyA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP114712", "NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08", "E9_9neg_S1_L003_R1_001.fastq.gz", "fastq", 665901310.0, 8846927.0, "E MTAB 7846:sponge tdr gfp negative rep2 lane3", "0:75.27 1:0", "A:180412445;C:151589489;G:156677030;T:177206192;N:16154", 75, 0, null, null, 180412445, 151589489, 156677030, 177206192, 16154, "ERX3293001", "ERS3358384", "ERA1822647", "European Nucleotide Archive", "European Nucleotide Archive", 1, 0.95095, null, 0.06855, null, 0.7082, null, 0.4787, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Unknown", "2019-04-08", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [9662, "ERR3266387", "ERX3293001", "ERS3358384", "ERP114712", "PRJEB32081", "RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "E-MTAB-7846", "Transcriptome Analysis", "To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs  the evolution of enhancers has been difficult to trace because of their fast evolution. Here  we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed  three were located in conserved syntenic gene regions that are unique to animals Islet\u2013Scaper  Ccne1\u2013Uri  Tdrd3\u2013Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity  sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse  which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.", "ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08", null, "Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28\u00b0C for 5 minutes and a single cell solution was prepared by passing through a 40\u03bcm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies  respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/\u00b5L was combined with 1 \u00b5L of 10 \u00b5M oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 \u00b5L of dNTP mix 10 mM each; Invitrogen  y02256  then the protocol was continued as described ref. 2. Briefly  the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  Integrated DNA Technologies  followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol  except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 \u00b5M. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina  FC 131 1096  with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer  CLS760672. Libraries were pooled in equimolar ratios.", "sponge tdr gfp negative rep2", "SAMEA5556344", "UQ", "ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "E MTAB 7846:sponge tdr gfp negative rep2 s", "sponge tdr gfp negative rep2 s", "RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28\u00b0C for 5 minutes and a single cell solution was prepared by passing through a 40\u03bcm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies  respectively with a BD FACSAria Cell Sorter BD Biosciences.  RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/\u00b5L was combined with 1 \u00b5L of 10 \u00b5M oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 \u00b5L of dNTP mix 10 mM each; Invitrogen  y02256  then the protocol was continued as described ref. 2. Briefly  the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  Integrated DNA Technologies  followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol  except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 \u00b5M. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina  FC 131 1096  with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer  CLS760672. Libraries were pooled in equimolar ratios.", "Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative", "RNA-Seq", "TRANSCRIPTOMIC", "PolyA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP114712", "NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08", "E9_9neg_S1_L004_R1_001.fastq.gz", "fastq", 655674573.0, 8711278.0, "E MTAB 7846:sponge tdr gfp negative rep2 lane4", "0:75.27 1:0", "A:177658097;C:149188009;G:154201531;T:174609176;N:17760", 75, 0, null, null, 177658097, 149188009, 154201531, 174609176, 17760, "ERX3293001", "ERS3358384", "ERA1822647", "European Nucleotide Archive", "European Nucleotide Archive", 1, 0.9503, null, 0.06838, null, 0.70926, null, 0.47475, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Unknown", "2019-04-08", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [9663, "ERR3266380", "ERX3293000", "ERS3358383", "ERP114712", "PRJEB32081", "RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "E-MTAB-7846", "Transcriptome Analysis", "To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs  the evolution of enhancers has been difficult to trace because of their fast evolution. Here  we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed  three were located in conserved syntenic gene regions that are unique to animals Islet\u2013Scaper  Ccne1\u2013Uri  Tdrd3\u2013Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity  sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse  which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.", "ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08", null, "Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28\u00b0C for 5 minutes and a single cell solution was prepared by passing through a 40\u03bcm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies  respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/\u00b5L was combined with 1 \u00b5L of 10 \u00b5M oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 \u00b5L of dNTP mix 10 mM each; Invitrogen  y02256  then the protocol was continued as described ref. 2. Briefly  the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  Integrated DNA Technologies  followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol  except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 \u00b5M. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina  FC 131 1096  with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer  CLS760672. Libraries were pooled in equimolar ratios.", "sponge tdr gfp negative rep1", "SAMEA5556343", "UQ", "ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "E MTAB 7846:sponge tdr gfp negative rep1 s", "sponge tdr gfp negative rep1 s", "RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28\u00b0C for 5 minutes and a single cell solution was prepared by passing through a 40\u03bcm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies  respectively with a BD FACSAria Cell Sorter BD Biosciences.  RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/\u00b5L was combined with 1 \u00b5L of 10 \u00b5M oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 \u00b5L of dNTP mix 10 mM each; Invitrogen  y02256  then the protocol was continued as described ref. 2. Briefly  the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  Integrated DNA Technologies  followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol  except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 \u00b5M. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina  FC 131 1096  with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer  CLS760672. Libraries were pooled in equimolar ratios.", "Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative", "RNA-Seq", "TRANSCRIPTOMIC", "PolyA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP114712", "NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08", "E9_6neg_S3_L001_R1_001.fastq.gz", "fastq", 634491637.0, 8440052.0, "E MTAB 7846:sponge tdr gfp negative rep1 lane1", "0:75.18 1:0", "A:170881257;C:145535643;G:150561786;T:167495156;N:17795", 75, 0, null, null, 170881257, 145535643, 150561786, 167495156, 17795, "ERX3293000", "ERS3358383", "ERA1822647", "European Nucleotide Archive", "European Nucleotide Archive", 1, 0.94996, null, 0.05672, null, 0.70571, null, 0.48691, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Unknown", "2019-04-08", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [9664, "ERR3266381", "ERX3293000", "ERS3358383", "ERP114712", "PRJEB32081", "RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "E-MTAB-7846", "Transcriptome Analysis", "To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs  the evolution of enhancers has been difficult to trace because of their fast evolution. Here  we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed  three were located in conserved syntenic gene regions that are unique to animals Islet\u2013Scaper  Ccne1\u2013Uri  Tdrd3\u2013Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity  sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse  which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.", "ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08", null, "Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28\u00b0C for 5 minutes and a single cell solution was prepared by passing through a 40\u03bcm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies  respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/\u00b5L was combined with 1 \u00b5L of 10 \u00b5M oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 \u00b5L of dNTP mix 10 mM each; Invitrogen  y02256  then the protocol was continued as described ref. 2. Briefly  the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  Integrated DNA Technologies  followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol  except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 \u00b5M. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina  FC 131 1096  with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer  CLS760672. Libraries were pooled in equimolar ratios.", "sponge tdr gfp negative rep1", "SAMEA5556343", "UQ", "ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "E MTAB 7846:sponge tdr gfp negative rep1 s", "sponge tdr gfp negative rep1 s", "RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28\u00b0C for 5 minutes and a single cell solution was prepared by passing through a 40\u03bcm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies  respectively with a BD FACSAria Cell Sorter BD Biosciences.  RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/\u00b5L was combined with 1 \u00b5L of 10 \u00b5M oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 \u00b5L of dNTP mix 10 mM each; Invitrogen  y02256  then the protocol was continued as described ref. 2. Briefly  the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  Integrated DNA Technologies  followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol  except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 \u00b5M. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina  FC 131 1096  with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer  CLS760672. Libraries were pooled in equimolar ratios.", "Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative", "RNA-Seq", "TRANSCRIPTOMIC", "PolyA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP114712", "NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08", "E9_6neg_S3_L002_R1_001.fastq.gz", "fastq", 632900752.0, 8418846.0, "E MTAB 7846:sponge tdr gfp negative rep1 lane2", "0:75.18 1:0", "A:170454908;C:145141392;G:150172752;T:167112562;N:19138", 75, 0, null, null, 170454908, 145141392, 150172752, 167112562, 19138, "ERX3293000", "ERS3358383", "ERA1822647", "European Nucleotide Archive", "European Nucleotide Archive", 1, 0.94905, null, 0.05627, null, 0.70457, null, 0.4865, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Unknown", "2019-04-08", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"], [9665, "ERR3266382", "ERX3293000", "ERS3358383", "ERP114712", "PRJEB32081", "RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "E-MTAB-7846", "Transcriptome Analysis", "To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs  the evolution of enhancers has been difficult to trace because of their fast evolution. Here  we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed  three were located in conserved syntenic gene regions that are unique to animals Islet\u2013Scaper  Ccne1\u2013Uri  Tdrd3\u2013Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity  sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse  which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.", "ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08", null, "Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28\u00b0C for 5 minutes and a single cell solution was prepared by passing through a 40\u03bcm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies  respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/\u00b5L was combined with 1 \u00b5L of 10 \u00b5M oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 \u00b5L of dNTP mix 10 mM each; Invitrogen  y02256  then the protocol was continued as described ref. 2. Briefly  the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  Integrated DNA Technologies  followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol  except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 \u00b5M. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina  FC 131 1096  with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer  CLS760672. Libraries were pooled in equimolar ratios.", "sponge tdr gfp negative rep1", "SAMEA5556343", "UQ", "ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains", null, null, null, null, null, null, null, null, "NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "E MTAB 7846:sponge tdr gfp negative rep1 s", "sponge tdr gfp negative rep1 s", "RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28\u00b0C for 5 minutes and a single cell solution was prepared by passing through a 40\u03bcm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies  respectively with a BD FACSAria Cell Sorter BD Biosciences.  RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/\u00b5L was combined with 1 \u00b5L of 10 \u00b5M oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 \u00b5L of dNTP mix 10 mM each; Invitrogen  y02256  then the protocol was continued as described ref. 2. Briefly  the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  Integrated DNA Technologies  followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol  except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 \u00b5M. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina  FC 131 1096  with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer  CLS760672. Libraries were pooled in equimolar ratios.", "Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative", "RNA-Seq", "TRANSCRIPTOMIC", "PolyA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "ERP114712", "NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers", "ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08", "E9_6neg_S3_L003_R1_001.fastq.gz", "fastq", 638530115.0, 8494045.0, "E MTAB 7846:sponge tdr gfp negative rep1 lane3", "0:75.17 1:0", "A:171907482;C:146526309;G:151612209;T:168464163;N:19952", 75, 0, null, null, 171907482, 146526309, 151612209, 168464163, 19952, "ERX3293000", "ERS3358383", "ERA1822647", "European Nucleotide Archive", "European Nucleotide Archive", 1, 0.94919, null, 0.05578, null, 0.70849, null, 0.48073, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "poly_a", "nextera", "sc", "single_cell_plate", "smartseq", null, "Unknown", "2019-04-08", "Larval", "Larval", "Embryo Imprecise", "All anatomical structures"]], "truncated": false, "filtered_table_rows_count": 4675, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"devstage_curation_coarse\" = :p0 and \"experiment.library_layout\" = :p1 order by rowid limit 101", "params": {"p0": "Larval", "p1": "SINGLE"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE", "results": [{"value": "RNA-Seq", "label": "RNA-Seq", "count": 4422, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&experiment.library_strategy=RNA-Seq", "selected": false}, {"value": "OTHER", "label": "OTHER", "count": 90, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&experiment.library_strategy=OTHER", "selected": false}, {"value": "miRNA-Seq", "label": "miRNA-Seq", "count": 73, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&experiment.library_strategy=miRNA-Seq", "selected": false}, {"value": "ncRNA-Seq", "label": "ncRNA-Seq", "count": 70, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&experiment.library_strategy=ncRNA-Seq", "selected": false}, {"value": "AMPLICON", "label": "AMPLICON", "count": 8, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&experiment.library_strategy=AMPLICON", "selected": false}, {"value": "RIP-Seq", "label": "RIP-Seq", "count": 8, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&experiment.library_strategy=RIP-Seq", "selected": false}, {"value": "FL-cDNA", "label": "FL-cDNA", "count": 4, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&experiment.library_strategy=FL-cDNA", "selected": false}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 4142, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&experiment.library_source=TRANSCRIPTOMIC", "selected": false}, {"value": "TRANSCRIPTOMIC SINGLE CELL", "label": "TRANSCRIPTOMIC SINGLE CELL", "count": 533, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&experiment.library_source=TRANSCRIPTOMIC+SINGLE+CELL", "selected": false}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE", "results": [{"value": "cDNA", "label": "cDNA", "count": 3769, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&experiment.library_selection=cDNA", "selected": false}, {"value": "PolyA", "label": "PolyA", "count": 378, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&experiment.library_selection=PolyA", "selected": false}, {"value": "size fractionation", "label": "size fractionation", "count": 121, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&experiment.library_selection=size+fractionation", "selected": false}, {"value": "other", "label": "other", "count": 110, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&experiment.library_selection=other", "selected": false}, {"value": "Oligo-dT", "label": "Oligo-dT", "count": 93, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&experiment.library_selection=Oligo-dT", "selected": false}, {"value": "unspecified", "label": "unspecified", "count": 61, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&experiment.library_selection=unspecified", "selected": false}, {"value": "RANDOM", "label": "RANDOM", "count": 58, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&experiment.library_selection=RANDOM", "selected": false}, {"value": "RANDOM PCR", "label": "RANDOM PCR", "count": 31, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&experiment.library_selection=RANDOM+PCR", "selected": false}, {"value": "PCR", "label": "PCR", "count": 28, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&experiment.library_selection=PCR", "selected": false}, {"value": "RT-PCR", "label": "RT-PCR", "count": 26, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&experiment.library_selection=RT-PCR", "selected": false}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE", "results": [{"value": "SINGLE", "label": "SINGLE", "count": 4675, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval", "selected": true}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE", "results": [{"value": "ILLUMINA", "label": "ILLUMINA", "count": 4582, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&experiment.platform=ILLUMINA", "selected": false}, {"value": "BGISEQ", "label": "BGISEQ", "count": 55, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&experiment.platform=BGISEQ", "selected": false}, {"value": "ABI_SOLID", "label": "ABI_SOLID", "count": 12, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&experiment.platform=ABI_SOLID", "selected": false}, {"value": "LS454", "label": "LS454", "count": 11, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&experiment.platform=LS454", "selected": false}, {"value": "COMPLETE_GENOMICS", "label": "COMPLETE_GENOMICS", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&experiment.platform=COMPLETE_GENOMICS", "selected": false}, {"value": "ION_TORRENT", "label": "ION_TORRENT", "count": 5, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&experiment.platform=ION_TORRENT", "selected": false}, {"value": "PACBIO_SMRT", "label": "PACBIO_SMRT", "count": 4, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&experiment.platform=PACBIO_SMRT", "selected": false}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE", "results": [{"value": "Larval", "label": "Larval", "count": 4675, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_layout=SINGLE", "selected": true}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE", "results": [{"value": "Larval", "label": "Larval", "count": 4362, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&devstage_curation=Larval", "selected": false}, {"value": "Undetermined", "label": "Undetermined", "count": 313, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&devstage_curation=Undetermined", "selected": false}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE", "results": [{"value": "All anatomical structures", "label": "All anatomical structures", "count": 2115, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&tissue_curation_coarse=All+anatomical+structures", "selected": false}, {"value": "Nervous System", "label": "Nervous System", "count": 937, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&tissue_curation_coarse=Nervous+System", "selected": false}, {"value": "Multi-system", "label": "Multi-system", "count": 578, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&tissue_curation_coarse=Multi-system", "selected": false}, {"value": "Undetermined", "label": "Undetermined", "count": 205, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&tissue_curation_coarse=Undetermined", "selected": false}, {"value": "Hematopoietic System", "label": "Hematopoietic System", "count": 186, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&tissue_curation_coarse=Hematopoietic+System", "selected": false}, {"value": "Surface Structure", "label": "Surface Structure", "count": 138, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&tissue_curation_coarse=Surface+Structure", "selected": false}, {"value": "Cardiovascular System", "label": "Cardiovascular System", "count": 124, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&tissue_curation_coarse=Cardiovascular+System", "selected": false}, {"value": "Sensory System", "label": "Sensory System", "count": 96, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&tissue_curation_coarse=Sensory+System", "selected": false}, {"value": "Liver and Biliary System", "label": "Liver and Biliary System", "count": 75, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&tissue_curation_coarse=Liver+and+Biliary+System", "selected": false}, {"value": "Cell Line", "label": "Cell Line", "count": 74, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&tissue_curation_coarse=Cell+Line", "selected": false}], "truncated": true}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE", "results": [{"value": "Whole Organism", "label": "Whole Organism", "count": 1626, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&tissue_curation=Whole+Organism", "selected": false}, {"value": "Multi-tissue", "label": "Multi-tissue", "count": 514, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&tissue_curation=Multi-tissue", "selected": false}, {"value": "Embryo Imprecise", "label": "Embryo Imprecise", "count": 489, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&tissue_curation=Embryo+Imprecise", "selected": false}, {"value": "Brain", "label": "Brain", "count": 425, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&tissue_curation=Brain", "selected": false}, {"value": "Spinal Cord", "label": "Spinal Cord", "count": 387, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&tissue_curation=Spinal+Cord", "selected": false}, {"value": "Undetermined", "label": "Undetermined", "count": 205, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&tissue_curation=Undetermined", "selected": false}, {"value": "Blood", "label": "Blood", "count": 178, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&tissue_curation=Blood", "selected": false}, {"value": "Head", "label": "Head", "count": 125, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&tissue_curation=Head", "selected": false}, {"value": "Trunk", "label": "Trunk", "count": 107, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&tissue_curation=Trunk", "selected": false}, {"value": "Heart", "label": "Heart", "count": 99, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&tissue_curation=Heart", "selected": false}], "truncated": true}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE", "results": [{"value": "unknown", "label": "unknown", "count": 2617, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&technology=unknown", "selected": false}, {"value": "smartseq", "label": "smartseq", "count": 1130, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&technology=smartseq", "selected": false}, {"value": "10x", "label": "10x", "count": 244, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&technology=10x", "selected": false}, {"value": "scirnaseq", "label": "scirnaseq", "count": 204, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&technology=scirnaseq", "selected": false}, {"value": "bulk", "label": "bulk", "count": 177, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&technology=bulk", "selected": false}, {"value": "generic-scrnaseq-only", "label": "generic-scrnaseq-only", "count": 111, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&technology=generic-scrnaseq-only", "selected": false}, {"value": "indrops", "label": "indrops", "count": 107, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&technology=indrops", "selected": false}, {"value": "celseq", "label": "celseq", "count": 74, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&technology=celseq", "selected": false}, {"value": "454", "label": "454", "count": 11, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&technology=454", "selected": false}], "truncated": false}}, "suggested_facets": [], "next": "9665", "next_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Larval&experiment.library_layout=SINGLE&_next=9665", "private": false, "allow_execute_sql": true, "query_ms": 127.09400499988988}