{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where devstage_curation_coarse = \"Adult\" and tissue_curation = \"BCR TCR repertoire\"", "rows": [[68262, "SRR099333", "SRX041597", "SRS172447", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio  leading with MID barcode TAGTATCAGC", "4432 1Y D", "4432 1Y D", null, null, null, null, null, null, null, null, null, null, "1", "4432 1Y D", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 72592827.0, 232367.0, "4432 1Y D", "0:4 1:308.41", null, 4, 308, null, null, null, null, null, null, null, "SRX041597", "SRS172447", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.13098, null, 0.04666, null, 0.99943, null, 0.00078, null, 195, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68263, "SRR099332", "SRX041596", "SRS172446", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio  leading with MID barcode TAGTATCAGC", "4432 1Y C9", "4432 1Y C9", null, null, null, null, null, null, null, null, null, null, "1", "4432 1Y C9", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 78320127.0, 261806.0, "4432 1Y C9", "0:4 1:295.15", null, 4, 295, null, null, null, null, null, null, null, "SRX041596", "SRS172446", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.20079, null, 0.01319, null, 0.99971, null, 0.0004, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68264, "SRR099331", "SRX041595", "SRS172445", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio  leading with MID barcode CTCGCGTGTC", "4432 1Y B8", "4432 1Y B8", null, null, null, null, null, null, null, null, null, null, "1", "4432 1Y B8", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 46900878.0, 156154.0, "4432 1Y B8", "0:4 1:296.35", null, 4, 296, null, null, null, null, null, null, null, "SRX041595", "SRS172445", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.21827, null, 0.01485, null, 0.99961, null, 0.00018, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68265, "SRR099330", "SRX041594", "SRS172444", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio  leading with MID barcode CGTGTCTCTA", "4432 1Y A7", "4432 1Y A7", null, null, null, null, null, null, null, null, null, null, "1", "4432 1Y A7", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 22543768.0, 73425.0, "4432 1Y A7", "0:4 1:303.03", null, 4, 303, null, null, null, null, null, null, null, "SRX041594", "SRS172444", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.16879, null, 0.02006, null, 0.99973, null, 0.00063, null, 89, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68266, "SRR099325", "SRX041593", "SRS172443", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio  leading with MID barcode ATATCGCGAG", "4430 1Y C6", "4430 1Y C6", null, null, null, null, null, null, null, null, null, null, "1", "4430 1Y C6", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 38479526.0, 134024.0, "4430 1Y C6", "0:4 1:283.11", null, 4, 283, null, null, null, null, null, null, null, "SRX041593", "SRS172443", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.11658, null, 0.00464, null, 0.99928, null, 0.00323, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68267, "SRR099324", "SRX041592", "SRS172442", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio  leading with MID barcode ATCAGACACG", "4430 1Y B5", "4430 1Y B5", null, null, null, null, null, null, null, null, null, null, "1", "4430 1Y B5", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 83990641.0, 290583.0, "4430 1Y B5", "0:4 1:285.04", null, 4, 285, null, null, null, null, null, null, null, "SRX041592", "SRS172442", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.20603, null, 0.01554, null, 0.99967, null, 0.00038, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68268, "SRR099323", "SRX041591", "SRS172441", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio  leading with MID barcode AGCACTGTAG", "4430 1Y A4", "4430 1Y A4", null, null, null, null, null, null, null, null, null, null, "1", "4430 1Y A4", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 27578630.0, 90031.0, "4430 1Y A4", "0:4 1:302.32", null, 4, 302, null, null, null, null, null, null, null, "SRX041591", "SRS172441", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.12444, null, 0.0197, null, 0.99975, null, 0.00096, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68269, "SRR099322", "SRX041590", "SRS172440", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio  leading with MID barcode AGACGCACTC", "4428 1Y C3", "4428 1Y C3", null, null, null, null, null, null, null, null, null, null, "1", "4428 1Y C3", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 62333740.0, 194228.0, "4428 1Y C3", "0:4 1:316.93", null, 4, 316, null, null, null, null, null, null, null, "SRX041590", "SRS172440", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.1865, null, 0.02265, null, 0.99947, null, 0.00049, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68270, "SRR099321", "SRX041589", "SRS172439", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio  leading with MID barcode ACGCTCGACA", "4428 1Y B2", "4428 1Y B2", null, null, null, null, null, null, null, null, null, null, "1", "4428 1Y B2", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 104263503.0, 333602.0, "4428 1Y B2", "0:4 1:308.54", null, 4, 308, null, null, null, null, null, null, null, "SRX041589", "SRS172439", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.15679, null, 0.02871, null, 0.99953, null, 0.00044, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68271, "SRR099320", "SRX041588", "SRS172438", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio  leading with MID barcode ACGAGTGCGT", "4428 1Y A1", "4428 1Y A1", null, null, null, null, null, null, null, null, null, null, "1", "4428 1Y A1", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 18763476.0, 59560.0, "4428 1Y A1", "0:4 1:311.03", null, 4, 311, null, null, null, null, null, null, null, "SRX041588", "SRS172438", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.13922, null, 0.01452, null, 0.99971, null, 0.00094, null, 160, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68272, "SRR099364", "SRX041587", "SRS172437", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode TGATACGTCT", "4433 6M D", "4433 6M D", null, null, null, null, null, null, null, null, null, null, "1", "4433 6M D", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 101345153.0, 290438.0, "4433 6M D", "0:4 1:344.94", null, 4, 344, null, null, null, null, null, null, null, "SRX041587", "SRS172437", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.14815, null, 0.01925, null, 0.99908, null, 0.00202, null, 155, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68273, "SRR099363", "SRX041586", "SRS172436", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode TCTCTATGCG", "4433 6M C", "4433 6M C", null, null, null, null, null, null, null, null, null, null, "1", "4433 6M C", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 75770901.0, 213529.0, "4433 6M C", "0:4 1:350.85", null, 4, 350, null, null, null, null, null, null, null, "SRX041586", "SRS172436", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.14445, null, 0.01047, null, 0.99878, null, 0.00299, null, 57, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68274, "SRR099362", "SRX041585", "SRS172435", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode TAGTATCAGC", "4433 6M B", "4433 6M B", null, null, null, null, null, null, null, null, null, null, "1", "4433 6M B", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 67192817.0, 194503.0, "4433 6M B", "0:4 1:341.46", null, 4, 341, null, null, null, null, null, null, null, "SRX041585", "SRS172435", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.13467, null, 0.01249, null, 0.99914, null, 0.00222, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68275, "SRR099361", "SRX041584", "SRS172434", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode CTCGCGTGTC", "4433 6M A", "4433 6M A", null, null, null, null, null, null, null, null, null, null, "1", "4433 6M A", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 72299403.0, 207618.0, "4433 6M A", "0:4 1:344.23", null, 4, 344, null, null, null, null, null, null, null, "SRX041584", "SRS172434", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.1041, null, 0.01046, null, 0.99764, null, 0.00892, null, 64, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68276, "SRR099348", "SRX041583", "SRS172433", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode CGTGTCTCTA", "4432 6M G", "4432 6M G", null, null, null, null, null, null, null, null, null, null, "1", "4432 6M G", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 79715586.0, 227631.0, "4432 6M G", "0:4 1:346.20", null, 4, 346, null, null, null, null, null, null, null, "SRX041583", "SRS172433", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.11472, null, 0.01795, null, 0.99898, null, 0.00298, null, 103, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68277, "SRR099347", "SRX041582", "SRS172432", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode ATATCGCGAG", "4432 6M F", "4432 6M F", null, null, null, null, null, null, null, null, null, null, "1", "4432 6M F", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 72024740.0, 203769.0, "4432 6M F", "0:4 1:349.46", null, 4, 349, null, null, null, null, null, null, null, "SRX041582", "SRS172432", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.11535, null, 0.01205, null, 0.99855, null, 0.00395, null, 40, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68278, "SRR099346", "SRX041581", "SRS172431", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode ATCAGACACG", "4432 6M E", "4432 6M E", null, null, null, null, null, null, null, null, null, null, "1", "4432 6M E", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 65072237.0, 190441.0, "4432 6M E", "0:4 1:337.69", null, 4, 337, null, null, null, null, null, null, null, "SRX041581", "SRS172431", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.11698, null, 0.01584, null, 0.99823, null, 0.00583, null, 65, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68279, "SRR099345", "SRX041580", "SRS172430", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode AGCACTGTAG", "4432 6M D", "4432 6M D", null, null, null, null, null, null, null, null, null, null, "1", "4432 6M D", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 74122161.0, 211816.0, "4432 6M D", "0:4 1:345.94", null, 4, 345, null, null, null, null, null, null, null, "SRX041580", "SRS172430", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.10275, null, 0.01376, null, 0.99912, null, 0.00377, null, 57, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68280, "SRR099344", "SRX041579", "SRS172429", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode AGACGCACTC", "4432 6M C", "4432 6M C", null, null, null, null, null, null, null, null, null, null, "1", "4432 6M C", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 78171765.0, 220585.0, "4432 6M C", "0:4 1:350.38", null, 4, 350, null, null, null, null, null, null, null, "SRX041579", "SRS172429", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.13401, null, 0.0146, null, 0.99711, null, 0.01012, null, 222, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68281, "SRR099343", "SRX041578", "SRS172428", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode ACGCTCGACA", "4432 6M B", "4432 6M B", null, null, null, null, null, null, null, null, null, null, "1", "4432 6M B", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 75262808.0, 217309.0, "4432 6M B", "0:4 1:342.34", null, 4, 342, null, null, null, null, null, null, null, "SRX041578", "SRS172428", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.16193, null, 0.00604, null, 0.99685, null, 0.00701, null, 452, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68282, "SRR099342", "SRX041577", "SRS172427", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode ACGAGTGCGT", "4432 6M A", "4432 6M A", null, null, null, null, null, null, null, null, null, null, "1", "4432 6M A", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 66235952.0, 184208.0, "4432 6M A", "0:4 1:355.57", null, 4, 355, null, null, null, null, null, null, null, "SRX041577", "SRS172427", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.10428, null, 0.01655, null, 0.99661, null, 0.01505, null, 183, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68283, "SRR099370", "SRX041576", "SRS172426", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode TACTGAGCTA", "F2 2", "F2 2", null, null, null, null, null, null, null, null, null, null, "1", "F2 2", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 64641127.0, 184383.0, "F2 2", "0:4 1:346.58", null, 4, 346, null, null, null, null, null, null, null, "SRX041576", "SRS172426", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.23604, null, 0.01003, null, 0.99959, null, 0.00028, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68284, "SRR099369", "SRX041575", "SRS172425", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode TGATACGTCT", "E2 2", "E2 2", null, null, null, null, null, null, null, null, null, null, "1", "E2 2", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 66206147.0, 181029.0, "E2 2", "0:4 1:361.72", null, 4, 361, null, null, null, null, null, null, null, "SRX041575", "SRS172425", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.13216, null, 0.00596, null, 0.99949, null, 0.00054, null, 101, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68285, "SRR099368", "SRX041574", "SRS172424", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode TGATACGTCT", "D2 2", "D2 2", null, null, null, null, null, null, null, null, null, null, "1", "D2 2", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 190136862.0, 562067.0, "D2 2", "0:4 1:334.28", null, 4, 334, null, null, null, null, null, null, null, "SRX041574", "SRS172424", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.25384, null, 0.03443, null, 0.99933, null, 0.00056, null, 416, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68286, "SRR099367", "SRX041573", "SRS172423", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode TAGTATCAGC", "C2 2", "C2 2", null, null, null, null, null, null, null, null, null, null, "1", "C2 2", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 118356460.0, 367001.0, "C2 2", "0:4 1:318.50", null, 4, 318, null, null, null, null, null, null, null, "SRX041573", "SRS172423", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.18882, null, 0.02167, null, 0.99969, null, 9e-05, null, 40, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68287, "SRR099366", "SRX041572", "SRS172422", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode CTCGCGTGTC", "B2 2", "B2 2", null, null, null, null, null, null, null, null, null, null, "1", "B2 2", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 24757877.0, 69408.0, "B2 2", "0:4 1:352.70", null, 4, 352, null, null, null, null, null, null, null, "SRX041572", "SRS172422", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.12537, null, 0.01076, null, 0.99975, null, 0.00029, null, 37, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68288, "SRR099365", "SRX041571", "SRS172421", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio  leading with MID barcode CGTGTCTCTA", "A2 2", "A2 2", null, null, null, null, null, null, null, null, null, null, "1", "A2 2", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 765824405.0, 2575264.0, "A2 2", "0:4 1:293.38", null, 4, 293, null, null, null, null, null, null, null, "SRX041571", "SRS172421", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.18359, null, 0.017, null, 0.99892, null, 0.00154, null, 152, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68289, "SRR099360", "SRX041570", "SRS172420", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio  leading with MID barcode CTCGCGTGTC or with no barcode leading with either IgM reverse primer TGCACTGAGACAAACCGAAG or IgZ reverse primer TCAGAGGCCAGACATCCAAT", "4433 3MA DT", "4433 3MA DT", null, null, null, null, null, null, null, null, null, null, "1", "4433 3MA DT", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 56064850.0, 187695.0, "4433 3MA DT", "0:4 1:294.70", null, 4, 294, null, null, null, null, null, null, null, "SRX041570", "SRS172420", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.3144, null, 0.00306, null, 0.99987, null, 0.0, null, 106, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68290, "SRR099359", "SRX041569", "SRS172419", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio  leading with MID barcode CGTGTCTCTA", "4433 3MA C7", "4433 3MA C7", null, null, null, null, null, null, null, null, null, null, "1", "4433 3MA C7", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 96179902.0, 300329.0, "4433 3MA C7", "0:4 1:316.25", null, 4, 316, null, null, null, null, null, null, null, "SRX041569", "SRS172419", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.1804, null, 0.01829, null, 0.99953, null, 0.00028, null, 468, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68291, "SRR099358", "SRX041568", "SRS172418", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio  leading with MID barcode ATATCGCGAG", "4433 3MA B6", "4433 3MA B6", null, null, null, null, null, null, null, null, null, null, "1", "4433 3MA B6", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 50421822.0, 147276.0, "4433 3MA B6", "0:4 1:338.36", null, 4, 338, null, null, null, null, null, null, null, "SRX041568", "SRS172418", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.19259, null, 0.00589, null, 0.99955, null, 0.00065, null, 99, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68292, "SRR099357", "SRX041567", "SRS172417", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio  leading with MID barcode ATCAGACACG", "4433 3MA A5", "4433 3MA A5", null, null, null, null, null, null, null, null, null, null, "1", "4433 3MA A5", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 156064156.0, 515822.0, "4433 3MA A5", "0:4 1:298.55", null, 4, 298, null, null, null, null, null, null, null, "SRX041567", "SRS172417", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.22633, null, 0.01233, null, 0.99971, null, 0.00016, null, 40, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68293, "SRR099341", "SRX041566", "SRS172416", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio  leading with MID barcode AGCACTGTAG", "4432 3MA D4", "4432 3MA D4", null, null, null, null, null, null, null, null, null, null, "1", "4432 3MA D4", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 61903651.0, 206769.0, "4432 3MA D4", "0:4 1:295.39", null, 4, 295, null, null, null, null, null, null, null, "SRX041566", "SRS172416", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.23888, null, 0.01136, null, 0.99953, null, 0.00047, null, 58, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68294, "SRR099340", "SRX041565", "SRS172415", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio  leading with MID barcode AGACGCACTC", "4432 3MA C3", "4432 3MA C3", null, null, null, null, null, null, null, null, null, null, "1", "4432 3MA C3", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 37914122.0, 116980.0, "4432 3MA C3", "0:4 1:320.11", null, 4, 320, null, null, null, null, null, null, null, "SRX041565", "SRS172415", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.19288, null, 0.0142, null, 0.99955, null, 0.00034, null, 125, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68295, "SRR099339", "SRX041564", "SRS172414", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio  leading with MID barcode ACGCTCGACA", "4432 3MA B2", "4432 3MA B2", null, null, null, null, null, null, null, null, null, null, "1", "4432 3MA B2", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 89178437.0, 298194.0, "4432 3MA B2", "0:4 1:295.06", null, 4, 295, null, null, null, null, null, null, null, "SRX041564", "SRS172414", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.21059, null, 0.00985, null, 0.99969, null, 0.00012, null, 107, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"], [68296, "SRR099338", "SRX041563", "SRS172413", "SRP005640", "PRJNA79973", "Zebrafish Development", "4432-2WA", "Other", "Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang  Weinstein  Penland  White  Fish  and Quake.", null, "pubmed:21393572", "Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio  leading with MID barcode ACGAGTGCGT", "4432 3MA A1", "4432 3MA A1", null, null, null, null, null, null, null, null, null, null, "1", "4432 3MA A1", "Zebrafish WIK", "Standard Roche 454 GS Titanium shotgun library protocol was followed.", null, null, "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX Titanium", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP005640", null, null, null, null, 59101536.0, 194332.0, "4432 3MA A1", "0:4 1:300.13", null, 4, 300, null, null, null, null, null, null, null, "SRX041563", "SRS172413", "SRA029829", "Stanford University|Quake", "Stanford University", 1, 0.26977, null, 0.00958, null, 0.99971, null, 0.00015, null, 69, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-04-07", "Adult", "Adult", "BCR TCR repertoire", "Hematopoietic System"]], "truncated": false, "filtered_table_rows_count": 35, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"devstage_curation_coarse\" = :p0 and \"tissue_curation\" = :p1 order by rowid limit 101", "params": {"p0": "Adult", "p1": "BCR TCR repertoire"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Adult&tissue_curation=BCR+TCR+repertoire", "results": [{"value": "AMPLICON", "label": "AMPLICON", "count": 35, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Adult&tissue_curation=BCR+TCR+repertoire&experiment.library_strategy=AMPLICON", "selected": false}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Adult&tissue_curation=BCR+TCR+repertoire", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 35, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Adult&tissue_curation=BCR+TCR+repertoire&experiment.library_source=TRANSCRIPTOMIC", "selected": false}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Adult&tissue_curation=BCR+TCR+repertoire", "results": [{"value": "PCR", "label": "PCR", "count": 35, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Adult&tissue_curation=BCR+TCR+repertoire&experiment.library_selection=PCR", "selected": false}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Adult&tissue_curation=BCR+TCR+repertoire", "results": [{"value": "SINGLE", "label": "SINGLE", "count": 35, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Adult&tissue_curation=BCR+TCR+repertoire&experiment.library_layout=SINGLE", "selected": false}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Adult&tissue_curation=BCR+TCR+repertoire", "results": [{"value": "LS454", "label": "LS454", "count": 35, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Adult&tissue_curation=BCR+TCR+repertoire&experiment.platform=LS454", "selected": false}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Adult&tissue_curation=BCR+TCR+repertoire", "results": [{"value": "Adult", "label": "Adult", "count": 35, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?tissue_curation=BCR+TCR+repertoire", "selected": true}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Adult&tissue_curation=BCR+TCR+repertoire", "results": [{"value": "Adult", "label": "Adult", "count": 35, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Adult&tissue_curation=BCR+TCR+repertoire&devstage_curation=Adult", "selected": false}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Adult&tissue_curation=BCR+TCR+repertoire", "results": [{"value": "Hematopoietic System", "label": "Hematopoietic System", "count": 35, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Adult&tissue_curation=BCR+TCR+repertoire&tissue_curation_coarse=Hematopoietic+System", "selected": false}], "truncated": false}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Adult&tissue_curation=BCR+TCR+repertoire", "results": [{"value": "BCR TCR repertoire", "label": "BCR TCR repertoire", "count": 35, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Adult", "selected": true}], "truncated": false}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation_coarse=Adult&tissue_curation=BCR+TCR+repertoire", "results": [{"value": "454", "label": "454", "count": 35, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation_coarse=Adult&tissue_curation=BCR+TCR+repertoire&technology=454", "selected": false}], "truncated": false}}, "suggested_facets": [], "next": null, "next_url": null, "private": false, "allow_execute_sql": true, "query_ms": 101.74879899568623}