{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where devstage_curation = \"Undetermined\" and tissue_curation_coarse = \"Hematopoietic System\"", "rows": [[8092, "ERR2402432", "ERX2443286", "ERS2295360", "ERP107516", "PRJEB25583", "The transcriptome of Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos", "ena-STUDY-DPSQ-14-03-2018-19:09:10:340-151", "Other", "The zebrafish gene trap line qmc551 carries a gene trap transposon in intron 1 of the gene gfi1aa which a encodes a transcriptional repressor. The presence of the transposon interferes with the transcription of the gfi1aa gene during haematopoiesis. Despite the lack of Gfi1aa expression  primitive red blood cell development appears to be normal due to functional redundancy with a second gene called gfi1b. Loss of Gfi1aa and Gfi1b protein expression in embryos that are homozygous for qmc551 and injected with gfi1b morpholinos leads to maturation defects in primitive red blood cells. Here  we performed an RNA sequencing experiment to study the early programming of Gfi1aa and/or Gfi1b depleted primitive red blood cells. For this purpose  we made use of the gene trap's gfp reporter gene expression in the primitive red blood cells to isolate these cells by fluorescence activated cell sorting from either qmc551 heterozygous or homozygous 20 hpf embryos that were or were not injected with the gfi1b morpholinos at the one cell stage. Batches of 200 embryos were dissociated in a Liberase Blendzyme solution. GFP positive primitive red blood cells were isolated by fluorescence activated cell sorting. 3 samples of between 1700 and 4000 cells were collected per batch. Total RNA was isolated from the cells of each of the 4 x 3 samples Het1 3  HetMO1 3  Hom1 3 and HomMO1 3 and used to generate full length cDNA of polyadenylated transcripts. Following cDNA amplification and library preparation paired end 75 bp reads were generated on the Illumina NextSeq500 sequencing platform.", "ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 03 14", null, "Hom MO rep3", "Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos", "SAMEA104693977", "DPSQ", "ENA FIRST PUBLIC:2018 10 12T17:03:15Z|ENA LAST UPDATE:2018 03 14T19:09:14Z|External Id:SAMEA104693977|INSDC center name:DPSQ|INSDC first public:2018 10 12T17:03:15Z|INSDC last update:2018 03 14T19:09:14Z|INSDC status:public|Submitter Id:CM12|common name:zebrafish|sample name:CM12|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "NextSeq 500 paired end sequencing", "ena EXPERIMENT DPSQ 14 03 2018 19:09:09:420 12", "unspecified", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "PAIRED", "ILLUMINA", "NextSeq 500", null, "ERP107516", "NextSeq 500 paired end sequencing", "ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 11 16", "CM12.trimmed.read_1.fastq.gz CM12.trimmed.read_2.fastq.gz", "fastq fastq", 5384061477.0, 38388598.0, "ena RUN DPSQ 14 03 2018 19:09:09:420 12", "0:70.70 1:69.55", "A:1490429493;C:1197976503;G:1220014984;T:1475615043;N:25454", 70, 69, null, null, 1490429493, 1197976503, 1220014984, 1475615043, 25454, "ERX2443286", "ERS2295360", "ERA1246315", "European Nucleotide Archive", "Deep Seq department, Centre for Genetics and Genomics, The University of Nottingham, United Kingdom", 2, 0.92285, 0.9206, 0.06862, 0.0688, 0.73983, 0.74566, 0.4752, 0.49125, 76, 75, "B", "B", "biological fallback assumption", "illumina", "nextseq", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2018-03-14", "Undetermined", "Embryo", "Blood", "Hematopoietic System"], [8093, "ERR2402431", "ERX2443285", "ERS2295359", "ERP107516", "PRJEB25583", "The transcriptome of Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos", "ena-STUDY-DPSQ-14-03-2018-19:09:10:340-151", "Other", "The zebrafish gene trap line qmc551 carries a gene trap transposon in intron 1 of the gene gfi1aa which a encodes a transcriptional repressor. The presence of the transposon interferes with the transcription of the gfi1aa gene during haematopoiesis. Despite the lack of Gfi1aa expression  primitive red blood cell development appears to be normal due to functional redundancy with a second gene called gfi1b. Loss of Gfi1aa and Gfi1b protein expression in embryos that are homozygous for qmc551 and injected with gfi1b morpholinos leads to maturation defects in primitive red blood cells. Here  we performed an RNA sequencing experiment to study the early programming of Gfi1aa and/or Gfi1b depleted primitive red blood cells. For this purpose  we made use of the gene trap's gfp reporter gene expression in the primitive red blood cells to isolate these cells by fluorescence activated cell sorting from either qmc551 heterozygous or homozygous 20 hpf embryos that were or were not injected with the gfi1b morpholinos at the one cell stage. Batches of 200 embryos were dissociated in a Liberase Blendzyme solution. GFP positive primitive red blood cells were isolated by fluorescence activated cell sorting. 3 samples of between 1700 and 4000 cells were collected per batch. Total RNA was isolated from the cells of each of the 4 x 3 samples Het1 3  HetMO1 3  Hom1 3 and HomMO1 3 and used to generate full length cDNA of polyadenylated transcripts. Following cDNA amplification and library preparation paired end 75 bp reads were generated on the Illumina NextSeq500 sequencing platform.", "ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 03 14", null, "Hom MO rep2", "Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos", "SAMEA104693976", "DPSQ", "ENA FIRST PUBLIC:2018 10 12T17:03:15Z|ENA LAST UPDATE:2018 03 14T19:09:14Z|External Id:SAMEA104693976|INSDC center name:DPSQ|INSDC first public:2018 10 12T17:03:15Z|INSDC last update:2018 03 14T19:09:14Z|INSDC status:public|Submitter Id:CM11|common name:zebrafish|sample name:CM11|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "NextSeq 500 paired end sequencing", "ena EXPERIMENT DPSQ 14 03 2018 19:09:09:420 11", "unspecified", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "PAIRED", "ILLUMINA", "NextSeq 500", null, "ERP107516", "NextSeq 500 paired end sequencing", "ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 11 16", "CM11.trimmed.read_1.fastq.gz CM11.trimmed.read_2.fastq.gz", "fastq fastq", 5472085589.0, 38860681.0, "ena RUN DPSQ 14 03 2018 19:09:09:420 11", "0:70.98 1:69.83", "A:1514986213;C:1217661004;G:1240412104;T:1499000816;N:25452", 70, 69, null, null, 1514986213, 1217661004, 1240412104, 1499000816, 25452, "ERX2443285", "ERS2295359", "ERA1246315", "European Nucleotide Archive", "Deep Seq department, Centre for Genetics and Genomics, The University of Nottingham, United Kingdom", 2, 0.91987, 0.91874, 0.0693, 0.07042, 0.74042, 0.74629, 0.48229, 0.49144, 76, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2018-03-14", "Undetermined", "Embryo", "Blood", "Hematopoietic System"], [8094, "ERR2402430", "ERX2443284", "ERS2295358", "ERP107516", "PRJEB25583", "The transcriptome of Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos", "ena-STUDY-DPSQ-14-03-2018-19:09:10:340-151", "Other", "The zebrafish gene trap line qmc551 carries a gene trap transposon in intron 1 of the gene gfi1aa which a encodes a transcriptional repressor. The presence of the transposon interferes with the transcription of the gfi1aa gene during haematopoiesis. Despite the lack of Gfi1aa expression  primitive red blood cell development appears to be normal due to functional redundancy with a second gene called gfi1b. Loss of Gfi1aa and Gfi1b protein expression in embryos that are homozygous for qmc551 and injected with gfi1b morpholinos leads to maturation defects in primitive red blood cells. Here  we performed an RNA sequencing experiment to study the early programming of Gfi1aa and/or Gfi1b depleted primitive red blood cells. For this purpose  we made use of the gene trap's gfp reporter gene expression in the primitive red blood cells to isolate these cells by fluorescence activated cell sorting from either qmc551 heterozygous or homozygous 20 hpf embryos that were or were not injected with the gfi1b morpholinos at the one cell stage. Batches of 200 embryos were dissociated in a Liberase Blendzyme solution. GFP positive primitive red blood cells were isolated by fluorescence activated cell sorting. 3 samples of between 1700 and 4000 cells were collected per batch. Total RNA was isolated from the cells of each of the 4 x 3 samples Het1 3  HetMO1 3  Hom1 3 and HomMO1 3 and used to generate full length cDNA of polyadenylated transcripts. Following cDNA amplification and library preparation paired end 75 bp reads were generated on the Illumina NextSeq500 sequencing platform.", "ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 03 14", null, "Hom MO rep1", "Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos", "SAMEA104693975", "DPSQ", "ENA FIRST PUBLIC:2018 10 12T17:03:15Z|ENA LAST UPDATE:2018 03 14T19:09:14Z|External Id:SAMEA104693975|INSDC center name:DPSQ|INSDC first public:2018 10 12T17:03:15Z|INSDC last update:2018 03 14T19:09:14Z|INSDC status:public|Submitter Id:CM10|common name:zebrafish|sample name:CM10|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "NextSeq 500 paired end sequencing", "ena EXPERIMENT DPSQ 14 03 2018 19:09:09:420 10", "unspecified", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "PAIRED", "ILLUMINA", "NextSeq 500", null, "ERP107516", "NextSeq 500 paired end sequencing", "ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 11 16", "CM10.trimmed.read_1.fastq.gz CM10.trimmed.read_2.fastq.gz", "fastq fastq", 6091085806.0, 43064771.0, "ena RUN DPSQ 14 03 2018 19:09:09:420 10", "0:71.33 1:70.11", "A:1692450462;C:1348639943;G:1375433963;T:1674532019;N:29419", 71, 70, null, null, 1692450462, 1348639943, 1375433963, 1674532019, 29419, "ERX2443284", "ERS2295358", "ERA1246315", "European Nucleotide Archive", "Deep Seq department, Centre for Genetics and Genomics, The University of Nottingham, United Kingdom", 2, 0.92184, 0.92064, 0.0699, 0.0704, 0.74286, 0.74874, 0.48978, 0.48997, 75, 73, "B", "B", "biological fallback assumption", "illumina", "nextseq", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2018-03-14", "Undetermined", "Embryo", "Blood", "Hematopoietic System"], [8095, "ERR2402429", "ERX2443283", "ERS2295357", "ERP107516", "PRJEB25583", "The transcriptome of Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos", "ena-STUDY-DPSQ-14-03-2018-19:09:10:340-151", "Other", "The zebrafish gene trap line qmc551 carries a gene trap transposon in intron 1 of the gene gfi1aa which a encodes a transcriptional repressor. The presence of the transposon interferes with the transcription of the gfi1aa gene during haematopoiesis. Despite the lack of Gfi1aa expression  primitive red blood cell development appears to be normal due to functional redundancy with a second gene called gfi1b. Loss of Gfi1aa and Gfi1b protein expression in embryos that are homozygous for qmc551 and injected with gfi1b morpholinos leads to maturation defects in primitive red blood cells. Here  we performed an RNA sequencing experiment to study the early programming of Gfi1aa and/or Gfi1b depleted primitive red blood cells. For this purpose  we made use of the gene trap's gfp reporter gene expression in the primitive red blood cells to isolate these cells by fluorescence activated cell sorting from either qmc551 heterozygous or homozygous 20 hpf embryos that were or were not injected with the gfi1b morpholinos at the one cell stage. Batches of 200 embryos were dissociated in a Liberase Blendzyme solution. GFP positive primitive red blood cells were isolated by fluorescence activated cell sorting. 3 samples of between 1700 and 4000 cells were collected per batch. Total RNA was isolated from the cells of each of the 4 x 3 samples Het1 3  HetMO1 3  Hom1 3 and HomMO1 3 and used to generate full length cDNA of polyadenylated transcripts. Following cDNA amplification and library preparation paired end 75 bp reads were generated on the Illumina NextSeq500 sequencing platform.", "ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 03 14", null, "Hom uninj rep3", "Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos", "SAMEA104693974", "DPSQ", "ENA FIRST PUBLIC:2018 10 12T17:03:15Z|ENA LAST UPDATE:2018 03 14T19:09:14Z|External Id:SAMEA104693974|INSDC center name:DPSQ|INSDC first public:2018 10 12T17:03:15Z|INSDC last update:2018 03 14T19:09:14Z|INSDC status:public|Submitter Id:CM9|common name:zebrafish|sample name:CM9|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "NextSeq 500 paired end sequencing", "ena EXPERIMENT DPSQ 14 03 2018 19:09:09:420 9", "unspecified", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "PAIRED", "ILLUMINA", "NextSeq 500", null, "ERP107516", "NextSeq 500 paired end sequencing", "ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 11 16", "CM9.trimmed.read_1.fastq.gz CM9.trimmed.read_2.fastq.gz", "fastq fastq", 6329252570.0, 45070159.0, "ena RUN DPSQ 14 03 2018 19:09:09:420 9", "0:70.79 1:69.64", "A:1753489708;C:1407193617;G:1433449502;T:1735090181;N:29562", 70, 69, null, null, 1753489708, 1407193617, 1433449502, 1735090181, 29562, "ERX2443283", "ERS2295357", "ERA1246315", "European Nucleotide Archive", "Deep Seq department, Centre for Genetics and Genomics, The University of Nottingham, United Kingdom", 2, 0.91683, 0.91616, 0.06775, 0.06825, 0.75158, 0.75737, 0.49386, 0.49199, 76, 75, "B", "B", "biological fallback assumption", "illumina", "nextseq", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2018-03-14", "Undetermined", "Embryo", "Blood", "Hematopoietic System"], [8096, "ERR2402428", "ERX2443282", "ERS2295356", "ERP107516", "PRJEB25583", "The transcriptome of Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos", "ena-STUDY-DPSQ-14-03-2018-19:09:10:340-151", "Other", "The zebrafish gene trap line qmc551 carries a gene trap transposon in intron 1 of the gene gfi1aa which a encodes a transcriptional repressor. The presence of the transposon interferes with the transcription of the gfi1aa gene during haematopoiesis. Despite the lack of Gfi1aa expression  primitive red blood cell development appears to be normal due to functional redundancy with a second gene called gfi1b. Loss of Gfi1aa and Gfi1b protein expression in embryos that are homozygous for qmc551 and injected with gfi1b morpholinos leads to maturation defects in primitive red blood cells. Here  we performed an RNA sequencing experiment to study the early programming of Gfi1aa and/or Gfi1b depleted primitive red blood cells. For this purpose  we made use of the gene trap's gfp reporter gene expression in the primitive red blood cells to isolate these cells by fluorescence activated cell sorting from either qmc551 heterozygous or homozygous 20 hpf embryos that were or were not injected with the gfi1b morpholinos at the one cell stage. Batches of 200 embryos were dissociated in a Liberase Blendzyme solution. GFP positive primitive red blood cells were isolated by fluorescence activated cell sorting. 3 samples of between 1700 and 4000 cells were collected per batch. Total RNA was isolated from the cells of each of the 4 x 3 samples Het1 3  HetMO1 3  Hom1 3 and HomMO1 3 and used to generate full length cDNA of polyadenylated transcripts. Following cDNA amplification and library preparation paired end 75 bp reads were generated on the Illumina NextSeq500 sequencing platform.", "ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 03 14", null, "Hom uninj rep2", "Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos", "SAMEA104693973", "DPSQ", "ENA FIRST PUBLIC:2018 10 12T17:03:15Z|ENA LAST UPDATE:2018 03 14T19:09:14Z|External Id:SAMEA104693973|INSDC center name:DPSQ|INSDC first public:2018 10 12T17:03:15Z|INSDC last update:2018 03 14T19:09:14Z|INSDC status:public|Submitter Id:CM8|common name:zebrafish|sample name:CM8|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "NextSeq 500 paired end sequencing", "ena EXPERIMENT DPSQ 14 03 2018 19:09:09:420 8", "unspecified", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "PAIRED", "ILLUMINA", "NextSeq 500", null, "ERP107516", "NextSeq 500 paired end sequencing", "ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 11 16", "CM8.trimmed.read_1.fastq.gz CM8.trimmed.read_2.fastq.gz", "fastq fastq", 5405185494.0, 38637007.0, "ena RUN DPSQ 14 03 2018 19:09:09:420 8", "0:70.45 1:69.44", "A:1491577735;C:1206599147;G:1229354248;T:1477628006;N:26358", 70, 69, null, null, 1491577735, 1206599147, 1229354248, 1477628006, 26358, "ERX2443282", "ERS2295356", "ERA1246315", "European Nucleotide Archive", "Deep Seq department, Centre for Genetics and Genomics, The University of Nottingham, United Kingdom", 2, 0.91776, 0.91567, 0.07134, 0.07241, 0.7517, 0.75716, 0.47952, 0.48745, 73, 73, "B", "B", "biological fallback assumption", "illumina", "nextseq", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2018-03-14", "Undetermined", "Embryo", "Blood", "Hematopoietic System"], [8097, "ERR2402427", "ERX2443281", "ERS2295355", "ERP107516", "PRJEB25583", "The transcriptome of Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos", "ena-STUDY-DPSQ-14-03-2018-19:09:10:340-151", "Other", "The zebrafish gene trap line qmc551 carries a gene trap transposon in intron 1 of the gene gfi1aa which a encodes a transcriptional repressor. The presence of the transposon interferes with the transcription of the gfi1aa gene during haematopoiesis. Despite the lack of Gfi1aa expression  primitive red blood cell development appears to be normal due to functional redundancy with a second gene called gfi1b. Loss of Gfi1aa and Gfi1b protein expression in embryos that are homozygous for qmc551 and injected with gfi1b morpholinos leads to maturation defects in primitive red blood cells. Here  we performed an RNA sequencing experiment to study the early programming of Gfi1aa and/or Gfi1b depleted primitive red blood cells. For this purpose  we made use of the gene trap's gfp reporter gene expression in the primitive red blood cells to isolate these cells by fluorescence activated cell sorting from either qmc551 heterozygous or homozygous 20 hpf embryos that were or were not injected with the gfi1b morpholinos at the one cell stage. Batches of 200 embryos were dissociated in a Liberase Blendzyme solution. GFP positive primitive red blood cells were isolated by fluorescence activated cell sorting. 3 samples of between 1700 and 4000 cells were collected per batch. Total RNA was isolated from the cells of each of the 4 x 3 samples Het1 3  HetMO1 3  Hom1 3 and HomMO1 3 and used to generate full length cDNA of polyadenylated transcripts. Following cDNA amplification and library preparation paired end 75 bp reads were generated on the Illumina NextSeq500 sequencing platform.", "ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 03 14", null, "Hom uninj rep1", "Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos", "SAMEA104693972", "DPSQ", "ENA FIRST PUBLIC:2018 10 12T17:03:15Z|ENA LAST UPDATE:2018 03 14T19:09:14Z|External Id:SAMEA104693972|INSDC center name:DPSQ|INSDC first public:2018 10 12T17:03:15Z|INSDC last update:2018 03 14T19:09:14Z|INSDC status:public|Submitter Id:CM7|common name:zebrafish|sample name:CM7|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "NextSeq 500 paired end sequencing", "ena EXPERIMENT DPSQ 14 03 2018 19:09:09:420 7", "unspecified", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "PAIRED", "ILLUMINA", "NextSeq 500", null, "ERP107516", "NextSeq 500 paired end sequencing", "ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 11 16", "CM7.trimmed.read_1.fastq.gz CM7.trimmed.read_2.fastq.gz", "fastq fastq", 6262947202.0, 44863127.0, "ena RUN DPSQ 14 03 2018 19:09:09:420 7", "0:70.28 1:69.32", "A:1732018658;C:1394742098;G:1420957611;T:1715198292;N:30543", 70, 69, null, null, 1732018658, 1394742098, 1420957611, 1715198292, 30543, "ERX2443281", "ERS2295355", "ERA1246315", "European Nucleotide Archive", "Deep Seq department, Centre for Genetics and Genomics, The University of Nottingham, United Kingdom", 2, 0.91622, 0.9144, 0.0754, 0.07588, 0.74886, 0.75371, 0.48672, 0.48471, 76, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2018-03-14", "Undetermined", "Embryo", "Blood", "Hematopoietic System"], [8098, "ERR2402426", "ERX2443280", "ERS2295354", "ERP107516", "PRJEB25583", "The transcriptome of Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos", "ena-STUDY-DPSQ-14-03-2018-19:09:10:340-151", "Other", "The zebrafish gene trap line qmc551 carries a gene trap transposon in intron 1 of the gene gfi1aa which a encodes a transcriptional repressor. The presence of the transposon interferes with the transcription of the gfi1aa gene during haematopoiesis. Despite the lack of Gfi1aa expression  primitive red blood cell development appears to be normal due to functional redundancy with a second gene called gfi1b. Loss of Gfi1aa and Gfi1b protein expression in embryos that are homozygous for qmc551 and injected with gfi1b morpholinos leads to maturation defects in primitive red blood cells. Here  we performed an RNA sequencing experiment to study the early programming of Gfi1aa and/or Gfi1b depleted primitive red blood cells. For this purpose  we made use of the gene trap's gfp reporter gene expression in the primitive red blood cells to isolate these cells by fluorescence activated cell sorting from either qmc551 heterozygous or homozygous 20 hpf embryos that were or were not injected with the gfi1b morpholinos at the one cell stage. Batches of 200 embryos were dissociated in a Liberase Blendzyme solution. GFP positive primitive red blood cells were isolated by fluorescence activated cell sorting. 3 samples of between 1700 and 4000 cells were collected per batch. Total RNA was isolated from the cells of each of the 4 x 3 samples Het1 3  HetMO1 3  Hom1 3 and HomMO1 3 and used to generate full length cDNA of polyadenylated transcripts. Following cDNA amplification and library preparation paired end 75 bp reads were generated on the Illumina NextSeq500 sequencing platform.", "ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 03 14", null, "Het MO rep3", "Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos", "SAMEA104693971", "DPSQ", "ENA FIRST PUBLIC:2018 10 12T17:03:15Z|ENA LAST UPDATE:2018 03 14T19:09:14Z|External Id:SAMEA104693971|INSDC center name:DPSQ|INSDC first public:2018 10 12T17:03:15Z|INSDC last update:2018 03 14T19:09:14Z|INSDC status:public|Submitter Id:CM6|common name:zebrafish|sample name:CM6|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "NextSeq 500 paired end sequencing", "ena EXPERIMENT DPSQ 14 03 2018 19:09:09:420 6", "unspecified", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "PAIRED", "ILLUMINA", "NextSeq 500", null, "ERP107516", "NextSeq 500 paired end sequencing", "ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 11 16", "CM6.trimmed.read_1.fastq.gz CM6.trimmed.read_2.fastq.gz", "fastq fastq", 5819615834.0, 41591499.0, "ena RUN DPSQ 14 03 2018 19:09:09:420 6", "0:70.47 1:69.45", "A:1594833553;C:1309877713;G:1335153588;T:1579722744;N:28236", 70, 69, null, null, 1594833553, 1309877713, 1335153588, 1579722744, 28236, "ERX2443280", "ERS2295354", "ERA1246315", "European Nucleotide Archive", "Deep Seq department, Centre for Genetics and Genomics, The University of Nottingham, United Kingdom", 2, 0.92, 0.9183, 0.0573, 0.05793, 0.77362, 0.778, 0.47792, 0.46987, 76, 75, "B", "B", "biological fallback assumption", "illumina", "nextseq", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2018-03-14", "Undetermined", "Embryo", "Blood", "Hematopoietic System"], [8099, "ERR2402425", "ERX2443279", "ERS2295353", "ERP107516", "PRJEB25583", "The transcriptome of Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos", "ena-STUDY-DPSQ-14-03-2018-19:09:10:340-151", "Other", "The zebrafish gene trap line qmc551 carries a gene trap transposon in intron 1 of the gene gfi1aa which a encodes a transcriptional repressor. The presence of the transposon interferes with the transcription of the gfi1aa gene during haematopoiesis. Despite the lack of Gfi1aa expression  primitive red blood cell development appears to be normal due to functional redundancy with a second gene called gfi1b. Loss of Gfi1aa and Gfi1b protein expression in embryos that are homozygous for qmc551 and injected with gfi1b morpholinos leads to maturation defects in primitive red blood cells. Here  we performed an RNA sequencing experiment to study the early programming of Gfi1aa and/or Gfi1b depleted primitive red blood cells. For this purpose  we made use of the gene trap's gfp reporter gene expression in the primitive red blood cells to isolate these cells by fluorescence activated cell sorting from either qmc551 heterozygous or homozygous 20 hpf embryos that were or were not injected with the gfi1b morpholinos at the one cell stage. Batches of 200 embryos were dissociated in a Liberase Blendzyme solution. GFP positive primitive red blood cells were isolated by fluorescence activated cell sorting. 3 samples of between 1700 and 4000 cells were collected per batch. Total RNA was isolated from the cells of each of the 4 x 3 samples Het1 3  HetMO1 3  Hom1 3 and HomMO1 3 and used to generate full length cDNA of polyadenylated transcripts. Following cDNA amplification and library preparation paired end 75 bp reads were generated on the Illumina NextSeq500 sequencing platform.", "ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 03 14", null, "Het MO rep2", "Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos", "SAMEA104693970", "DPSQ", "ENA FIRST PUBLIC:2018 10 12T17:03:15Z|ENA LAST UPDATE:2018 03 14T19:09:14Z|External Id:SAMEA104693970|INSDC center name:DPSQ|INSDC first public:2018 10 12T17:03:15Z|INSDC last update:2018 03 14T19:09:14Z|INSDC status:public|Submitter Id:CM5|common name:zebrafish|sample name:CM5|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "NextSeq 500 paired end sequencing", "ena EXPERIMENT DPSQ 14 03 2018 19:09:09:420 5", "unspecified", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "PAIRED", "ILLUMINA", "NextSeq 500", null, "ERP107516", "NextSeq 500 paired end sequencing", "ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 11 16", "CM5.trimmed.read_1.fastq.gz CM5.trimmed.read_2.fastq.gz", "fastq fastq", 5573895202.0, 39518227.0, "ena RUN DPSQ 14 03 2018 19:09:09:420 5", "0:71.02 1:70.03", "A:1530297250;C:1251775796;G:1276506882;T:1515288256;N:27018", 71, 70, null, null, 1530297250, 1251775796, 1276506882, 1515288256, 27018, "ERX2443279", "ERS2295353", "ERA1246315", "European Nucleotide Archive", "Deep Seq department, Centre for Genetics and Genomics, The University of Nottingham, United Kingdom", 2, 0.92217, 0.92081, 0.06807, 0.06843, 0.76926, 0.77441, 0.45543, 0.48098, 76, 75, "B", "B", "biological fallback assumption", "illumina", "nextseq", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2018-03-14", "Undetermined", "Embryo", "Blood", "Hematopoietic System"], [8100, "ERR2402424", "ERX2443278", "ERS2295352", "ERP107516", "PRJEB25583", "The transcriptome of Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos", "ena-STUDY-DPSQ-14-03-2018-19:09:10:340-151", "Other", "The zebrafish gene trap line qmc551 carries a gene trap transposon in intron 1 of the gene gfi1aa which a encodes a transcriptional repressor. The presence of the transposon interferes with the transcription of the gfi1aa gene during haematopoiesis. Despite the lack of Gfi1aa expression  primitive red blood cell development appears to be normal due to functional redundancy with a second gene called gfi1b. Loss of Gfi1aa and Gfi1b protein expression in embryos that are homozygous for qmc551 and injected with gfi1b morpholinos leads to maturation defects in primitive red blood cells. Here  we performed an RNA sequencing experiment to study the early programming of Gfi1aa and/or Gfi1b depleted primitive red blood cells. For this purpose  we made use of the gene trap's gfp reporter gene expression in the primitive red blood cells to isolate these cells by fluorescence activated cell sorting from either qmc551 heterozygous or homozygous 20 hpf embryos that were or were not injected with the gfi1b morpholinos at the one cell stage. Batches of 200 embryos were dissociated in a Liberase Blendzyme solution. GFP positive primitive red blood cells were isolated by fluorescence activated cell sorting. 3 samples of between 1700 and 4000 cells were collected per batch. Total RNA was isolated from the cells of each of the 4 x 3 samples Het1 3  HetMO1 3  Hom1 3 and HomMO1 3 and used to generate full length cDNA of polyadenylated transcripts. Following cDNA amplification and library preparation paired end 75 bp reads were generated on the Illumina NextSeq500 sequencing platform.", "ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 03 14", null, "Het MO rep1", "Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos", "SAMEA104693969", "DPSQ", "ENA FIRST PUBLIC:2018 10 12T17:03:15Z|ENA LAST UPDATE:2018 03 14T19:09:14Z|External Id:SAMEA104693969|INSDC center name:DPSQ|INSDC first public:2018 10 12T17:03:15Z|INSDC last update:2018 03 14T19:09:14Z|INSDC status:public|Submitter Id:CM4|common name:zebrafish|sample name:CM4|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "NextSeq 500 paired end sequencing", "ena EXPERIMENT DPSQ 14 03 2018 19:09:09:420 4", "unspecified", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "PAIRED", "ILLUMINA", "NextSeq 500", null, "ERP107516", "NextSeq 500 paired end sequencing", "ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 11 16", "CM4.trimmed.read_1.fastq.gz CM4.trimmed.read_2.fastq.gz", "fastq fastq", 5803404091.0, 41335851.0, "ena RUN DPSQ 14 03 2018 19:09:09:420 4", "0:70.72 1:69.67", "A:1590577583;C:1305683925;G:1331895549;T:1575219146;N:27888", 70, 69, null, null, 1590577583, 1305683925, 1331895549, 1575219146, 27888, "ERX2443278", "ERS2295352", "ERA1246315", "European Nucleotide Archive", "Deep Seq department, Centre for Genetics and Genomics, The University of Nottingham, United Kingdom", 2, 0.9216, 0.91971, 0.05719, 0.05738, 0.77333, 0.77761, 0.47789, 0.47244, 76, 74, "B", "B", "biological fallback assumption", "illumina", "nextseq", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2018-03-14", "Undetermined", "Embryo", "Blood", "Hematopoietic System"], [8101, "ERR2402423", "ERX2443277", "ERS2295351", "ERP107516", "PRJEB25583", "The transcriptome of Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos", "ena-STUDY-DPSQ-14-03-2018-19:09:10:340-151", "Other", "The zebrafish gene trap line qmc551 carries a gene trap transposon in intron 1 of the gene gfi1aa which a encodes a transcriptional repressor. The presence of the transposon interferes with the transcription of the gfi1aa gene during haematopoiesis. Despite the lack of Gfi1aa expression  primitive red blood cell development appears to be normal due to functional redundancy with a second gene called gfi1b. Loss of Gfi1aa and Gfi1b protein expression in embryos that are homozygous for qmc551 and injected with gfi1b morpholinos leads to maturation defects in primitive red blood cells. Here  we performed an RNA sequencing experiment to study the early programming of Gfi1aa and/or Gfi1b depleted primitive red blood cells. For this purpose  we made use of the gene trap's gfp reporter gene expression in the primitive red blood cells to isolate these cells by fluorescence activated cell sorting from either qmc551 heterozygous or homozygous 20 hpf embryos that were or were not injected with the gfi1b morpholinos at the one cell stage. Batches of 200 embryos were dissociated in a Liberase Blendzyme solution. GFP positive primitive red blood cells were isolated by fluorescence activated cell sorting. 3 samples of between 1700 and 4000 cells were collected per batch. Total RNA was isolated from the cells of each of the 4 x 3 samples Het1 3  HetMO1 3  Hom1 3 and HomMO1 3 and used to generate full length cDNA of polyadenylated transcripts. Following cDNA amplification and library preparation paired end 75 bp reads were generated on the Illumina NextSeq500 sequencing platform.", "ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 03 14", null, "Het uninj rep3", "Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos", "SAMEA104693968", "DPSQ", "ENA FIRST PUBLIC:2018 10 12T17:03:15Z|ENA LAST UPDATE:2018 03 14T19:09:14Z|External Id:SAMEA104693968|INSDC center name:DPSQ|INSDC first public:2018 10 12T17:03:15Z|INSDC last update:2018 03 14T19:09:14Z|INSDC status:public|Submitter Id:CM3|common name:zebrafish|sample name:CM3|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "NextSeq 500 paired end sequencing", "ena EXPERIMENT DPSQ 14 03 2018 19:09:09:420 3", "unspecified", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "PAIRED", "ILLUMINA", "NextSeq 500", null, "ERP107516", "NextSeq 500 paired end sequencing", "ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 11 16", "CM3.trimmed.read_1.fastq.gz CM3.trimmed.read_2.fastq.gz", "fastq fastq", 5992797058.0, 42390223.0, "ena RUN DPSQ 14 03 2018 19:09:09:420 3", "0:71.26 1:70.11", "A:1639390320;C:1352082344;G:1378624207;T:1622672043;N:28144", 71, 70, null, null, 1639390320, 1352082344, 1378624207, 1622672043, 28144, "ERX2443277", "ERS2295351", "ERA1246315", "European Nucleotide Archive", "Deep Seq department, Centre for Genetics and Genomics, The University of Nottingham, United Kingdom", 2, 0.92104, 0.92006, 0.07044, 0.07056, 0.77506, 0.78137, 0.48154, 0.46497, 75, 75, "B", "B", "biological fallback assumption", "illumina", "nextseq", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2018-03-14", "Undetermined", "Embryo", "Blood", "Hematopoietic System"], [8102, "ERR2402422", "ERX2443276", "ERS2295350", "ERP107516", "PRJEB25583", "The transcriptome of Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos", "ena-STUDY-DPSQ-14-03-2018-19:09:10:340-151", "Other", "The zebrafish gene trap line qmc551 carries a gene trap transposon in intron 1 of the gene gfi1aa which a encodes a transcriptional repressor. The presence of the transposon interferes with the transcription of the gfi1aa gene during haematopoiesis. Despite the lack of Gfi1aa expression  primitive red blood cell development appears to be normal due to functional redundancy with a second gene called gfi1b. Loss of Gfi1aa and Gfi1b protein expression in embryos that are homozygous for qmc551 and injected with gfi1b morpholinos leads to maturation defects in primitive red blood cells. Here  we performed an RNA sequencing experiment to study the early programming of Gfi1aa and/or Gfi1b depleted primitive red blood cells. For this purpose  we made use of the gene trap's gfp reporter gene expression in the primitive red blood cells to isolate these cells by fluorescence activated cell sorting from either qmc551 heterozygous or homozygous 20 hpf embryos that were or were not injected with the gfi1b morpholinos at the one cell stage. Batches of 200 embryos were dissociated in a Liberase Blendzyme solution. GFP positive primitive red blood cells were isolated by fluorescence activated cell sorting. 3 samples of between 1700 and 4000 cells were collected per batch. Total RNA was isolated from the cells of each of the 4 x 3 samples Het1 3  HetMO1 3  Hom1 3 and HomMO1 3 and used to generate full length cDNA of polyadenylated transcripts. Following cDNA amplification and library preparation paired end 75 bp reads were generated on the Illumina NextSeq500 sequencing platform.", "ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 03 14", null, "Het uninj rep2", "Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos", "SAMEA104693967", "DPSQ", "ENA FIRST PUBLIC:2018 10 12T17:03:15Z|ENA LAST UPDATE:2018 03 14T19:09:14Z|External Id:SAMEA104693967|INSDC center name:DPSQ|INSDC first public:2018 10 12T17:03:15Z|INSDC last update:2018 03 14T19:09:14Z|INSDC status:public|Submitter Id:CM2|common name:zebrafish|sample name:CM2|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "NextSeq 500 paired end sequencing", "ena EXPERIMENT DPSQ 14 03 2018 19:09:09:420 2", "unspecified", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "PAIRED", "ILLUMINA", "NextSeq 500", null, "ERP107516", "NextSeq 500 paired end sequencing", "ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 11 16", "CM2.trimmed.read_2.fastq.gz CM2.trimmed.read_1.fastq.gz", "fastq fastq", 5611396868.0, 39759688.0, "ena RUN DPSQ 14 03 2018 19:09:09:420 2", "0:71.11 1:70.02", "A:1537234166;C:1262883447;G:1288444384;T:1522807333;N:27538", 71, 70, null, null, 1537234166, 1262883447, 1288444384, 1522807333, 27538, "ERX2443276", "ERS2295350", "ERA1246315", "European Nucleotide Archive", "Deep Seq department, Centre for Genetics and Genomics, The University of Nottingham, United Kingdom", 2, 0.91881, 0.91733, 0.06861, 0.06958, 0.77238, 0.77883, 0.48415, 0.47367, 76, 73, "B", "B", "biological fallback assumption", "illumina", "nextseq", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2018-03-14", "Undetermined", "Embryo", "Blood", "Hematopoietic System"], [8103, "ERR2402421", "ERX2443275", "ERS2295349", "ERP107516", "PRJEB25583", "The transcriptome of Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos", "ena-STUDY-DPSQ-14-03-2018-19:09:10:340-151", "Other", "The zebrafish gene trap line qmc551 carries a gene trap transposon in intron 1 of the gene gfi1aa which a encodes a transcriptional repressor. The presence of the transposon interferes with the transcription of the gfi1aa gene during haematopoiesis. Despite the lack of Gfi1aa expression  primitive red blood cell development appears to be normal due to functional redundancy with a second gene called gfi1b. Loss of Gfi1aa and Gfi1b protein expression in embryos that are homozygous for qmc551 and injected with gfi1b morpholinos leads to maturation defects in primitive red blood cells. Here  we performed an RNA sequencing experiment to study the early programming of Gfi1aa and/or Gfi1b depleted primitive red blood cells. For this purpose  we made use of the gene trap's gfp reporter gene expression in the primitive red blood cells to isolate these cells by fluorescence activated cell sorting from either qmc551 heterozygous or homozygous 20 hpf embryos that were or were not injected with the gfi1b morpholinos at the one cell stage. Batches of 200 embryos were dissociated in a Liberase Blendzyme solution. GFP positive primitive red blood cells were isolated by fluorescence activated cell sorting. 3 samples of between 1700 and 4000 cells were collected per batch. Total RNA was isolated from the cells of each of the 4 x 3 samples Het1 3  HetMO1 3  Hom1 3 and HomMO1 3 and used to generate full length cDNA of polyadenylated transcripts. Following cDNA amplification and library preparation paired end 75 bp reads were generated on the Illumina NextSeq500 sequencing platform.", "ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 03 14", null, "Het uninj rep1", "Gfi1aa and/or Gfi1b depleted primitive red blood cells in zebrafish embryos", "SAMEA104693966", "DPSQ", "ENA FIRST PUBLIC:2018 10 12T17:03:15Z|ENA LAST UPDATE:2018 03 14T19:09:14Z|External Id:SAMEA104693966|INSDC center name:DPSQ|INSDC first public:2018 10 12T17:03:15Z|INSDC last update:2018 03 14T19:09:14Z|INSDC status:public|Submitter Id:CM1|common name:zebrafish|sample name:CM1|scientific name:Danio rerio", null, null, null, null, null, null, null, null, "NextSeq 500 paired end sequencing", "ena EXPERIMENT DPSQ 14 03 2018 19:09:09:420 1", "unspecified", "1", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "PAIRED", "ILLUMINA", "NextSeq 500", null, "ERP107516", "NextSeq 500 paired end sequencing", "ENA FIRST PUBLIC:2018 10 12|ENA LAST UPDATE:2018 11 16", "CM1.trimmed.read_1.fastq.gz CM1.trimmed.read_2.fastq.gz", "fastq fastq", 6229432533.0, 44233290.0, "ena RUN DPSQ 14 03 2018 19:09:09:420 1", "0:70.98 1:69.85", "A:1712806281;C:1395764700;G:1423415860;T:1697416127;N:29565", 70, 69, null, null, 1712806281, 1395764700, 1423415860, 1697416127, 29565, "ERX2443275", "ERS2295349", "ERA1246315", "European Nucleotide Archive", "Deep Seq department, Centre for Genetics and Genomics, The University of Nottingham, United Kingdom", 2, 0.91818, 0.9169, 0.07104, 0.07095, 0.77585, 0.78066, 0.47896, 0.46653, 56, 56, "B", "B", "biological fallback assumption", "illumina", "nextseq", "full_length", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "United Kingdom", "2018-03-14", "Undetermined", "Embryo", "Blood", "Hematopoietic System"], [33158, "SRR29791088", "SRX25290435", "SRS21969151", "SRP519440", "PRJNA1134759", "Developmental trajectory and evolutionary origin of thymic mimetic cells  [dataset 2]", "GSE272064", "Transcriptome Analysis", "The generation of self tolerant repertoires of T cells depends on the expression of peripheral self antigens in the thymic epithelium  and the presence of small populations of cells mimicking the diverse phenotypes of peripheral tissues. Whereas the molecular underpinnings of self antigen expression have been extensively studied  the developmental origins and differentiation pathways of thymic mimetic cells remain to be identified. Moreover  the histological identification of myoid and other peripheral cell types as components of the thymic microenvironment of many vertebrate species raises questions as to the evolutionary origin of this unique tolerance mechanism. Here  we show that during mouse development  mimetic cells appear in the microenvironment in two successive waves. Cells exhibiting transcriptional signatures characteristic of muscle  ionocyte  goblet and ciliated cells emerge before birth  whereas others  for instance those mimicking enterohepatic cells and skin keratinocytes appear postnatally. These two groups also respond differently to modulations of TEC progenitor pools caused by deletions of Foxn1 and Ascl1  expression of a hypomorphic Foxn1 transcription factor  and overexpression of Bmp4 and Fgf7 signalling molecules. Differences in mimetic cell populations were also observed in thymic microenvironments reconstructed by replacement of mouse Foxn1 with evolutionarily ancient Foxn1/4 gene family members  including the Foxn4 gene of the cephalochordate amphioxus  and the Foxn4 and Foxn1 genes of a cartilaginous fish. Whereas some cell types  such as ciliated cells  develop in the thymus in the absence of Foxn1  mimetic cells appearing postnatally  such as enterohepatic cells  require the activity of the vertebrate specific transcription factor Foxn1. The thymus of cartilaginous fishes and the thymoid of lampreys  a representative of jawless vertebrates that exhibit an alternative adaptive immune system  also harbour cells expressing genes encoding peripheral tissue components  such as the liver specific protein transthyretin. Our findings suggest an evolutionary model of successive changes of thymic epithelial genetic networks enabling the coordinated contribution of peripheral antigen expression and mimetic cell formation to achieve central tolerance for vertebrate specific innovations of certain tissues  such as the liver. Overall design: Cells from whole thymic tissue from zebrafish were prepared  and subjected to bulk RNAseq. Foxn1+/+  samples and foxn1 /  samples were sequenced.", null, null, null, "Dr thymus foxn1 /  rep3", "GSM8392364", null, "source name:thymus|tissue:thymus|cell type:thymus cells|genotype:foxn1 / |geo loc name:missing|collection date:missing", "Dr thymus foxn1 /  rep3", "Transcriptomes were analyzed on the Galaxy platform. Adapters were trimmed with TrimGalore! version 0.4.3.1. Reads were aligned to the reference genome with Hisat2  version 2.1.0. Counts were generated with featureCounts version 1.6.1.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files containing raw counts for each sample", "thymus", null, "Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.", null, "tissue:thymus|cell type:thymus cells|genotype:foxn1 / ", "GSM8392364", "GSM8392364: Dr thymus foxn1 /  rep3; Danio rerio; RNA Seq", "GSM8392364 r1", "GSM8392364", "1", "Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP519440", null, null, "BK6_R1.fastq.gz BK6_R2.fastq.gz", "fastq fastq", 40416715568.0, 133830184.0, "GSM8392364 r1", "0:151 1:151", "A:11536946706;C:8490306261;G:9295609599;T:11092005423;N:1847579", 151, 151, null, null, 11536946706, 8490306261, 9295609599, 11092005423, 1847579, "SRX25290435", "SRS21969151", "SRA1922343", "Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics", "Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics", 2, 0.89276, 0.89283, 0.11419, 0.11482, 0.73306, 0.73409, 0.46305, 0.46571, 151, 151, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "nebnext", "bulk", "bulk", "bulk", null, "Germany", "2024-07-11", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [33159, "SRR29791089", "SRX25290434", "SRS21969152", "SRP519440", "PRJNA1134759", "Developmental trajectory and evolutionary origin of thymic mimetic cells  [dataset 2]", "GSE272064", "Transcriptome Analysis", "The generation of self tolerant repertoires of T cells depends on the expression of peripheral self antigens in the thymic epithelium  and the presence of small populations of cells mimicking the diverse phenotypes of peripheral tissues. Whereas the molecular underpinnings of self antigen expression have been extensively studied  the developmental origins and differentiation pathways of thymic mimetic cells remain to be identified. Moreover  the histological identification of myoid and other peripheral cell types as components of the thymic microenvironment of many vertebrate species raises questions as to the evolutionary origin of this unique tolerance mechanism. Here  we show that during mouse development  mimetic cells appear in the microenvironment in two successive waves. Cells exhibiting transcriptional signatures characteristic of muscle  ionocyte  goblet and ciliated cells emerge before birth  whereas others  for instance those mimicking enterohepatic cells and skin keratinocytes appear postnatally. These two groups also respond differently to modulations of TEC progenitor pools caused by deletions of Foxn1 and Ascl1  expression of a hypomorphic Foxn1 transcription factor  and overexpression of Bmp4 and Fgf7 signalling molecules. Differences in mimetic cell populations were also observed in thymic microenvironments reconstructed by replacement of mouse Foxn1 with evolutionarily ancient Foxn1/4 gene family members  including the Foxn4 gene of the cephalochordate amphioxus  and the Foxn4 and Foxn1 genes of a cartilaginous fish. Whereas some cell types  such as ciliated cells  develop in the thymus in the absence of Foxn1  mimetic cells appearing postnatally  such as enterohepatic cells  require the activity of the vertebrate specific transcription factor Foxn1. The thymus of cartilaginous fishes and the thymoid of lampreys  a representative of jawless vertebrates that exhibit an alternative adaptive immune system  also harbour cells expressing genes encoding peripheral tissue components  such as the liver specific protein transthyretin. Our findings suggest an evolutionary model of successive changes of thymic epithelial genetic networks enabling the coordinated contribution of peripheral antigen expression and mimetic cell formation to achieve central tolerance for vertebrate specific innovations of certain tissues  such as the liver. Overall design: Cells from whole thymic tissue from zebrafish were prepared  and subjected to bulk RNAseq. Foxn1+/+  samples and foxn1 /  samples were sequenced.", null, null, null, "Dr thymus foxn1 /  rep2", "GSM8392363", null, "source name:thymus|tissue:thymus|cell type:thymus cells|genotype:foxn1 / |geo loc name:missing|collection date:missing", "Dr thymus foxn1 /  rep2", "Transcriptomes were analyzed on the Galaxy platform. Adapters were trimmed with TrimGalore! version 0.4.3.1. Reads were aligned to the reference genome with Hisat2  version 2.1.0. Counts were generated with featureCounts version 1.6.1.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files containing raw counts for each sample", "thymus", null, "Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.", null, "tissue:thymus|cell type:thymus cells|genotype:foxn1 / ", "GSM8392363", "GSM8392363: Dr thymus foxn1 /  rep2; Danio rerio; RNA Seq", "GSM8392363 r1", "GSM8392363", "1", "Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP519440", null, null, "BK5_R1.fastq.gz BK5_R2.fastq.gz", "fastq fastq", 41734368446.0, 138193273.0, "GSM8392363 r1", "0:151 1:151", "A:12015023285;C:8850050726;G:9485443497;T:11381944831;N:1906107", 151, 151, null, null, 12015023285, 8850050726, 9485443497, 11381944831, 1906107, "SRX25290434", "SRS21969152", "SRA1922343", "Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics", "Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics", 2, 0.88856, 0.88918, 0.11978, 0.11946, 0.73003, 0.732, 0.44244, 0.43125, 151, 151, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "nebnext", "bulk", "bulk", "bulk", null, "Germany", "2024-07-11", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [33160, "SRR29791090", "SRX25290433", "SRS21969150", "SRP519440", "PRJNA1134759", "Developmental trajectory and evolutionary origin of thymic mimetic cells  [dataset 2]", "GSE272064", "Transcriptome Analysis", "The generation of self tolerant repertoires of T cells depends on the expression of peripheral self antigens in the thymic epithelium  and the presence of small populations of cells mimicking the diverse phenotypes of peripheral tissues. Whereas the molecular underpinnings of self antigen expression have been extensively studied  the developmental origins and differentiation pathways of thymic mimetic cells remain to be identified. Moreover  the histological identification of myoid and other peripheral cell types as components of the thymic microenvironment of many vertebrate species raises questions as to the evolutionary origin of this unique tolerance mechanism. Here  we show that during mouse development  mimetic cells appear in the microenvironment in two successive waves. Cells exhibiting transcriptional signatures characteristic of muscle  ionocyte  goblet and ciliated cells emerge before birth  whereas others  for instance those mimicking enterohepatic cells and skin keratinocytes appear postnatally. These two groups also respond differently to modulations of TEC progenitor pools caused by deletions of Foxn1 and Ascl1  expression of a hypomorphic Foxn1 transcription factor  and overexpression of Bmp4 and Fgf7 signalling molecules. Differences in mimetic cell populations were also observed in thymic microenvironments reconstructed by replacement of mouse Foxn1 with evolutionarily ancient Foxn1/4 gene family members  including the Foxn4 gene of the cephalochordate amphioxus  and the Foxn4 and Foxn1 genes of a cartilaginous fish. Whereas some cell types  such as ciliated cells  develop in the thymus in the absence of Foxn1  mimetic cells appearing postnatally  such as enterohepatic cells  require the activity of the vertebrate specific transcription factor Foxn1. The thymus of cartilaginous fishes and the thymoid of lampreys  a representative of jawless vertebrates that exhibit an alternative adaptive immune system  also harbour cells expressing genes encoding peripheral tissue components  such as the liver specific protein transthyretin. Our findings suggest an evolutionary model of successive changes of thymic epithelial genetic networks enabling the coordinated contribution of peripheral antigen expression and mimetic cell formation to achieve central tolerance for vertebrate specific innovations of certain tissues  such as the liver. Overall design: Cells from whole thymic tissue from zebrafish were prepared  and subjected to bulk RNAseq. Foxn1+/+  samples and foxn1 /  samples were sequenced.", null, null, null, "Dr thymus foxn1 /  rep1", "GSM8392362", null, "source name:thymus|tissue:thymus|cell type:thymus cells|genotype:foxn1 / |geo loc name:missing|collection date:missing", "Dr thymus foxn1 /  rep1", "Transcriptomes were analyzed on the Galaxy platform. Adapters were trimmed with TrimGalore! version 0.4.3.1. Reads were aligned to the reference genome with Hisat2  version 2.1.0. Counts were generated with featureCounts version 1.6.1.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files containing raw counts for each sample", "thymus", null, "Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.", null, "tissue:thymus|cell type:thymus cells|genotype:foxn1 / ", "GSM8392362", "GSM8392362: Dr thymus foxn1 /  rep1; Danio rerio; RNA Seq", "GSM8392362 r1", "GSM8392362", "1", "Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP519440", null, null, "BK4_R2.fastq.gz BK4_R1.fastq.gz", "fastq fastq", 39302001858.0, 130139079.0, "GSM8392362 r1", "0:151 1:151", "A:11220466966;C:8305776940;G:9105878447;T:10668104948;N:1774557", 151, 151, null, null, 11220466966, 8305776940, 9105878447, 10668104948, 1774557, "SRX25290433", "SRS21969150", "SRA1922343", "Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics", "Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics", 2, 0.89299, 0.89318, 0.11306, 0.1139, 0.74123, 0.74345, 0.45102, 0.46093, 151, 151, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "nebnext", "bulk", "bulk", "bulk", null, "Germany", "2024-07-11", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [33161, "SRR29791091", "SRX25290432", "SRS21969149", "SRP519440", "PRJNA1134759", "Developmental trajectory and evolutionary origin of thymic mimetic cells  [dataset 2]", "GSE272064", "Transcriptome Analysis", "The generation of self tolerant repertoires of T cells depends on the expression of peripheral self antigens in the thymic epithelium  and the presence of small populations of cells mimicking the diverse phenotypes of peripheral tissues. Whereas the molecular underpinnings of self antigen expression have been extensively studied  the developmental origins and differentiation pathways of thymic mimetic cells remain to be identified. Moreover  the histological identification of myoid and other peripheral cell types as components of the thymic microenvironment of many vertebrate species raises questions as to the evolutionary origin of this unique tolerance mechanism. Here  we show that during mouse development  mimetic cells appear in the microenvironment in two successive waves. Cells exhibiting transcriptional signatures characteristic of muscle  ionocyte  goblet and ciliated cells emerge before birth  whereas others  for instance those mimicking enterohepatic cells and skin keratinocytes appear postnatally. These two groups also respond differently to modulations of TEC progenitor pools caused by deletions of Foxn1 and Ascl1  expression of a hypomorphic Foxn1 transcription factor  and overexpression of Bmp4 and Fgf7 signalling molecules. Differences in mimetic cell populations were also observed in thymic microenvironments reconstructed by replacement of mouse Foxn1 with evolutionarily ancient Foxn1/4 gene family members  including the Foxn4 gene of the cephalochordate amphioxus  and the Foxn4 and Foxn1 genes of a cartilaginous fish. Whereas some cell types  such as ciliated cells  develop in the thymus in the absence of Foxn1  mimetic cells appearing postnatally  such as enterohepatic cells  require the activity of the vertebrate specific transcription factor Foxn1. The thymus of cartilaginous fishes and the thymoid of lampreys  a representative of jawless vertebrates that exhibit an alternative adaptive immune system  also harbour cells expressing genes encoding peripheral tissue components  such as the liver specific protein transthyretin. Our findings suggest an evolutionary model of successive changes of thymic epithelial genetic networks enabling the coordinated contribution of peripheral antigen expression and mimetic cell formation to achieve central tolerance for vertebrate specific innovations of certain tissues  such as the liver. Overall design: Cells from whole thymic tissue from zebrafish were prepared  and subjected to bulk RNAseq. Foxn1+/+  samples and foxn1 /  samples were sequenced.", null, null, null, "Dr thymus foxn1+/+ rep3", "GSM8392361", null, "source name:thymus|tissue:thymus|cell type:thymus cells|genotype:foxn1+/+|geo loc name:missing|collection date:missing", "Dr thymus foxn1+/+ rep3", "Transcriptomes were analyzed on the Galaxy platform. Adapters were trimmed with TrimGalore! version 0.4.3.1. Reads were aligned to the reference genome with Hisat2  version 2.1.0. Counts were generated with featureCounts version 1.6.1.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files containing raw counts for each sample", "thymus", null, "Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.", null, "tissue:thymus|cell type:thymus cells|genotype:foxn1+/+", "GSM8392361", "GSM8392361: Dr thymus foxn1+/+ rep3; Danio rerio; RNA Seq", "GSM8392361 r1", "GSM8392361", "1", "Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP519440", null, null, "BK3_R1.fastq.gz BK3_R2.fastq.gz", "fastq fastq", 37243022634.0, 123321267.0, "GSM8392361 r1", "0:151 1:151", "A:10858514997;C:7805630226;G:8359994769;T:10217208022;N:1674620", 151, 151, null, null, 10858514997, 7805630226, 8359994769, 10217208022, 1674620, "SRX25290432", "SRS21969149", "SRA1922343", "Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics", "Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics", 2, 0.87732, 0.87686, 0.20353, 0.20336, 0.73261, 0.7343, 0.49192, 0.4924, 151, 151, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "nebnext", "bulk", "bulk", "bulk", null, "Germany", "2024-07-11", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [33162, "SRR29791092", "SRX25290431", "SRS21969148", "SRP519440", "PRJNA1134759", "Developmental trajectory and evolutionary origin of thymic mimetic cells  [dataset 2]", "GSE272064", "Transcriptome Analysis", "The generation of self tolerant repertoires of T cells depends on the expression of peripheral self antigens in the thymic epithelium  and the presence of small populations of cells mimicking the diverse phenotypes of peripheral tissues. Whereas the molecular underpinnings of self antigen expression have been extensively studied  the developmental origins and differentiation pathways of thymic mimetic cells remain to be identified. Moreover  the histological identification of myoid and other peripheral cell types as components of the thymic microenvironment of many vertebrate species raises questions as to the evolutionary origin of this unique tolerance mechanism. Here  we show that during mouse development  mimetic cells appear in the microenvironment in two successive waves. Cells exhibiting transcriptional signatures characteristic of muscle  ionocyte  goblet and ciliated cells emerge before birth  whereas others  for instance those mimicking enterohepatic cells and skin keratinocytes appear postnatally. These two groups also respond differently to modulations of TEC progenitor pools caused by deletions of Foxn1 and Ascl1  expression of a hypomorphic Foxn1 transcription factor  and overexpression of Bmp4 and Fgf7 signalling molecules. Differences in mimetic cell populations were also observed in thymic microenvironments reconstructed by replacement of mouse Foxn1 with evolutionarily ancient Foxn1/4 gene family members  including the Foxn4 gene of the cephalochordate amphioxus  and the Foxn4 and Foxn1 genes of a cartilaginous fish. Whereas some cell types  such as ciliated cells  develop in the thymus in the absence of Foxn1  mimetic cells appearing postnatally  such as enterohepatic cells  require the activity of the vertebrate specific transcription factor Foxn1. The thymus of cartilaginous fishes and the thymoid of lampreys  a representative of jawless vertebrates that exhibit an alternative adaptive immune system  also harbour cells expressing genes encoding peripheral tissue components  such as the liver specific protein transthyretin. Our findings suggest an evolutionary model of successive changes of thymic epithelial genetic networks enabling the coordinated contribution of peripheral antigen expression and mimetic cell formation to achieve central tolerance for vertebrate specific innovations of certain tissues  such as the liver. Overall design: Cells from whole thymic tissue from zebrafish were prepared  and subjected to bulk RNAseq. Foxn1+/+  samples and foxn1 /  samples were sequenced.", null, null, null, "Dr thymus foxn1+/+ rep2", "GSM8392360", null, "source name:thymus|tissue:thymus|cell type:thymus cells|genotype:foxn1+/+|geo loc name:missing|collection date:missing", "Dr thymus foxn1+/+ rep2", "Transcriptomes were analyzed on the Galaxy platform. Adapters were trimmed with TrimGalore! version 0.4.3.1. Reads were aligned to the reference genome with Hisat2  version 2.1.0. Counts were generated with featureCounts version 1.6.1.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files containing raw counts for each sample", "thymus", null, "Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.", null, "tissue:thymus|cell type:thymus cells|genotype:foxn1+/+", "GSM8392360", "GSM8392360: Dr thymus foxn1+/+ rep2; Danio rerio; RNA Seq", "GSM8392360 r1", "GSM8392360", "1", "Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP519440", null, null, "BK2_R1.fastq.gz BK2_R2.fastq.gz", "fastq fastq", 34154139756.0, 113093178.0, "GSM8392360 r1", "0:151 1:151", "A:9754575779;C:7198913431;G:7834944597;T:9364172876;N:1533073", 151, 151, null, null, 9754575779, 7198913431, 7834944597, 9364172876, 1533073, "SRX25290431", "SRS21969148", "SRA1922343", "Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics", "Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics", 2, 0.87955, 0.88145, 0.18817, 0.18856, 0.72707, 0.72839, 0.49921, 0.49737, 151, 151, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "nebnext", "bulk", "bulk", "bulk", null, "Germany", "2024-07-11", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [33163, "SRR29791093", "SRX25290430", "SRS21969147", "SRP519440", "PRJNA1134759", "Developmental trajectory and evolutionary origin of thymic mimetic cells  [dataset 2]", "GSE272064", "Transcriptome Analysis", "The generation of self tolerant repertoires of T cells depends on the expression of peripheral self antigens in the thymic epithelium  and the presence of small populations of cells mimicking the diverse phenotypes of peripheral tissues. Whereas the molecular underpinnings of self antigen expression have been extensively studied  the developmental origins and differentiation pathways of thymic mimetic cells remain to be identified. Moreover  the histological identification of myoid and other peripheral cell types as components of the thymic microenvironment of many vertebrate species raises questions as to the evolutionary origin of this unique tolerance mechanism. Here  we show that during mouse development  mimetic cells appear in the microenvironment in two successive waves. Cells exhibiting transcriptional signatures characteristic of muscle  ionocyte  goblet and ciliated cells emerge before birth  whereas others  for instance those mimicking enterohepatic cells and skin keratinocytes appear postnatally. These two groups also respond differently to modulations of TEC progenitor pools caused by deletions of Foxn1 and Ascl1  expression of a hypomorphic Foxn1 transcription factor  and overexpression of Bmp4 and Fgf7 signalling molecules. Differences in mimetic cell populations were also observed in thymic microenvironments reconstructed by replacement of mouse Foxn1 with evolutionarily ancient Foxn1/4 gene family members  including the Foxn4 gene of the cephalochordate amphioxus  and the Foxn4 and Foxn1 genes of a cartilaginous fish. Whereas some cell types  such as ciliated cells  develop in the thymus in the absence of Foxn1  mimetic cells appearing postnatally  such as enterohepatic cells  require the activity of the vertebrate specific transcription factor Foxn1. The thymus of cartilaginous fishes and the thymoid of lampreys  a representative of jawless vertebrates that exhibit an alternative adaptive immune system  also harbour cells expressing genes encoding peripheral tissue components  such as the liver specific protein transthyretin. Our findings suggest an evolutionary model of successive changes of thymic epithelial genetic networks enabling the coordinated contribution of peripheral antigen expression and mimetic cell formation to achieve central tolerance for vertebrate specific innovations of certain tissues  such as the liver. Overall design: Cells from whole thymic tissue from zebrafish were prepared  and subjected to bulk RNAseq. Foxn1+/+  samples and foxn1 /  samples were sequenced.", null, null, null, "Dr thymus foxn1+/+ rep1", "GSM8392359", null, "source name:thymus|tissue:thymus|cell type:thymus cells|genotype:foxn1+/+|geo loc name:missing|collection date:missing", "Dr thymus foxn1+/+ rep1", "Transcriptomes were analyzed on the Galaxy platform. Adapters were trimmed with TrimGalore! version 0.4.3.1. Reads were aligned to the reference genome with Hisat2  version 2.1.0. Counts were generated with featureCounts version 1.6.1.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files containing raw counts for each sample", "thymus", null, "Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.", null, "tissue:thymus|cell type:thymus cells|genotype:foxn1+/+", "GSM8392359", "GSM8392359: Dr thymus foxn1+/+ rep1; Danio rerio; RNA Seq", "GSM8392359 r1", "GSM8392359", "1", "Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP519440", null, null, "BK1_R2.fastq.gz BK1_R1.fastq.gz", "fastq fastq", 48045652026.0, 159091563.0, "GSM8392359 r1", "0:151 1:151", "A:13986882382;C:9969611893;G:10712447624;T:13374538759;N:2171368", 151, 151, null, null, 13986882382, 9969611893, 10712447624, 13374538759, 2171368, "SRX25290430", "SRS21969147", "SRA1922343", "Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics", "Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics", 2, 0.87379, 0.87656, 0.21786, 0.2191, 0.73815, 0.73975, 0.49869, 0.49808, 151, 151, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "nebnext", "bulk", "bulk", "bulk", null, "Germany", "2024-07-11", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [38293, "SRR1647684", "SRX756919", "SRS742121", "SRP049663", "PRJNA266803", "Spring Varaemia of Carp Virus SVCV infection of adult zebrafish", "GSE63133", "Transcriptome Analysis", "During viral infection  a large number of immune response signaling molecules including the interferon regulatory IRF family and type I interferon IFN transcribe. The exact identity and expression levels of fish IRFs and type I IFNs during viral infection remains largely unknown. Here  we utilized Illumina sequencing technology to determine differential expression patterns for both zebrafish IRFs and type I IFNs during two stages of SVCV infection  i.e. 6h and 24h post infection. For 12 zebrafish IRFs  we identified DrIRF1 mRNA as one of the most abundant in normal tissues and also in SVCV infected tissues  but DrIRF11 had a very weak basal expression and was almost not induced by SVCV infection. We also identified the highly basal expression of DrIRF7  which together with DrIRF3  was highly induced by SVCV infection. For type I IFNs  zebrafish has four IFN genes  three of which  IFN1/2/3  particularly IFN 1 and IFN 3  were significantly transcribed under the same conditions. Overall design: 12 adult healthy male and female 1:1 zebrafish were infected by intraperitoneal inoculation with approximately  50 \u00b5L SVCV 10 8TCID50/mL. 6 infected fish male:female=1:1 were sacrificed at 6h post injection  and 6 male:female=1:1 were sacrificed at 24h post injection for head kidney 6K and 24K and spleen 6S and 24S. Head kidney and spleen 0K and 0S from the 6 control adult zebrafish male:female=1:1 were collected as negative control.", null, "pubmed:25535281", null, "24S", "GSM1541908", null, "source name:spleen|tissue:spleen|disease state:24h post SVCV infection", "24S", "Illumina Casava1.7 software used for basecalling. Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence  then mapped to mm8 whole genome using bowtie v0.12.2 with parameters  q  p 4  e 100  y  a  m 10   best   strata Reads Per Kilobase of exon per Megabase of library size RPKM were calculated using a protocol from Chepelev et al.  Nucleic Acids Research  2009. In short  exons from all isoforms of a gene were merged to create one meta transcript. The number of reads falling in the exons of this meta transcript were counted and normalized by the size of the meta transcript and by the size of the library. Genome build: mm8 Supplementary files format and content: tab delimited text files include RPKM values for each Sample ...", "spleen", null, "Total RNA was extracted using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 5 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:spleen|disease state:24h post SVCV infection", "GSM1541908", "GSM1541908: 24S; Danio rerio; RNA Seq", "GSM1541908", null, "1", "Total RNA was extracted using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 5 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM1541908", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP049663", null, null, "24S_ATGTCA_L003_R1.fastq", "fastq", 1207014756.0, 23666956.0, "GSM1541908 r1", "0:51", "A:316359100;C:290453604;G:283305513;T:316815698;N:80841", 51, null, null, null, 316359100, 290453604, 283305513, 316815698, 80841, "SRX756919", "SRS742121", "SRA200717", "GEO", "Institute of Hydrobiology, Chinese Academy of Sciences", 1, 0.91158, null, 0.09021, null, 0.70867, null, 0.46907, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2014-11-10", "Undetermined", "Adult", "Spleen", "Hematopoietic System"], [38294, "SRR1647683", "SRX756918", "SRS742119", "SRP049663", "PRJNA266803", "Spring Varaemia of Carp Virus SVCV infection of adult zebrafish", "GSE63133", "Transcriptome Analysis", "During viral infection  a large number of immune response signaling molecules including the interferon regulatory IRF family and type I interferon IFN transcribe. The exact identity and expression levels of fish IRFs and type I IFNs during viral infection remains largely unknown. Here  we utilized Illumina sequencing technology to determine differential expression patterns for both zebrafish IRFs and type I IFNs during two stages of SVCV infection  i.e. 6h and 24h post infection. For 12 zebrafish IRFs  we identified DrIRF1 mRNA as one of the most abundant in normal tissues and also in SVCV infected tissues  but DrIRF11 had a very weak basal expression and was almost not induced by SVCV infection. We also identified the highly basal expression of DrIRF7  which together with DrIRF3  was highly induced by SVCV infection. For type I IFNs  zebrafish has four IFN genes  three of which  IFN1/2/3  particularly IFN 1 and IFN 3  were significantly transcribed under the same conditions. Overall design: 12 adult healthy male and female 1:1 zebrafish were infected by intraperitoneal inoculation with approximately  50 \u00b5L SVCV 10 8TCID50/mL. 6 infected fish male:female=1:1 were sacrificed at 6h post injection  and 6 male:female=1:1 were sacrificed at 24h post injection for head kidney 6K and 24K and spleen 6S and 24S. Head kidney and spleen 0K and 0S from the 6 control adult zebrafish male:female=1:1 were collected as negative control.", null, "pubmed:25535281", null, "6S", "GSM1541907", null, "source name:spleen|tissue:spleen|disease state:6h post SVCV infection", "6S", "Illumina Casava1.7 software used for basecalling. Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence  then mapped to mm8 whole genome using bowtie v0.12.2 with parameters  q  p 4  e 100  y  a  m 10   best   strata Reads Per Kilobase of exon per Megabase of library size RPKM were calculated using a protocol from Chepelev et al.  Nucleic Acids Research  2009. In short  exons from all isoforms of a gene were merged to create one meta transcript. The number of reads falling in the exons of this meta transcript were counted and normalized by the size of the meta transcript and by the size of the library. Genome build: mm8 Supplementary files format and content: tab delimited text files include RPKM values for each Sample ...", "spleen", null, "Total RNA was extracted using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 5 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:spleen|disease state:6h post SVCV infection", "GSM1541907", "GSM1541907: 6S; Danio rerio; RNA Seq", "GSM1541907", null, "1", "Total RNA was extracted using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 5 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM1541907", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP049663", null, null, "6S_AGTTCC_L003_R1.fastq", "fastq", 1251006540.0, 24529540.0, "GSM1541907 r1", "0:51", "A:323805792;C:303846999;G:297418642;T:325862442;N:72665", 51, null, null, null, 323805792, 303846999, 297418642, 325862442, 72665, "SRX756918", "SRS742119", "SRA200717", "GEO", "Institute of Hydrobiology, Chinese Academy of Sciences", 1, 0.92105, null, 0.09005, null, 0.71273, null, 0.46937, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2014-11-10", "Undetermined", "Adult", "Spleen", "Hematopoietic System"], [38295, "SRR1647682", "SRX756917", "SRS742118", "SRP049663", "PRJNA266803", "Spring Varaemia of Carp Virus SVCV infection of adult zebrafish", "GSE63133", "Transcriptome Analysis", "During viral infection  a large number of immune response signaling molecules including the interferon regulatory IRF family and type I interferon IFN transcribe. The exact identity and expression levels of fish IRFs and type I IFNs during viral infection remains largely unknown. Here  we utilized Illumina sequencing technology to determine differential expression patterns for both zebrafish IRFs and type I IFNs during two stages of SVCV infection  i.e. 6h and 24h post infection. For 12 zebrafish IRFs  we identified DrIRF1 mRNA as one of the most abundant in normal tissues and also in SVCV infected tissues  but DrIRF11 had a very weak basal expression and was almost not induced by SVCV infection. We also identified the highly basal expression of DrIRF7  which together with DrIRF3  was highly induced by SVCV infection. For type I IFNs  zebrafish has four IFN genes  three of which  IFN1/2/3  particularly IFN 1 and IFN 3  were significantly transcribed under the same conditions. Overall design: 12 adult healthy male and female 1:1 zebrafish were infected by intraperitoneal inoculation with approximately  50 \u00b5L SVCV 10 8TCID50/mL. 6 infected fish male:female=1:1 were sacrificed at 6h post injection  and 6 male:female=1:1 were sacrificed at 24h post injection for head kidney 6K and 24K and spleen 6S and 24S. Head kidney and spleen 0K and 0S from the 6 control adult zebrafish male:female=1:1 were collected as negative control.", null, "pubmed:25535281", null, "0S", "GSM1541906", null, "source name:spleen|tissue:spleen|disease state:un infected", "0S", "Illumina Casava1.7 software used for basecalling. Sequenced reads were trimmed for adaptor sequence  and masked for low complexity or low quality sequence  then mapped to mm8 whole genome using bowtie v0.12.2 with parameters  q  p 4  e 100  y  a  m 10   best   strata Reads Per Kilobase of exon per Megabase of library size RPKM were calculated using a protocol from Chepelev et al.  Nucleic Acids Research  2009. In short  exons from all isoforms of a gene were merged to create one meta transcript. The number of reads falling in the exons of this meta transcript were counted and normalized by the size of the meta transcript and by the size of the library. Genome build: mm8 Supplementary files format and content: tab delimited text files include RPKM values for each Sample ...", "spleen", null, "Total RNA was extracted using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 5 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols", null, "tissue:spleen|disease state:un infected", "GSM1541906", "GSM1541906: 0S; Danio rerio; RNA Seq", "GSM1541906", null, "1", "Total RNA was extracted using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 5 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols", "GEO Accession:GSM1541906", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP049663", null, null, "0S_AGTCAA_L003_R1.fastq", "fastq", 1155087372.0, 22648772.0, "GSM1541906 r1", "0:51", "A:301183546;C:279328135;G:272663981;T:301834798;N:76912", 51, null, null, null, 301183546, 279328135, 272663981, 301834798, 76912, "SRX756917", "SRS742118", "SRA200717", "GEO", "Institute of Hydrobiology, Chinese Academy of Sciences", 1, 0.91841, null, 0.09679, null, 0.70546, null, 0.47624, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2014-11-10", "Undetermined", "Adult", "Spleen", "Hematopoietic System"], [47869, "SRR6908743", "SRX3856808", "SRS3100400", "SRP136633", "PRJNA446034", "Cell type purification by single cell transcriptome trained sorting", "GSE112438", "Other", "Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.", null, "pubmed:31585086", null, "WKM9 eosinophils", "GSM3070146", null, "tissue:WKM9 eosinophils|FISHid:WKM9|cell type:whole kidney marrow single cells|cell subtype:eosinophils", "WKM9 eosinophils", "In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode", "WKM9 eosinophils", null, "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", null, "FISHid:WKM9|cell type:whole kidney marrow single cells|cell subtype:eosinophils", "GSM3070146", "GSM3070146: WKM9 eosinophils; Danio rerio; RNA Seq", "GSM3070146", null, "1", "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", "GEO Accession:GSM3070146", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP136633", null, null, "WKM9_eosinophils_L001_R1_001.fastq.gz WKM9_eosinophils_L001_R2_001.fastq.gz", "fastq fastq", 1378279915.0, 9133302.0, "GSM3070146 r1", "0:75.43 1:75.48", "A:398409215;C:214050926;G:243007260;T:522806293;N:6221", 75, 75, null, null, 398409215, 214050926, 243007260, 522806293, 6221, "SRX3856808", "SRS3100400", "SRA675960", "GEO", "Hubrecht Institute", 2, 0.32967, 0.72245, 0.27664, 0.49284, 0.96217, 0.88688, 0.44743, 0.5676, 76, 73, "T", "B", "mate1 technical by mapping diff", "illumina", "nextseq", "unknown", "random_priming", "trueseq", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-03-28", "Undetermined", "Undetermined", "Blood", "Hematopoietic System"], [47870, "SRR6908744", "SRX3856808", "SRS3100400", "SRP136633", "PRJNA446034", "Cell type purification by single cell transcriptome trained sorting", "GSE112438", "Other", "Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.", null, "pubmed:31585086", null, "WKM9 eosinophils", "GSM3070146", null, "tissue:WKM9 eosinophils|FISHid:WKM9|cell type:whole kidney marrow single cells|cell subtype:eosinophils", "WKM9 eosinophils", "In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode", "WKM9 eosinophils", null, "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", null, "FISHid:WKM9|cell type:whole kidney marrow single cells|cell subtype:eosinophils", "GSM3070146", "GSM3070146: WKM9 eosinophils; Danio rerio; RNA Seq", "GSM3070146", null, "1", "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", "GEO Accession:GSM3070146", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP136633", null, null, "WKM9_eosinophils_L002_R1_001.fastq.gz WKM9_eosinophils_L002_R2_001.fastq.gz", "fastq fastq", 1347027331.0, 8926023.0, "GSM3070146 r2", "0:75.43 1:75.48", "A:386373331;C:208319487;G:242442973;T:509887930;N:3610", 75, 75, null, null, 386373331, 208319487, 242442973, 509887930, 3610, "SRX3856808", "SRS3100400", "SRA675960", "GEO", "Hubrecht Institute", 2, 0.32008, 0.72405, 0.26859, 0.48848, 0.96512, 0.88791, 0.46692, 0.55937, 76, 76, "T", "B", "mate1 technical by mapping diff", "illumina", "nextseq", "unknown", "random_priming", "trueseq", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-03-28", "Undetermined", "Undetermined", "Blood", "Hematopoietic System"], [47871, "SRR6908745", "SRX3856808", "SRS3100400", "SRP136633", "PRJNA446034", "Cell type purification by single cell transcriptome trained sorting", "GSE112438", "Other", "Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.", null, "pubmed:31585086", null, "WKM9 eosinophils", "GSM3070146", null, "tissue:WKM9 eosinophils|FISHid:WKM9|cell type:whole kidney marrow single cells|cell subtype:eosinophils", "WKM9 eosinophils", "In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode", "WKM9 eosinophils", null, "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", null, "FISHid:WKM9|cell type:whole kidney marrow single cells|cell subtype:eosinophils", "GSM3070146", "GSM3070146: WKM9 eosinophils; Danio rerio; RNA Seq", "GSM3070146", null, "1", "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", "GEO Accession:GSM3070146", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP136633", null, null, "WKM9_eosinophils_L003_R1_001.fastq.gz WKM9_eosinophils_L003_R2_001.fastq.gz", "fastq fastq", 1241011911.0, 8223327.0, "GSM3070146 r3", "0:75.44 1:75.48", "A:356514159;C:192418351;G:221034567;T:471023588;N:21246", 75, 75, null, null, 356514159, 192418351, 221034567, 471023588, 21246, "SRX3856808", "SRS3100400", "SRA675960", "GEO", "Hubrecht Institute", 2, 0.31504, 0.71934, 0.26517, 0.48722, 0.96932, 0.89499, 0.47715, 0.56814, 76, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "nextseq", "unknown", "random_priming", "trueseq", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-03-28", "Undetermined", "Undetermined", "Blood", "Hematopoietic System"], [47872, "SRR6908746", "SRX3856808", "SRS3100400", "SRP136633", "PRJNA446034", "Cell type purification by single cell transcriptome trained sorting", "GSE112438", "Other", "Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.", null, "pubmed:31585086", null, "WKM9 eosinophils", "GSM3070146", null, "tissue:WKM9 eosinophils|FISHid:WKM9|cell type:whole kidney marrow single cells|cell subtype:eosinophils", "WKM9 eosinophils", "In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode", "WKM9 eosinophils", null, "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", null, "FISHid:WKM9|cell type:whole kidney marrow single cells|cell subtype:eosinophils", "GSM3070146", "GSM3070146: WKM9 eosinophils; Danio rerio; RNA Seq", "GSM3070146", null, "1", "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", "GEO Accession:GSM3070146", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP136633", null, null, "WKM9_eosinophils_L004_R1_001.fastq.gz WKM9_eosinophils_L004_R2_001.fastq.gz", "fastq fastq", 1199788386.0, 7950347.0, "GSM3070146 r4", "0:75.44 1:75.47", "A:343966384;C:184985849;G:216629920;T:454187010;N:19223", 75, 75, null, null, 343966384, 184985849, 216629920, 454187010, 19223, "SRX3856808", "SRS3100400", "SRA675960", "GEO", "Hubrecht Institute", 2, 0.32136, 0.71802, 0.27107, 0.48741, 0.97098, 0.90057, 0.4616, 0.56009, 76, 76, "T", "B", "mate1 technical by mapping diff", "illumina", "nextseq", "unknown", "random_priming", "trueseq", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-03-28", "Undetermined", "Undetermined", "Blood", "Hematopoietic System"], [47917, "SRR6908693", "SRX3856796", "SRS3100388", "SRP136633", "PRJNA446034", "Cell type purification by single cell transcriptome trained sorting", "GSE112438", "Other", "Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.", null, "pubmed:31585086", null, "WKM4 eosinophils", "GSM3070134", null, "tissue:WKM4 eosinophils|FISHid:WKM4|cell type:whole kidney marrow single cells|cell subtype:eosinophils", "WKM4 eosinophils", "In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode", "WKM4 eosinophils", null, "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", null, "FISHid:WKM4|cell type:whole kidney marrow single cells|cell subtype:eosinophils", "GSM3070134", "GSM3070134: WKM4 eosinophils; Danio rerio; RNA Seq", "GSM3070134", null, "1", "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", "GEO Accession:GSM3070134", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP136633", null, null, "WKM4_eosinophils_L001_R1_001.fastq.gz WKM4_eosinophils_L001_R2_001.fastq.gz", "fastq fastq", 1044383799.0, 6918578.0, "GSM3070134 r1", "0:75.49 1:75.46", "A:293266328;C:159927306;G:179144897;T:412003143;N:42125", 75, 75, null, null, 293266328, 159927306, 179144897, 412003143, 42125, "SRX3856796", "SRS3100388", "SRA675960", "GEO", "Hubrecht Institute", 2, 0.38953, 0.76677, 0.33438, 0.55076, 0.94775, 0.83664, 0.47684, 0.51667, 75, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "nextseq", "unknown", "random_priming", "trueseq", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-03-28", "Undetermined", "Undetermined", "Blood", "Hematopoietic System"], [47918, "SRR6908694", "SRX3856796", "SRS3100388", "SRP136633", "PRJNA446034", "Cell type purification by single cell transcriptome trained sorting", "GSE112438", "Other", "Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.", null, "pubmed:31585086", null, "WKM4 eosinophils", "GSM3070134", null, "tissue:WKM4 eosinophils|FISHid:WKM4|cell type:whole kidney marrow single cells|cell subtype:eosinophils", "WKM4 eosinophils", "In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode", "WKM4 eosinophils", null, "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", null, "FISHid:WKM4|cell type:whole kidney marrow single cells|cell subtype:eosinophils", "GSM3070134", "GSM3070134: WKM4 eosinophils; Danio rerio; RNA Seq", "GSM3070134", null, "1", "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", "GEO Accession:GSM3070134", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP136633", null, null, "WKM4_eosinophils_L002_R1_001.fastq.gz WKM4_eosinophils_L002_R2_001.fastq.gz", "fastq fastq", 1065518294.0, 7059081.0, "GSM3070134 r2", "0:75.49 1:75.45", "A:299578147;C:162208243;G:185866185;T:417812882;N:52837", 75, 75, null, null, 299578147, 162208243, 185866185, 417812882, 52837, "SRX3856796", "SRS3100388", "SRA675960", "GEO", "Hubrecht Institute", 2, 0.36825, 0.75817, 0.3148, 0.55624, 0.95061, 0.84794, 0.47713, 0.52081, 76, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "nextseq", "unknown", "random_priming", "trueseq", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-03-28", "Undetermined", "Undetermined", "Blood", "Hematopoietic System"], [47919, "SRR6908695", "SRX3856796", "SRS3100388", "SRP136633", "PRJNA446034", "Cell type purification by single cell transcriptome trained sorting", "GSE112438", "Other", "Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.", null, "pubmed:31585086", null, "WKM4 eosinophils", "GSM3070134", null, "tissue:WKM4 eosinophils|FISHid:WKM4|cell type:whole kidney marrow single cells|cell subtype:eosinophils", "WKM4 eosinophils", "In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode", "WKM4 eosinophils", null, "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", null, "FISHid:WKM4|cell type:whole kidney marrow single cells|cell subtype:eosinophils", "GSM3070134", "GSM3070134: WKM4 eosinophils; Danio rerio; RNA Seq", "GSM3070134", null, "1", "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", "GEO Accession:GSM3070134", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP136633", null, null, "WKM4_eosinophils_L003_R1_001.fastq.gz WKM4_eosinophils_L003_R2_001.fastq.gz", "fastq fastq", 1020526841.0, 6760661.0, "GSM3070134 r3", "0:75.50 1:75.45", "A:287644655;C:155831653;G:174910820;T:402133481;N:6232", 75, 75, null, null, 287644655, 155831653, 174910820, 402133481, 6232, "SRX3856796", "SRS3100388", "SRA675960", "GEO", "Hubrecht Institute", 2, 0.38266, 0.76495, 0.32861, 0.55487, 0.94909, 0.84502, 0.47881, 0.50844, 76, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "nextseq", "unknown", "random_priming", "trueseq", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-03-28", "Undetermined", "Undetermined", "Blood", "Hematopoietic System"], [47920, "SRR6908696", "SRX3856796", "SRS3100388", "SRP136633", "PRJNA446034", "Cell type purification by single cell transcriptome trained sorting", "GSE112438", "Other", "Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.", null, "pubmed:31585086", null, "WKM4 eosinophils", "GSM3070134", null, "tissue:WKM4 eosinophils|FISHid:WKM4|cell type:whole kidney marrow single cells|cell subtype:eosinophils", "WKM4 eosinophils", "In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode", "WKM4 eosinophils", null, "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", null, "FISHid:WKM4|cell type:whole kidney marrow single cells|cell subtype:eosinophils", "GSM3070134", "GSM3070134: WKM4 eosinophils; Danio rerio; RNA Seq", "GSM3070134", null, "1", "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", "GEO Accession:GSM3070134", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP136633", null, null, "WKM4_eosinophils_L004_R2_001.fastq.gz WKM4_eosinophils_L004_R1_001.fastq.gz", "fastq fastq", 1036249497.0, 6864317.0, "GSM3070134 r4", "0:75.50 1:75.46", "A:290241796;C:157806083;G:180760457;T:407436042;N:5119", 75, 75, null, null, 290241796, 157806083, 180760457, 407436042, 5119, "SRX3856796", "SRS3100388", "SRA675960", "GEO", "Hubrecht Institute", 2, 0.38456, 0.76284, 0.32829, 0.54843, 0.9497, 0.84668, 0.48302, 0.51789, 76, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "nextseq", "unknown", "random_priming", "trueseq", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-03-28", "Undetermined", "Undetermined", "Blood", "Hematopoietic System"], [47925, "SRR6908685", "SRX3856794", "SRS3100386", "SRP136633", "PRJNA446034", "Cell type purification by single cell transcriptome trained sorting", "GSE112438", "Other", "Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.", null, "pubmed:31585086", null, "WKM3 eosinophils", "GSM3070132", null, "tissue:WKM3 eosinophils|FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:eosinophils", "WKM3 eosinophils", "In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode", "WKM3 eosinophils", null, "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", null, "FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:eosinophils", "GSM3070132", "GSM3070132: WKM3 eosinophils; Danio rerio; RNA Seq", "GSM3070132", null, "1", "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", "GEO Accession:GSM3070132", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP136633", null, null, "WKM3_eosinophils_L001_R1_001.fastq.gz WKM3_eosinophils_L001_R2_001.fastq.gz", "fastq fastq", 1288630538.0, 8538558.0, "GSM3070132 r1", "0:75.44 1:75.48", "A:384649233;C:189860338;G:186795029;T:527108032;N:217906", 75, 75, null, null, 384649233, 189860338, 186795029, 527108032, 217906, "SRX3856794", "SRS3100386", "SRA675960", "GEO", "Hubrecht Institute", 2, 0.38213, 0.80648, 0.32, 0.39443, 0.96749, 0.92997, 0.49763, 0.55351, 75, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "nextseq", "unknown", "random_priming", "trueseq", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-03-28", "Undetermined", "Undetermined", "Blood", "Hematopoietic System"], [47926, "SRR6908686", "SRX3856794", "SRS3100386", "SRP136633", "PRJNA446034", "Cell type purification by single cell transcriptome trained sorting", "GSE112438", "Other", "Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.", null, "pubmed:31585086", null, "WKM3 eosinophils", "GSM3070132", null, "tissue:WKM3 eosinophils|FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:eosinophils", "WKM3 eosinophils", "In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode", "WKM3 eosinophils", null, "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", null, "FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:eosinophils", "GSM3070132", "GSM3070132: WKM3 eosinophils; Danio rerio; RNA Seq", "GSM3070132", null, "1", "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", "GEO Accession:GSM3070132", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP136633", null, null, "WKM3_eosinophils_L002_R1_001.fastq.gz WKM3_eosinophils_L002_R2_001.fastq.gz", "fastq fastq", 1176806695.0, 7797829.0, "GSM3070132 r2", "0:75.44 1:75.48", "A:349406324;C:172751257;G:173925861;T:480558924;N:164329", 75, 75, null, null, 349406324, 172751257, 173925861, 480558924, 164329, "SRX3856794", "SRS3100386", "SRA675960", "GEO", "Hubrecht Institute", 2, 0.3792, 0.81293, 0.31911, 0.39312, 0.96834, 0.93176, 0.52878, 0.54431, 75, 76, "T", "B", "mate1 technical by mapping diff", "illumina", "nextseq", "unknown", "random_priming", "trueseq", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-03-28", "Undetermined", "Undetermined", "Blood", "Hematopoietic System"], [47927, "SRR6908687", "SRX3856794", "SRS3100386", "SRP136633", "PRJNA446034", "Cell type purification by single cell transcriptome trained sorting", "GSE112438", "Other", "Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.", null, "pubmed:31585086", null, "WKM3 eosinophils", "GSM3070132", null, "tissue:WKM3 eosinophils|FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:eosinophils", "WKM3 eosinophils", "In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode", "WKM3 eosinophils", null, "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", null, "FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:eosinophils", "GSM3070132", "GSM3070132: WKM3 eosinophils; Danio rerio; RNA Seq", "GSM3070132", null, "1", "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", "GEO Accession:GSM3070132", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP136633", null, null, "WKM3_eosinophils_L003_R1_001.fastq.gz WKM3_eosinophils_L003_R2_001.fastq.gz", "fastq fastq", 1341470236.0, 8888024.0, "GSM3070132 r3", "0:75.45 1:75.48", "A:395746232;C:196893713;G:196590339;T:552105050;N:134902", 75, 75, null, null, 395746232, 196893713, 196590339, 552105050, 134902, "SRX3856794", "SRS3100386", "SRA675960", "GEO", "Hubrecht Institute", 2, 0.38231, 0.81774, 0.3205, 0.39891, 0.97279, 0.92817, 0.47656, 0.53862, 75, 74, "T", "B", "mate1 technical by mapping diff", "illumina", "nextseq", "unknown", "random_priming", "trueseq", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-03-28", "Undetermined", "Undetermined", "Blood", "Hematopoietic System"], [47928, "SRR6908688", "SRX3856794", "SRS3100386", "SRP136633", "PRJNA446034", "Cell type purification by single cell transcriptome trained sorting", "GSE112438", "Other", "Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.", null, "pubmed:31585086", null, "WKM3 eosinophils", "GSM3070132", null, "tissue:WKM3 eosinophils|FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:eosinophils", "WKM3 eosinophils", "In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode", "WKM3 eosinophils", null, "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", null, "FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:eosinophils", "GSM3070132", "GSM3070132: WKM3 eosinophils; Danio rerio; RNA Seq", "GSM3070132", null, "1", "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", "GEO Accession:GSM3070132", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP136633", null, null, "WKM3_eosinophils_L004_R1_001.fastq.gz WKM3_eosinophils_L004_R2_001.fastq.gz", "fastq fastq", 1280409546.0, 8484656.0, "GSM3070132 r4", "0:75.44 1:75.47", "A:378449241;C:186686350;G:189951619;T:525218711;N:103625", 75, 75, null, null, 378449241, 186686350, 189951619, 525218711, 103625, "SRX3856794", "SRS3100386", "SRA675960", "GEO", "Hubrecht Institute", 2, 0.36531, 0.80793, 0.30661, 0.38147, 0.97492, 0.94401, 0.47223, 0.55437, 76, 76, "T", "B", "mate1 technical by mapping diff", "illumina", "nextseq", "unknown", "random_priming", "trueseq", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-03-28", "Undetermined", "Undetermined", "Blood", "Hematopoietic System"], [47929, "SRR6908681", "SRX3856793", "SRS3100385", "SRP136633", "PRJNA446034", "Cell type purification by single cell transcriptome trained sorting", "GSE112438", "Other", "Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.", null, "pubmed:31585086", null, "WKM3 classicalgate eosinophils", "GSM3070131", null, "tissue:WKM3 classicalgate eosinophils|FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils", "WKM3 classicalgate eosinophils", "In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode", "WKM3 classicalgate eosinophils", null, "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", null, "FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils", "GSM3070131", "GSM3070131: WKM3 classicalgate eosinophils; Danio rerio; RNA Seq", "GSM3070131", null, "1", "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", "GEO Accession:GSM3070131", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP136633", null, null, "WKM3_classicalgate-eosinophils_L001_R1_001.fastq.gz WKM3_classicalgate-eosinophils_L001_R2_001.fastq.gz", "fastq fastq", 1462702668.0, 9694435.0, "GSM3070131 r1", "0:75.42 1:75.46", "A:445709472;C:205316750;G:205641600;T:605784979;N:249867", 75, 75, null, null, 445709472, 205316750, 205641600, 605784979, 249867, "SRX3856793", "SRS3100385", "SRA675960", "GEO", "Hubrecht Institute", 2, 0.39724, 0.82292, 0.32577, 0.36062, 0.9713, 0.9301, 0.46129, 0.54716, 75, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "nextseq", "unknown", "random_priming", "trueseq", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-03-28", "Undetermined", "Undetermined", "Blood", "Hematopoietic System"], [47930, "SRR6908682", "SRX3856793", "SRS3100385", "SRP136633", "PRJNA446034", "Cell type purification by single cell transcriptome trained sorting", "GSE112438", "Other", "Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.", null, "pubmed:31585086", null, "WKM3 classicalgate eosinophils", "GSM3070131", null, "tissue:WKM3 classicalgate eosinophils|FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils", "WKM3 classicalgate eosinophils", "In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode", "WKM3 classicalgate eosinophils", null, "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", null, "FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils", "GSM3070131", "GSM3070131: WKM3 classicalgate eosinophils; Danio rerio; RNA Seq", "GSM3070131", null, "1", "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", "GEO Accession:GSM3070131", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP136633", null, null, "WKM3_classicalgate-eosinophils_L002_R2_001.fastq.gz WKM3_classicalgate-eosinophils_L002_R1_001.fastq.gz", "fastq fastq", 1331127146.0, 8822708.0, "GSM3070131 r2", "0:75.42 1:75.45", "A:403738285;C:185977311;G:190160316;T:551055048;N:196186", 75, 75, null, null, 403738285, 185977311, 190160316, 551055048, 196186, "SRX3856793", "SRS3100385", "SRA675960", "GEO", "Hubrecht Institute", 2, 0.39004, 0.81794, 0.32291, 0.35472, 0.97228, 0.93626, 0.48683, 0.54607, 76, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "nextseq", "unknown", "random_priming", "trueseq", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-03-28", "Undetermined", "Undetermined", "Blood", "Hematopoietic System"], [47931, "SRR6908683", "SRX3856793", "SRS3100385", "SRP136633", "PRJNA446034", "Cell type purification by single cell transcriptome trained sorting", "GSE112438", "Other", "Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.", null, "pubmed:31585086", null, "WKM3 classicalgate eosinophils", "GSM3070131", null, "tissue:WKM3 classicalgate eosinophils|FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils", "WKM3 classicalgate eosinophils", "In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode", "WKM3 classicalgate eosinophils", null, "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", null, "FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils", "GSM3070131", "GSM3070131: WKM3 classicalgate eosinophils; Danio rerio; RNA Seq", "GSM3070131", null, "1", "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", "GEO Accession:GSM3070131", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP136633", null, null, "WKM3_classicalgate-eosinophils_L003_R2_001.fastq.gz WKM3_classicalgate-eosinophils_L003_R1_001.fastq.gz", "fastq fastq", 1530092022.0, 10140266.0, "GSM3070131 r3", "0:75.43 1:75.46", "A:460384140;C:214158501;G:217473146;T:637914633;N:161602", 75, 75, null, null, 460384140, 214158501, 217473146, 637914633, 161602, "SRX3856793", "SRS3100385", "SRA675960", "GEO", "Hubrecht Institute", 2, 0.39487, 0.82643, 0.32278, 0.35403, 0.97555, 0.92989, 0.49836, 0.55498, 75, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "nextseq", "unknown", "random_priming", "trueseq", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-03-28", "Undetermined", "Undetermined", "Blood", "Hematopoietic System"], [47932, "SRR6908684", "SRX3856793", "SRS3100385", "SRP136633", "PRJNA446034", "Cell type purification by single cell transcriptome trained sorting", "GSE112438", "Other", "Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.", null, "pubmed:31585086", null, "WKM3 classicalgate eosinophils", "GSM3070131", null, "tissue:WKM3 classicalgate eosinophils|FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils", "WKM3 classicalgate eosinophils", "In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode", "WKM3 classicalgate eosinophils", null, "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", null, "FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils", "GSM3070131", "GSM3070131: WKM3 classicalgate eosinophils; Danio rerio; RNA Seq", "GSM3070131", null, "1", "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", "GEO Accession:GSM3070131", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP136633", null, null, "WKM3_classicalgate-eosinophils_L004_R1_001.fastq.gz WKM3_classicalgate-eosinophils_L004_R2_001.fastq.gz", "fastq fastq", 1434145773.0, 9505626.0, "GSM3070131 r4", "0:75.43 1:75.45", "A:431807112;C:200115802;G:205473991;T:596630601;N:118267", 75, 75, null, null, 431807112, 200115802, 205473991, 596630601, 118267, "SRX3856793", "SRS3100385", "SRA675960", "GEO", "Hubrecht Institute", 2, 0.38268, 0.82073, 0.31346, 0.34043, 0.97678, 0.94172, 0.45791, 0.5661, 75, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "nextseq", "unknown", "random_priming", "trueseq", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-03-28", "Undetermined", "Undetermined", "Blood", "Hematopoietic System"], [47937, "SRR6908673", "SRX3856790", "SRS3100384", "SRP136633", "PRJNA446034", "Cell type purification by single cell transcriptome trained sorting", "GSE112438", "Other", "Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.", null, "pubmed:31585086", null, "WKM2 eosinophils", "GSM3070129", null, "tissue:WKM2 eosinophils|FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:eosinophils", "WKM2 eosinophils", "In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode", "WKM2 eosinophils", null, "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", null, "FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:eosinophils", "GSM3070129", "GSM3070129: WKM2 eosinophils; Danio rerio; RNA Seq", "GSM3070129", null, "1", "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", "GEO Accession:GSM3070129", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP136633", null, null, "WKM2_eosinophils_L001_R1_001.fastq.gz WKM2_eosinophils_L001_R2_001.fastq.gz", "fastq fastq", 1444176720.0, 9566997.0, "GSM3070129 r1", "0:75.46 1:75.50", "A:432764637;C:224282941;G:222436448;T:564444426;N:248268", 75, 75, null, null, 432764637, 224282941, 222436448, 564444426, 248268, "SRX3856790", "SRS3100384", "SRA675960", "GEO", "Hubrecht Institute", 2, 0.37168, 0.75194, 0.32262, 0.52753, 0.95915, 0.94073, 0.51621, 0.55453, 76, 76, "T", "B", "mate1 technical by mapping diff", "illumina", "nextseq", "unknown", "random_priming", "trueseq", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-03-28", "Undetermined", "Undetermined", "Blood", "Hematopoietic System"], [47938, "SRR6908674", "SRX3856790", "SRS3100384", "SRP136633", "PRJNA446034", "Cell type purification by single cell transcriptome trained sorting", "GSE112438", "Other", "Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.", null, "pubmed:31585086", null, "WKM2 eosinophils", "GSM3070129", null, "tissue:WKM2 eosinophils|FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:eosinophils", "WKM2 eosinophils", "In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode", "WKM2 eosinophils", null, "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", null, "FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:eosinophils", "GSM3070129", "GSM3070129: WKM2 eosinophils; Danio rerio; RNA Seq", "GSM3070129", null, "1", "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", "GEO Accession:GSM3070129", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP136633", null, null, "WKM2_eosinophils_L002_R1_001.fastq.gz WKM2_eosinophils_L002_R2_001.fastq.gz", "fastq fastq", 1320784826.0, 8749678.0, "GSM3070129 r2", "0:75.45 1:75.50", "A:392835077;C:204358703;G:208201633;T:515202839;N:186574", 75, 75, null, null, 392835077, 204358703, 208201633, 515202839, 186574, "SRX3856790", "SRS3100384", "SRA675960", "GEO", "Hubrecht Institute", 2, 0.36921, 0.73955, 0.32271, 0.52168, 0.96047, 0.94643, 0.49733, 0.53116, 76, 76, "T", "B", "mate1 technical by mapping diff", "illumina", "nextseq", "unknown", "random_priming", "trueseq", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-03-28", "Undetermined", "Undetermined", "Blood", "Hematopoietic System"], [47939, "SRR6908675", "SRX3856790", "SRS3100384", "SRP136633", "PRJNA446034", "Cell type purification by single cell transcriptome trained sorting", "GSE112438", "Other", "Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.", null, "pubmed:31585086", null, "WKM2 eosinophils", "GSM3070129", null, "tissue:WKM2 eosinophils|FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:eosinophils", "WKM2 eosinophils", "In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode", "WKM2 eosinophils", null, "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", null, "FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:eosinophils", "GSM3070129", "GSM3070129: WKM2 eosinophils; Danio rerio; RNA Seq", "GSM3070129", null, "1", "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", "GEO Accession:GSM3070129", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP136633", null, null, "WKM2_eosinophils_L003_R2_001.fastq.gz WKM2_eosinophils_L003_R1_001.fastq.gz", "fastq fastq", 1500143635.0, 9937133.0, "GSM3070129 r3", "0:75.46 1:75.50", "A:445152171;C:231621688;G:233127317;T:590090278;N:152181", 75, 75, null, null, 445152171, 231621688, 233127317, 590090278, 152181, "SRX3856790", "SRS3100384", "SRA675960", "GEO", "Hubrecht Institute", 2, 0.36533, 0.75138, 0.31769, 0.52682, 0.96731, 0.94209, 0.50569, 0.54346, 76, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "nextseq", "unknown", "random_priming", "trueseq", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-03-28", "Undetermined", "Undetermined", "Blood", "Hematopoietic System"], [47940, "SRR6908676", "SRX3856790", "SRS3100384", "SRP136633", "PRJNA446034", "Cell type purification by single cell transcriptome trained sorting", "GSE112438", "Other", "Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.", null, "pubmed:31585086", null, "WKM2 eosinophils", "GSM3070129", null, "tissue:WKM2 eosinophils|FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:eosinophils", "WKM2 eosinophils", "In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode", "WKM2 eosinophils", null, "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", null, "FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:eosinophils", "GSM3070129", "GSM3070129: WKM2 eosinophils; Danio rerio; RNA Seq", "GSM3070129", null, "1", "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", "GEO Accession:GSM3070129", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP136633", null, null, "WKM2_eosinophils_L004_R1_001.fastq.gz WKM2_eosinophils_L004_R2_001.fastq.gz", "fastq fastq", 1428668507.0, 9464755.0, "GSM3070129 r4", "0:75.46 1:75.49", "A:423108347;C:219338398;G:226517917;T:559587502;N:116343", 75, 75, null, null, 423108347, 219338398, 226517917, 559587502, 116343, "SRX3856790", "SRS3100384", "SRA675960", "GEO", "Hubrecht Institute", 2, 0.35962, 0.7405, 0.31464, 0.51805, 0.96962, 0.95747, 0.48862, 0.53364, 76, 76, "T", "B", "mate1 technical by mapping diff", "illumina", "nextseq", "unknown", "random_priming", "trueseq", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-03-28", "Undetermined", "Undetermined", "Blood", "Hematopoietic System"], [47941, "SRR6908669", "SRX3856789", "SRS3100381", "SRP136633", "PRJNA446034", "Cell type purification by single cell transcriptome trained sorting", "GSE112438", "Other", "Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.", null, "pubmed:31585086", null, "WKM2 classicalgate eosinophils", "GSM3070128", null, "tissue:WKM2 classicalgate eosinophils|FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils", "WKM2 classicalgate eosinophils", "In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode", "WKM2 classicalgate eosinophils", null, "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", null, "FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils", "GSM3070128", "GSM3070128: WKM2 classicalgate eosinophils; Danio rerio; RNA Seq", "GSM3070128", null, "1", "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", "GEO Accession:GSM3070128", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP136633", null, null, "WKM2_classicalgate-eosinophils_L001_R2_001.fastq.gz WKM2_classicalgate-eosinophils_L001_R1_001.fastq.gz", "fastq fastq", 880478792.0, 5834816.0, "GSM3070128 r1", "0:75.43 1:75.47", "A:267072322;C:127440559;G:126304290;T:359512123;N:149498", 75, 75, null, null, 267072322, 127440559, 126304290, 359512123, 149498, "SRX3856789", "SRS3100381", "SRA675960", "GEO", "Hubrecht Institute", 2, 0.3788, 0.812, 0.28918, 0.38972, 0.96595, 0.92904, 0.5376, 0.55651, 75, 75, "T", "B", "mate1 technical by mapping diff", "illumina", "nextseq", "unknown", "random_priming", "trueseq", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-03-28", "Undetermined", "Undetermined", "Blood", "Hematopoietic System"], [47942, "SRR6908670", "SRX3856789", "SRS3100381", "SRP136633", "PRJNA446034", "Cell type purification by single cell transcriptome trained sorting", "GSE112438", "Other", "Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.", null, "pubmed:31585086", null, "WKM2 classicalgate eosinophils", "GSM3070128", null, "tissue:WKM2 classicalgate eosinophils|FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils", "WKM2 classicalgate eosinophils", "In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode", "WKM2 classicalgate eosinophils", null, "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", null, "FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils", "GSM3070128", "GSM3070128: WKM2 classicalgate eosinophils; Danio rerio; RNA Seq", "GSM3070128", null, "1", "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", "GEO Accession:GSM3070128", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP136633", null, null, "WKM2_classicalgate-eosinophils_L002_R1_001.fastq.gz WKM2_classicalgate-eosinophils_L002_R2_001.fastq.gz", "fastq fastq", 806110283.0, 5342262.0, "GSM3070128 r2", "0:75.42 1:75.47", "A:243426891;C:116100169;G:117840212;T:328625621;N:117390", 75, 75, null, null, 243426891, 116100169, 117840212, 328625621, 117390, "SRX3856789", "SRS3100381", "SRA675960", "GEO", "Hubrecht Institute", 2, 0.38141, 0.80952, 0.29221, 0.37995, 0.96546, 0.93381, 0.54149, 0.55378, 75, 76, "T", "B", "mate1 technical by mapping diff", "illumina", "nextseq", "unknown", "random_priming", "trueseq", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-03-28", "Undetermined", "Undetermined", "Blood", "Hematopoietic System"], [47943, "SRR6908671", "SRX3856789", "SRS3100381", "SRP136633", "PRJNA446034", "Cell type purification by single cell transcriptome trained sorting", "GSE112438", "Other", "Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.", null, "pubmed:31585086", null, "WKM2 classicalgate eosinophils", "GSM3070128", null, "tissue:WKM2 classicalgate eosinophils|FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils", "WKM2 classicalgate eosinophils", "In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode", "WKM2 classicalgate eosinophils", null, "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", null, "FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils", "GSM3070128", "GSM3070128: WKM2 classicalgate eosinophils; Danio rerio; RNA Seq", "GSM3070128", null, "1", "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", "GEO Accession:GSM3070128", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP136633", null, null, "WKM2_classicalgate-eosinophils_L003_R1_001.fastq.gz WKM2_classicalgate-eosinophils_L003_R2_001.fastq.gz", "fastq fastq", 924045470.0, 6123105.0, "GSM3070128 r3", "0:75.44 1:75.47", "A:276824263;C:133108077;G:134012420;T:380008370;N:92340", 75, 75, null, null, 276824263, 133108077, 134012420, 380008370, 92340, "SRX3856789", "SRS3100381", "SRA675960", "GEO", "Hubrecht Institute", 2, 0.3819, 0.81801, 0.29161, 0.38224, 0.97124, 0.92809, 0.53982, 0.54629, 76, 76, "T", "B", "mate1 technical by mapping diff", "illumina", "nextseq", "unknown", "random_priming", "trueseq", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-03-28", "Undetermined", "Undetermined", "Blood", "Hematopoietic System"], [47944, "SRR6908672", "SRX3856789", "SRS3100381", "SRP136633", "PRJNA446034", "Cell type purification by single cell transcriptome trained sorting", "GSE112438", "Other", "Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.", null, "pubmed:31585086", null, "WKM2 classicalgate eosinophils", "GSM3070128", null, "tissue:WKM2 classicalgate eosinophils|FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils", "WKM2 classicalgate eosinophils", "In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode", "WKM2 classicalgate eosinophils", null, "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", null, "FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils", "GSM3070128", "GSM3070128: WKM2 classicalgate eosinophils; Danio rerio; RNA Seq", "GSM3070128", null, "1", "post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters", "GEO Accession:GSM3070128", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP136633", null, null, "WKM2_classicalgate-eosinophils_L004_R1_001.fastq.gz WKM2_classicalgate-eosinophils_L004_R2_001.fastq.gz", "fastq fastq", 867397884.0, 5748519.0, "GSM3070128 r4", "0:75.43 1:75.46", "A:260294749;C:124376674;G:127341359;T:355314902;N:70200", 75, 75, null, null, 260294749, 124376674, 127341359, 355314902, 70200, "SRX3856789", "SRS3100381", "SRA675960", "GEO", "Hubrecht Institute", 2, 0.37148, 0.80708, 0.28632, 0.3846, 0.97299, 0.94474, 0.5375, 0.54419, 76, 76, "T", "B", "mate1 technical by mapping diff", "illumina", "nextseq", "unknown", "random_priming", "trueseq", "sc", "single_cell_plate", "celseq", null, "Netherlands", "2018-03-28", "Undetermined", "Undetermined", "Blood", "Hematopoietic System"], [52175, "SRR10902872", "SRX7571042", "SRS6006643", "SRP194254", "PRJNA540466", "Characterization of the zebrafish cell landscape at single cell resolution", "GSE130487", "Transcriptome Analysis", "Zebrafish have been found to be a premier model organism in biological and regeneration research. However  the comprehensive cell compositions and molecular dynamics during tissue regeneration in zebrafish remain poorly understood. Here  we utilized Microwell seq to analyze more than 250 000 single cells covering major zebrafish cell types and constructed a systematic zebrafish cell landscape. We revealed single cell compositions for 18 zebrafish tissue types covering both embryo and adult stages. Single cell mapping of caudal fin regeneration revealed a unique characteristic of blastema population and key genetic regulation involved in zebrafish tissue repair. Overall  our single cell datasets demonstrate the utility of zebrafish cell landscape resources in various fields of biological research. Overall design: Expression profiling by high throughput sequencing of major zebrafish organ types. Please note that 19 samples were added and 9 samples were deleted on Mar 1  2022.", null, "pubmed:34660600", null, "Blood 2", "GSM4274618", null, "source name:blood|strain:Tubingen|tissue:blood|genotype:wild type", "Blood 2", "Base calls were performed with Illumina bcl2fastq Sequenced reads were trimmed for adaptor sequence.Then reads in bam files were tagged with the cell and molecular UMI barcode sequences using Drop seq tools 1.12.The cell barcodes are tagged as XC in the bam file and the UMI is tagged as XM in the bam file. The reads quality under 10 were removed. ScRNA seq reads were aligned to the Danio rerio GRCz10 genome assembly using STAR version 2.5.2a  with default configurations. Next  merge the STAR alignment tagged bam SAM to recover cell /molecular barcodes and the reads are annotated with exon tags. Last  we demultiplexed all cell barcodes taken into consideration for the analysis from the exon tagged bam files to get a digital expression matrix based on UMI counts. Genome build: Danio rerio GRCz10 Supplementary files format and content: tab delimited text files of digital expression matrix dge based on raw UMI counts  columns are cells  and rows are genes.", "blood", null, "Tissue dissociation and  single cell lysate Library preparations were performed with the Microwell seq protocol", null, "strain:Tubingen|tissue:blood|genotype:wild type", "GSM4274618", "GSM4274618: Blood 2; Danio rerio; RNA Seq", "GSM4274618", null, "1", "Tissue dissociation and  single cell lysate Library preparations were performed with the Microwell seq protocol", "GEO Accession:GSM4274618", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP194254", null, "assembly:GRCz10|intentional duplicate", "Blood2.bam", "bam", 31418773850.0, 104035675.0, "GSM4274618 r1", "0:151 1:151", "A:8027580943;C:5644210831;G:5587896051;T:12151089233;N:7996792", 151, 151, null, null, 8027580943, 5644210831, 5587896051, 12151089233, 7996792, "SRX7571042", "SRS6006643", "SRA880843", "GEO", "Zhejiang University", 2, 8e-05, 0.56276, 0.0, 0.04786, 0.99991, 0.88363, 0.75, 0.53078, 151, 151, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "microwellseq", null, "China", "2020-01-16", "Undetermined", "Multi-stage", "Blood", "Hematopoietic System"], [52176, "SRR10902871", "SRX7571041", "SRS6006642", "SRP194254", "PRJNA540466", "Characterization of the zebrafish cell landscape at single cell resolution", "GSE130487", "Transcriptome Analysis", "Zebrafish have been found to be a premier model organism in biological and regeneration research. However  the comprehensive cell compositions and molecular dynamics during tissue regeneration in zebrafish remain poorly understood. Here  we utilized Microwell seq to analyze more than 250 000 single cells covering major zebrafish cell types and constructed a systematic zebrafish cell landscape. We revealed single cell compositions for 18 zebrafish tissue types covering both embryo and adult stages. Single cell mapping of caudal fin regeneration revealed a unique characteristic of blastema population and key genetic regulation involved in zebrafish tissue repair. Overall  our single cell datasets demonstrate the utility of zebrafish cell landscape resources in various fields of biological research. Overall design: Expression profiling by high throughput sequencing of major zebrafish organ types. Please note that 19 samples were added and 9 samples were deleted on Mar 1  2022.", null, "pubmed:34660600", null, "Blood 1", "GSM4274617", null, "source name:blood|strain:Tubingen|tissue:blood|genotype:wild type", "Blood 1", "Base calls were performed with Illumina bcl2fastq Sequenced reads were trimmed for adaptor sequence.Then reads in bam files were tagged with the cell and molecular UMI barcode sequences using Drop seq tools 1.12.The cell barcodes are tagged as XC in the bam file and the UMI is tagged as XM in the bam file. The reads quality under 10 were removed. ScRNA seq reads were aligned to the Danio rerio GRCz10 genome assembly using STAR version 2.5.2a  with default configurations. Next  merge the STAR alignment tagged bam SAM to recover cell /molecular barcodes and the reads are annotated with exon tags. Last  we demultiplexed all cell barcodes taken into consideration for the analysis from the exon tagged bam files to get a digital expression matrix based on UMI counts. Genome build: Danio rerio GRCz10 Supplementary files format and content: tab delimited text files of digital expression matrix dge based on raw UMI counts  columns are cells  and rows are genes.", "blood", null, "Tissue dissociation and  single cell lysate Library preparations were performed with the Microwell seq protocol", null, "strain:Tubingen|tissue:blood|genotype:wild type", "GSM4274617", "GSM4274617: Blood 1; Danio rerio; RNA Seq", "GSM4274617", null, "1", "Tissue dissociation and  single cell lysate Library preparations were performed with the Microwell seq protocol", "GEO Accession:GSM4274617", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP194254", null, "assembly:GRCz10|intentional duplicate", "Blood1.bam", "bam", 14970178354.0, 49570127.0, "GSM4274617 r1", "0:151 1:151", "A:3767585238;C:2725333545;G:2707312228;T:5766389198;N:3558145", 151, 151, null, null, 3767585238, 2725333545, 2707312228, 5766389198, 3558145, "SRX7571041", "SRS6006642", "SRA880843", "GEO", "Zhejiang University", 2, 0.0, 0.58542, 0.0, 0.0298, 1.0, 0.89033, null, 0.53826, 151, 151, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "microwellseq", null, "China", "2020-01-16", "Undetermined", "Multi-stage", "Blood", "Hematopoietic System"], [52200, "SRR8991406", "SRX5770474", "SRS4704583", "SRP194254", "PRJNA540466", "Characterization of the zebrafish cell landscape at single cell resolution", "GSE130487", "Transcriptome Analysis", "Zebrafish have been found to be a premier model organism in biological and regeneration research. However  the comprehensive cell compositions and molecular dynamics during tissue regeneration in zebrafish remain poorly understood. Here  we utilized Microwell seq to analyze more than 250 000 single cells covering major zebrafish cell types and constructed a systematic zebrafish cell landscape. We revealed single cell compositions for 18 zebrafish tissue types covering both embryo and adult stages. Single cell mapping of caudal fin regeneration revealed a unique characteristic of blastema population and key genetic regulation involved in zebrafish tissue repair. Overall  our single cell datasets demonstrate the utility of zebrafish cell landscape resources in various fields of biological research. Overall design: Expression profiling by high throughput sequencing of major zebrafish organ types. Please note that 19 samples were added and 9 samples were deleted on Mar 1  2022.", null, "pubmed:34660600", null, "Spleen3", "GSM3740959", null, "source name:spleen|strain:Tubingen|genotype:wild type|tissue:spleen", "Spleen3", "The drop seq core computational tool was used for preprocessing of the Microwell seq data. The implementation is described in the Drop seq computational cookbook http://mccarrolllab.org/dropseq/. Base calls were performed with Illumina bcl2fastq Sequenced reads were trimmed for adaptor sequence.Then reads in bam files were tagged with the cell and molecular UMI barcode sequences using Drop seq tools 1.12.The cell barcodes are tagged as XC in the bam file and the UMI is tagged as XM in the bam file. The reads quality under 10 were removed. ScRNA seq reads were aligned to the Danio rerio GRCz10 genome assembly using STAR version 2.5.2a  with default configurations. Next  merge the STAR alignment tagged bam SAM to recover cell /molecular barcodes and the reads are annotated with exon tags. Last  we demultiplexed all cell barcodes taken into consideration for the analysis from the exon tagged bam files to get a digital expression matrix based on UMI counts. Genome build: http://dec2017.archive.ensembl.org/Danio rerio/Info/Index Supplementary files format and content: tab delimited text files of digital expression matrix dge based on raw UMI counts  columns are cells  and rows are genes.", "spleen", null, "Tissue dissociation and  single cell lysate Library preparations were performed with the Microwell seq protocol", null, "strain:Tubingen|genotype:wild type|tissue:spleen", "GSM3740959", "GSM3740959: Spleen3; Danio rerio; RNA Seq", "GSM3740959", null, "1", "Tissue dissociation and  single cell lysate Library preparations were performed with the Microwell seq protocol", "GEO Accession:GSM3740959", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq X Ten", null, "SRP194254", null, "assembly:Danio rerio GRCz10", "Spleen3.bam", "bam", 29617062386.0, 98069743.0, "GSM3740959 r1", "0:151 1:151", "A:7464139749;C:4972084318;G:5132144813;T:11970808438;N:77885068", 151, 151, null, null, 7464139749, 4972084318, 5132144813, 11970808438, 77885068, "SRX5770474", "SRS4704583", "SRA880843", "GEO", "Zhejiang University", 2, 0.0, 0.7261, 0.0, 0.03774, 1.0, 0.86275, null, 0.5339, 151, 151, "T", "B", "mate1 technical by mapping diff", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "microwellseq", null, "China", "2019-04-30", "Undetermined", "Multi-stage", "Spleen", "Hematopoietic System"], [59515, "SRR11926689", "SRX8472335", "SRS6772936", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "WT5", "GSM4591370", null, "tissue:Healthy sorted thymus|cell type:thymocytes|genotype:Tglck:GFP|tumor stg:healthy|lab of sample collection and sequencing:Frazer lab", "WT5", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "Healthy sorted  thymus", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:thymocytes|genotype:Tglck:GFP|tumor stg:healthy|lab of sample collection and sequencing:Frazer lab", "GSM4591370", "GSM4591370: WT5; Danio rerio; RNA Seq", "GSM4591370", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591370", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 3000", null, "SRP265974", null, null, "FWTsample_5.fastq.gz FWTsample_5_R2.fastq.gz", "fastq fastq", 4633582858.0, 22938529.0, "GSM4591370 r1", "0:101 1:101", "A:1263929939;C:1047240206;G:1052800791;T:1263574247;N:6037675", 101, 101, null, null, 1263929939, 1047240206, 1052800791, 1263574247, 6037675, "SRX8472335", "SRS6772936", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 2, 0.91347, 0.91728, 0.27187, 0.27409, 0.76585, 0.76859, 0.45662, 0.48071, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [59516, "SRR11926688", "SRX8472334", "SRS6772935", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "WT4", "GSM4591369", null, "tissue:Healthy sorted thymus|cell type:thymocytes|genotype:Tglck:GFP|tumor stg:healthy|lab of sample collection and sequencing:Frazer lab", "WT4", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "Healthy sorted  thymus", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:thymocytes|genotype:Tglck:GFP|tumor stg:healthy|lab of sample collection and sequencing:Frazer lab", "GSM4591369", "GSM4591369: WT4; Danio rerio; RNA Seq", "GSM4591369", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591369", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 3000", null, "SRP265974", null, null, "FWTsample_4.fastq.gz FWTsample_4_R2.fastq.gz", "fastq fastq", 4113149600.0, 20565748.0, "GSM4591369 r1", "0:100 1:100", "A:1084628064;C:963840734;G:985823964;T:1078691018;N:165820", 100, 100, null, null, 1084628064, 963840734, 985823964, 1078691018, 165820, "SRX8472334", "SRS6772935", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 2, 0.9336, 0.93539, 0.11919, 0.11989, 0.76368, 0.76757, 0.4904, 0.47498, 100, 100, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [59517, "SRR11926687", "SRX8472333", "SRS6772934", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "WT3", "GSM4591368", null, "tissue:Healthy sorted thymus|cell type:thymocytes|genotype:Tglck:GFP|tumor stg:healthy|lab of sample collection and sequencing:Frazer lab", "WT3", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "Healthy sorted  thymus", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:thymocytes|genotype:Tglck:GFP|tumor stg:healthy|lab of sample collection and sequencing:Frazer lab", "GSM4591368", "GSM4591368: WT3; Danio rerio; RNA Seq", "GSM4591368", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591368", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 3000", null, "SRP265974", null, null, "FWTsample_3_R2.fastq.gz FWTsample_3.fastq.gz", "fastq fastq", 3966667200.0, 19833336.0, "GSM4591368 r1", "0:100 1:100", "A:1125938234;C:857622800;G:856236104;T:1122434590;N:4435472", 100, 100, null, null, 1125938234, 857622800, 856236104, 1122434590, 4435472, "SRX8472333", "SRS6772934", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 2, 0.93918, 0.92495, 0.16292, 0.15907, 0.75866, 0.76883, 0.51794, 0.51278, 100, 100, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [59518, "SRR11926686", "SRX8472332", "SRS6772933", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "WT2", "GSM4591367", null, "tissue:Healthy sorted thymus|cell type:thymocytes|genotype:Tglck:GFP|tumor stg:healthy|lab of sample collection and sequencing:Frazer lab", "WT2", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "Healthy sorted  thymus", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:thymocytes|genotype:Tglck:GFP|tumor stg:healthy|lab of sample collection and sequencing:Frazer lab", "GSM4591367", "GSM4591367: WT2; Danio rerio; RNA Seq", "GSM4591367", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591367", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 3000", null, "SRP265974", null, null, "FWTsample_2_R2.fastq.gz FWTsample_2.fastq.gz", "fastq fastq", 3598961400.0, 17994807.0, "GSM4591367 r1", "0:100 1:100", "A:982353707;C:818188790;G:810911943;T:983465623;N:4041337", 100, 100, null, null, 982353707, 818188790, 810911943, 983465623, 4041337, "SRX8472332", "SRS6772933", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 2, 0.93426, 0.9195, 0.12591, 0.12501, 0.76763, 0.77621, 0.49491, 0.50063, 100, 100, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [59519, "SRR11926685", "SRX8472331", "SRS6772932", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "WT1", "GSM4591366", null, "tissue:Healthy sorted thymus|cell type:thymocytes|genotype:Tglck:GFP|tumor stg:healthy|lab of sample collection and sequencing:Frazer lab", "WT1", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "Healthy sorted  thymus", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:thymocytes|genotype:Tglck:GFP|tumor stg:healthy|lab of sample collection and sequencing:Frazer lab", "GSM4591366", "GSM4591366: WT1; Danio rerio; RNA Seq", "GSM4591366", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591366", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 3000", null, "SRP265974", null, null, "FWTsample_1_R2.fastq.gz FWTsample_1.fastq.gz", "fastq fastq", 3686706000.0, 18433530.0, "GSM4591366 r1", "0:100 1:100", "A:1004954280;C:838347690;G:833756041;T:1005493425;N:4154564", 100, 100, null, null, 1004954280, 838347690, 833756041, 1005493425, 4154564, "SRX8472331", "SRS6772932", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 2, 0.93171, 0.91783, 0.13677, 0.13606, 0.76723, 0.7752, 0.51062, 0.50949, 100, 100, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [59520, "SRR11926684", "SRX8472330", "SRS6772931", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "SPL002", "GSM4591365", null, "tissue:shrek preleukemic thymocytes|cell type:thymocytes|genotype:shrek;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab", "SPL002", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "shrek preleukemic thymocytes", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:thymocytes|genotype:shrek;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab", "GSM4591365", "GSM4591365: SPL002; Danio rerio; RNA Seq", "GSM4591365", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591365", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 3000", null, "SRP265974", null, null, "Fsample_48.fastq.gz Fsample_48_R2.fastq.gz", "fastq fastq", 23525993582.0, 77900641.0, "GSM4591365 r1", "0:151 1:151", "A:6365057472;C:5454588670;G:5620997543;T:6082859005;N:2490892", 151, 151, null, null, 6365057472, 5454588670, 5620997543, 6082859005, 2490892, "SRX8472330", "SRS6772931", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 2, 0.96011, 0.96113, 0.23076, 0.22681, 0.80858, 0.81221, 0.52577, 0.51928, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [59521, "SRR11926683", "SRX8472329", "SRS6772930", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "SPL001", "GSM4591364", null, "tissue:shrek preleukemic thymocytes|cell type:thymocytes|genotype:shrek;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab", "SPL001", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "shrek preleukemic thymocytes", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:thymocytes|genotype:shrek;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab", "GSM4591364", "GSM4591364: SPL001; Danio rerio; RNA Seq", "GSM4591364", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591364", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 3000", null, "SRP265974", null, null, "Fsample_47.fastq.gz Fsample_47_R2.fastq.gz", "fastq fastq", 26795594770.0, 88727135.0, "GSM4591364 r1", "0:151 1:151", "A:7305822132;C:6082789601;G:6442162847;T:6961938191;N:2881999", 151, 151, null, null, 7305822132, 6082789601, 6442162847, 6961938191, 2881999, "SRX8472329", "SRS6772930", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 2, 0.96139, 0.96343, 0.22215, 0.2185, 0.81296, 0.81647, 0.50868, 0.51446, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [59532, "SRR11926672", "SRX8472318", "SRS6772919", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "OPL4", "GSM4591353", null, "tissue:otg preleukemic thymocytes|cell type:thymocytes|genotype:otg;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab", "OPL4", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "otg preleukemic thymocytes", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:thymocytes|genotype:otg;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab", "GSM4591353", "GSM4591353: OPL4; Danio rerio; RNA Seq", "GSM4591353", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591353", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 3000", null, "SRP265974", null, null, "Fsample_36.fastq.gz Fsample_36_R2.fastq.gz", "fastq fastq", 4686865610.0, 23202305.0, "GSM4591353 r1", "0:101 1:101", "A:1290395271;C:1046629683;G:1049444449;T:1294288823;N:6107384", 101, 101, null, null, 1290395271, 1046629683, 1049444449, 1294288823, 6107384, "SRX8472318", "SRS6772919", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 2, 0.92236, 0.92454, 0.31359, 0.31617, 0.76625, 0.76779, 0.48273, 0.47205, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [59533, "SRR11926671", "SRX8472317", "SRS6772918", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "OPL3", "GSM4591352", null, "tissue:otg preleukemic thymocytes|cell type:thymocytes|genotype:otg;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab", "OPL3", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "otg preleukemic thymocytes", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:thymocytes|genotype:otg;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab", "GSM4591352", "GSM4591352: OPL3; Danio rerio; RNA Seq", "GSM4591352", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591352", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 3000", null, "SRP265974", null, null, "Fsample_35_R2.fastq.gz Fsample_35.fastq.gz", "fastq fastq", 6253893538.0, 30959869.0, "GSM4591352 r1", "0:101 1:101", "A:1720308233;C:1397371474;G:1404797248;T:1723210472;N:8206111", 101, 101, null, null, 1720308233, 1397371474, 1404797248, 1723210472, 8206111, "SRX8472317", "SRS6772918", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 2, 0.93192, 0.93318, 0.35833, 0.3632, 0.78518, 0.78788, 0.48278, 0.48009, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [59534, "SRR11926670", "SRX8472316", "SRS6772917", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "OPL2", "GSM4591351", null, "tissue:otg preleukemic thymocytes|cell type:thymocytes|genotype:otg;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab", "OPL2", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "otg preleukemic thymocytes", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:thymocytes|genotype:otg;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab", "GSM4591351", "GSM4591351: OPL2; Danio rerio; RNA Seq", "GSM4591351", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591351", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 3000", null, "SRP265974", null, null, "Fsample_34_R2.fastq.gz Fsample_34.fastq.gz", "fastq fastq", 5351903948.0, 26494574.0, "GSM4591351 r1", "0:101 1:101", "A:1442793834;C:1227325750;G:1233975738;T:1440891564;N:6917062", 101, 101, null, null, 1442793834, 1227325750, 1233975738, 1440891564, 6917062, "SRX8472316", "SRS6772917", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 2, 0.92964, 0.93101, 0.21706, 0.2185, 0.76497, 0.76848, 0.47634, 0.48247, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [59535, "SRR11926669", "SRX8472315", "SRS6772916", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "OPL1", "GSM4591350", null, "tissue:otg preleukemic thymocytes|cell type:thymocytes|genotype:otg;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab", "OPL1", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "otg preleukemic thymocytes", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:thymocytes|genotype:otg;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab", "GSM4591350", "GSM4591350: OPL1; Danio rerio; RNA Seq", "GSM4591350", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591350", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 3000", null, "SRP265974", null, null, "Fsample_33.fastq.gz Fsample_33_R2.fastq.gz", "fastq fastq", 5499039536.0, 27222968.0, "GSM4591350 r1", "0:101 1:101", "A:1515036859;C:1226882670;G:1229198085;T:1520688016;N:7233906", 101, 101, null, null, 1515036859, 1226882670, 1229198085, 1520688016, 7233906, "SRX8472315", "SRS6772916", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 2, 0.92637, 0.92762, 0.31857, 0.32243, 0.76769, 0.77116, 0.46456, 0.46584, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [59546, "SRR11926658", "SRX8472304", "SRS6772905", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "MPL3", "GSM4591339", null, "tissue:hMYC preleukemic thymocytes|cell type:thymocytes|genotype:Tgrag2:hMYC  Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab", "MPL3", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "hMYC preleukemic thymocytes", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:thymocytes|genotype:Tgrag2:hMYC  Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab", "GSM4591339", "GSM4591339: MPL3; Danio rerio; RNA Seq", "GSM4591339", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591339", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 3000", null, "SRP265974", null, null, "Fsample_21.fastq.gz Fsample_21_R2.fastq.gz", "fastq fastq", 8876009218.0, 29390759.0, "GSM4591339 r1", "0:151 1:151", "A:2397445782;C:2052027740;G:2018874313;T:2405562242;N:2099141", 151, 151, null, null, 2397445782, 2052027740, 2018874313, 2405562242, 2099141, "SRX8472304", "SRS6772905", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 2, 0.92414, 0.9227, 0.2461, 0.23997, 0.78841, 0.79506, 0.50203, 0.5018, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [59547, "SRR11926657", "SRX8472303", "SRS6772904", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "MPL2", "GSM4591338", null, "tissue:hMYC preleukemic thymocytes|cell type:thymocytes|genotype:Tgrag2:hMYC  Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab", "MPL2", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "hMYC preleukemic thymocytes", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:thymocytes|genotype:Tgrag2:hMYC  Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab", "GSM4591338", "GSM4591338: MPL2; Danio rerio; RNA Seq", "GSM4591338", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591338", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 3000", null, "SRP265974", null, null, "Fsample_20.fastq.gz Fsample_20_R2.fastq.gz", "fastq fastq", 8942441970.0, 29610735.0, "GSM4591338 r1", "0:151 1:151", "A:2434196467;C:2047066969;G:2021293350;T:2437752994;N:2132190", 151, 151, null, null, 2434196467, 2047066969, 2021293350, 2437752994, 2132190, "SRX8472303", "SRS6772904", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 2, 0.9147, 0.91499, 0.22028, 0.2117, 0.77713, 0.78334, 0.50243, 0.49838, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [59548, "SRR11926656", "SRX8472302", "SRS6772903", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "MPL1", "GSM4591337", null, "tissue:hMYC preleukemic thymocytes|cell type:thymocytes|genotype:Tgrag2:hMYC  Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab", "MPL1", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "hMYC preleukemic thymocytes", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:thymocytes|genotype:Tgrag2:hMYC  Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab", "GSM4591337", "GSM4591337: MPL1; Danio rerio; RNA Seq", "GSM4591337", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591337", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 3000", null, "SRP265974", null, null, "Fsample_19.fastq.gz Fsample_19_R2.fastq.gz", "fastq fastq", 9778540144.0, 32379272.0, "GSM4591337 r1", "0:151 1:151", "A:2676504038;C:2223347787;G:2177506547;T:2698864055;N:2317717", 151, 151, null, null, 2676504038, 2223347787, 2177506547, 2698864055, 2317717, "SRX8472302", "SRS6772903", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 2, 0.91346, 0.91413, 0.29555, 0.28893, 0.79078, 0.79825, 0.49875, 0.50518, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [59549, "SRR11926655", "SRX8472301", "SRS6772902", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "HPL3", "GSM4591336", null, "tissue:hulk mutant preleukemic thymocytes|cell type:thymocytes|genotype:hulk;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab", "HPL3", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "hulk mutant preleukemic thymocytes", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:thymocytes|genotype:hulk;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab", "GSM4591336", "GSM4591336: HPL3; Danio rerio; RNA Seq", "GSM4591336", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591336", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 3000", null, "SRP265974", null, null, "Fsample_12.fastq.gz Fsample_12_R2.fastq.gz", "fastq fastq", 3378760800.0, 16893804.0, "GSM4591336 r1", "0:100 1:100", "A:869653801;C:820588210;G:823025653;T:861750769;N:3742367", 100, 100, null, null, 869653801, 820588210, 823025653, 861750769, 3742367, "SRX8472301", "SRS6772902", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 2, 0.93754, 0.92151, 0.17513, 0.16969, 0.79922, 0.8071, 0.63894, 0.61913, 100, 100, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [59550, "SRR11926654", "SRX8472300", "SRS6772901", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "HPL2", "GSM4591335", null, "tissue:hulk mutant preleukemic thymocytes|cell type:thymocytes|genotype:hulk;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab", "HPL2", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "hulk mutant preleukemic thymocytes", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:thymocytes|genotype:hulk;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab", "GSM4591335", "GSM4591335: HPL2; Danio rerio; RNA Seq", "GSM4591335", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591335", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 3000", null, "SRP265974", null, null, "Fsample_11.fastq.gz Fsample_11_R2.fastq.gz", "fastq fastq", 3276290400.0, 16381452.0, "GSM4591335 r1", "0:100 1:100", "A:909076954;C:730010076;G:728583319;T:904911154;N:3708897", 100, 100, null, null, 909076954, 730010076, 728583319, 904911154, 3708897, "SRX8472300", "SRS6772901", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 2, 0.93409, 0.92023, 0.18134, 0.18141, 0.78108, 0.78981, 0.53659, 0.52431, 100, 100, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [59551, "SRR11926653", "SRX8472299", "SRS6772900", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "HPL1", "GSM4591334", null, "tissue:hulk mutant preleukemic thymocytes|cell type:thymocytes|genotype:hulk;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab", "HPL1", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "hulk mutant preleukemic thymocytes", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:thymocytes|genotype:hulk;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab", "GSM4591334", "GSM4591334: HPL1; Danio rerio; RNA Seq", "GSM4591334", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591334", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 3000", null, "SRP265974", null, null, "Fsample_10.fastq.gz Fsample_10_R2.fastq.gz", "fastq fastq", 3700727800.0, 18503639.0, "GSM4591334 r1", "0:100 1:100", "A:1028412839;C:821049620;G:815741395;T:1031399520;N:4124426", 100, 100, null, null, 1028412839, 821049620, 815741395, 1031399520, 4124426, "SRX8472299", "SRS6772900", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 2, 0.93381, 0.92058, 0.22321, 0.22223, 0.73655, 0.74732, 0.4822, 0.48829, 100, 100, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [59579, "SRR11926625", "SRX8472271", "SRS6772872", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "AB thymus 9", "GSM4591306", null, "tissue:Healthy dissected thymus|cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab", "AB thymus 9", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "Healthy dissected  thymus", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab", "GSM4591306", "GSM4591306: AB thymus 9; Danio rerio; RNA Seq", "GSM4591306", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591306", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP265974", null, null, "sample_6.fastq.gz", "fastq", 2786385619.0, 36888152.0, "GSM4591306 r1", "0:75.54 1:0", "A:663089588;C:692060734;G:651825670;T:779197417;N:212210", 75, 0, null, null, 663089588, 692060734, 651825670, 779197417, 212210, "SRX8472271", "SRS6772872", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 1, 0.94942, null, 0.05717, null, 0.73018, null, 0.49009, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [59580, "SRR11926624", "SRX8472270", "SRS6772871", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "AB thymus 8", "GSM4591305", null, "tissue:Healthy dissected thymus|cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab", "AB thymus 8", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "Healthy dissected  thymus", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab", "GSM4591305", "GSM4591305: AB thymus 8; Danio rerio; RNA Seq", "GSM4591305", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591305", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP265974", null, null, "sample_5.fastq.gz", "fastq", 2456067469.0, 32519095.0, "GSM4591305 r1", "0:75.53 1:0", "A:606304745;C:594426559;G:556316196;T:698842180;N:177789", 75, 0, null, null, 606304745, 594426559, 556316196, 698842180, 177789, "SRX8472270", "SRS6772871", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 1, 0.94282, null, 0.08874, null, 0.70851, null, 0.49253, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [59581, "SRR11926623", "SRX8472269", "SRS6772870", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "AB thymus 7", "GSM4591304", null, "tissue:Healthy dissected thymus|cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab", "AB thymus 7", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "Healthy dissected  thymus", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab", "GSM4591304", "GSM4591304: AB thymus 7; Danio rerio; RNA Seq", "GSM4591304", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591304", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP265974", null, null, "sample_4.fastq.gz", "fastq", 2889915115.0, 38259114.0, "GSM4591304 r1", "0:75.54 1:0", "A:694082728;C:713330573;G:669832103;T:812454853;N:214858", 75, 0, null, null, 694082728, 713330573, 669832103, 812454853, 214858, "SRX8472269", "SRS6772870", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 1, 0.94794, null, 0.06446, null, 0.72697, null, 0.49962, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [59582, "SRR11926622", "SRX8472268", "SRS6772869", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "AB thymus 2 3 5 6", "GSM4591303", null, "tissue:Healthy dissected thymus|cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab", "AB thymus 2 3 5 6", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "Healthy dissected  thymus", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab", "GSM4591303", "GSM4591303: AB thymus 2 3 5 6; Danio rerio; RNA Seq", "GSM4591303", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591303", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP265974", null, null, "sample_3.fastq.gz", "fastq", 2338535479.0, 30955998.0, "GSM4591303 r1", "0:75.54 1:0", "A:540165709;C:595429439;G:553807340;T:648952381;N:180610", 75, 0, null, null, 540165709, 595429439, 553807340, 648952381, 180610, "SRX8472268", "SRS6772869", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 1, 0.94992, null, 0.04962, null, 0.73032, null, 0.4837, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [59583, "SRR11926621", "SRX8472267", "SRS6772868", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "AB thymus 11", "GSM4591302", null, "tissue:Healthy dissected thymus|cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab", "AB thymus 11", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "Healthy dissected  thymus", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab", "GSM4591302", "GSM4591302: AB thymus 11; Danio rerio; RNA Seq", "GSM4591302", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591302", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP265974", null, null, "sample_2.fastq.gz", "fastq", 2942053849.0, 38949737.0, "GSM4591302 r1", "0:75.53 1:0", "A:688398915;C:734856328;G:694653408;T:823920342;N:224856", 75, 0, null, null, 688398915, 734856328, 694653408, 823920342, 224856, "SRX8472267", "SRS6772868", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 1, 0.94862, null, 0.06975, null, 0.72224, null, 0.49305, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [59584, "SRR11926620", "SRX8472266", "SRS6772867", "SRP265974", "PRJNA637328", "A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models", "GSE151816", "Transcriptome Analysis", "We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes", null, "pubmed:32591643", null, "AB thymus 10", "GSM4591301", null, "tissue:Healthy dissected thymus|cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab", "AB thymus 10", "First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts", "Healthy dissected  thymus", null, "Truseq stranded mRNA library prep illumina  #20020594", null, "cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab", "GSM4591301", "GSM4591301: AB thymus 10; Danio rerio; RNA Seq", "GSM4591301", null, "1", "Truseq stranded mRNA library prep illumina  #20020594", "GEO Accession:GSM4591301", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP265974", null, null, "sample_1.fastq.gz", "fastq", 2923525817.0, 38707354.0, "GSM4591301 r1", "0:75.53 1:0", "A:697204107;C:721945575;G:689048693;T:815100976;N:226466", 75, 0, null, null, 697204107, 721945575, 689048693, 815100976, 226466, "SRX8472266", "SRS6772867", "SRA1083220", "GEO", "Center for Medical Genetics, Ghent University", 1, 0.94964, null, 0.05377, null, 0.71904, null, 0.4902, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2020-06-04", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [63895, "SRR14213371", "SRX10579916", "SRS8684384", "SRP314470", "PRJNA721381", "RNA Seq from zebrafish adult tissues", "GSE171906", "Transcriptome Analysis", "The goal of this study was to profile transcript expression levels across zebrafish adult tissues. Overall design: Transcriptome profiles of nine zebrafish adult tissues. Every tissue contains triplicates.", null, "pubmed:34556579", null, "Spleen3", "GSM5237140", null, "source name:zebrafish spleen|genotype:wild type|tissue:spleen|strain:TLAB", "Spleen3", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 102. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing TPM", "zebrafish spleen", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. Strand specific cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:wild type|tissue:spleen|strain:TLAB", "GSM5237140", "GSM5237140: Spleen3; Danio rerio; RNA Seq", "GSM5237140", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. Strand specific cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM5237140", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP314470", null, null, "Spleen3.fastq", "fastq", 2469245600.0, 24692456.0, "GSM5237140 r1", "0:100", "A:595265067;C:649103304;G:625399353;T:599383209;N:94667", 100, null, null, null, 595265067, 649103304, 625399353, 599383209, 94667, "SRX10579916", "SRS8684384", "SRA1217576", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.9388, null, 0.16508, null, 0.75205, null, 0.59719, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2021-04-12", "Undetermined", "Undetermined", "Spleen", "Hematopoietic System"], [63896, "SRR14213370", "SRX10579915", "SRS8684383", "SRP314470", "PRJNA721381", "RNA Seq from zebrafish adult tissues", "GSE171906", "Transcriptome Analysis", "The goal of this study was to profile transcript expression levels across zebrafish adult tissues. Overall design: Transcriptome profiles of nine zebrafish adult tissues. Every tissue contains triplicates.", null, "pubmed:34556579", null, "Spleen2", "GSM5237139", null, "source name:zebrafish spleen|genotype:wild type|tissue:spleen|strain:TLAB", "Spleen2", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 102. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing TPM", "zebrafish spleen", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. Strand specific cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:wild type|tissue:spleen|strain:TLAB", "GSM5237139", "GSM5237139: Spleen2; Danio rerio; RNA Seq", "GSM5237139", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. Strand specific cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM5237139", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP314470", null, null, "Spleen2.fastq", "fastq", 1372663100.0, 13726631.0, "GSM5237139 r1", "0:100", "A:303080845;C:392345861;G:369765807;T:307418421;N:52166", 100, null, null, null, 303080845, 392345861, 369765807, 307418421, 52166, "SRX10579915", "SRS8684383", "SRA1217576", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.96541, null, 0.18478, null, 0.78565, null, 0.60522, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2021-04-12", "Undetermined", "Undetermined", "Spleen", "Hematopoietic System"], [63897, "SRR14213369", "SRX10579914", "SRS8684382", "SRP314470", "PRJNA721381", "RNA Seq from zebrafish adult tissues", "GSE171906", "Transcriptome Analysis", "The goal of this study was to profile transcript expression levels across zebrafish adult tissues. Overall design: Transcriptome profiles of nine zebrafish adult tissues. Every tissue contains triplicates.", null, "pubmed:34556579", null, "Spleen1", "GSM5237138", null, "source name:zebrafish spleen|genotype:wild type|tissue:spleen|strain:TLAB", "Spleen1", "Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 102. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing TPM", "zebrafish spleen", null, "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. Strand specific cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "Zebrafish Danio rerio were raised according to standard protocols 28\u00b0C water temperature; 14/10 hour light/dark cycle", "genotype:wild type|tissue:spleen|strain:TLAB", "GSM5237138", "GSM5237138: Spleen1; Danio rerio; RNA Seq", "GSM5237138", null, "1", "Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. Strand specific cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina", "GEO Accession:GSM5237138", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP314470", null, null, "Spleen1.fastq", "fastq", 2268815600.0, 22688156.0, "GSM5237138 r1", "0:100", "A:570901318;C:562128594;G:552921437;T:582778510;N:85741", 100, null, null, null, 570901318, 562128594, 552921437, 582778510, 85741, "SRX10579914", "SRS8684382", "SRA1217576", "GEO", "Pauli lab, Research Institute of Molecular Pathology", 1, 0.93633, null, 0.14981, null, 0.72825, null, 0.52073, null, 100, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "nebnext", "bulk", "unknown", "unknown", null, "Austria", "2021-04-12", "Undetermined", "Undetermined", "Spleen", "Hematopoietic System"], [67018, "SRR16973884", "SRX13164748", "SRS11095951", "SRP346708", "PRJNA781453", "WGBS and RNA seq of Danio rerio in HSPC generation", "GSE189072", "Other", "In this study  we interrogated the role of DNA methylation in HSPC generation by taking advantage of dnmt1 knockout/knockdown embryos in zebrafish. First  we generated a comprehensive DNA methylation landscape of EHT  which revealed gradually hypermethylated regions associated with vasculogenesis. Taking advantage of dnmt1 deficient embryos  we showed that the decreased DNA methylation blocked HSPC emergence. Mechanistically  we demonstrated that the decreased DNA methylation increased the expression of arterial genes and Notch signaling  thus contributing to defects in the EHT in dnmt1 deficient embryos. Herein  we identified that DNA methylation  as epigenetic regulator  participates in the negative modulation of Notch signaling through inhibiting transcription during HSPC generation in zebrafish. Overall design: WGBS and RNA seq of Danio rerio in EC HE and HSPC.", null, "pubmed:35502759", null, "HSC mut rep3 RNA", "GSM5694258", null, "tissue:hematopoietic stem cells|developmental stage:HSC|genotype:dnmt1 mutant|region:AGM", "HSC mut rep3 RNA", "Basecalls perfomed using CASAVA2.19 WGBS and RNA seq raw sequencing reads were first trimmed for adapter and low quality sequences. Then mapped to GRCz11 using BS Seeker2v2.1.8 and hisat2v2.2.1 with parameters \" t Y  m 0.04   bt2  end to end\" and \"  known splicesite infile  p 30  k 10   dta  t\" separately. Student's T test was used to perform DMR analysis for WGBS data. Gene expression level was quantified by HTSeqv0.12.4 and differentially expressed genesDEGs were determined by DESeq2v1.30.1 Genome build: GRCz11 Supplementary files format and content: RNA seq raw count matrix Supplementary files format and content: raw count.txt raw counts Supplementary files format and content: EC sib.bed DMRs of  EC sibling compared with HE sibling and HSC sibling Supplementary files format and content: HE sib.bed DMRs of  HE sibling compared with EC sibling and HSC sibling Supplementary files format and content: HSC sib.bed DMRs of  HSC sibling compared with EC sibling and HE sibling Supplementary files format and content: EC HE sib.bed DMRs of  EC and HE sibling Supplementary files format and content: HE HSC sib.bed DMRs of  HE and HSC sibling Supplementary files format and content: EC sib mut.bed DMRs of  EC sibling and EC mutant Supplementary files format and content: HE sib mut.bed DMRs of  HE sibling and HE mutant Supplementary files format and content: HSC sib mut.bed DMRs of  HSC sibling and HSC mutant", "hematopoietic stem cells", null, "Zebrafish embryos were harvested and dissected for single cell suspension. Single cell was sorted in lysis buffer by fluorescence activated cell sorting. The RNA seq library preparation and sequencing were performed based on the 3\u2032 biased single cell tagged reverse transcription sequencing STRT seq.The DNA libraries conduction were performed according to the scBS seq with some modification", null, "developmental stage:HSC|genotype:dnmt1 mutant|region:AGM", "GSM5694258", "GSM5694258: HSC mut rep3 RNA; Danio rerio; RNA Seq", "GSM5694258", null, "1", "Zebrafish embryos were harvested and dissected for single cell suspension. Single cell was sorted in lysis buffer by fluorescence activated cell sorting. The RNA seq library preparation and sequencing were performed based on the 3\u2032 biased single cell tagged reverse transcription sequencing STRT seq.The DNA libraries conduction were performed according to the scBS seq with some modification", "GEO Accession:GSM5694258", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP346708", null, "loader:fastq load.py", "HSC_sib_3_1_RNA.fq.gz HSC_sib_3_2_RNA.fq.gz", "fastq fastq", 8212205400.0, 27374018.0, "GSM5694258 r1", "0:150 1:150", "A:2309633599;C:1667340979;G:1773247570;T:2461956533;N:26719", 150, 150, null, null, 2309633599, 1667340979, 1773247570, 2461956533, 26719, "SRX13164748", "SRS11095951", "SRA1331007", "GEO", "Institute of Hematology and Blood Diseases Hospital", 2, 0.9402, 0.93297, 0.16899, 0.16784, 0.73089, 0.73665, 0.49638, 0.49263, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "strtseq", null, "China", "2021-11-18", "Undetermined", "Embryo", "Blood", "Hematopoietic System"], [67019, "SRR16973883", "SRX13164747", "SRS11095950", "SRP346708", "PRJNA781453", "WGBS and RNA seq of Danio rerio in HSPC generation", "GSE189072", "Other", "In this study  we interrogated the role of DNA methylation in HSPC generation by taking advantage of dnmt1 knockout/knockdown embryos in zebrafish. First  we generated a comprehensive DNA methylation landscape of EHT  which revealed gradually hypermethylated regions associated with vasculogenesis. Taking advantage of dnmt1 deficient embryos  we showed that the decreased DNA methylation blocked HSPC emergence. Mechanistically  we demonstrated that the decreased DNA methylation increased the expression of arterial genes and Notch signaling  thus contributing to defects in the EHT in dnmt1 deficient embryos. Herein  we identified that DNA methylation  as epigenetic regulator  participates in the negative modulation of Notch signaling through inhibiting transcription during HSPC generation in zebrafish. Overall design: WGBS and RNA seq of Danio rerio in EC HE and HSPC.", null, "pubmed:35502759", null, "HSC mut rep2 RNA", "GSM5694257", null, "tissue:hematopoietic stem cells|developmental stage:HSC|genotype:dnmt1 mutant|region:AGM", "HSC mut rep2 RNA", "Basecalls perfomed using CASAVA2.19 WGBS and RNA seq raw sequencing reads were first trimmed for adapter and low quality sequences. Then mapped to GRCz11 using BS Seeker2v2.1.8 and hisat2v2.2.1 with parameters \" t Y  m 0.04   bt2  end to end\" and \"  known splicesite infile  p 30  k 10   dta  t\" separately. Student's T test was used to perform DMR analysis for WGBS data. Gene expression level was quantified by HTSeqv0.12.4 and differentially expressed genesDEGs were determined by DESeq2v1.30.1 Genome build: GRCz11 Supplementary files format and content: RNA seq raw count matrix Supplementary files format and content: raw count.txt raw counts Supplementary files format and content: EC sib.bed DMRs of  EC sibling compared with HE sibling and HSC sibling Supplementary files format and content: HE sib.bed DMRs of  HE sibling compared with EC sibling and HSC sibling Supplementary files format and content: HSC sib.bed DMRs of  HSC sibling compared with EC sibling and HE sibling Supplementary files format and content: EC HE sib.bed DMRs of  EC and HE sibling Supplementary files format and content: HE HSC sib.bed DMRs of  HE and HSC sibling Supplementary files format and content: EC sib mut.bed DMRs of  EC sibling and EC mutant Supplementary files format and content: HE sib mut.bed DMRs of  HE sibling and HE mutant Supplementary files format and content: HSC sib mut.bed DMRs of  HSC sibling and HSC mutant", "hematopoietic stem cells", null, "Zebrafish embryos were harvested and dissected for single cell suspension. Single cell was sorted in lysis buffer by fluorescence activated cell sorting. The RNA seq library preparation and sequencing were performed based on the 3\u2032 biased single cell tagged reverse transcription sequencing STRT seq.The DNA libraries conduction were performed according to the scBS seq with some modification", null, "developmental stage:HSC|genotype:dnmt1 mutant|region:AGM", "GSM5694257", "GSM5694257: HSC mut rep2 RNA; Danio rerio; RNA Seq", "GSM5694257", null, "1", "Zebrafish embryos were harvested and dissected for single cell suspension. Single cell was sorted in lysis buffer by fluorescence activated cell sorting. The RNA seq library preparation and sequencing were performed based on the 3\u2032 biased single cell tagged reverse transcription sequencing STRT seq.The DNA libraries conduction were performed according to the scBS seq with some modification", "GEO Accession:GSM5694257", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP346708", null, null, "HSC_sib_2_1_RNA.fq.gz HSC_sib_2_2_RNA.fq.gz", "fastq fastq", 3426398100.0, 11421327.0, "GSM5694257 r1", "0:150 1:150", "A:946653601;C:712946549;G:748099225;T:1018648813;N:49912", 150, 150, null, null, 946653601, 712946549, 748099225, 1018648813, 49912, "SRX13164747", "SRS11095950", "SRA1331007", "GEO", "Institute of Hematology and Blood Diseases Hospital", 2, 0.94198, 0.95128, 0.10797, 0.10975, 0.78366, 0.78892, 0.46218, 0.45981, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "strtseq", null, "China", "2021-11-18", "Undetermined", "Embryo", "Blood", "Hematopoietic System"], [67020, "SRR16973881", "SRX13164745", "SRS11095948", "SRP346708", "PRJNA781453", "WGBS and RNA seq of Danio rerio in HSPC generation", "GSE189072", "Other", "In this study  we interrogated the role of DNA methylation in HSPC generation by taking advantage of dnmt1 knockout/knockdown embryos in zebrafish. First  we generated a comprehensive DNA methylation landscape of EHT  which revealed gradually hypermethylated regions associated with vasculogenesis. Taking advantage of dnmt1 deficient embryos  we showed that the decreased DNA methylation blocked HSPC emergence. Mechanistically  we demonstrated that the decreased DNA methylation increased the expression of arterial genes and Notch signaling  thus contributing to defects in the EHT in dnmt1 deficient embryos. Herein  we identified that DNA methylation  as epigenetic regulator  participates in the negative modulation of Notch signaling through inhibiting transcription during HSPC generation in zebrafish. Overall design: WGBS and RNA seq of Danio rerio in EC HE and HSPC.", null, "pubmed:35502759", null, "HSC sib rep3 RNA", "GSM5694255", null, "tissue:hematopoietic stem cells|developmental stage:HSC|genotype:sibling|region:AGM", "HSC sib rep3 RNA", "Basecalls perfomed using CASAVA2.19 WGBS and RNA seq raw sequencing reads were first trimmed for adapter and low quality sequences. Then mapped to GRCz11 using BS Seeker2v2.1.8 and hisat2v2.2.1 with parameters \" t Y  m 0.04   bt2  end to end\" and \"  known splicesite infile  p 30  k 10   dta  t\" separately. Student's T test was used to perform DMR analysis for WGBS data. Gene expression level was quantified by HTSeqv0.12.4 and differentially expressed genesDEGs were determined by DESeq2v1.30.1 Genome build: GRCz11 Supplementary files format and content: RNA seq raw count matrix Supplementary files format and content: raw count.txt raw counts Supplementary files format and content: EC sib.bed DMRs of  EC sibling compared with HE sibling and HSC sibling Supplementary files format and content: HE sib.bed DMRs of  HE sibling compared with EC sibling and HSC sibling Supplementary files format and content: HSC sib.bed DMRs of  HSC sibling compared with EC sibling and HE sibling Supplementary files format and content: EC HE sib.bed DMRs of  EC and HE sibling Supplementary files format and content: HE HSC sib.bed DMRs of  HE and HSC sibling Supplementary files format and content: EC sib mut.bed DMRs of  EC sibling and EC mutant Supplementary files format and content: HE sib mut.bed DMRs of  HE sibling and HE mutant Supplementary files format and content: HSC sib mut.bed DMRs of  HSC sibling and HSC mutant", "hematopoietic stem cells", null, "Zebrafish embryos were harvested and dissected for single cell suspension. Single cell was sorted in lysis buffer by fluorescence activated cell sorting. The RNA seq library preparation and sequencing were performed based on the 3\u2032 biased single cell tagged reverse transcription sequencing STRT seq.The DNA libraries conduction were performed according to the scBS seq with some modification", null, "developmental stage:HSC|genotype:sibling|region:AGM", "GSM5694255", "GSM5694255: HSC sib rep3 RNA; Danio rerio; RNA Seq", "GSM5694255", null, "1", "Zebrafish embryos were harvested and dissected for single cell suspension. Single cell was sorted in lysis buffer by fluorescence activated cell sorting. The RNA seq library preparation and sequencing were performed based on the 3\u2032 biased single cell tagged reverse transcription sequencing STRT seq.The DNA libraries conduction were performed according to the scBS seq with some modification", "GEO Accession:GSM5694255", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP346708", null, "loader:fastq load.py", "HSC_mut_3_1_RNA.fq.gz HSC_mut_3_2_RNA.fq.gz", "fastq fastq", 9049492800.0, 30164976.0, "GSM5694255 r1", "0:150 1:150", "A:2539831836;C:1839829118;G:1955216925;T:2714585195;N:29726", 150, 150, null, null, 2539831836, 1839829118, 1955216925, 2714585195, 29726, "SRX13164745", "SRS11095948", "SRA1331007", "GEO", "Institute of Hematology and Blood Diseases Hospital", 2, 0.94274, 0.93556, 0.16188, 0.1602, 0.73046, 0.73308, 0.49974, 0.49435, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "strtseq", null, "China", "2021-11-18", "Undetermined", "Embryo", "Blood", "Hematopoietic System"], [67021, "SRR16973880", "SRX13164744", "SRS11095947", "SRP346708", "PRJNA781453", "WGBS and RNA seq of Danio rerio in HSPC generation", "GSE189072", "Other", "In this study  we interrogated the role of DNA methylation in HSPC generation by taking advantage of dnmt1 knockout/knockdown embryos in zebrafish. First  we generated a comprehensive DNA methylation landscape of EHT  which revealed gradually hypermethylated regions associated with vasculogenesis. Taking advantage of dnmt1 deficient embryos  we showed that the decreased DNA methylation blocked HSPC emergence. Mechanistically  we demonstrated that the decreased DNA methylation increased the expression of arterial genes and Notch signaling  thus contributing to defects in the EHT in dnmt1 deficient embryos. Herein  we identified that DNA methylation  as epigenetic regulator  participates in the negative modulation of Notch signaling through inhibiting transcription during HSPC generation in zebrafish. Overall design: WGBS and RNA seq of Danio rerio in EC HE and HSPC.", null, "pubmed:35502759", null, "HSC sib rep2 RNA", "GSM5694254", null, "tissue:hematopoietic stem cells|developmental stage:HSC|genotype:sibling|region:AGM", "HSC sib rep2 RNA", "Basecalls perfomed using CASAVA2.19 WGBS and RNA seq raw sequencing reads were first trimmed for adapter and low quality sequences. Then mapped to GRCz11 using BS Seeker2v2.1.8 and hisat2v2.2.1 with parameters \" t Y  m 0.04   bt2  end to end\" and \"  known splicesite infile  p 30  k 10   dta  t\" separately. Student's T test was used to perform DMR analysis for WGBS data. Gene expression level was quantified by HTSeqv0.12.4 and differentially expressed genesDEGs were determined by DESeq2v1.30.1 Genome build: GRCz11 Supplementary files format and content: RNA seq raw count matrix Supplementary files format and content: raw count.txt raw counts Supplementary files format and content: EC sib.bed DMRs of  EC sibling compared with HE sibling and HSC sibling Supplementary files format and content: HE sib.bed DMRs of  HE sibling compared with EC sibling and HSC sibling Supplementary files format and content: HSC sib.bed DMRs of  HSC sibling compared with EC sibling and HE sibling Supplementary files format and content: EC HE sib.bed DMRs of  EC and HE sibling Supplementary files format and content: HE HSC sib.bed DMRs of  HE and HSC sibling Supplementary files format and content: EC sib mut.bed DMRs of  EC sibling and EC mutant Supplementary files format and content: HE sib mut.bed DMRs of  HE sibling and HE mutant Supplementary files format and content: HSC sib mut.bed DMRs of  HSC sibling and HSC mutant", "hematopoietic stem cells", null, "Zebrafish embryos were harvested and dissected for single cell suspension. Single cell was sorted in lysis buffer by fluorescence activated cell sorting. The RNA seq library preparation and sequencing were performed based on the 3\u2032 biased single cell tagged reverse transcription sequencing STRT seq.The DNA libraries conduction were performed according to the scBS seq with some modification", null, "developmental stage:HSC|genotype:sibling|region:AGM", "GSM5694254", "GSM5694254: HSC sib rep2 RNA; Danio rerio; RNA Seq", "GSM5694254", null, "1", "Zebrafish embryos were harvested and dissected for single cell suspension. Single cell was sorted in lysis buffer by fluorescence activated cell sorting. The RNA seq library preparation and sequencing were performed based on the 3\u2032 biased single cell tagged reverse transcription sequencing STRT seq.The DNA libraries conduction were performed according to the scBS seq with some modification", "GEO Accession:GSM5694254", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP346708", null, null, "HSC_mut_2_1_RNA.fq.gz HSC_mut_2_2_RNA.fq.gz", "fastq fastq", 3488203500.0, 11627345.0, "GSM5694254 r1", "0:150 1:150", "A:993927631;C:700449875;G:737230481;T:1056544435;N:51078", 150, 150, null, null, 993927631, 700449875, 737230481, 1056544435, 51078, "SRX13164744", "SRS11095947", "SRA1331007", "GEO", "Institute of Hematology and Blood Diseases Hospital", 2, 0.93176, 0.93765, 0.14294, 0.14478, 0.75302, 0.7582, 0.49038, 0.48496, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "strtseq", null, "China", "2021-11-18", "Undetermined", "Embryo", "Blood", "Hematopoietic System"], [67908, "SRR017341", "SRX003632", "SRS002067", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish N", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishN", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "N_fish.tar", "fastq", 40231384.0, 173756.0, "Zebrafish IgH cDNA FishN", "0:4 1:227.54", "A:10436935;C:8800020;G:9512025;T:11471941;N:10463", 4, 227, null, null, 10436935, 8800020, 9512025, 11471941, 10463, "SRX003632", "SRS002067", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.26487, null, 0.0663, null, 0.99304, null, 0.01389, null, 229, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67909, "SRR017340", "SRX003631", "SRS002066", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish M", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishM", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "M_fish.tar", "fastq", 37492198.0, 161639.0, "Zebrafish IgH cDNA FishM", "0:4 1:227.95", "A:9527141;C:8129088;G:9025760;T:10804127;N:6082", 4, 227, null, null, 9527141, 8129088, 9025760, 10804127, 6082, "SRX003631", "SRS002066", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.31521, null, 0.11394, null, 0.99823, null, 0.00291, null, 208, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67910, "SRR017339", "SRX003630", "SRS002065", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish L", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishL", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "L_fish.tar", "fastq", 37971443.0, 163701.0, "Zebrafish IgH cDNA FishL", "0:4 1:227.96", "A:9544875;C:8363123;G:9094601;T:10963684;N:5160", 4, 227, null, null, 9544875, 8363123, 9094601, 10963684, 5160, "SRX003630", "SRS002065", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.29057, null, 0.07862, null, 0.99636, null, 0.00534, null, 245, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67911, "SRR017338", "SRX003629", "SRS002064", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish K", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishK", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "K_fish.tar", "fastq", 54201403.0, 234266.0, "Zebrafish IgH cDNA FishK", "0:4 1:227.37", "A:13608677;C:11652239;G:12945164;T:15975205;N:20118", 4, 227, null, null, 13608677, 11652239, 12945164, 15975205, 20118, "SRX003629", "SRS002064", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.27218, null, 0.07987, null, 0.99275, null, 0.01242, null, 244, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67912, "SRR017337", "SRX003628", "SRS002063", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish J", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishJ", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "J_fish.tar", "fastq", 51915342.0, 224027.0, "Zebrafish IgH cDNA FishJ", "0:4 1:227.74", "A:12664582;C:12040983;G:12609762;T:14589770;N:10245", 4, 227, null, null, 12664582, 12040983, 12609762, 14589770, 10245, "SRX003628", "SRS002063", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.29028, null, 0.10039, null, 0.9964, null, 0.00625, null, 97, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67913, "SRR017336", "SRX003627", "SRS002062", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish I", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishI", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "I_fish.tar", "fastq", 23436268.0, 100120.0, "Zebrafish IgH cDNA FishI", "0:4 1:230.08", "A:5801823;C:5246438;G:5587169;T:6797624;N:3214", 4, 230, null, null, 5801823, 5246438, 5587169, 6797624, 3214, "SRX003627", "SRS002062", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.34362, null, 0.0757, null, 0.99241, null, 0.02647, null, 232, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67914, "SRR017335", "SRX003626", "SRS002061", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish H", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishH", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "H_fish.tar", "fastq", 48443452.0, 213531.0, "Zebrafish IgH cDNA FishH", "0:4 1:222.87", "A:12720681;C:10490855;G:11923926;T:13303989;N:4001", 4, 222, null, null, 12720681, 10490855, 11923926, 13303989, 4001, "SRX003626", "SRS002061", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.45847, null, 0.04709, null, 0.98754, null, 0.0161, null, 56, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67915, "SRR017334", "SRX003625", "SRS002060", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish G", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishG", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "G_fish.tar", "fastq", 50095821.0, 217866.0, "Zebrafish IgH cDNA FishG", "0:4 1:225.94", "A:13182103;C:11299206;G:11909574;T:13700817;N:4121", 4, 225, null, null, 13182103, 11299206, 11909574, 13700817, 4121, "SRX003625", "SRS002060", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.37294, null, 0.09947, null, 0.99034, null, 0.02245, null, 230, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67916, "SRR017333", "SRX003624", "SRS002059", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish F", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishF", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "F_fish.tar", "fastq", 16577798.0, 83387.0, "Zebrafish IgH cDNA FishF", "0:4 1:194.81", "A:4215316;C:3618457;G:4002690;T:4736893;N:4442", 4, 194, null, null, 4215316, 3618457, 4002690, 4736893, 4442, "SRX003624", "SRS002059", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.57361, null, 0.0727, null, 0.99965, null, 0.00026, null, 62, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67917, "SRR017332", "SRX003623", "SRS002058", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish E", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishE", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "E_fish.tar", "fastq", 29705006.0, 131553.0, "Zebrafish IgH cDNA FishE", "0:4 1:221.80", "A:7474430;C:6417563;G:7115572;T:8693543;N:3898", 4, 221, null, null, 7474430, 6417563, 7115572, 8693543, 3898, "SRX003623", "SRS002058", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.3099, null, 0.09802, null, 0.99904, null, 0.00099, null, 45, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67918, "SRR017331", "SRX003622", "SRS002057", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish D", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishD", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "D_fish.tar", "fastq", 27611909.0, 123468.0, "Zebrafish IgH cDNA FishD", "0:4 1:219.64", "A:6809564;C:6219469;G:6636933;T:7943112;N:2831", 4, 219, null, null, 6809564, 6219469, 6636933, 7943112, 2831, "SRX003622", "SRS002057", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.45962, null, 0.09396, null, 0.99941, null, 0.00026, null, 218, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67919, "SRR017330", "SRX003621", "SRS002056", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish C", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishC", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "C_fish.tar", "fastq", 21845405.0, 95733.0, "Zebrafish IgH cDNA FishC", "0:4 1:224.19", "A:5735195;C:4746747;G:5266352;T:6095066;N:2045", 4, 224, null, null, 5735195, 4746747, 5266352, 6095066, 2045, "SRX003621", "SRS002056", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.38908, null, 0.20497, null, 0.99967, null, 0.00047, null, 145, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67920, "SRR017329", "SRX003620", "SRS002055", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish B", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishB", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "B_fish.tar", "fastq", 26680294.0, 118385.0, "Zebrafish IgH cDNA FishB", "0:4 1:221.37", "A:6380496;C:6168810;G:6541530;T:7587018;N:2440", 4, 221, null, null, 6380496, 6168810, 6541530, 7587018, 2440, "SRX003620", "SRS002055", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.35498, null, 0.14675, null, 0.99906, null, 0.00098, null, 228, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67921, "SRR017328", "SRX003619", "SRS002054", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish A", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishA", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "A_fish.tar", "fastq", 13497752.0, 61111.0, "Zebrafish IgH cDNA FishA", "0:4 1:216.87", "A:3287411;C:3078068;G:3224467;T:3906026;N:1780", 4, 216, null, null, 3287411, 3078068, 3224467, 3906026, 1780, "SRX003619", "SRS002054", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.32333, null, 0.14098, null, 0.99937, null, 0.00169, null, 52, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [68889, "SRR18218067", "SRX14364507", "SRS12177802", "SRP362416", "PRJNA812715", "Mutant IL7R collaborates with MYC to induce  T cell Acute Lymphoblastic Leukemia", "PRJNA812715", "Other", "T cell acute lymphoblastic leukemia T ALL is an aggressive pediatric cancer. Amongst the wide array of driver mutations  10% of T ALL patients display gain of function mutations in the IL 7 receptor alpha chain IL 7Ralpha  encoded by IL7R  which occur in different molecular subtypes of this disease. However  it is still unclear whether IL 7R mutational activation is sufficient to transform T cell precursors. Also  which genes cooperate with IL7R to drive leukemogenesis remain poorly defined. Here  we demonstrate that mutant IL7R alone is capable of inducing T ALL with long latency in stable transgenic zebrafish and transformation is associated with MYC transcriptional activation. Additionally  we find that mutant IL7R collaborates with Myc to induce early onset T ALL in transgenic zebrafish. T ALLs co expressing mutant IL7R and Myc show activation of STAT5 and AKT pathways  harbor reduced numbers of apoptotic cells and remake tumors in transplanted zebrafish faster than T ALLs expressing Myc alone. Moreover  limiting dilution cell transplantation experiments reveal that activated IL 7R signaling increases the overall frequency of leukemia propagating cells. Our work highlights a synergy between mutant IL7R and Myc in inducing T ALL and demonstrates that mutant IL7R enriches for leukemia propagating potential.", null, null, null, null, "Thy rag2 RFP 6", null, "strain:Tu/AB|age:not collected|sex:not collected|tissue:thymus|birth date: |death date:02 07 2019|genotype:rag2:RFP|biological replicate:Thy rag2 RFP biological replicate 4|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA seq of Danio rerio thymus Tu/AB", "Thy rag2 RFP 6", "Thy rag2 RFP 6", "Tu/AB WT zebrafish were sacrificed to harvest the thymus visible through RFP staining for further analysis. The RNA was extracted from sorted thymic cells using the RNeasy Mini Kit according to the manufacturers instructions Qiagen. mRNA was enriched using magnetic beads with Oligo dT  fragmented and converted to cDNA  size selected and PCR amplified generating paired end 100 bp sequences using a Illumina NovaSeq 6000.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PolyA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP362416", null, null, "FCHT5GHDSXX_L1_HKRDZEBmfpEAAPRABPEI-P86H2_1.fq.gz FCHT5GHDSXX_L1_HKRDZEBmfpEAAPRABPEI-P86H2_2.fq.gz", "fastq fastq", 18061636200.0, 60205454.0, "FCHT5GHDSXX L1 HKRDZEBmfpEAAPRABPEI P86H2 1.fq.gz", "0:150 1:150", "A:4749806271;C:4292116510;G:4365562558;T:4654124713;N:26148", 150, 150, null, null, 4749806271, 4292116510, 4365562558, 4654124713, 26148, "SRX14364507", "SRS12177802", "SRA1380603", "Instituto de Medicina Molecular Joao Lobo Antunes|JBarata lab", "Instituto de Medicina Molecular Joao Lobo Antunes", 2, 0.9283, 0.92884, 0.11636, 0.1154, 0.77642, 0.77697, 0.48938, 0.49117, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Portugal", "2022-03-04", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [68890, "SRR18218069", "SRX14364506", "SRS12177801", "SRP362416", "PRJNA812715", "Mutant IL7R collaborates with MYC to induce  T cell Acute Lymphoblastic Leukemia", "PRJNA812715", "Other", "T cell acute lymphoblastic leukemia T ALL is an aggressive pediatric cancer. Amongst the wide array of driver mutations  10% of T ALL patients display gain of function mutations in the IL 7 receptor alpha chain IL 7Ralpha  encoded by IL7R  which occur in different molecular subtypes of this disease. However  it is still unclear whether IL 7R mutational activation is sufficient to transform T cell precursors. Also  which genes cooperate with IL7R to drive leukemogenesis remain poorly defined. Here  we demonstrate that mutant IL7R alone is capable of inducing T ALL with long latency in stable transgenic zebrafish and transformation is associated with MYC transcriptional activation. Additionally  we find that mutant IL7R collaborates with Myc to induce early onset T ALL in transgenic zebrafish. T ALLs co expressing mutant IL7R and Myc show activation of STAT5 and AKT pathways  harbor reduced numbers of apoptotic cells and remake tumors in transplanted zebrafish faster than T ALLs expressing Myc alone. Moreover  limiting dilution cell transplantation experiments reveal that activated IL 7R signaling increases the overall frequency of leukemia propagating cells. Our work highlights a synergy between mutant IL7R and Myc in inducing T ALL and demonstrates that mutant IL7R enriches for leukemia propagating potential.", null, null, null, null, "Thy rag2 RFP 5", null, "strain:Tu/AB|age:not collected|sex:not collected|tissue:thymus|birth date: |death date:02 07 2019|genotype:rag2:RFP|biological replicate:Thy rag2 RFP biological replicate 3|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA seq of Danio rerio thymus Tu/AB", "Thy rag2 RFP 5", "Thy rag2 RFP 5", "Tu/AB WT zebrafish were sacrificed to harvest the thymus visible through RFP staining for further analysis. The RNA was extracted from sorted thymic cells using the RNeasy Mini Kit according to the manufacturers instructions Qiagen. mRNA was enriched using magnetic beads with Oligo dT  fragmented and converted to cDNA  size selected and PCR amplified generating paired end 100 bp sequences using a Illumina NovaSeq 6000.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PolyA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP362416", null, null, "FCHT5GHDSXX_L1_HKRDZEBmfpEAAORAAPEI-P74G2_1.fq.gz FCHT5GHDSXX_L1_HKRDZEBmfpEAAORAAPEI-P74G2_2.fq.gz", "fastq fastq", 16916167800.0, 56387226.0, "FCHT5GHDSXX L1 HKRDZEBmfpEAAORAAPEI P74G2 1.fq.gz", "0:150 1:150", "A:4469149097;C:4004191756;G:4070955203;T:4371847041;N:24703", 150, 150, null, null, 4469149097, 4004191756, 4070955203, 4371847041, 24703, "SRX14364506", "SRS12177801", "SRA1380603", "Instituto de Medicina Molecular Joao Lobo Antunes|JBarata lab", "Instituto de Medicina Molecular Joao Lobo Antunes", 2, 0.92644, 0.92786, 0.13071, 0.13011, 0.77833, 0.77792, 0.47942, 0.4816, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Portugal", "2022-03-04", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [68891, "SRR18218070", "SRX14364505", "SRS12177800", "SRP362416", "PRJNA812715", "Mutant IL7R collaborates with MYC to induce  T cell Acute Lymphoblastic Leukemia", "PRJNA812715", "Other", "T cell acute lymphoblastic leukemia T ALL is an aggressive pediatric cancer. Amongst the wide array of driver mutations  10% of T ALL patients display gain of function mutations in the IL 7 receptor alpha chain IL 7Ralpha  encoded by IL7R  which occur in different molecular subtypes of this disease. However  it is still unclear whether IL 7R mutational activation is sufficient to transform T cell precursors. Also  which genes cooperate with IL7R to drive leukemogenesis remain poorly defined. Here  we demonstrate that mutant IL7R alone is capable of inducing T ALL with long latency in stable transgenic zebrafish and transformation is associated with MYC transcriptional activation. Additionally  we find that mutant IL7R collaborates with Myc to induce early onset T ALL in transgenic zebrafish. T ALLs co expressing mutant IL7R and Myc show activation of STAT5 and AKT pathways  harbor reduced numbers of apoptotic cells and remake tumors in transplanted zebrafish faster than T ALLs expressing Myc alone. Moreover  limiting dilution cell transplantation experiments reveal that activated IL 7R signaling increases the overall frequency of leukemia propagating cells. Our work highlights a synergy between mutant IL7R and Myc in inducing T ALL and demonstrates that mutant IL7R enriches for leukemia propagating potential.", null, null, null, null, "Thy rag2 RFP 4", null, "strain:Tu/AB|age:not collected|sex:not collected|tissue:thymus|birth date: |death date:02 07 2019|genotype:rag2:RFP|biological replicate:Thy rag2 RFP biological replicate 2|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA seq of Danio rerio thymus Tu/AB", "Thy rag2 RFP 4", "Thy rag2 RFP 4", "Tu/AB WT zebrafish were sacrificed to harvest the thymus visible through RFP staining for further analysis. The RNA was extracted from sorted thymic cells using the RNeasy Mini Kit according to the manufacturers instructions Qiagen. mRNA was enriched using magnetic beads with Oligo dT  fragmented and converted to cDNA  size selected and PCR amplified generating paired end 100 bp sequences using a Illumina NovaSeq 6000.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PolyA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP362416", null, null, "FCHT5GHDSXX_L1_HKRDZEBmfpEAANRABPEI-P62F2_1.fq.gz FCHT5GHDSXX_L1_HKRDZEBmfpEAANRABPEI-P62F2_2.fq.gz", "fastq fastq", 17996947500.0, 59989825.0, "FCHT5GHDSXX L1 HKRDZEBmfpEAANRABPEI P62F2 1.fq.gz", "0:150 1:150", "A:4882125302;C:4136332786;G:4194970590;T:4783492952;N:25870", 150, 150, null, null, 4882125302, 4136332786, 4194970590, 4783492952, 25870, "SRX14364505", "SRS12177800", "SRA1380603", "Instituto de Medicina Molecular Joao Lobo Antunes|JBarata lab", "Instituto de Medicina Molecular Joao Lobo Antunes", 2, 0.86095, 0.86165, 0.25113, 0.2504, 0.80204, 0.80188, 0.48309, 0.48627, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Portugal", "2022-03-04", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [68892, "SRR18218071", "SRX14364504", "SRS12177799", "SRP362416", "PRJNA812715", "Mutant IL7R collaborates with MYC to induce  T cell Acute Lymphoblastic Leukemia", "PRJNA812715", "Other", "T cell acute lymphoblastic leukemia T ALL is an aggressive pediatric cancer. Amongst the wide array of driver mutations  10% of T ALL patients display gain of function mutations in the IL 7 receptor alpha chain IL 7Ralpha  encoded by IL7R  which occur in different molecular subtypes of this disease. However  it is still unclear whether IL 7R mutational activation is sufficient to transform T cell precursors. Also  which genes cooperate with IL7R to drive leukemogenesis remain poorly defined. Here  we demonstrate that mutant IL7R alone is capable of inducing T ALL with long latency in stable transgenic zebrafish and transformation is associated with MYC transcriptional activation. Additionally  we find that mutant IL7R collaborates with Myc to induce early onset T ALL in transgenic zebrafish. T ALLs co expressing mutant IL7R and Myc show activation of STAT5 and AKT pathways  harbor reduced numbers of apoptotic cells and remake tumors in transplanted zebrafish faster than T ALLs expressing Myc alone. Moreover  limiting dilution cell transplantation experiments reveal that activated IL 7R signaling increases the overall frequency of leukemia propagating cells. Our work highlights a synergy between mutant IL7R and Myc in inducing T ALL and demonstrates that mutant IL7R enriches for leukemia propagating potential.", null, null, null, null, "Thy rag2 RFP 3", null, "strain:Tu/AB|age:not collected|sex:not collected|tissue:thymus|birth date: |death date:02 07 2019|genotype:rag2:RFP|biological replicate:Thy rag2 RFP biological replicate 1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA seq of Danio rerio thymus Tu/AB", "Thy rag2 RFP 3", "Thy rag2 RFP 3", "Tu/AB WT zebrafish were sacrificed to harvest the thymus visible through RFP staining for further analysis. The RNA was extracted from sorted thymic cells using the RNeasy Mini Kit according to the manufacturers instructions Qiagen. mRNA was enriched using magnetic beads with Oligo dT  fragmented and converted to cDNA  size selected and PCR amplified generating paired end 100 bp sequences using a Illumina NovaSeq 6000.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PolyA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP362416", null, null, "FCHT5GHDSXX_L1_HKRDZEBmfpEAAMRABPEI-P50E2_1.fq.gz FCHT5GHDSXX_L1_HKRDZEBmfpEAAMRABPEI-P50E2_2.fq.gz", "fastq fastq", 18041602200.0, 60138674.0, "FCHT5GHDSXX L1 HKRDZEBmfpEAAMRABPEI P50E2 1.fq.gz", "0:150 1:150", "A:4726391295;C:4303349397;G:4380843440;T:4630991494;N:26574", 150, 150, null, null, 4726391295, 4303349397, 4380843440, 4630991494, 26574, "SRX14364504", "SRS12177799", "SRA1380603", "Instituto de Medicina Molecular Joao Lobo Antunes|JBarata lab", "Instituto de Medicina Molecular Joao Lobo Antunes", 2, 0.93138, 0.9316, 0.11291, 0.11196, 0.78143, 0.78261, 0.4799, 0.47958, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "Portugal", "2022-03-04", "Undetermined", "Undetermined", "Thymus", "Hematopoietic System"], [71972, "SRR22163682", "SRX18142568", "SRS15644032", "SRP405990", "PRJNA897077", "Transcriptome of zebrafish Danio rerio", "PRJNA897077", "Other", "Zebrafish Danio rerio have been used as a model organism to study innate immune system and hostpathogen interactions. Until now  the information related to the immune system against A. hydrophila of zebrafish and the treatment by probiotics is incomplete. To increase knowledge of the molecular mechanisms of the host defense against A. hydrophila and provide evidence that antibiotics can replace by probiotics  we conducted transcriptome analysis of spleen in zebrafish 48 h post infection and treatment by Lactococcus lactis post 4h post infection via sequencing.", null, null, null, null, "C3", null, "strain:not applicable|age:not collected|sex:not collected|tissue:spleen|treatment:control|replicate:replicate3|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA seq of Danio rerio", "C3", "C3", "control group", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP405990", null, null, "C3.R1.fastq.gz C3.R2.fastq.gz", "fastq fastq", 6777299176.0, 22441388.0, "C3.R1.fastq.gz", "0:151 1:151", "A:1869146927;C:1513142912;G:1565477798;T:1829395893;N:135646", 151, 151, null, null, 1869146927, 1513142912, 1565477798, 1829395893, 135646, "SRX18142568", "SRS15644032", "SRA1532870", "Kunming University of Science and Technology|Faculty of Life Science and Technology", "Kunming University of Science and Technology", 2, 0.91581, 0.91452, 0.09416, 0.09344, 0.71167, 0.71338, 0.50247, 0.50311, 151, 151, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "China", "2022-11-02", "Undetermined", "Undetermined", "Spleen", "Hematopoietic System"], [71973, "SRR22163683", "SRX18142567", "SRS15644031", "SRP405990", "PRJNA897077", "Transcriptome of zebrafish Danio rerio", "PRJNA897077", "Other", "Zebrafish Danio rerio have been used as a model organism to study innate immune system and hostpathogen interactions. Until now  the information related to the immune system against A. hydrophila of zebrafish and the treatment by probiotics is incomplete. To increase knowledge of the molecular mechanisms of the host defense against A. hydrophila and provide evidence that antibiotics can replace by probiotics  we conducted transcriptome analysis of spleen in zebrafish 48 h post infection and treatment by Lactococcus lactis post 4h post infection via sequencing.", null, null, null, null, "C2", null, "strain:not applicable|age:not collected|sex:not collected|tissue:spleen|treatment:control|replicate:replicate2|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA seq of Danio rerio", "C2", "C2", "control group", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP405990", null, null, "C2.R1.fastq.gz C2.R2.fastq.gz", "fastq fastq", 6956425644.0, 23034522.0, "C2.R1.fastq.gz", "0:151 1:151", "A:1847551873;C:1616308106;G:1662475314;T:1829952767;N:137584", 151, 151, null, null, 1847551873, 1616308106, 1662475314, 1829952767, 137584, "SRX18142567", "SRS15644031", "SRA1532870", "Kunming University of Science and Technology|Faculty of Life Science and Technology", "Kunming University of Science and Technology", 2, 0.93033, 0.9312, 0.056, 0.05619, 0.71261, 0.71376, 0.4668, 0.47014, 151, 151, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "China", "2022-11-02", "Undetermined", "Undetermined", "Spleen", "Hematopoietic System"], [71974, "SRR22163684", "SRX18142566", "SRS15644030", "SRP405990", "PRJNA897077", "Transcriptome of zebrafish Danio rerio", "PRJNA897077", "Other", "Zebrafish Danio rerio have been used as a model organism to study innate immune system and hostpathogen interactions. Until now  the information related to the immune system against A. hydrophila of zebrafish and the treatment by probiotics is incomplete. To increase knowledge of the molecular mechanisms of the host defense against A. hydrophila and provide evidence that antibiotics can replace by probiotics  we conducted transcriptome analysis of spleen in zebrafish 48 h post infection and treatment by Lactococcus lactis post 4h post infection via sequencing.", null, null, null, null, "C1", null, "strain:not applicable|age:not collected|sex:not collected|tissue:spleen|treatment:control|replicate:replicate1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA seq of Danio rerio", "C1", "C1", "control group", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP405990", null, null, "C1.R1.fastq.gz C1.R2.fastq.gz", "fastq fastq", 6218689172.0, 20591686.0, "C1.R1.fastq.gz", "0:151 1:151", "A:1651743119;C:1444992966;G:1490934383;T:1630891482;N:127222", 151, 151, null, null, 1651743119, 1444992966, 1490934383, 1630891482, 127222, "SRX18142566", "SRS15644030", "SRA1532870", "Kunming University of Science and Technology|Faculty of Life Science and Technology", "Kunming University of Science and Technology", 2, 0.93571, 0.93627, 0.03427, 0.0346, 0.73336, 0.73401, 0.47064, 0.47601, 151, 151, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "China", "2022-11-02", "Undetermined", "Undetermined", "Spleen", "Hematopoietic System"], [71975, "SRR22163685", "SRX18142565", "SRS15644029", "SRP405990", "PRJNA897077", "Transcriptome of zebrafish Danio rerio", "PRJNA897077", "Other", "Zebrafish Danio rerio have been used as a model organism to study innate immune system and hostpathogen interactions. Until now  the information related to the immune system against A. hydrophila of zebrafish and the treatment by probiotics is incomplete. To increase knowledge of the molecular mechanisms of the host defense against A. hydrophila and provide evidence that antibiotics can replace by probiotics  we conducted transcriptome analysis of spleen in zebrafish 48 h post infection and treatment by Lactococcus lactis post 4h post infection via sequencing.", null, null, null, null, "B3", null, "strain:not applicable|age:not collected|sex:not collected|tissue:spleen|treatment:challenge|replicate:replicate3|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "RNA seq of Danio rerio", "B3", "B3", "challenge group", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP405990", null, null, "B3.R1.fastq.gz B3.R2.fastq.gz", "fastq fastq", 7958268062.0, 26351881.0, "B3.R1.fastq.gz", "0:151 1:151", "A:2067039750;C:1894612680;G:1943559820;T:2052891379;N:164433", 151, 151, null, null, 2067039750, 1894612680, 1943559820, 2052891379, 164433, "SRX18142565", "SRS15644029", "SRA1532870", "Kunming University of Science and Technology|Faculty of Life Science and Technology", "Kunming University of Science and Technology", 2, 0.93754, 0.93809, 0.03309, 0.03347, 0.71762, 0.71731, 0.49012, 0.4888, 151, 151, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "unknown", "bulk", "unknown", "unknown", null, "China", "2022-11-02", "Undetermined", "Undetermined", "Spleen", "Hematopoietic System"]], "truncated": false, "filtered_table_rows_count": 137, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"devstage_curation\" = :p0 and \"tissue_curation_coarse\" = :p1 order by rowid limit 101", "params": {"p0": "Undetermined", "p1": "Hematopoietic System"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System", "results": [{"value": "RNA-Seq", "label": "RNA-Seq", "count": 123, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System&experiment.library_strategy=RNA-Seq", "selected": false}, {"value": "AMPLICON", "label": "AMPLICON", "count": 14, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System&experiment.library_strategy=AMPLICON", "selected": false}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 136, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System&experiment.library_source=TRANSCRIPTOMIC", "selected": false}, {"value": "TRANSCRIPTOMIC SINGLE CELL", "label": "TRANSCRIPTOMIC SINGLE CELL", "count": 1, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System&experiment.library_source=TRANSCRIPTOMIC+SINGLE+CELL", "selected": false}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System", "results": [{"value": "cDNA", "label": "cDNA", "count": 98, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System&experiment.library_selection=cDNA", "selected": false}, {"value": "Oligo-dT", "label": "Oligo-dT", "count": 21, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System&experiment.library_selection=Oligo-dT", "selected": false}, {"value": "PCR", "label": "PCR", "count": 14, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System&experiment.library_selection=PCR", "selected": false}, {"value": "PolyA", "label": "PolyA", "count": 4, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System&experiment.library_selection=PolyA", "selected": false}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System", "results": [{"value": "PAIRED", "label": "PAIRED", "count": 111, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System&experiment.library_layout=PAIRED", "selected": false}, {"value": "SINGLE", "label": "SINGLE", "count": 26, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System&experiment.library_layout=SINGLE", "selected": false}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System", "results": [{"value": "ILLUMINA", "label": "ILLUMINA", "count": 123, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System&experiment.platform=ILLUMINA", "selected": false}, {"value": "LS454", "label": "LS454", "count": 14, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System&experiment.platform=LS454", "selected": false}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System", "results": [{"value": "Undetermined", "label": "Undetermined", "count": 113, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System&devstage_curation_coarse=Undetermined", "selected": false}, {"value": "Embryo", "label": "Embryo", "count": 18, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System&devstage_curation_coarse=Embryo", "selected": false}, {"value": "Adult", "label": "Adult", "count": 3, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System&devstage_curation_coarse=Adult", "selected": false}, {"value": "Multi-stage", "label": "Multi-stage", "count": 3, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System&devstage_curation_coarse=Multi-stage", "selected": false}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System", "results": [{"value": "Undetermined", "label": "Undetermined", "count": 137, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?tissue_curation_coarse=Hematopoietic+System", "selected": true}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System", "results": [{"value": "Hematopoietic System", "label": "Hematopoietic System", "count": 137, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined", "selected": true}], "truncated": false}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System", "results": [{"value": "Thymus", "label": "Thymus", "count": 63, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System&tissue_curation=Thymus", "selected": false}, {"value": "Blood", "label": "Blood", "count": 44, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System&tissue_curation=Blood", "selected": false}, {"value": "Spleen", "label": "Spleen", "count": 16, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System&tissue_curation=Spleen", "selected": false}, {"value": "BCR TCR repertoire", "label": "BCR TCR repertoire", "count": 14, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System&tissue_curation=BCR+TCR+repertoire", "selected": false}], "truncated": false}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System", "results": [{"value": "unknown", "label": "unknown", "count": 56, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System&technology=unknown", "selected": false}, {"value": "bulk", "label": "bulk", "count": 35, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System&technology=bulk", "selected": false}, {"value": "celseq", "label": "celseq", "count": 24, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System&technology=celseq", "selected": false}, {"value": "454", "label": "454", "count": 14, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System&technology=454", "selected": false}, {"value": "strtseq", "label": "strtseq", "count": 4, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System&technology=strtseq", "selected": false}, {"value": "microwellseq", "label": "microwellseq", "count": 3, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System&technology=microwellseq", "selected": false}, {"value": "10x", "label": "10x", "count": 1, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System&technology=10x", "selected": false}], "truncated": false}}, "suggested_facets": [], "next": "71975", "next_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&tissue_curation_coarse=Hematopoietic+System&_next=71975", "private": false, "allow_execute_sql": true, "query_ms": 90.94026699312963}