{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where devstage_curation = \"Undetermined\" and experiment.library_selection = \"PCR\"", "rows": [[8076, "ERR2304209", "ERX2355537", "ERS2201745", "ERP106721", "PRJEB24858", "Zebrafish   modelling familialAlzheimer's disease using heterozygous K97fs mutation in locus psen1", "ena-STUDY-Adelaide Bioinformatics Hub-08-02-2018-04:47:34:743-1099", "Other", "RNA seq analysis of whole brains from zebrafish possessing a heterozygous K97fs mutation in psen1 to model familial Alzheimer's disease Total RNA was extracted from the whole brains of mutant and wild type zebrafish when they were either 6 mpf young adult or 24 mpf infertile adult. Mutant zebrafish possess a heterozygous K97fs mutation at the endogenous zebrafish psen1 locus while wild type zebrafish do not.", "ENA FIRST PUBLIC:2018 05 11|ENA LAST UPDATE:2018 02 08", null, null, "Aged mutant biorep3", "SAMEA104590463", "Adelaide Bioinformatics Hub", "ENA first public:2018 05 11|ENA last update:2018 02 14|External Id:SAMEA104590463|INSDC center alias:Adelaide Bioinformatics Hub|INSDC center name:Adelaide Bioinformatics Hub|INSDC first public:2018 05 11T17:03:03Z|INSDC last update:2018 02 14T06:16:03Z|INSDC status:public|Submitter Id:Aged mutant biorep3|common name:zebrafish|sample name:Aged mutant biorep3", null, null, null, null, null, null, null, null, "NextSeq 500 paired end sequencing", "ena EXPERIMENT Adelaide Bioinformatics Hub 15 02 2018 04:44:34:534 12", "9 psen1K97Gfshet 24mth 13 03 2014 S3 fem", "RNA seq analysis of whole brains from zebrafish possessing a heterozygous K97fs mutation in psen1 to model familial Alzheimer's disease", "Total RNA was extracted from whole brains using the mirVana miRNA isolation kit ThermoFisher using the manufacturer's protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "ERP106721", "NextSeq 500 paired end sequencing", "ENA FIRST PUBLIC:2018 05 11|ENA LAST UPDATE:2018 11 16", "9_psen1K97Gfshet_24mth_13_03_2014_S3_fem_R1.fastq.gz 9_psen1K97Gfshet_24mth_13_03_2014_S3_fem_R2.fastq.gz", "fastq fastq", 9318039088.0, 38360343.0, "ena RUN Adelaide Bioinformatics Hub 15 02 2018 04:44:34:534 12", "0:121.17 1:121.74", "A:2583644589;C:2091813317;G:2105322994;T:2536795040;N:463148", 121, 121, null, null, 2583644589, 2091813317, 2105322994, 2536795040, 463148, "ERX2355537", "ERS2201745", "ERA1210082", "Adelaide Bioinformatics Hub|European Nucleotide Archive", "Adelaide Bioinformatics Hub", 2, 0.93003, 0.92836, 0.26254, 0.26157, 0.68992, 0.69593, 0.48246, 0.48292, 134, 134, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "Australia", "2018-02-08", "Undetermined", "Adult", "Brain", "Nervous System"], [8077, "ERR2304208", "ERX2355536", "ERS2201744", "ERP106721", "PRJEB24858", "Zebrafish   modelling familialAlzheimer's disease using heterozygous K97fs mutation in locus psen1", "ena-STUDY-Adelaide Bioinformatics Hub-08-02-2018-04:47:34:743-1099", "Other", "RNA seq analysis of whole brains from zebrafish possessing a heterozygous K97fs mutation in psen1 to model familial Alzheimer's disease Total RNA was extracted from the whole brains of mutant and wild type zebrafish when they were either 6 mpf young adult or 24 mpf infertile adult. Mutant zebrafish possess a heterozygous K97fs mutation at the endogenous zebrafish psen1 locus while wild type zebrafish do not.", "ENA FIRST PUBLIC:2018 05 11|ENA LAST UPDATE:2018 02 08", null, null, "Aged mutant biorep2", "SAMEA104590462", "Adelaide Bioinformatics Hub", "ENA first public:2018 05 11|ENA last update:2018 02 14|External Id:SAMEA104590462|INSDC center alias:Adelaide Bioinformatics Hub|INSDC center name:Adelaide Bioinformatics Hub|INSDC first public:2018 05 11T17:03:03Z|INSDC last update:2018 02 14T06:16:03Z|INSDC status:public|Submitter Id:Aged mutant biorep2|common name:zebrafish|sample name:Aged mutant biorep2", null, null, null, null, null, null, null, null, "NextSeq 500 paired end sequencing", "ena EXPERIMENT Adelaide Bioinformatics Hub 15 02 2018 04:44:34:534 11", "8 psen1K97Gfshet 24mth 13 03 2014 S2 fem", "RNA seq analysis of whole brains from zebrafish possessing a heterozygous K97fs mutation in psen1 to model familial Alzheimer's disease", "Total RNA was extracted from whole brains using the mirVana miRNA isolation kit ThermoFisher using the manufacturer's protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "ERP106721", "NextSeq 500 paired end sequencing", "ENA FIRST PUBLIC:2018 05 11|ENA LAST UPDATE:2018 11 16", "8_psen1K97Gfshet_24mth_13_03_2014_S2_fem_R1.fastq.gz 8_psen1K97Gfshet_24mth_13_03_2014_S2_fem_R2.fastq.gz", "fastq fastq", 8559244581.0, 35608377.0, "ena RUN Adelaide Bioinformatics Hub 15 02 2018 04:44:34:534 11", "0:119.87 1:120.50", "A:2397336730;C:1892236963;G:1910506310;T:2358778868;N:385710", 119, 120, null, null, 2397336730, 1892236963, 1910506310, 2358778868, 385710, "ERX2355536", "ERS2201744", "ERA1210082", "Adelaide Bioinformatics Hub|European Nucleotide Archive", "Adelaide Bioinformatics Hub", 2, 0.92422, 0.92311, 0.30514, 0.30437, 0.69578, 0.7008, 0.49054, 0.48857, 150, 150, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "Australia", "2018-02-08", "Undetermined", "Adult", "Brain", "Nervous System"], [8078, "ERR2304207", "ERX2355535", "ERS2201743", "ERP106721", "PRJEB24858", "Zebrafish   modelling familialAlzheimer's disease using heterozygous K97fs mutation in locus psen1", "ena-STUDY-Adelaide Bioinformatics Hub-08-02-2018-04:47:34:743-1099", "Other", "RNA seq analysis of whole brains from zebrafish possessing a heterozygous K97fs mutation in psen1 to model familial Alzheimer's disease Total RNA was extracted from the whole brains of mutant and wild type zebrafish when they were either 6 mpf young adult or 24 mpf infertile adult. Mutant zebrafish possess a heterozygous K97fs mutation at the endogenous zebrafish psen1 locus while wild type zebrafish do not.", "ENA FIRST PUBLIC:2018 05 11|ENA LAST UPDATE:2018 02 08", null, null, "Aged mutant biorep1", "SAMEA104590461", "Adelaide Bioinformatics Hub", "ENA first public:2018 05 11|ENA last update:2018 02 14|External Id:SAMEA104590461|INSDC center alias:Adelaide Bioinformatics Hub|INSDC center name:Adelaide Bioinformatics Hub|INSDC first public:2018 05 11T17:03:03Z|INSDC last update:2018 02 14T06:16:03Z|INSDC status:public|Submitter Id:Aged mutant biorep1|common name:zebrafish|sample name:Aged mutant biorep1", null, null, null, null, null, null, null, null, "NextSeq 500 paired end sequencing", "ena EXPERIMENT Adelaide Bioinformatics Hub 15 02 2018 04:44:34:534 10", "7 psen1K97Gfshet 24mth 13 03 2014 S1 fem", "RNA seq analysis of whole brains from zebrafish possessing a heterozygous K97fs mutation in psen1 to model familial Alzheimer's disease", "Total RNA was extracted from whole brains using the mirVana miRNA isolation kit ThermoFisher using the manufacturer's protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "ERP106721", "NextSeq 500 paired end sequencing", "ENA FIRST PUBLIC:2018 05 11|ENA LAST UPDATE:2018 11 16", "7_psen1K97Gfshet_24mth_13_03_2014_S1_fem_R1.fastq.gz 7_psen1K97Gfshet_24mth_13_03_2014_S1_fem_R2.fastq.gz", "fastq fastq", 6521711648.0, 27182062.0, "ena RUN Adelaide Bioinformatics Hub 15 02 2018 04:44:34:534 10", "0:119.65 1:120.27", "A:1831722484;C:1434689482;G:1449266189;T:1805677755;N:355738", 119, 120, null, null, 1831722484, 1434689482, 1449266189, 1805677755, 355738, "ERX2355535", "ERS2201743", "ERA1210082", "Adelaide Bioinformatics Hub|European Nucleotide Archive", "Adelaide Bioinformatics Hub", 2, 0.92564, 0.92498, 0.29344, 0.29212, 0.69327, 0.69964, 0.48557, 0.48942, 86, 86, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "Australia", "2018-02-08", "Undetermined", "Adult", "Brain", "Nervous System"], [8079, "ERR2304206", "ERX2355534", "ERS2201742", "ERP106721", "PRJEB24858", "Zebrafish   modelling familialAlzheimer's disease using heterozygous K97fs mutation in locus psen1", "ena-STUDY-Adelaide Bioinformatics Hub-08-02-2018-04:47:34:743-1099", "Other", "RNA seq analysis of whole brains from zebrafish possessing a heterozygous K97fs mutation in psen1 to model familial Alzheimer's disease Total RNA was extracted from the whole brains of mutant and wild type zebrafish when they were either 6 mpf young adult or 24 mpf infertile adult. Mutant zebrafish possess a heterozygous K97fs mutation at the endogenous zebrafish psen1 locus while wild type zebrafish do not.", "ENA FIRST PUBLIC:2018 05 11|ENA LAST UPDATE:2018 02 08", null, null, "Aged wild type biorep3", "SAMEA104590460", "Adelaide Bioinformatics Hub", "ENA first public:2018 05 11|ENA last update:2018 02 14|External Id:SAMEA104590460|INSDC center alias:Adelaide Bioinformatics Hub|INSDC center name:Adelaide Bioinformatics Hub|INSDC first public:2018 05 11T17:03:03Z|INSDC last update:2018 02 14T06:16:03Z|INSDC status:public|Submitter Id:Aged wild type biorep3|common name:zebrafish|sample name:Aged wild type biorep3", null, null, null, null, null, null, null, null, "NextSeq 500 paired end sequencing", "ena EXPERIMENT Adelaide Bioinformatics Hub 15 02 2018 04:44:34:534 9", "3 non mutant K97Gfs 24mth 13 03 2014 S3 fem", "RNA seq analysis of whole brains from zebrafish possessing a heterozygous K97fs mutation in psen1 to model familial Alzheimer's disease", "Total RNA was extracted from whole brains using the mirVana miRNA isolation kit ThermoFisher using the manufacturer's protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "ERP106721", "NextSeq 500 paired end sequencing", "ENA FIRST PUBLIC:2018 05 11|ENA LAST UPDATE:2018 11 16", "3_non_mutant_K97Gfs_24mth_13_03_2014_S3_fem_R1.fastq.gz 3_non_mutant_K97Gfs_24mth_13_03_2014_S3_fem_R2.fastq.gz", "fastq fastq", 6865452019.0, 28646225.0, "ena RUN Adelaide Bioinformatics Hub 15 02 2018 04:44:34:534 9", "0:119.50 1:120.16", "A:1903309108;C:1535570672;G:1550661363;T:1875578941;N:331935", 119, 120, null, null, 1903309108, 1535570672, 1550661363, 1875578941, 331935, "ERX2355534", "ERS2201742", "ERA1210082", "Adelaide Bioinformatics Hub|European Nucleotide Archive", "Adelaide Bioinformatics Hub", 2, 0.92997, 0.92904, 0.26949, 0.26497, 0.69485, 0.70072, 0.49378, 0.50075, 96, 96, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "Australia", "2018-02-08", "Undetermined", "Adult", "Brain", "Nervous System"], [8080, "ERR2304205", "ERX2355533", "ERS2201741", "ERP106721", "PRJEB24858", "Zebrafish   modelling familialAlzheimer's disease using heterozygous K97fs mutation in locus psen1", "ena-STUDY-Adelaide Bioinformatics Hub-08-02-2018-04:47:34:743-1099", "Other", "RNA seq analysis of whole brains from zebrafish possessing a heterozygous K97fs mutation in psen1 to model familial Alzheimer's disease Total RNA was extracted from the whole brains of mutant and wild type zebrafish when they were either 6 mpf young adult or 24 mpf infertile adult. Mutant zebrafish possess a heterozygous K97fs mutation at the endogenous zebrafish psen1 locus while wild type zebrafish do not.", "ENA FIRST PUBLIC:2018 05 11|ENA LAST UPDATE:2018 02 08", null, null, "Aged wild type biorep2", "SAMEA104590459", "Adelaide Bioinformatics Hub", "ENA first public:2018 05 11|ENA last update:2018 02 14|External Id:SAMEA104590459|INSDC center alias:Adelaide Bioinformatics Hub|INSDC center name:Adelaide Bioinformatics Hub|INSDC first public:2018 05 11T17:03:03Z|INSDC last update:2018 02 14T06:16:03Z|INSDC status:public|Submitter Id:Aged wild type biorep2|common name:zebrafish|sample name:Aged wild type biorep2", null, null, null, null, null, null, null, null, "NextSeq 500 paired end sequencing", "ena EXPERIMENT Adelaide Bioinformatics Hub 15 02 2018 04:44:34:534 8", "2 non mutant K97Gfs 24mth 13 03 2014 S2 fem", "RNA seq analysis of whole brains from zebrafish possessing a heterozygous K97fs mutation in psen1 to model familial Alzheimer's disease", "Total RNA was extracted from whole brains using the mirVana miRNA isolation kit ThermoFisher using the manufacturer's protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "ERP106721", "NextSeq 500 paired end sequencing", "ENA FIRST PUBLIC:2018 05 11|ENA LAST UPDATE:2018 11 16", "2_non_mutant_K97Gfs_24mth_13_03_2014_S2_fem_R1.fastq.gz 2_non_mutant_K97Gfs_24mth_13_03_2014_S2_fem_R2.fastq.gz", "fastq fastq", 8418868343.0, 34905186.0, "ena RUN Adelaide Bioinformatics Hub 15 02 2018 04:44:34:534 8", "0:120.29 1:120.91", "A:2334515884;C:1885784857;G:1900432559;T:2297775998;N:359045", 120, 120, null, null, 2334515884, 1885784857, 1900432559, 2297775998, 359045, "ERX2355533", "ERS2201741", "ERA1210082", "Adelaide Bioinformatics Hub|European Nucleotide Archive", "Adelaide Bioinformatics Hub", 2, 0.93078, 0.92967, 0.25478, 0.25365, 0.69372, 0.69938, 0.4988, 0.49709, 132, 132, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "Australia", "2018-02-08", "Undetermined", "Adult", "Brain", "Nervous System"], [8081, "ERR2304204", "ERX2355532", "ERS2201740", "ERP106721", "PRJEB24858", "Zebrafish   modelling familialAlzheimer's disease using heterozygous K97fs mutation in locus psen1", "ena-STUDY-Adelaide Bioinformatics Hub-08-02-2018-04:47:34:743-1099", "Other", "RNA seq analysis of whole brains from zebrafish possessing a heterozygous K97fs mutation in psen1 to model familial Alzheimer's disease Total RNA was extracted from the whole brains of mutant and wild type zebrafish when they were either 6 mpf young adult or 24 mpf infertile adult. Mutant zebrafish possess a heterozygous K97fs mutation at the endogenous zebrafish psen1 locus while wild type zebrafish do not.", "ENA FIRST PUBLIC:2018 05 11|ENA LAST UPDATE:2018 02 08", null, null, "Aged wild type biorep1", "SAMEA104590458", "Adelaide Bioinformatics Hub", "ENA first public:2018 05 11|ENA last update:2018 02 14|External Id:SAMEA104590458|INSDC center alias:Adelaide Bioinformatics Hub|INSDC center name:Adelaide Bioinformatics Hub|INSDC first public:2018 05 11T17:03:03Z|INSDC last update:2018 02 14T06:16:03Z|INSDC status:public|Submitter Id:Aged wild type biorep1|common name:zebrafish|sample name:Aged wild type biorep1", null, null, null, null, null, null, null, null, "NextSeq 500 paired end sequencing", "ena EXPERIMENT Adelaide Bioinformatics Hub 15 02 2018 04:44:34:534 7", "1 non mutant K97Gfs 24mth 13 03 2014 S1 fem", "RNA seq analysis of whole brains from zebrafish possessing a heterozygous K97fs mutation in psen1 to model familial Alzheimer's disease", "Total RNA was extracted from whole brains using the mirVana miRNA isolation kit ThermoFisher using the manufacturer's protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "ERP106721", "NextSeq 500 paired end sequencing", "ENA FIRST PUBLIC:2018 05 11|ENA LAST UPDATE:2018 11 16", "1_non_mutant_K97Gfs_24mth_13_03_2014_S1_fem_R1.fastq.gz 1_non_mutant_K97Gfs_24mth_13_03_2014_S1_fem_R2.fastq.gz", "fastq fastq", 6628468736.0, 27477727.0, "ena RUN Adelaide Bioinformatics Hub 15 02 2018 04:44:34:534 7", "0:120.31 1:120.92", "A:1839014115;C:1487750495;G:1497160978;T:1804205119;N:338029", 120, 120, null, null, 1839014115, 1487750495, 1497160978, 1804205119, 338029, "ERX2355532", "ERS2201740", "ERA1210082", "Adelaide Bioinformatics Hub|European Nucleotide Archive", "Adelaide Bioinformatics Hub", 2, 0.92916, 0.92783, 0.28453, 0.28375, 0.69798, 0.70289, 0.48132, 0.48227, 125, 125, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "Australia", "2018-02-08", "Undetermined", "Adult", "Brain", "Nervous System"], [8082, "ERR2304203", "ERX2355531", "ERS2201739", "ERP106721", "PRJEB24858", "Zebrafish   modelling familialAlzheimer's disease using heterozygous K97fs mutation in locus psen1", "ena-STUDY-Adelaide Bioinformatics Hub-08-02-2018-04:47:34:743-1099", "Other", "RNA seq analysis of whole brains from zebrafish possessing a heterozygous K97fs mutation in psen1 to model familial Alzheimer's disease Total RNA was extracted from the whole brains of mutant and wild type zebrafish when they were either 6 mpf young adult or 24 mpf infertile adult. Mutant zebrafish possess a heterozygous K97fs mutation at the endogenous zebrafish psen1 locus while wild type zebrafish do not.", "ENA FIRST PUBLIC:2018 05 11|ENA LAST UPDATE:2018 02 08", null, null, "Young mutant biorep3", "SAMEA104590457", "Adelaide Bioinformatics Hub", "ENA first public:2018 05 11|ENA last update:2018 02 14|External Id:SAMEA104590457|INSDC center alias:Adelaide Bioinformatics Hub|INSDC center name:Adelaide Bioinformatics Hub|INSDC first public:2018 05 11T17:03:03Z|INSDC last update:2018 02 14T06:16:03Z|INSDC status:public|Submitter Id:Young mutant biorep3|common name:zebrafish|sample name:Young mutant biorep3", null, null, null, null, null, null, null, null, "NextSeq 500 paired end sequencing", "ena EXPERIMENT Adelaide Bioinformatics Hub 15 02 2018 04:44:34:534 6", "12 psen1K97Gfshet 6mth 10 03 2016 S3 fem", "RNA seq analysis of whole brains from zebrafish possessing a heterozygous K97fs mutation in psen1 to model familial Alzheimer's disease", "Total RNA was extracted from whole brains using the mirVana miRNA isolation kit ThermoFisher using the manufacturer's protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "ERP106721", "NextSeq 500 paired end sequencing", "ENA FIRST PUBLIC:2018 05 11|ENA LAST UPDATE:2018 11 16", "12_psen1K97Gfshet_6mth_10_03_2016_S3_fem_R1.fastq.gz 12_psen1K97Gfshet_6mth_10_03_2016_S3_fem_R2.fastq.gz", "fastq fastq", 11485397100.0, 38284657.0, "ena RUN Adelaide Bioinformatics Hub 15 02 2018 04:44:34:534 6", "0:150 1:150", "A:3206707597;C:2539306860;G:2721427816;T:3015264084;N:2690743", 150, 150, null, null, 3206707597, 2539306860, 2721427816, 3015264084, 2690743, "ERX2355531", "ERS2201739", "ERA1210082", "Adelaide Bioinformatics Hub|European Nucleotide Archive", "Adelaide Bioinformatics Hub", 2, 0.92853, 0.92813, 0.26757, 0.26433, 0.68487, 0.68903, 0.47708, 0.47074, 150, 150, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "Australia", "2018-02-08", "Undetermined", "Adult", "Brain", "Nervous System"], [8083, "ERR2304202", "ERX2355530", "ERS2201738", "ERP106721", "PRJEB24858", "Zebrafish   modelling familialAlzheimer's disease using heterozygous K97fs mutation in locus psen1", "ena-STUDY-Adelaide Bioinformatics Hub-08-02-2018-04:47:34:743-1099", "Other", "RNA seq analysis of whole brains from zebrafish possessing a heterozygous K97fs mutation in psen1 to model familial Alzheimer's disease Total RNA was extracted from the whole brains of mutant and wild type zebrafish when they were either 6 mpf young adult or 24 mpf infertile adult. Mutant zebrafish possess a heterozygous K97fs mutation at the endogenous zebrafish psen1 locus while wild type zebrafish do not.", "ENA FIRST PUBLIC:2018 05 11|ENA LAST UPDATE:2018 02 08", null, null, "Young mutant biorep2", "SAMEA104590456", "Adelaide Bioinformatics Hub", "ENA first public:2018 05 11|ENA last update:2018 02 14|External Id:SAMEA104590456|INSDC center alias:Adelaide Bioinformatics Hub|INSDC center name:Adelaide Bioinformatics Hub|INSDC first public:2018 05 11T17:03:03Z|INSDC last update:2018 02 14T06:16:03Z|INSDC status:public|Submitter Id:Young mutant biorep2|common name:zebrafish|sample name:Young mutant biorep2", null, null, null, null, null, null, null, null, "NextSeq 500 paired end sequencing", "ena EXPERIMENT Adelaide Bioinformatics Hub 15 02 2018 04:44:34:534 5", "11 psen1K97Gfshet 6mth 10 03 2016 S2 fem", "RNA seq analysis of whole brains from zebrafish possessing a heterozygous K97fs mutation in psen1 to model familial Alzheimer's disease", "Total RNA was extracted from whole brains using the mirVana miRNA isolation kit ThermoFisher using the manufacturer's protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "ERP106721", "NextSeq 500 paired end sequencing", "ENA FIRST PUBLIC:2018 05 11|ENA LAST UPDATE:2018 11 16", "11_psen1K97Gfshet_6mth_10_03_2016_S2_fem_R1.fastq.gz 11_psen1K97Gfshet_6mth_10_03_2016_S2_fem_R2.fastq.gz", "fastq fastq", 13258122000.0, 44193740.0, "ena RUN Adelaide Bioinformatics Hub 15 02 2018 04:44:34:534 5", "0:150 1:150", "A:3781076311;C:2868334319;G:3063279426;T:3542309854;N:3122090", 150, 150, null, null, 3781076311, 2868334319, 3063279426, 3542309854, 3122090, "ERX2355530", "ERS2201738", "ERA1210082", "Adelaide Bioinformatics Hub|European Nucleotide Archive", "Adelaide Bioinformatics Hub", 2, 0.91552, 0.91659, 0.32337, 0.32168, 0.69546, 0.698, 0.4697, 0.47295, 150, 150, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "Australia", "2018-02-08", "Undetermined", "Adult", "Brain", "Nervous System"], [8084, "ERR2304201", "ERX2355529", "ERS2201737", "ERP106721", "PRJEB24858", "Zebrafish   modelling familialAlzheimer's disease using heterozygous K97fs mutation in locus psen1", "ena-STUDY-Adelaide Bioinformatics Hub-08-02-2018-04:47:34:743-1099", "Other", "RNA seq analysis of whole brains from zebrafish possessing a heterozygous K97fs mutation in psen1 to model familial Alzheimer's disease Total RNA was extracted from the whole brains of mutant and wild type zebrafish when they were either 6 mpf young adult or 24 mpf infertile adult. Mutant zebrafish possess a heterozygous K97fs mutation at the endogenous zebrafish psen1 locus while wild type zebrafish do not.", "ENA FIRST PUBLIC:2018 05 11|ENA LAST UPDATE:2018 02 08", null, null, "Young mutant biorep1", "SAMEA104590455", "Adelaide Bioinformatics Hub", "ENA first public:2018 05 11|ENA last update:2018 02 14|External Id:SAMEA104590455|INSDC center alias:Adelaide Bioinformatics Hub|INSDC center name:Adelaide Bioinformatics Hub|INSDC first public:2018 05 11T17:03:03Z|INSDC last update:2018 02 14T06:16:03Z|INSDC status:public|Submitter Id:Young mutant biorep1|common name:zebrafish|sample name:Young mutant biorep1", null, null, null, null, null, null, null, null, "NextSeq 500 paired end sequencing", "ena EXPERIMENT Adelaide Bioinformatics Hub 15 02 2018 04:44:34:534 4", "10 psen1K97Gfshet 6mth 10 03 2016 S1 fem", "RNA seq analysis of whole brains from zebrafish possessing a heterozygous K97fs mutation in psen1 to model familial Alzheimer's disease", "Total RNA was extracted from whole brains using the mirVana miRNA isolation kit ThermoFisher using the manufacturer's protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "ERP106721", "NextSeq 500 paired end sequencing", "ENA FIRST PUBLIC:2018 05 11|ENA LAST UPDATE:2018 11 16", "10_psen1K97Gfshet_6mth_10_03_2016_S1_fem_R1.fastq.gz 10_psen1K97Gfshet_6mth_10_03_2016_S1_fem_R2.fastq.gz", "fastq fastq", 11724649800.0, 39082166.0, "ena RUN Adelaide Bioinformatics Hub 15 02 2018 04:44:34:534 4", "0:150 1:150", "A:3304100658;C:2560616667;G:2779636286;T:3077545106;N:2751083", 150, 150, null, null, 3304100658, 2560616667, 2779636286, 3077545106, 2751083, "ERX2355529", "ERS2201737", "ERA1210082", "Adelaide Bioinformatics Hub|European Nucleotide Archive", "Adelaide Bioinformatics Hub", 2, 0.92121, 0.91893, 0.28263, 0.27928, 0.69073, 0.6953, 0.47174, 0.46157, 150, 150, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "Australia", "2018-02-08", "Undetermined", "Adult", "Brain", "Nervous System"], [8085, "ERR2304200", "ERX2355528", "ERS2201736", "ERP106721", "PRJEB24858", "Zebrafish   modelling familialAlzheimer's disease using heterozygous K97fs mutation in locus psen1", "ena-STUDY-Adelaide Bioinformatics Hub-08-02-2018-04:47:34:743-1099", "Other", "RNA seq analysis of whole brains from zebrafish possessing a heterozygous K97fs mutation in psen1 to model familial Alzheimer's disease Total RNA was extracted from the whole brains of mutant and wild type zebrafish when they were either 6 mpf young adult or 24 mpf infertile adult. Mutant zebrafish possess a heterozygous K97fs mutation at the endogenous zebrafish psen1 locus while wild type zebrafish do not.", "ENA FIRST PUBLIC:2018 05 11|ENA LAST UPDATE:2018 02 08", null, null, "Young wild type biorep3", "SAMEA104590454", "Adelaide Bioinformatics Hub", "ENA first public:2018 05 11|ENA last update:2018 02 14|External Id:SAMEA104590454|INSDC center alias:Adelaide Bioinformatics Hub|INSDC center name:Adelaide Bioinformatics Hub|INSDC first public:2018 05 11T17:03:03Z|INSDC last update:2018 02 14T06:16:03Z|INSDC status:public|Submitter Id:Young wild type biorep3|common name:zebrafish|sample name:Young wild type biorep3", null, null, null, null, null, null, null, null, "NextSeq 500 paired end sequencing", "ena EXPERIMENT Adelaide Bioinformatics Hub 15 02 2018 04:44:34:534 3", "6 non mutant K97Gfs 6mth 10 03 2016 S3 fem", "RNA seq analysis of whole brains from zebrafish possessing a heterozygous K97fs mutation in psen1 to model familial Alzheimer's disease", "Total RNA was extracted from whole brains using the mirVana miRNA isolation kit ThermoFisher using the manufacturer's protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "ERP106721", "NextSeq 500 paired end sequencing", "ENA FIRST PUBLIC:2018 05 11|ENA LAST UPDATE:2018 11 16", "6_non_mutant_K97Gfs_6mth_10_03_2016_S3_fem_R1.fastq.gz 6_non_mutant_K97Gfs_6mth_10_03_2016_S3_fem_R2.fastq.gz", "fastq fastq", 24923212200.0, 83077374.0, "ena RUN Adelaide Bioinformatics Hub 15 02 2018 04:44:34:534 3", "0:150 1:150", "A:7077378299;C:5398402396;G:5838059014;T:6604505033;N:4867458", 150, 150, null, null, 7077378299, 5398402396, 5838059014, 6604505033, 4867458, "ERX2355528", "ERS2201736", "ERA1210082", "Adelaide Bioinformatics Hub|European Nucleotide Archive", "Adelaide Bioinformatics Hub", 2, 0.91973, 0.92144, 0.29148, 0.29015, 0.69587, 0.69994, 0.46145, 0.47047, 150, 150, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "Australia", "2018-02-08", "Undetermined", "Adult", "Brain", "Nervous System"], [8086, "ERR2304199", "ERX2355527", "ERS2201735", "ERP106721", "PRJEB24858", "Zebrafish   modelling familialAlzheimer's disease using heterozygous K97fs mutation in locus psen1", "ena-STUDY-Adelaide Bioinformatics Hub-08-02-2018-04:47:34:743-1099", "Other", "RNA seq analysis of whole brains from zebrafish possessing a heterozygous K97fs mutation in psen1 to model familial Alzheimer's disease Total RNA was extracted from the whole brains of mutant and wild type zebrafish when they were either 6 mpf young adult or 24 mpf infertile adult. Mutant zebrafish possess a heterozygous K97fs mutation at the endogenous zebrafish psen1 locus while wild type zebrafish do not.", "ENA FIRST PUBLIC:2018 05 11|ENA LAST UPDATE:2018 02 08", null, null, "Young wild type biorep2", "SAMEA104590453", "Adelaide Bioinformatics Hub", "ENA first public:2018 05 11|ENA last update:2018 02 14|External Id:SAMEA104590453|INSDC center alias:Adelaide Bioinformatics Hub|INSDC center name:Adelaide Bioinformatics Hub|INSDC first public:2018 05 11T17:03:03Z|INSDC last update:2018 02 14T06:16:03Z|INSDC status:public|Submitter Id:Young wild type biorep2|common name:zebrafish|sample name:Young wild type biorep2", null, null, null, null, null, null, null, null, "NextSeq 500 paired end sequencing", "ena EXPERIMENT Adelaide Bioinformatics Hub 15 02 2018 04:44:34:534 2", "5 non mutant K97Gfs 6mth 10 03 2016 S2 fem", "RNA seq analysis of whole brains from zebrafish possessing a heterozygous K97fs mutation in psen1 to model familial Alzheimer's disease", "Total RNA was extracted from whole brains using the mirVana miRNA isolation kit ThermoFisher using the manufacturer's protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "ERP106721", "NextSeq 500 paired end sequencing", "ENA FIRST PUBLIC:2018 05 11|ENA LAST UPDATE:2018 11 16", "5_non_mutant_K97Gfs_6mth_10_03_2016_S2_fem_R1.fastq.gz 5_non_mutant_K97Gfs_6mth_10_03_2016_S2_fem_R2.fastq.gz", "fastq fastq", 7840317153.0, 39006553.0, "ena RUN Adelaide Bioinformatics Hub 15 02 2018 04:44:34:534 2", "0:101 1:100", "A:2200490653;C:1718458832;G:1730278863;T:2188900320;N:2188485", 101, 100, null, null, 2200490653, 1718458832, 1730278863, 2188900320, 2188485, "ERX2355527", "ERS2201735", "ERA1210082", "Adelaide Bioinformatics Hub|European Nucleotide Archive", "Adelaide Bioinformatics Hub", 2, 0.91783, 0.91983, 0.32092, 0.32105, 0.67714, 0.67691, 0.47312, 0.47481, 101, 100, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "Australia", "2018-02-08", "Undetermined", "Adult", "Brain", "Nervous System"], [8087, "ERR2304198", "ERX2355526", "ERS2201734", "ERP106721", "PRJEB24858", "Zebrafish   modelling familialAlzheimer's disease using heterozygous K97fs mutation in locus psen1", "ena-STUDY-Adelaide Bioinformatics Hub-08-02-2018-04:47:34:743-1099", "Other", "RNA seq analysis of whole brains from zebrafish possessing a heterozygous K97fs mutation in psen1 to model familial Alzheimer's disease Total RNA was extracted from the whole brains of mutant and wild type zebrafish when they were either 6 mpf young adult or 24 mpf infertile adult. Mutant zebrafish possess a heterozygous K97fs mutation at the endogenous zebrafish psen1 locus while wild type zebrafish do not.", "ENA FIRST PUBLIC:2018 05 11|ENA LAST UPDATE:2018 02 08", null, null, "Young wild type biorep1", "SAMEA104590452", "Adelaide Bioinformatics Hub", "ENA first public:2018 05 11|ENA last update:2018 02 14|External Id:SAMEA104590452|INSDC center alias:Adelaide Bioinformatics Hub|INSDC center name:Adelaide Bioinformatics Hub|INSDC first public:2018 05 11T17:03:03Z|INSDC last update:2018 02 14T06:16:03Z|INSDC status:public|Submitter Id:Young wild type biorep1|common name:zebrafish|sample name:Young wild type biorep1", null, null, null, null, null, null, null, null, "NextSeq 500 paired end sequencing", "ena EXPERIMENT Adelaide Bioinformatics Hub 15 02 2018 04:44:34:534 1", "4 non mutant K97Gfs 6mth 10 03 2016 S1 fem", "RNA seq analysis of whole brains from zebrafish possessing a heterozygous K97fs mutation in psen1 to model familial Alzheimer's disease", "Total RNA was extracted from whole brains using the mirVana miRNA isolation kit ThermoFisher using the manufacturer's protocol.", null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "ERP106721", "NextSeq 500 paired end sequencing", "ENA FIRST PUBLIC:2018 05 11|ENA LAST UPDATE:2018 11 16", "4_non_mutant_K97Gfs_6mth_10_03_2016_S1_fem_R1.fastq.gz 4_non_mutant_K97Gfs_6mth_10_03_2016_S1_fem_R2.fastq.gz", "fastq fastq", 13910901600.0, 46369672.0, "ena RUN Adelaide Bioinformatics Hub 15 02 2018 04:44:34:534 1", "0:150 1:150", "A:3994738757;C:2957179645;G:3191379676;T:3764325893;N:3277629", 150, 150, null, null, 3994738757, 2957179645, 3191379676, 3764325893, 3277629, "ERX2355526", "ERS2201734", "ERA1210082", "Adelaide Bioinformatics Hub|European Nucleotide Archive", "Adelaide Bioinformatics Hub", 2, 0.91399, 0.9166, 0.3202, 0.31818, 0.6942, 0.698, 0.46902, 0.47111, 150, 150, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "Australia", "2018-02-08", "Undetermined", "Adult", "Brain", "Nervous System"], [28470, "SRR26253203", "SRX21963295", "SRS19039869", "SRP464138", "PRJNA1022587", "Danio rerio Raw sequence reads", "PRJNA1022587", "Whole Genome Sequencing", "In teleost  type I IFNs are categorized into 2 subgroups containing one or two pairs of disulphide bond. However  their functional differences have not been fully unveiled. It has been shown that IFN1 can be induced by viruses and trigger strong antiviral response in inducing hundreds of IFN stimulated genes   conferring cell resistance to viruses. However  the antiviral functions of IFN4 have been debated. To investigate the genes modulated by IFN1 and IFN4  ZF4 cells were stimulated with recombinant IFN1 and IFN4  and were performed transcriptome analysis of the small RNA.", null, null, null, null, "Small RNA IFN4 2", null, "strain:not collected|age:not collected|collection date:2023 08 20|geo loc name:not collected|sex:not collected|tissue:not collected|cell line:ZF4|replicate:biological replicate 22|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "Small RNAseq of zebrafish", "Small RNA IFND2", "Small RNA IFND2", "small RNA seq of zebrafish", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "PCR", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP464138", null, null, "IFN4-2.deadaptor.fq.gz", "fastq", 278362309.0, 11056139.0, "IFN4 2.deadaptor.fq.gz", "0:25.18", "A:71944968;C:54562141;G:73333701;T:78511075;N:10424", 25, null, null, null, 71944968, 54562141, 73333701, 78511075, 10424, "SRX21963295", "SRS19039869", "SRA1724093", "Shanghai Ocean University|College of Fisheries and Life Science", "Shanghai Ocean University", 1, 0.93133, null, 0.07401, null, 0.96181, null, 0.74558, null, 31, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2023-10-02", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [28471, "SRR26253204", "SRX21963294", "SRS19039868", "SRP464138", "PRJNA1022587", "Danio rerio Raw sequence reads", "PRJNA1022587", "Whole Genome Sequencing", "In teleost  type I IFNs are categorized into 2 subgroups containing one or two pairs of disulphide bond. However  their functional differences have not been fully unveiled. It has been shown that IFN1 can be induced by viruses and trigger strong antiviral response in inducing hundreds of IFN stimulated genes   conferring cell resistance to viruses. However  the antiviral functions of IFN4 have been debated. To investigate the genes modulated by IFN1 and IFN4  ZF4 cells were stimulated with recombinant IFN1 and IFN4  and were performed transcriptome analysis of the small RNA.", null, null, null, null, "Small RNA IFN4 1", null, "strain:not collected|age:not collected|collection date:2023 08 20|geo loc name:not collected|sex:not collected|tissue:not collected|cell line:ZF4|replicate:biological replicate 21|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "Small RNAseq of zebrafish", "Small RNA IFND1", "Small RNA IFND1", "small RNA seq of zebrafish", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "PCR", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP464138", null, null, "IFN4-1.deadaptor.fq.gz", "fastq", 289362334.0, 11048590.0, "IFN4 1.deadaptor.fq.gz", "0:26.19", "A:73933649;C:59386039;G:76847534;T:79184583;N:10529", 26, null, null, null, 73933649, 59386039, 76847534, 79184583, 10529, "SRX21963294", "SRS19039868", "SRA1724093", "Shanghai Ocean University|College of Fisheries and Life Science", "Shanghai Ocean University", 1, 0.91683, null, 0.07099, null, 0.96132, null, 0.64882, null, 25, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2023-10-02", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [28472, "SRR26253205", "SRX21963293", "SRS19039867", "SRP464138", "PRJNA1022587", "Danio rerio Raw sequence reads", "PRJNA1022587", "Whole Genome Sequencing", "In teleost  type I IFNs are categorized into 2 subgroups containing one or two pairs of disulphide bond. However  their functional differences have not been fully unveiled. It has been shown that IFN1 can be induced by viruses and trigger strong antiviral response in inducing hundreds of IFN stimulated genes   conferring cell resistance to viruses. However  the antiviral functions of IFN4 have been debated. To investigate the genes modulated by IFN1 and IFN4  ZF4 cells were stimulated with recombinant IFN1 and IFN4  and were performed transcriptome analysis of the small RNA.", null, null, null, null, "Small RNA IFN1 4", null, "strain:not collected|age:not collected|collection date:2023 08 20|geo loc name:not collected|sex:not collected|tissue:not collected|cell line:ZF4|replicate:biological replicate 20|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "Small RNAseq of zebrafish", "Small RNA IFNA4", "Small RNA IFNA4", "small RNA seq of zebrafish", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "PCR", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP464138", null, null, "IFN1-4.deadaptor.fq.gz", "fastq", 270529395.0, 11070360.0, "IFN1 4.deadaptor.fq.gz", "0:24.44", "A:69759888;C:54924667;G:71358091;T:74470720;N:16029", 24, null, null, null, 69759888, 54924667, 71358091, 74470720, 16029, "SRX21963293", "SRS19039867", "SRA1724093", "Shanghai Ocean University|College of Fisheries and Life Science", "Shanghai Ocean University", 1, 0.88469, null, 0.06696, null, 0.96664, null, 0.74853, null, 22, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2023-10-02", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [28473, "SRR26253206", "SRX21963292", "SRS19039866", "SRP464138", "PRJNA1022587", "Danio rerio Raw sequence reads", "PRJNA1022587", "Whole Genome Sequencing", "In teleost  type I IFNs are categorized into 2 subgroups containing one or two pairs of disulphide bond. However  their functional differences have not been fully unveiled. It has been shown that IFN1 can be induced by viruses and trigger strong antiviral response in inducing hundreds of IFN stimulated genes   conferring cell resistance to viruses. However  the antiviral functions of IFN4 have been debated. To investigate the genes modulated by IFN1 and IFN4  ZF4 cells were stimulated with recombinant IFN1 and IFN4  and were performed transcriptome analysis of the small RNA.", null, null, null, null, "Small RNA IFN1 3", null, "strain:not collected|age:not collected|collection date:2023 08 20|geo loc name:not collected|sex:not collected|tissue:not collected|cell line:ZF4|replicate:biological replicate 19|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "Small RNAseq of zebrafish", "Small RNA IFNA3", "Small RNA IFNA3", "small RNA seq of zebrafish", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "PCR", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP464138", null, null, "IFN1-3.deadaptor.fq.gz", "fastq", 353291957.0, 11740560.0, "IFN1 3.deadaptor.fq.gz", "0:30.09", "A:89026549;C:76490337;G:94719420;T:93036955;N:18696", 30, null, null, null, 89026549, 76490337, 94719420, 93036955, 18696, "SRX21963292", "SRS19039866", "SRA1724093", "Shanghai Ocean University|College of Fisheries and Life Science", "Shanghai Ocean University", 1, 0.83151, null, 0.07199, null, 0.96471, null, 0.71641, null, 22, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2023-10-02", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [28474, "SRR26253207", "SRX21963291", "SRS19039865", "SRP464138", "PRJNA1022587", "Danio rerio Raw sequence reads", "PRJNA1022587", "Whole Genome Sequencing", "In teleost  type I IFNs are categorized into 2 subgroups containing one or two pairs of disulphide bond. However  their functional differences have not been fully unveiled. It has been shown that IFN1 can be induced by viruses and trigger strong antiviral response in inducing hundreds of IFN stimulated genes   conferring cell resistance to viruses. However  the antiviral functions of IFN4 have been debated. To investigate the genes modulated by IFN1 and IFN4  ZF4 cells were stimulated with recombinant IFN1 and IFN4  and were performed transcriptome analysis of the small RNA.", null, null, null, null, "Small RNA IFN1 2", null, "strain:not collected|age:not collected|collection date:2023 08 20|geo loc name:not collected|sex:not collected|tissue:not collected|cell line:ZF4|replicate:biological replicate 18|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "Small RNAseq of zebrafish", "Small RNA IFNA2", "Small RNA IFNA2", "small RNA seq of zebrafish", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "PCR", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP464138", null, null, "IFN1-2.deadaptor.fq.gz", "fastq", 257949577.0, 11213774.0, "IFN1 2.deadaptor.fq.gz", "0:23.00", "A:67371681;C:51128621;G:67605590;T:71826657;N:17028", 23, null, null, null, 67371681, 51128621, 67605590, 71826657, 17028, "SRX21963291", "SRS19039865", "SRA1724093", "Shanghai Ocean University|College of Fisheries and Life Science", "Shanghai Ocean University", 1, 0.91396, null, 0.06536, null, 0.97197, null, 0.76269, null, 23, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2023-10-02", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [28475, "SRR26253208", "SRX21963290", "SRS19039864", "SRP464138", "PRJNA1022587", "Danio rerio Raw sequence reads", "PRJNA1022587", "Whole Genome Sequencing", "In teleost  type I IFNs are categorized into 2 subgroups containing one or two pairs of disulphide bond. However  their functional differences have not been fully unveiled. It has been shown that IFN1 can be induced by viruses and trigger strong antiviral response in inducing hundreds of IFN stimulated genes   conferring cell resistance to viruses. However  the antiviral functions of IFN4 have been debated. To investigate the genes modulated by IFN1 and IFN4  ZF4 cells were stimulated with recombinant IFN1 and IFN4  and were performed transcriptome analysis of the small RNA.", null, null, null, null, "Small RNA IFN1 1", null, "strain:not collected|age:not collected|collection date:2023 08 20|geo loc name:not collected|sex:not collected|tissue:not collected|cell line:ZF4|replicate:biological replicate 17|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "Small RNAseq of zebrafish", "Small RNA IFNA1", "Small RNA IFNA1", "small RNA seq of zebrafish", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "PCR", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP464138", null, null, "IFN1-1.deadaptor.fq.gz", "fastq", 329358383.0, 11799176.0, "IFN1 1.deadaptor.fq.gz", "0:27.91", "A:84093681;C:68961271;G:86502739;T:89779605;N:21087", 27, null, null, null, 84093681, 68961271, 86502739, 89779605, 21087, "SRX21963290", "SRS19039864", "SRA1724093", "Shanghai Ocean University|College of Fisheries and Life Science", "Shanghai Ocean University", 1, 0.92116, null, 0.07483, null, 0.96796, null, 0.75179, null, 22, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2023-10-02", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [28476, "SRR26253209", "SRX21963289", "SRS19039863", "SRP464138", "PRJNA1022587", "Danio rerio Raw sequence reads", "PRJNA1022587", "Whole Genome Sequencing", "In teleost  type I IFNs are categorized into 2 subgroups containing one or two pairs of disulphide bond. However  their functional differences have not been fully unveiled. It has been shown that IFN1 can be induced by viruses and trigger strong antiviral response in inducing hundreds of IFN stimulated genes   conferring cell resistance to viruses. However  the antiviral functions of IFN4 have been debated. To investigate the genes modulated by IFN1 and IFN4  ZF4 cells were stimulated with recombinant IFN1 and IFN4  and were performed transcriptome analysis of the small RNA.", null, null, null, null, "Small RNA Control 4", null, "strain:not collected|age:not collected|collection date:2023 08 20|geo loc name:not collected|sex:not collected|tissue:not collected|cell line:ZF4|replicate:biological replicate 16|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "Small RNAseq of zebrafish", "Small RNA C4", "Small RNA C4", "small RNA seq of zebrafish", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "PCR", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP464138", null, null, "Control-4.deadaptor.fq.gz", "fastq", 251577736.0, 10951659.0, "Control 4.deadaptor.fq.gz", "0:22.97", "A:65382449;C:50041232;G:66038625;T:70106464;N:8966", 22, null, null, null, 65382449, 50041232, 66038625, 70106464, 8966, "SRX21963289", "SRS19039863", "SRA1724093", "Shanghai Ocean University|College of Fisheries and Life Science", "Shanghai Ocean University", 1, 0.89744, null, 0.06821, null, 0.96607, null, 0.63829, null, 22, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2023-10-02", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [28477, "SRR26253210", "SRX21963288", "SRS19039862", "SRP464138", "PRJNA1022587", "Danio rerio Raw sequence reads", "PRJNA1022587", "Whole Genome Sequencing", "In teleost  type I IFNs are categorized into 2 subgroups containing one or two pairs of disulphide bond. However  their functional differences have not been fully unveiled. It has been shown that IFN1 can be induced by viruses and trigger strong antiviral response in inducing hundreds of IFN stimulated genes   conferring cell resistance to viruses. However  the antiviral functions of IFN4 have been debated. To investigate the genes modulated by IFN1 and IFN4  ZF4 cells were stimulated with recombinant IFN1 and IFN4  and were performed transcriptome analysis of the small RNA.", null, null, null, null, "Small RNA Control 3", null, "strain:not collected|age:not collected|collection date:2023 08 20|geo loc name:not collected|sex:not collected|tissue:not collected|cell line:ZF4|replicate:biological replicate 15|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "Small RNAseq of zebrafish", "Small RNA C3", "Small RNA C3", "small RNA seq of zebrafish", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "PCR", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP464138", null, null, "Control-3.deadaptor.fq.gz", "fastq", 252164979.0, 11004167.0, "Control 3.deadaptor.fq.gz", "0:22.92", "A:65850899;C:48466665;G:66708038;T:71130786;N:8591", 22, null, null, null, 65850899, 48466665, 66708038, 71130786, 8591, "SRX21963288", "SRS19039862", "SRA1724093", "Shanghai Ocean University|College of Fisheries and Life Science", "Shanghai Ocean University", 1, 0.91567, null, 0.06804, null, 0.96278, null, 0.75579, null, 22, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2023-10-02", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [28478, "SRR26253211", "SRX21963287", "SRS19039861", "SRP464138", "PRJNA1022587", "Danio rerio Raw sequence reads", "PRJNA1022587", "Whole Genome Sequencing", "In teleost  type I IFNs are categorized into 2 subgroups containing one or two pairs of disulphide bond. However  their functional differences have not been fully unveiled. It has been shown that IFN1 can be induced by viruses and trigger strong antiviral response in inducing hundreds of IFN stimulated genes   conferring cell resistance to viruses. However  the antiviral functions of IFN4 have been debated. To investigate the genes modulated by IFN1 and IFN4  ZF4 cells were stimulated with recombinant IFN1 and IFN4  and were performed transcriptome analysis of the small RNA.", null, null, null, null, "Small RNA IFN4 4", null, "strain:not collected|age:not collected|collection date:2023 08 20|geo loc name:not collected|sex:not collected|tissue:not collected|cell line:ZF4|replicate:biological replicate 24|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "Small RNAseq of zebrafish", "Small RNA IFND4", "Small RNA IFND4", "small RNA seq of zebrafish", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "PCR", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP464138", null, null, "IFN4-4.deadaptor.fq.gz", "fastq", 291708053.0, 11503883.0, "IFN4 4.deadaptor.fq.gz", "0:25.36", "A:74079231;C:61368459;G:76898572;T:79351225;N:10566", 25, null, null, null, 74079231, 61368459, 76898572, 79351225, 10566, "SRX21963287", "SRS19039861", "SRA1724093", "Shanghai Ocean University|College of Fisheries and Life Science", "Shanghai Ocean University", 1, 0.88888, null, 0.0633, null, 0.97305, null, 0.74862, null, 23, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2023-10-02", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [28479, "SRR26253212", "SRX21963286", "SRS19039860", "SRP464138", "PRJNA1022587", "Danio rerio Raw sequence reads", "PRJNA1022587", "Whole Genome Sequencing", "In teleost  type I IFNs are categorized into 2 subgroups containing one or two pairs of disulphide bond. However  their functional differences have not been fully unveiled. It has been shown that IFN1 can be induced by viruses and trigger strong antiviral response in inducing hundreds of IFN stimulated genes   conferring cell resistance to viruses. However  the antiviral functions of IFN4 have been debated. To investigate the genes modulated by IFN1 and IFN4  ZF4 cells were stimulated with recombinant IFN1 and IFN4  and were performed transcriptome analysis of the small RNA.", null, null, null, null, "Small RNA IFN4 3", null, "strain:not collected|age:not collected|collection date:2023 08 20|geo loc name:not collected|sex:not collected|tissue:not collected|cell line:ZF4|replicate:biological replicate 23|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "Small RNAseq of zebrafish", "Small RNA IFND3", "Small RNA IFND3", "small RNA seq of zebrafish", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "PCR", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP464138", null, null, "IFN4-3.deadaptor.fq.gz", "fastq", 349995495.0, 11885662.0, "IFN4 3.deadaptor.fq.gz", "0:29.45", "A:87443709;C:76373108;G:92741296;T:93425866;N:11516", 29, null, null, null, 87443709, 76373108, 92741296, 93425866, 11516, "SRX21963286", "SRS19039860", "SRA1724093", "Shanghai Ocean University|College of Fisheries and Life Science", "Shanghai Ocean University", 1, 0.92619, null, 0.06843, null, 0.9709, null, 0.74977, null, 73, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2023-10-02", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [28480, "SRR26253213", "SRX21963285", "SRS19039859", "SRP464138", "PRJNA1022587", "Danio rerio Raw sequence reads", "PRJNA1022587", "Whole Genome Sequencing", "In teleost  type I IFNs are categorized into 2 subgroups containing one or two pairs of disulphide bond. However  their functional differences have not been fully unveiled. It has been shown that IFN1 can be induced by viruses and trigger strong antiviral response in inducing hundreds of IFN stimulated genes   conferring cell resistance to viruses. However  the antiviral functions of IFN4 have been debated. To investigate the genes modulated by IFN1 and IFN4  ZF4 cells were stimulated with recombinant IFN1 and IFN4  and were performed transcriptome analysis of the small RNA.", null, null, null, null, "Small RNA Control 2", null, "strain:not collected|age:not collected|collection date:2023 08 20|geo loc name:not collected|sex:not collected|tissue:not collected|cell line:ZF4|replicate:biological replicate 14|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "Small RNAseq of zebrafish", "Small RNA C2", "Small RNA C2", "small RNA seq of zebrafish", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "PCR", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP464138", null, null, "Control-2.deadaptor.fq.gz", "fastq", 254163676.0, 10744164.0, "Control 2.deadaptor.fq.gz", "0:23.66", "A:66003417;C:49309846;G:67463940;T:71377644;N:8829", 23, null, null, null, 66003417, 49309846, 67463940, 71377644, 8829, "SRX21963285", "SRS19039859", "SRA1724093", "Shanghai Ocean University|College of Fisheries and Life Science", "Shanghai Ocean University", 1, 0.93068, null, 0.06626, null, 0.96441, null, 0.7492, null, 22, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2023-10-02", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [28481, "SRR26253214", "SRX21963284", "SRS19039858", "SRP464138", "PRJNA1022587", "Danio rerio Raw sequence reads", "PRJNA1022587", "Whole Genome Sequencing", "In teleost  type I IFNs are categorized into 2 subgroups containing one or two pairs of disulphide bond. However  their functional differences have not been fully unveiled. It has been shown that IFN1 can be induced by viruses and trigger strong antiviral response in inducing hundreds of IFN stimulated genes   conferring cell resistance to viruses. However  the antiviral functions of IFN4 have been debated. To investigate the genes modulated by IFN1 and IFN4  ZF4 cells were stimulated with recombinant IFN1 and IFN4  and were performed transcriptome analysis of the small RNA.", null, null, null, null, "Small RNA Control 1", null, "strain:not collected|age:not collected|collection date:2023 08 20|geo loc name:not collected|sex:not collected|tissue:not collected|cell line:ZF4|replicate:biological replicate 13|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "Small RNAseq of zebrafish", "Small RNA C1", "Small RNA C1", "small RNA seq of zebrafish", null, null, "miRNA-Seq", "TRANSCRIPTOMIC", "PCR", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP464138", null, null, "Control-1.deadaptor.fq.gz", "fastq", 267090429.0, 11027241.0, "Control 1.deadaptor.fq.gz", "0:24.22", "A:70162511;C:50705437;G:69872659;T:76339682;N:10140", 24, null, null, null, 70162511, 50705437, 69872659, 76339682, 10140, "SRX21963284", "SRS19039858", "SRA1724093", "Shanghai Ocean University|College of Fisheries and Life Science", "Shanghai Ocean University", 1, 0.93267, null, 0.07189, null, 0.96735, null, 0.75447, null, 21, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2023-10-02", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [30250, "SRR27756860", "SRX23421865", "SRS20276790", "SRP486416", "PRJNA1069604", "Danio rerio strain:TL | breed:Danio rerio Raw sequence reads", "PRJNA1069604", "Other", "To study the effect of a gene deletion in zebrafish", null, null, null, "Model organism or animal sample from danio rerio", "cobll1a", null, "ecotype:missing|dev stage:missing|collection date:2023 02 21|geo loc name:missing|sex:neuter|tissue:FISH|biomaterial provider:missing|z:1000|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "Sample A", "1", "1", "common method", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP486416", null, null, "cobll1a1.R2.fq.gz cobll1a1.R1.fq.gz", "fastq fastq", 7119566009.0, 24893517.0, "cobll1a1.R1.fq.gz", "0:143.02 1:142.98", "A:1899718926;C:1652762152;G:1669973661;T:1897092278;N:18992", 143, 142, null, null, 1899718926, 1652762152, 1669973661, 1897092278, 18992, "SRX23421865", "SRS20276790", "SRA1792726", "Hunan Normal University|Hunan Normal University", "Hunan Normal University Hunan Normal University Hunan Normal University", 2, 0.95825, 0.95956, 0.0788, 0.07795, 0.67894, 0.67884, 0.48342, 0.48268, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2024-01-29", "Undetermined", "Undetermined", "Undetermined", "Undetermined"], [30251, "SRR27756861", "SRX23421864", "SRS20276789", "SRP486416", "PRJNA1069604", "Danio rerio strain:TL | breed:Danio rerio Raw sequence reads", "PRJNA1069604", "Other", "To study the effect of a gene deletion in zebrafish", null, null, null, "MIMARKS Specimen sample from Danio rerio", "WT", null, "strain:WT|collection date:2023 02 28|depth:missing|elev:missing|env broad scale:missing|env local scale:missing|env medium:missing|geo loc name:missing|isol growth condt:missing|lat lon:missing|BioSampleModel:MIMARKS.specimen|BioSampleModel:MIGS/MIMS/MIMARKS.microbial", null, null, null, null, null, null, null, null, "Sample L", "11", "11", "common method", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP486416", null, null, "tu3.R1.fq.gz tu3.R2.fq.gz", "fastq fastq", 6881670461.0, 24208326.0, "tu3.R1.fq.gz", "0:142.15 1:142.12", "A:1820714788;C:1612866668;G:1629078247;T:1818992861;N:17897", 142, 142, null, null, 1820714788, 1612866668, 1629078247, 1818992861, 17897, "SRX23421864", "SRS20276789", "SRA1792726", "Hunan Normal University|Hunan Normal University", "Hunan Normal University Hunan Normal University Hunan Normal University", 2, 0.95713, 0.95821, 0.07191, 0.07071, 0.67801, 0.67726, 0.48591, 0.48501, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2024-01-29", "Undetermined", "Undetermined", "Undetermined", "Undetermined"], [30252, "SRR27756862", "SRX23421863", "SRS20276790", "SRP486416", "PRJNA1069604", "Danio rerio strain:TL | breed:Danio rerio Raw sequence reads", "PRJNA1069604", "Other", "To study the effect of a gene deletion in zebrafish", null, null, null, "Model organism or animal sample from danio rerio", "cobll1a", null, "ecotype:missing|dev stage:missing|collection date:2023 02 21|geo loc name:missing|sex:neuter|tissue:FISH|biomaterial provider:missing|z:1000|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "Sample C", "3", "3", "common method", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP486416", null, null, "cobll1a2.R1.fq.gz cobll1a2.R2.fq.gz", "fastq fastq", 6639076778.0, 23213579.0, "cobll1a2.R1.fq.gz", "0:143.02 1:142.98", "A:1799749408;C:1513051586;G:1530064901;T:1796193421;N:17462", 143, 142, null, null, 1799749408, 1513051586, 1530064901, 1796193421, 17462, "SRX23421863", "SRS20276790", "SRA1792726", "Hunan Normal University|Hunan Normal University", "Hunan Normal University Hunan Normal University Hunan Normal University", 2, 0.95695, 0.95781, 0.091, 0.0896, 0.68199, 0.68075, 0.49051, 0.49057, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2024-01-29", "Undetermined", "Undetermined", "Undetermined", "Undetermined"], [30253, "SRR27756863", "SRX23421862", "SRS20276790", "SRP486416", "PRJNA1069604", "Danio rerio strain:TL | breed:Danio rerio Raw sequence reads", "PRJNA1069604", "Other", "To study the effect of a gene deletion in zebrafish", null, null, null, "Model organism or animal sample from danio rerio", "cobll1a", null, "ecotype:missing|dev stage:missing|collection date:2023 02 21|geo loc name:missing|sex:neuter|tissue:FISH|biomaterial provider:missing|z:1000|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "Sample E", "5", "5", "common method", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP486416", null, null, "cobll1a3.R2.fq.gz cobll1a3.R1.fq.gz", "fastq fastq", 6697695084.0, 23490214.0, "cobll1a3.R1.fq.gz", "0:142.58 1:142.55", "A:1755043056;C:1586242926;G:1602146148;T:1754245480;N:17474", 142, 142, null, null, 1755043056, 1586242926, 1602146148, 1754245480, 17474, "SRX23421862", "SRS20276790", "SRA1792726", "Hunan Normal University|Hunan Normal University", "Hunan Normal University Hunan Normal University Hunan Normal University", 2, 0.96007, 0.96224, 0.06487, 0.06404, 0.66939, 0.66906, 0.48829, 0.48765, 130, 130, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2024-01-29", "Undetermined", "Undetermined", "Undetermined", "Undetermined"], [30254, "SRR27756864", "SRX23421861", "SRS20276789", "SRP486416", "PRJNA1069604", "Danio rerio strain:TL | breed:Danio rerio Raw sequence reads", "PRJNA1069604", "Other", "To study the effect of a gene deletion in zebrafish", null, null, null, "MIMARKS Specimen sample from Danio rerio", "WT", null, "strain:WT|collection date:2023 02 28|depth:missing|elev:missing|env broad scale:missing|env local scale:missing|env medium:missing|geo loc name:missing|isol growth condt:missing|lat lon:missing|BioSampleModel:MIMARKS.specimen|BioSampleModel:MIGS/MIMS/MIMARKS.microbial", null, null, null, null, null, null, null, null, "Sample G", "7", "7", "common method", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP486416", null, null, "tu1.R1.fq.gz tu1.R2.fq.gz", "fastq fastq", 7124072376.0, 25020568.0, "tu1.R1.fq.gz", "0:142.38 1:142.35", "A:1889928651;C:1664950324;G:1681768417;T:1887406325;N:18659", 142, 142, null, null, 1889928651, 1664950324, 1681768417, 1887406325, 18659, "SRX23421861", "SRS20276789", "SRA1792726", "Hunan Normal University|Hunan Normal University", "Hunan Normal University Hunan Normal University Hunan Normal University", 2, 0.96032, 0.96145, 0.07398, 0.07359, 0.68503, 0.6843, 0.48524, 0.48933, 116, 116, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2024-01-29", "Undetermined", "Undetermined", "Undetermined", "Undetermined"], [30255, "SRR27756865", "SRX23421860", "SRS20276789", "SRP486416", "PRJNA1069604", "Danio rerio strain:TL | breed:Danio rerio Raw sequence reads", "PRJNA1069604", "Other", "To study the effect of a gene deletion in zebrafish", null, null, null, "MIMARKS Specimen sample from Danio rerio", "WT", null, "strain:WT|collection date:2023 02 28|depth:missing|elev:missing|env broad scale:missing|env local scale:missing|env medium:missing|geo loc name:missing|isol growth condt:missing|lat lon:missing|BioSampleModel:MIMARKS.specimen|BioSampleModel:MIGS/MIMS/MIMARKS.microbial", null, null, null, null, null, null, null, null, "Sample J", "9", "9", "common method", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP486416", null, null, "tu2.R1.fq.gz tu2.R2.fq.gz", "fastq fastq", 7024719799.0, 24627933.0, "tu2.R1.fq.gz", "0:142.63 1:142.60", "A:1841519314;C:1662861553;G:1679614735;T:1840705226;N:18971", 142, 142, null, null, 1841519314, 1662861553, 1679614735, 1840705226, 18971, "SRX23421860", "SRS20276789", "SRA1792726", "Hunan Normal University|Hunan Normal University", "Hunan Normal University Hunan Normal University Hunan Normal University", 2, 0.96006, 0.96141, 0.06713, 0.06631, 0.67464, 0.67426, 0.48684, 0.48648, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2024-01-29", "Undetermined", "Undetermined", "Undetermined", "Undetermined"], [30702, "SRR28328136", "SRX23936571", "SRS20740255", "SRP494948", "PRJNA1086823", "Danio rerio Raw sequence reads", "PRJNA1086823", "Whole Genome Sequencing", "Study the effects on the body when this gene is lost", null, null, "Study the effects on the body when this gene is lost", "Model organism or animal sample from Danio rerio", "tu ", null, "strain:FISH|age:2|collection date:2023 02 28|geo loc name:missing|sex:missing|tissue:missing|biomaterial provider:missing|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "SampleF", "6", "6", "control", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP494948", null, null, "tu_3.R1.raw.fastq.gz tu_3.R2.raw.fastq.gz", "fastq fastq", 6836795894.0, 22638397.0, "tu 3.R1.raw.fastq.gz", "0:151 1:151", "A:1911756035;C:1496221872;G:1563235044;T:1865509810;N:73133", 151, 151, null, null, 1911756035, 1496221872, 1563235044, 1865509810, 73133, "SRX23936571", "SRS20740255", "SRA1823374", "Hunan Normal University|Hunan Normal University", "Hunan Normal University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2024-03-13", "Undetermined", "Undetermined", "Trunk", "Surface Structure"], [30703, "SRR28328137", "SRX23936570", "SRS20740255", "SRP494948", "PRJNA1086823", "Danio rerio Raw sequence reads", "PRJNA1086823", "Whole Genome Sequencing", "Study the effects on the body when this gene is lost", null, null, "Study the effects on the body when this gene is lost", "Model organism or animal sample from Danio rerio", "tu ", null, "strain:FISH|age:2|collection date:2023 02 28|geo loc name:missing|sex:missing|tissue:missing|biomaterial provider:missing|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "SampleE", "5", "5", "control", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP494948", null, null, "tu_2.R1.raw.fastq.gz tu_2.R2.raw.fastq.gz", "fastq fastq", 6933313282.0, 22957991.0, "tu 2.R1.raw.fastq.gz", "0:151 1:151", "A:1895897966;C:1562896362;G:1633152399;T:1841286721;N:79834", 151, 151, null, null, 1895897966, 1562896362, 1633152399, 1841286721, 79834, "SRX23936570", "SRS20740255", "SRA1823374", "Hunan Normal University|Hunan Normal University", "Hunan Normal University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2024-03-13", "Undetermined", "Undetermined", "Trunk", "Surface Structure"], [30704, "SRR28328138", "SRX23936569", "SRS20740255", "SRP494948", "PRJNA1086823", "Danio rerio Raw sequence reads", "PRJNA1086823", "Whole Genome Sequencing", "Study the effects on the body when this gene is lost", null, null, "Study the effects on the body when this gene is lost", "Model organism or animal sample from Danio rerio", "tu ", null, "strain:FISH|age:2|collection date:2023 02 28|geo loc name:missing|sex:missing|tissue:missing|biomaterial provider:missing|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "SampleD", "4", "4", "control", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP494948", null, null, "tu_1.R1.raw.fastq.gz tu_1.R2.raw.fastq.gz", "fastq fastq", 6953463930.0, 23024715.0, "tu 1.R1.raw.fastq.gz", "0:151 1:151", "A:1914281996;C:1558685345;G:1630355775;T:1850061551;N:79263", 151, 151, null, null, 1914281996, 1558685345, 1630355775, 1850061551, 79263, "SRX23936569", "SRS20740255", "SRA1823374", "Hunan Normal University|Hunan Normal University", "Hunan Normal University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2024-03-13", "Undetermined", "Undetermined", "Trunk", "Surface Structure"], [30705, "SRR28328139", "SRX23936568", "SRS20740254", "SRP494948", "PRJNA1086823", "Danio rerio Raw sequence reads", "PRJNA1086823", "Whole Genome Sequencing", "Study the effects on the body when this gene is lost", null, null, "Study the effects on the body when this gene is lost", "Model organism or animal sample from Danio rerio", "myo7aa", null, "strain:FISH|age:2|collection date:2023 02 28|geo loc name:missing|sex:missing|tissue:missing|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "SampleC", "3", "3", "treatment", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP494948", null, null, "myo7aa_3.R1.raw.fastq.gz myo7aa_3.R2.raw.fastq.gz", "fastq fastq", 6793366180.0, 22494590.0, "myo7aa 3.R1.raw.fastq.gz", "0:151 1:151", "A:1786353133;C:1602317410;G:1674855786;T:1729822151;N:17700", 151, 151, null, null, 1786353133, 1602317410, 1674855786, 1729822151, 17700, "SRX23936568", "SRS20740254", "SRA1823374", "Hunan Normal University|Hunan Normal University", "Hunan Normal University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2024-03-13", "Undetermined", "Undetermined", "Trunk", "Surface Structure"], [30706, "SRR28328140", "SRX23936567", "SRS20740254", "SRP494948", "PRJNA1086823", "Danio rerio Raw sequence reads", "PRJNA1086823", "Whole Genome Sequencing", "Study the effects on the body when this gene is lost", null, null, "Study the effects on the body when this gene is lost", "Model organism or animal sample from Danio rerio", "myo7aa", null, "strain:FISH|age:2|collection date:2023 02 28|geo loc name:missing|sex:missing|tissue:missing|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "SampleB", "2", "2", "treatment", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP494948", null, null, "myo7aa_2.R1.raw.fastq.gz myo7aa_2.R2.raw.fastq.gz", "fastq fastq", 6762797438.0, 22393369.0, "myo7aa 2.R1.raw.fastq.gz", "0:151 1:151", "A:1816704062;C:1557768239;G:1627373716;T:1760926609;N:24812", 151, 151, null, null, 1816704062, 1557768239, 1627373716, 1760926609, 24812, "SRX23936567", "SRS20740254", "SRA1823374", "Hunan Normal University|Hunan Normal University", "Hunan Normal University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2024-03-13", "Undetermined", "Undetermined", "Trunk", "Surface Structure"], [30707, "SRR28328141", "SRX23936566", "SRS20740254", "SRP494948", "PRJNA1086823", "Danio rerio Raw sequence reads", "PRJNA1086823", "Whole Genome Sequencing", "Study the effects on the body when this gene is lost", null, null, "Study the effects on the body when this gene is lost", "Model organism or animal sample from Danio rerio", "myo7aa", null, "strain:FISH|age:2|collection date:2023 02 28|geo loc name:missing|sex:missing|tissue:missing|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "SampleA", "1", "1", "treatment", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP494948", null, null, "myo7aa_1.R1.raw.fastq.gz myo7aa_1.R2.raw.fastq.gz", "fastq fastq", 6605710628.0, 21873214.0, "myo7aa 1.R1.raw.fastq.gz", "0:151 1:151", "A:1728796843;C:1565920605;G:1629477870;T:1681497978;N:17332", 151, 151, null, null, 1728796843, 1565920605, 1629477870, 1681497978, 17332, "SRX23936566", "SRS20740254", "SRA1823374", "Hunan Normal University|Hunan Normal University", "Hunan Normal University", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2024-03-13", "Undetermined", "Undetermined", "Trunk", "Surface Structure"], [32476, "SRR29270149", "SRX24787634", "SRS21505104", "SRP511487", "PRJNA1119569", "RNA seq of zebrafish foxl2l mutant", "PRJNA1119569", "Other", "Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.", null, null, null, null, "foxl2l Mut 20 1", null, "strain:AB|age:20|collection date:2023 06 10|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "foxl2l Mut 20 1", "E10", "E10", "50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme  NR604 01", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP511487", null, null, "foxl2l_Mut-20-1_S162_R1.fastq.gz foxl2l_Mut-20-1_S162_R2.fastq.gz", "fastq fastq", 8940963680.0, 29605840.0, "foxl2l Mut 20 1 S162 R1.fastq.gz", "0:151 1:151", "A:2232167098;C:2229744850;G:2271326718;T:2207692629;N:32385", 151, 151, null, null, 2232167098, 2229744850, 2271326718, 2207692629, 32385, "SRX24787634", "SRS21505104", "SRA1887976", "Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology", "Institute of Hydrobiology, Chinese Academy of Sciences", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "bulk", "bulk", null, "China", "2024-06-03", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [32477, "SRR29270150", "SRX24787633", "SRS21505103", "SRP511487", "PRJNA1119569", "RNA seq of zebrafish foxl2l mutant", "PRJNA1119569", "Other", "Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.", null, null, null, null, "foxl2l Het 20 3", null, "strain:AB|age:20|collection date:2023 06 09|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "foxl2l Het 20 3", "E9", "E9", "50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme  NR604 01", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP511487", null, null, "foxl2l_Het-20-3_S161_R1.fastq.gz foxl2l_Het-20-3_S161_R2.fastq.gz", "fastq fastq", 7038409282.0, 23305991.0, "foxl2l Het 20 3 S161 R1.fastq.gz", "0:151 1:151", "A:1766863186;C:1740008639;G:1787471686;T:1744039429;N:26342", 151, 151, null, null, 1766863186, 1740008639, 1787471686, 1744039429, 26342, "SRX24787633", "SRS21505103", "SRA1887976", "Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology", "Institute of Hydrobiology, Chinese Academy of Sciences", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "bulk", "bulk", null, "China", "2024-06-03", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [32478, "SRR29270151", "SRX24787632", "SRS21505102", "SRP511487", "PRJNA1119569", "RNA seq of zebrafish foxl2l mutant", "PRJNA1119569", "Other", "Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.", null, null, null, null, "foxl2l Het 20 2", null, "strain:AB|age:20|collection date:2023 06 08|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "foxl2l Het 20 2", "E8", "E8", "50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme  NR604 01", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP511487", null, null, "foxl2l_Het-20-2_S160_R1.fastq.gz foxl2l_Het-20-2_S160_R2.fastq.gz", "fastq fastq", 6772505832.0, 22425516.0, "foxl2l Het 20 2 S160 R1.fastq.gz", "0:151 1:151", "A:1704124986;C:1673138074;G:1713003931;T:1682214009;N:24832", 151, 151, null, null, 1704124986, 1673138074, 1713003931, 1682214009, 24832, "SRX24787632", "SRS21505102", "SRA1887976", "Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology", "Institute of Hydrobiology, Chinese Academy of Sciences", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "bulk", "bulk", null, "China", "2024-06-03", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [32479, "SRR29270152", "SRX24787631", "SRS21505101", "SRP511487", "PRJNA1119569", "RNA seq of zebrafish foxl2l mutant", "PRJNA1119569", "Other", "Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.", null, null, null, null, "foxl2l Het 20 1", null, "strain:AB|age:20|collection date:2023 06 07|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "foxl2l Het 20 1", "E7", "E7", "50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme  NR604 01", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP511487", null, null, "foxl2l_Het-20-1_S159_R1.fastq.gz foxl2l_Het-20-1_S159_R2.fastq.gz", "fastq fastq", 11685740812.0, 38694506.0, "foxl2l Het 20 1 S159 R1.fastq.gz", "0:151 1:151", "A:2939618668;C:2888861085;G:2958173208;T:2899044704;N:43147", 151, 151, null, null, 2939618668, 2888861085, 2958173208, 2899044704, 43147, "SRX24787631", "SRS21505101", "SRA1887976", "Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology", "Institute of Hydrobiology, Chinese Academy of Sciences", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "bulk", "bulk", null, "China", "2024-06-03", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [32480, "SRR29270153", "SRX24787630", "SRS21505100", "SRP511487", "PRJNA1119569", "RNA seq of zebrafish foxl2l mutant", "PRJNA1119569", "Other", "Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.", null, null, null, null, "foxl2l Mut 15 3", null, "strain:AB|age:15|collection date:2023 06 06|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "foxl2l Mut 15 3", "E6", "E6", "50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme  NR604 01", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP511487", null, null, "foxl2l_Mut-15-3_S158_R1.fastq.gz foxl2l_Mut-15-3_S158_R2.fastq.gz", "fastq fastq", 9503789604.0, 31469502.0, "foxl2l Mut 15 3 S158 R1.fastq.gz", "0:151 1:151", "A:2393052443;C:2340958111;G:2411502428;T:2358240313;N:36309", 151, 151, null, null, 2393052443, 2340958111, 2411502428, 2358240313, 36309, "SRX24787630", "SRS21505100", "SRA1887976", "Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology", "Institute of Hydrobiology, Chinese Academy of Sciences", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "bulk", "bulk", null, "China", "2024-06-03", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [32481, "SRR29270154", "SRX24787629", "SRS21505099", "SRP511487", "PRJNA1119569", "RNA seq of zebrafish foxl2l mutant", "PRJNA1119569", "Other", "Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.", null, null, null, null, "foxl2l Mut 15 2", null, "strain:AB|age:15|collection date:2023 06 05|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "foxl2l Mut 15 2", "E5", "E5", "50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme  NR604 01", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP511487", null, null, "foxl2l_Mut-15-2_S157_R1.fastq.gz foxl2l_Mut-15-2_S157_R2.fastq.gz", "fastq fastq", 7416837026.0, 24559063.0, "foxl2l Mut 15 2 S157 R1.fastq.gz", "0:151 1:151", "A:1865711045;C:1830489703;G:1881612508;T:1838995980;N:27790", 151, 151, null, null, 1865711045, 1830489703, 1881612508, 1838995980, 27790, "SRX24787629", "SRS21505099", "SRA1887976", "Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology", "Institute of Hydrobiology, Chinese Academy of Sciences", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "bulk", "bulk", null, "China", "2024-06-03", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [32482, "SRR29270155", "SRX24787628", "SRS21505098", "SRP511487", "PRJNA1119569", "RNA seq of zebrafish foxl2l mutant", "PRJNA1119569", "Other", "Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.", null, null, null, null, "foxl2l Mut 15 1", null, "strain:AB|age:15|collection date:2023 06 04|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "foxl2l Mut 15 1", "E4", "E4", "50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme  NR604 01", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP511487", null, null, "foxl2l_Mut-15-1_S156_R1.fastq.gz foxl2l_Mut-15-1_S156_R2.fastq.gz", "fastq fastq", 7092721868.0, 23485834.0, "foxl2l Mut 15 1 S156 R1.fastq.gz", "0:151 1:151", "A:1764166761;C:1770534219;G:1820397492;T:1737597123;N:26273", 151, 151, null, null, 1764166761, 1770534219, 1820397492, 1737597123, 26273, "SRX24787628", "SRS21505098", "SRA1887976", "Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology", "Institute of Hydrobiology, Chinese Academy of Sciences", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "bulk", "bulk", null, "China", "2024-06-03", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [32483, "SRR29270156", "SRX24787627", "SRS21505097", "SRP511487", "PRJNA1119569", "RNA seq of zebrafish foxl2l mutant", "PRJNA1119569", "Other", "Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.", null, null, null, null, "foxl2l Het 15 3", null, "strain:AB|age:15|collection date:2023 06 03|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "foxl2l Het 15 3", "E3", "E3", "50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme  NR604 01", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP511487", null, null, "foxl2l_Het-15-3_S155_R1.fastq.gz foxl2l_Het-15-3_S155_R2.fastq.gz", "fastq fastq", 8083606820.0, 26766910.0, "foxl2l Het 15 3 S155 R1.fastq.gz", "0:151 1:151", "A:2028557443;C:2001113164;G:2050610840;T:2003295953;N:29420", 151, 151, null, null, 2028557443, 2001113164, 2050610840, 2003295953, 29420, "SRX24787627", "SRS21505097", "SRA1887976", "Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology", "Institute of Hydrobiology, Chinese Academy of Sciences", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "bulk", "bulk", null, "China", "2024-06-03", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [32484, "SRR29270157", "SRX24787626", "SRS21505096", "SRP511487", "PRJNA1119569", "RNA seq of zebrafish foxl2l mutant", "PRJNA1119569", "Other", "Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.", null, null, null, null, "foxl2l Mut 20 3", null, "strain:AB|age:20|collection date:2023 06 12|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "foxl2l Mut 20 3", "E12", "E12", "50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme  NR604 01", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP511487", null, null, "foxl2l_Mut-20-3_S164_R1.fastq.gz foxl2l_Mut-20-3_S164_R2.fastq.gz", "fastq fastq", 7474861796.0, 24751198.0, "foxl2l Mut 20 3 S164 R1.fastq.gz", "0:151 1:151", "A:1878881650;C:1849512621;G:1891142525;T:1855296720;N:28280", 151, 151, null, null, 1878881650, 1849512621, 1891142525, 1855296720, 28280, "SRX24787626", "SRS21505096", "SRA1887976", "Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology", "Institute of Hydrobiology, Chinese Academy of Sciences", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "bulk", "bulk", null, "China", "2024-06-03", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [32485, "SRR29270158", "SRX24787625", "SRS21505095", "SRP511487", "PRJNA1119569", "RNA seq of zebrafish foxl2l mutant", "PRJNA1119569", "Other", "Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.", null, null, null, null, "foxl2l Mut 20 2", null, "strain:AB|age:20|collection date:2023 06 11|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "foxl2l Mut 20 2", "E11", "E11", "50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme  NR604 01", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP511487", null, null, "foxl2l_Mut-20-2_S163_R1.fastq.gz foxl2l_Mut-20-2_S163_R2.fastq.gz", "fastq fastq", 8203704066.0, 27164583.0, "foxl2l Mut 20 2 S163 R1.fastq.gz", "0:151 1:151", "A:2061693689;C:2030126562;G:2072980952;T:2038873198;N:29665", 151, 151, null, null, 2061693689, 2030126562, 2072980952, 2038873198, 29665, "SRX24787625", "SRS21505095", "SRA1887976", "Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology", "Institute of Hydrobiology, Chinese Academy of Sciences", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "bulk", "bulk", null, "China", "2024-06-03", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [32486, "SRR29270159", "SRX24787624", "SRS21505094", "SRP511487", "PRJNA1119569", "RNA seq of zebrafish foxl2l mutant", "PRJNA1119569", "Other", "Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.", null, null, null, null, "foxl2l Het 15 2", null, "strain:AB|age:15|collection date:2023 06 02|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "foxl2l Het 15 2", "E2", "E2", "50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme  NR604 01", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP511487", null, null, "foxl2l_Het-15-2_S154_R1.fastq.gz foxl2l_Het-15-2_S154_R2.fastq.gz", "fastq fastq", 7868286860.0, 26053930.0, "foxl2l Het 15 2 S154 R1.fastq.gz", "0:151 1:151", "A:1972210357;C:1946891859;G:2008091153;T:1941064817;N:28674", 151, 151, null, null, 1972210357, 1946891859, 2008091153, 1941064817, 28674, "SRX24787624", "SRS21505094", "SRA1887976", "Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology", "Institute of Hydrobiology, Chinese Academy of Sciences", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "bulk", "bulk", null, "China", "2024-06-03", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [32487, "SRR29270160", "SRX24787623", "SRS21505093", "SRP511487", "PRJNA1119569", "RNA seq of zebrafish foxl2l mutant", "PRJNA1119569", "Other", "Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.", null, null, null, null, "foxl2l Het 15 1", null, "strain:AB|age:15|collection date:2023 06 01|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "foxl2l Het 15 1", "E1", "E1", "50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme  NR604 01", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP511487", null, null, "foxl2l_Het-15-1_S153_R1.fastq.gz foxl2l_Het-15-1_S153_R2.fastq.gz", "fastq fastq", 7117391946.0, 23567523.0, "foxl2l Het 15 1 S153 R1.fastq.gz", "0:151 1:151", "A:1795668098;C:1752824783;G:1793720116;T:1775153584;N:25365", 151, 151, null, null, 1795668098, 1752824783, 1793720116, 1775153584, 25365, "SRX24787623", "SRS21505093", "SRA1887976", "Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology", "Institute of Hydrobiology, Chinese Academy of Sciences", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "random_priming", "unknown", "bulk", "bulk", "bulk", null, "China", "2024-06-03", "Undetermined", "Undetermined", "Gonad", "Reproductive System"], [34593, "SRR32128857", "SRX27475161", "SRS23899211", "SRP559934", "PRJNA1215774", "3 mpf dark reared zebrafish eye RNA sequencing", "PRJNA1215774", "Other", "Outdoor time and light intensity are important emerging factors affecting myopia; however  the underlying mechanisms remain unknown. To clarify the possible molecular mechanisms underlying myopia caused by dark environment  3 mpf zebrafish eye RNA sequencing was performed.", null, null, null, null, "lighttreated4", null, "strain:not applicable|isolate:Sun Yat sen University|breed:not applicable10|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:not applicable10|collection date:2021 04 16|geo loc name:China: GuangZhou|sex:not applicable|tissue:zebrafish10|isolation source:zebrafish10|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample info", "library 10", "library 10", "DNA barcode10", null, null, "WXS", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP559934", null, null, "lighttreated4.read1.fastq.gz lighttreated4.read2.fastq.gz", "fastq fastq", 6388100400.0, 21293668.0, "lighttreated4.read1.fastq.gz", "0:150 1:150", "A:1711345062;C:1474552325;G:1531680528;T:1670485285;N:37200", 150, 150, null, null, 1711345062, 1474552325, 1531680528, 1670485285, 37200, "SRX27475161", "SRS23899211", "SRA2060897", "zhujiang hospital|ophthalmology", "zhujiang hospital", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2025-01-25", "Undetermined", "Adult", "Undetermined", "Undetermined"], [34594, "SRR32128858", "SRX27475160", "SRS23899210", "SRP559934", "PRJNA1215774", "3 mpf dark reared zebrafish eye RNA sequencing", "PRJNA1215774", "Other", "Outdoor time and light intensity are important emerging factors affecting myopia; however  the underlying mechanisms remain unknown. To clarify the possible molecular mechanisms underlying myopia caused by dark environment  3 mpf zebrafish eye RNA sequencing was performed.", null, null, null, null, "lighttreated3", null, "strain:not applicable|isolate:Sun Yat sen University|breed:not applicable9|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:not applicable9|collection date:2021 04 16|geo loc name:China: GuangZhou|sex:not applicable|tissue:zebrafish9|isolation source:zebrafish9|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample info", "library 9", "library 9", "DNA barcode9", null, null, "WXS", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP559934", null, null, "lighttreated3.read1.fastq.gz lighttreated3.read2.fastq.gz", "fastq fastq", 7919383200.0, 26397944.0, "lighttreated3.read1.fastq.gz", "0:150 1:150", "A:2135212601;C:1813586654;G:1892878979;T:2077658764;N:46202", 150, 150, null, null, 2135212601, 1813586654, 1892878979, 2077658764, 46202, "SRX27475160", "SRS23899210", "SRA2060897", "zhujiang hospital|ophthalmology", "zhujiang hospital", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2025-01-25", "Undetermined", "Adult", "Undetermined", "Undetermined"], [34595, "SRR32128859", "SRX27475159", "SRS23899209", "SRP559934", "PRJNA1215774", "3 mpf dark reared zebrafish eye RNA sequencing", "PRJNA1215774", "Other", "Outdoor time and light intensity are important emerging factors affecting myopia; however  the underlying mechanisms remain unknown. To clarify the possible molecular mechanisms underlying myopia caused by dark environment  3 mpf zebrafish eye RNA sequencing was performed.", null, null, null, null, "lighttreated2", null, "strain:not applicable|isolate:Sun Yat sen University|breed:not applicable8|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:not applicable8|collection date:2021 04 16|geo loc name:China: GuangZhou|sex:not applicable|tissue:zebrafish8|isolation source:zebrafish8|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample info", "library 8", "library 8", "DNA barcode8", null, null, "WXS", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP559934", null, null, "lighttreated2.read1.fastq.gz lighttreated2.read2.fastq.gz", "fastq fastq", 7060994100.0, 23536647.0, "lighttreated2.read1.fastq.gz", "0:150 1:150", "A:1921099545;C:1595276449;G:1668657714;T:1875918159;N:42233", 150, 150, null, null, 1921099545, 1595276449, 1668657714, 1875918159, 42233, "SRX27475159", "SRS23899209", "SRA2060897", "zhujiang hospital|ophthalmology", "zhujiang hospital", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2025-01-25", "Undetermined", "Adult", "Undetermined", "Undetermined"], [34596, "SRR32128860", "SRX27475158", "SRS23899208", "SRP559934", "PRJNA1215774", "3 mpf dark reared zebrafish eye RNA sequencing", "PRJNA1215774", "Other", "Outdoor time and light intensity are important emerging factors affecting myopia; however  the underlying mechanisms remain unknown. To clarify the possible molecular mechanisms underlying myopia caused by dark environment  3 mpf zebrafish eye RNA sequencing was performed.", null, null, null, null, "lighttreated1", null, "strain:not applicable|isolate:Sun Yat sen University|breed:not applicable7|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:not applicable7|collection date:2021 04 16|geo loc name:China: GuangZhou|sex:not applicable|tissue:zebrafish7|isolation source:zebrafish7|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample info", "library 7", "library 7", "DNA barcode7", null, null, "WXS", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP559934", null, null, "lighttreated1.read1.fastq.gz lighttreated1.read2.fastq.gz", "fastq fastq", 6908625300.0, 23028751.0, "lighttreated1.read1.fastq.gz", "0:150 1:150", "A:1872190225;C:1565342714;G:1644929113;T:1826124355;N:38893", 150, 150, null, null, 1872190225, 1565342714, 1644929113, 1826124355, 38893, "SRX27475158", "SRS23899208", "SRA2060897", "zhujiang hospital|ophthalmology", "zhujiang hospital", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2025-01-25", "Undetermined", "Adult", "Undetermined", "Undetermined"], [34597, "SRR32128861", "SRX27475157", "SRS23899207", "SRP559934", "PRJNA1215774", "3 mpf dark reared zebrafish eye RNA sequencing", "PRJNA1215774", "Other", "Outdoor time and light intensity are important emerging factors affecting myopia; however  the underlying mechanisms remain unknown. To clarify the possible molecular mechanisms underlying myopia caused by dark environment  3 mpf zebrafish eye RNA sequencing was performed.", null, null, null, null, "darktreated6", null, "strain:not applicable|isolate:Sun Yat sen University|breed:not applicable6|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:not applicable6|collection date:2021 04 16|geo loc name:China: GuangZhou|sex:not applicable|tissue:zebrafish6|isolation source:zebrafish6|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample info", "library 6", "library 6", "DNA barcode6", null, null, "WXS", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP559934", null, null, "darktreated6.read1.fastq.gz darktreated6.read2.fastq.gz", "fastq fastq", 8601630900.0, 28672103.0, "darktreated6.read1.fastq.gz", "0:150 1:150", "A:2318530970;C:1973292572;G:2040962638;T:2268796005;N:48715", 150, 150, null, null, 2318530970, 1973292572, 2040962638, 2268796005, 48715, "SRX27475157", "SRS23899207", "SRA2060897", "zhujiang hospital|ophthalmology", "zhujiang hospital", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2025-01-25", "Undetermined", "Adult", "Undetermined", "Undetermined"], [34598, "SRR32128862", "SRX27475156", "SRS23899206", "SRP559934", "PRJNA1215774", "3 mpf dark reared zebrafish eye RNA sequencing", "PRJNA1215774", "Other", "Outdoor time and light intensity are important emerging factors affecting myopia; however  the underlying mechanisms remain unknown. To clarify the possible molecular mechanisms underlying myopia caused by dark environment  3 mpf zebrafish eye RNA sequencing was performed.", null, null, null, null, "darktreated5", null, "strain:not applicable|isolate:Sun Yat sen University|breed:not applicable5|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:not applicable5|collection date:2021 04 16|geo loc name:China: GuangZhou|sex:not applicable|tissue:zebrafish5|isolation source:zebrafish5|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample info", "library 5", "library 5", "DNA barcode5", null, null, "WXS", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP559934", null, null, "darktreated5.read1.fastq.gz darktreated5.read2.fastq.gz", "fastq fastq", 8265255300.0, 27550851.0, "darktreated5.read1.fastq.gz", "0:150 1:150", "A:2224219375;C:1898065838;G:1969603341;T:2173318912;N:47834", 150, 150, null, null, 2224219375, 1898065838, 1969603341, 2173318912, 47834, "SRX27475156", "SRS23899206", "SRA2060897", "zhujiang hospital|ophthalmology", "zhujiang hospital", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2025-01-25", "Undetermined", "Adult", "Undetermined", "Undetermined"], [34599, "SRR32128863", "SRX27475155", "SRS23899205", "SRP559934", "PRJNA1215774", "3 mpf dark reared zebrafish eye RNA sequencing", "PRJNA1215774", "Other", "Outdoor time and light intensity are important emerging factors affecting myopia; however  the underlying mechanisms remain unknown. To clarify the possible molecular mechanisms underlying myopia caused by dark environment  3 mpf zebrafish eye RNA sequencing was performed.", null, null, null, null, "darktreated4", null, "strain:not applicable|isolate:Sun Yat sen University|breed:not applicable4|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:not applicable4|collection date:2021 04 16|geo loc name:China: GuangZhou|sex:not applicable|tissue:zebrafish4|isolation source:zebrafish4|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample info", "library 4", "library 4", "DNA barcode4", null, null, "WXS", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP559934", null, null, "darktreated4.read1.fastq.gz darktreated4.read2.fastq.gz", "fastq fastq", 8061663600.0, 26872212.0, "darktreated4.read1.fastq.gz", "0:150 1:150", "A:2171664867;C:1853256385;G:1909447014;T:2127248788;N:46546", 150, 150, null, null, 2171664867, 1853256385, 1909447014, 2127248788, 46546, "SRX27475155", "SRS23899205", "SRA2060897", "zhujiang hospital|ophthalmology", "zhujiang hospital", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2025-01-25", "Undetermined", "Adult", "Undetermined", "Undetermined"], [34600, "SRR32128864", "SRX27475154", "SRS23899204", "SRP559934", "PRJNA1215774", "3 mpf dark reared zebrafish eye RNA sequencing", "PRJNA1215774", "Other", "Outdoor time and light intensity are important emerging factors affecting myopia; however  the underlying mechanisms remain unknown. To clarify the possible molecular mechanisms underlying myopia caused by dark environment  3 mpf zebrafish eye RNA sequencing was performed.", null, null, null, null, "darktreated3", null, "strain:not applicable|isolate:Sun Yat sen University|breed:not applicable3|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:not applicable3|collection date:2021 04 16|geo loc name:China: GuangZhou|sex:not applicable|tissue:zebrafish3|isolation source:zebrafish3|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample info", "library 3", "library 3", "DNA barcode3", null, null, "WXS", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP559934", null, null, "darktreated3.read1.fastq.gz darktreated3.read2.fastq.gz", "fastq fastq", 8287650300.0, 27625501.0, "darktreated3.read1.fastq.gz", "0:150 1:150", "A:2231337901;C:1902488349;G:1971440974;T:2182335741;N:47335", 150, 150, null, null, 2231337901, 1902488349, 1971440974, 2182335741, 47335, "SRX27475154", "SRS23899204", "SRA2060897", "zhujiang hospital|ophthalmology", "zhujiang hospital", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2025-01-25", "Undetermined", "Adult", "Undetermined", "Undetermined"], [34601, "SRR32128865", "SRX27475153", "SRS23899203", "SRP559934", "PRJNA1215774", "3 mpf dark reared zebrafish eye RNA sequencing", "PRJNA1215774", "Other", "Outdoor time and light intensity are important emerging factors affecting myopia; however  the underlying mechanisms remain unknown. To clarify the possible molecular mechanisms underlying myopia caused by dark environment  3 mpf zebrafish eye RNA sequencing was performed.", null, null, null, null, "lighttreated6", null, "strain:not applicable|isolate:Sun Yat sen University|breed:not applicable12|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:not applicable12|collection date:2021 04 16|geo loc name:China: GuangZhou|sex:not applicable|tissue:zebrafish12|isolation source:zebrafish12|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample info", "library 12", "library 12", "DNA barcode12", null, null, "WXS", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP559934", null, null, "lighttreated6.read1.fastq.gz lighttreated6.read2.fastq.gz", "fastq fastq", 7610579400.0, 25368598.0, "lighttreated6.read1.fastq.gz", "0:150 1:150", "A:2063115765;C:1733106391;G:1795336188;T:2018975316;N:45740", 150, 150, null, null, 2063115765, 1733106391, 1795336188, 2018975316, 45740, "SRX27475153", "SRS23899203", "SRA2060897", "zhujiang hospital|ophthalmology", "zhujiang hospital", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2025-01-25", "Undetermined", "Adult", "Undetermined", "Undetermined"], [34602, "SRR32128866", "SRX27475152", "SRS23899202", "SRP559934", "PRJNA1215774", "3 mpf dark reared zebrafish eye RNA sequencing", "PRJNA1215774", "Other", "Outdoor time and light intensity are important emerging factors affecting myopia; however  the underlying mechanisms remain unknown. To clarify the possible molecular mechanisms underlying myopia caused by dark environment  3 mpf zebrafish eye RNA sequencing was performed.", null, null, null, null, "lighttreated5", null, "strain:not applicable|isolate:Sun Yat sen University|breed:not applicable11|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:not applicable11|collection date:2021 04 16|geo loc name:China: GuangZhou|sex:not applicable|tissue:zebrafish11|isolation source:zebrafish11|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample info", "library 11", "library 11", "DNA barcode11", null, null, "WXS", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP559934", null, null, "lighttreated5.read1.fastq.gz lighttreated5.read2.fastq.gz", "fastq fastq", 6677234100.0, 22257447.0, "lighttreated5.read1.fastq.gz", "0:150 1:150", "A:1812295746;C:1506030273;G:1585674870;T:1773195250;N:37961", 150, 150, null, null, 1812295746, 1506030273, 1585674870, 1773195250, 37961, "SRX27475152", "SRS23899202", "SRA2060897", "zhujiang hospital|ophthalmology", "zhujiang hospital", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2025-01-25", "Undetermined", "Adult", "Undetermined", "Undetermined"], [34603, "SRR32128867", "SRX27475151", "SRS23899201", "SRP559934", "PRJNA1215774", "3 mpf dark reared zebrafish eye RNA sequencing", "PRJNA1215774", "Other", "Outdoor time and light intensity are important emerging factors affecting myopia; however  the underlying mechanisms remain unknown. To clarify the possible molecular mechanisms underlying myopia caused by dark environment  3 mpf zebrafish eye RNA sequencing was performed.", null, null, null, null, "darktreated2", null, "strain:not applicable|isolate:Sun Yat sen University|breed:not applicable2|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:not applicable2|collection date:2021 04 16|geo loc name:China: GuangZhou|sex:not applicable|tissue:zebrafish2|isolation source:zebrafish2|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample info", "library 2", "library 2", "DNA barcode2", null, null, "WXS", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP559934", null, null, "darktreated2.read1.fastq.gz darktreated2.read2.fastq.gz", "fastq fastq", 8723972700.0, 29079909.0, "darktreated2.read1.fastq.gz", "0:150 1:150", "A:2341340036;C:2009282478;G:2082163796;T:2291135873;N:50517", 150, 150, null, null, 2341340036, 2009282478, 2082163796, 2291135873, 50517, "SRX27475151", "SRS23899201", "SRA2060897", "zhujiang hospital|ophthalmology", "zhujiang hospital", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2025-01-25", "Undetermined", "Adult", "Undetermined", "Undetermined"], [34604, "SRR32128868", "SRX27475150", "SRS23899200", "SRP559934", "PRJNA1215774", "3 mpf dark reared zebrafish eye RNA sequencing", "PRJNA1215774", "Other", "Outdoor time and light intensity are important emerging factors affecting myopia; however  the underlying mechanisms remain unknown. To clarify the possible molecular mechanisms underlying myopia caused by dark environment  3 mpf zebrafish eye RNA sequencing was performed.", null, null, null, null, "darktreated1", null, "strain:not applicable|isolate:Sun Yat sen University|breed:not applicable1|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:not applicable1|collection date:2021 04 16|geo loc name:China: GuangZhou|sex:not applicable|tissue:zebrafish1|isolation source:zebrafish1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample info", "library 1", "library 1", "DNA barcode1", null, null, "WXS", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP559934", null, null, "darktreated1.read1.fastq.gz darktreated1.read2.fastq.gz", "fastq fastq", 7940928300.0, 26469761.0, "darktreated1.read1.fastq.gz", "0:150 1:150", "A:2133717650;C:1824526059;G:1895330033;T:2087310578;N:43980", 150, 150, null, null, 2133717650, 1824526059, 1895330033, 2087310578, 43980, "SRX27475150", "SRS23899200", "SRA2060897", "zhujiang hospital|ophthalmology", "zhujiang hospital", null, null, null, null, null, null, null, null, null, null, null, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2025-01-25", "Undetermined", "Adult", "Undetermined", "Undetermined"], [48115, "SRR7252252", "SRX4156979", "SRS3369496", "SRP149646", "PRJNA453111", "Danio rerio Transcriptome or Gene expression", "PRJNA453111", "Other", "The effect of oligosaccharides on zebrafish genes", null, null, null, "Model organism or animal sample from Danio rerio 02", "zebrafish 2", null, "breed:zebrafish|dev stage:sexual maturity|sex:not determined|tissue:the whole fish|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "Danio rerio Raw sequence reads", "T02", "T02", "Liver of FOS exposure", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP149646", null, null, "Zebrafish_G017-T02_good_2.fq Zebrafish_G017-T02_good_1.fq", "fastq fastq", 14376728630.0, 48016590.0, "Zebrafish G017 T02 good 2.fq", "0:149.71 1:149.71", "A:3691193836;C:3492856068;G:3505759208;T:3686065491;N:854027", 149, 149, null, null, 3691193836, 3492856068, 3505759208, 3686065491, 854027, "SRX4156979", "SRS3369496", "SRA714653", "Henan University of Scientific and Technology|College of Animal Science and Technology", "Henan University of Scientific and Technology", 2, 0.91739, 0.92142, 0.02484, 0.02505, 0.6873, 0.69402, 0.47704, 0.47922, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2018-06-04", "Undetermined", "Undetermined", "Whole Organism", "All anatomical structures"], [48116, "SRR7252253", "SRX4156978", "SRS3369495", "SRP149646", "PRJNA453111", "Danio rerio Transcriptome or Gene expression", "PRJNA453111", "Other", "The effect of oligosaccharides on zebrafish genes", null, null, null, "Model organism or animal sample from Danio rerio", "zebrafish", null, "breed:zebrafish|dev stage:sexual maturity|sex:not determined|tissue:the whole fish|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "Danio rerio Raw sequence reads", "T01", "T01", "Liver of control", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP149646", null, null, "Zebrafish_G017-T01_good_1.fq Zebrafish_G017-T01_good_2.fq", "fastq fastq", 14807578386.0, 49468651.0, "Zebrafish G017 T01 good 2.fq", "0:149.67 1:149.67", "A:3802207986;C:3595045362;G:3614407174;T:3795034464;N:883400", 149, 149, null, null, 3802207986, 3595045362, 3614407174, 3795034464, 883400, "SRX4156978", "SRS3369495", "SRA714653", "Henan University of Scientific and Technology|College of Animal Science and Technology", "Henan University of Scientific and Technology", 2, 0.92048, 0.92419, 0.03167, 0.03195, 0.67105, 0.67489, 0.43695, 0.44187, 150, 150, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "unknown", "bulk", "unknown", "unknown", null, "China", "2018-06-04", "Undetermined", "Undetermined", "Whole Organism", "All anatomical structures"], [49815, "SRR8987978", "SRX5767074", "SRS4701368", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "24h 6", "sample exposed to microcystin for xxxh   replicate #6", null, "ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|cell line:ZFL cell line|treatment:sample exposed to microcystin for xxxh   replicate #6|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample exposed to  microcystin for xxxh   replicate #6", "24h 3", "24h 3", "Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly  mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments  Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "24h3_clean_R2.fq.gz 24h3_clean_R1.fq.gz", "fastq fastq", 6275458528.0, 20779664.0, "24h3 clean R1.fq.gz", "0:151 1:151", "A:1685303886;C:1437291030;G:1447147160;T:1702856463;N:2859989", 151, 151, null, null, 1685303886, 1437291030, 1447147160, 1702856463, 2859989, "SRX5767074", "SRS4701368", "SRA880742", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.92675, 0.92679, 0.13415, 0.13431, 0.73945, 0.74213, 0.50477, 0.50726, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2019-04-29", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49816, "SRR8987979", "SRX5767073", "SRS4701367", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "24h 4", "sample exposed to microcystin for xxxh   replicate #4", null, "ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|cell line:ZFL cell line|treatment:sample exposed to microcystin for xxxh   replicate #4|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample exposed to  microcystin for xxxh   replicate #4", "24h 1", "24h 1", "Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly  mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments  Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "24h1_clean_R1.fq.gz 24h1_clean_R2.fq.gz", "fastq fastq", 6373552356.0, 21104478.0, "24h1 clean R1.fq.gz", "0:151 1:151", "A:1712827186;C:1458408871;G:1470508604;T:1728973011;N:2834684", 151, 151, null, null, 1712827186, 1458408871, 1470508604, 1728973011, 2834684, "SRX5767073", "SRS4701367", "SRA880742", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.9248, 0.92582, 0.13207, 0.13239, 0.73839, 0.74038, 0.49865, 0.50119, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2019-04-29", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49817, "SRR8987980", "SRX5767072", "SRS4701366", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "24h 5", "sample exposed to microcystin for xxxh   replicate #5", null, "ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|cell line:ZFL cell line|treatment:sample exposed to microcystin for xxxh   replicate #5|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample exposed to  microcystin for xxxh   replicate #5", "24h 2", "24h 2", "Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly  mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments  Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "24h2_clean_R2.fq.gz 24h2_clean_R1.fq.gz", "fastq fastq", 6303822066.0, 20873583.0, "24h2 clean R1.fq.gz", "0:151 1:151", "A:1694366688;C:1441733171;G:1453717629;T:1711017538;N:2987040", 151, 151, null, null, 1694366688, 1441733171, 1453717629, 1711017538, 2987040, "SRX5767072", "SRS4701366", "SRA880742", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.9264, 0.92591, 0.13121, 0.13204, 0.7385, 0.74227, 0.50323, 0.49357, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2019-04-29", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49818, "SRR8983315", "SRX5762615", "SRS4697269", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "12h 5", "sample exposed to microcystin for xxxh   replicate #5", null, "ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|cell line:ZFL cell line|treatment:sample exposed to microcystin for xxxh   replicate #5|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample exposed to  microcystin for xxxh   replicate #5", "12h 5", "12h 5", "Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly  mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments  Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "12h2_clean_R1.fq.gz 12h2_clean_R2.fq.gz", "fastq fastq", 5637564766.0, 18667433.0, "12h2 clean R1.fq.gz", "0:151 1:151", "A:1484457309;C:1319928521;G:1331480348;T:1498547286;N:3151302", 151, 151, null, null, 1484457309, 1319928521, 1331480348, 1498547286, 3151302, "SRX5762615", "SRS4697269", "SRA880316", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.93974, 0.93913, 0.09518, 0.09588, 0.74982, 0.75331, 0.49858, 0.49712, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2019-04-29", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49819, "SRR8983316", "SRX5762614", "SRS4697268", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "12h 4", "sample exposed to microcystin for xxxh   replicate #4", null, "ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|cell line:ZFL cell line|treatment:sample exposed to microcystin for xxxh   replicate #4|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample exposed to  microcystin for xxxh   replicate #4", "12h 4", "12h 4", "Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly  mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments  Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "12h1_clean_R2.fq.gz 12h1_clean_R1.fq.gz", "fastq fastq", 5742037438.0, 19013369.0, "12h1 clean R1.fq.gz", "0:151 1:151", "A:1505967171;C:1350499061;G:1361100937;T:1521258216;N:3212053", 151, 151, null, null, 1505967171, 1350499061, 1361100937, 1521258216, 3212053, "SRX5762614", "SRS4697268", "SRA880316", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.9408, 0.93974, 0.09145, 0.09155, 0.75146, 0.75501, 0.49821, 0.49267, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2019-04-29", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49820, "SRR8983317", "SRX5762613", "SRS4697267", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "12h 6", "sample exposed to microcystin for xxxh   replicate #6", null, "ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|cell line:ZFL cell line|treatment:sample exposed to microcystin for xxxh   replicate #6|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample exposed to  microcystin for xxxh   replicate #6", "12h 6", "12h 6", "Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly  mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments  Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "12h3_clean_R2.fq.gz 12h3_clean_R1.fq.gz", "fastq fastq", 5456135246.0, 18066673.0, "12h3 clean R1.fq.gz", "0:151 1:151", "A:1445780220;C:1268483624;G:1278423072;T:1460394475;N:3053855", 151, 151, null, null, 1445780220, 1268483624, 1278423072, 1460394475, 3053855, "SRX5762613", "SRS4697267", "SRA880316", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.93632, 0.93624, 0.10093, 0.1015, 0.7499, 0.75367, 0.50485, 0.50164, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2019-04-29", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49821, "SRR8982954", "SRX5762254", "SRS4696966", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "6h 6", "sample exposed to microcystin for xxxh   replicate #6", null, "ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|cell line:ZFL cell line|treatment:sample exposed to microcystin for xxxh   replicate #6|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample exposed to  microcystin for xxxh   replicate #6", "6h 6", "6h 6", "Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly  mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments  Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "6h3_clean_R1.fq.gz 6h3_clean_R2.fq.gz", "fastq fastq", 7939056332.0, 26288266.0, "6h3 clean R1.fq.gz", "0:151 1:151", "A:2043932346;C:1908038526;G:1925388013;T:2058202469;N:3494978", 151, 151, null, null, 2043932346, 1908038526, 1925388013, 2058202469, 3494978, "SRX5762254", "SRS4696966", "SRA880287", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.94661, 0.94661, 0.07559, 0.07638, 0.76134, 0.76394, 0.49736, 0.50336, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2019-04-29", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49822, "SRR8982955", "SRX5762253", "SRS4696965", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "6h 5", "sample exposed to microcystin for xxxh   replicate #5", null, "ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|cell line:ZFL cell line|treatment:sample exposed to microcystin for xxxh   replicate #5|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample exposed to  microcystin for xxxh   replicate #5", "6h 5", "6h 5", "Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly  mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments  Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "6h2_clean_R1.fq.gz 6h2_clean_R2.fq.gz", "fastq fastq", 5431283968.0, 17984384.0, "6h2 clean R1.fq.gz", "0:151 1:151", "A:1432960105;C:1269588003;G:1284040697;T:1441657813;N:3037350", 151, 151, null, null, 1432960105, 1269588003, 1284040697, 1441657813, 3037350, "SRX5762253", "SRS4696965", "SRA880287", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.9325, 0.93223, 0.11537, 0.11461, 0.7433, 0.7457, 0.49688, 0.50558, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2019-04-29", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49823, "SRR8982956", "SRX5762252", "SRS4696964", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "6h 4", "sample exposed to microcystin for xxxh   replicate #4", null, "ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|cell line:ZFL cell line|treatment:sample exposed to microcystin for xxxh   replicate #4|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample exposed to  microcystin for xxxh   replicate #4", "6h 4", "6h 4", "Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly  mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments  Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "6h1_clean_R1.fq.gz 6h1_clean_R2.fq.gz", "fastq fastq", 5561923128.0, 18416964.0, "6h1 clean R1.fq.gz", "0:151 1:151", "A:1439698401;C:1327963901;G:1340151064;T:1450995064;N:3114698", 151, 151, null, null, 1439698401, 1327963901, 1340151064, 1450995064, 3114698, "SRX5762252", "SRS4696964", "SRA880287", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.9438, 0.94314, 0.08661, 0.08624, 0.75613, 0.75858, 0.49468, 0.47945, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2019-04-29", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49824, "SRR8981191", "SRX5760491", "SRS4695477", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "3h 5", "sample exposed to microcystin for xxxh   replicate #5", null, "ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|cell line:ZFL cell line|treatment:sample exposed to microcystin for xxxh   replicate #5|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample exposed to  microcystin for xxxh   replicate #5", "3h 5", "3h 5", "Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly  mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments  Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "3h2_clean_R1.fq.gz 3h2_clean_R2.fq.gz", "fastq fastq", 5426694474.0, 17969187.0, "3h2 clean R1.fq.gz", "0:151 1:151", "A:1455679038;C:1243463586;G:1253806438;T:1470703342;N:3042070", 151, 151, null, null, 1455679038, 1243463586, 1253806438, 1470703342, 3042070, "SRX5760491", "SRS4695477", "SRA880231", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.92775, 0.9265, 0.13003, 0.13039, 0.74257, 0.74679, 0.48728, 0.50236, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2019-04-28", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49825, "SRR8981192", "SRX5760490", "SRS4695476", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "3h 4", "sample exposed to microcystin for xxxh   replicate #4", null, "ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|cell line:ZFL cell line|treatment:sample exposed to microcystin for xxxh   replicate #4|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample exposed to  microcystin for xxxh   replicate #4", "3h 4", "3h 4", "Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly  mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments  Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "3h1_clean_R1.fq.gz 3h1_clean_R2.fq.gz", "fastq fastq", 6381408584.0, 21130492.0, "3h1 clean R1.fq.gz", "0:151 1:151", "A:1704493392;C:1471437290;G:1482728107;T:1720014953;N:2734842", 151, 151, null, null, 1704493392, 1471437290, 1482728107, 1720014953, 2734842, "SRX5760490", "SRS4695476", "SRA880231", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.93, 0.93014, 0.11977, 0.12069, 0.74434, 0.74864, 0.49627, 0.50428, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2019-04-28", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49826, "SRR8981193", "SRX5760489", "SRS4695475", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "3h 6", "sample exposed to microcystin for xxxh   replicate #6", null, "ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|cell line:ZFL cell line|treatment:sample exposed to microcystin for xxxh   replicate #6|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample exposed to  microcystin for xxxh   replicate #6", "3h 6", "3h 6", "Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly  mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments  Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "3h3_clean_R1.fq.gz 3h3_clean_R2.fq.gz", "fastq fastq", 6058080740.0, 20059870.0, "3h3 clean R1.fq.gz", "0:151 1:151", "A:1623401423;C:1391994584;G:1400166489;T:1639132542;N:3385702", 151, 151, null, null, 1623401423, 1391994584, 1400166489, 1639132542, 3385702, "SRX5760489", "SRS4695475", "SRA880231", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.93298, 0.93201, 0.10907, 0.10885, 0.75059, 0.75463, 0.50656, 0.49273, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2019-04-28", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49827, "SRR8961086", "SRX5740640", "SRS4676161", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "1h 6", "sample exposed to microcystin for xxxh   replicate #6", null, "ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|cell line:ZFL cell line|treatment:sample exposed to microcystin for xxxh   replicate #6|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample exposed to microcystin for xxxh    replicate #6", "1h 6", "1h 6", "Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly  mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments  Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "1h3_clean_R1.fq.gz 1h3_clean_R2.fq.gz", "fastq fastq", 6472187368.0, 21431084.0, "1h3 clean R1.fq.gz", "0:151 1:151", "A:1780621052;C:1438221849;G:1453983421;T:1796459482;N:2901564", 151, 151, null, null, 1780621052, 1438221849, 1453983421, 1796459482, 2901564, "SRX5740640", "SRS4676161", "SRA879791", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.92158, 0.91814, 0.14503, 0.14358, 0.75775, 0.75982, 0.50094, 0.49955, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2019-04-26", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49828, "SRR8961087", "SRX5740639", "SRS4676160", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "1h 4", "sample exposed to microcystin for xxxh   replicate #4", null, "ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|cell line:ZFL cell line|treatment:sample exposed to microcystin for xxxh   replicate #4|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample exposed to  microcystin for xxxh   replicate #4", "1h 4", "1h 4", "Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly  mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments  Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "1h1_clean_R1.fq.gz 1h1_clean_R2.fq.gz", "fastq fastq", 6177620796.0, 20455698.0, "1h1 clean R1.fq.gz", "0:151 1:151", "A:1646973061;C:1422549043;G:1441385824;T:1663912518;N:2800350", 151, 151, null, null, 1646973061, 1422549043, 1441385824, 1663912518, 2800350, "SRX5740639", "SRS4676160", "SRA879791", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.93085, 0.92866, 0.12633, 0.12579, 0.75812, 0.76136, 0.48992, 0.50959, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2019-04-26", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49829, "SRR8961088", "SRX5740638", "SRS4676159", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "1h 5", "sample exposed to microcystin for xxxh   replicate #5", null, "ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|cell line:ZFL cell line|treatment:sample exposed to microcystin for xxxh   replicate #5|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample exposed to microcystin for xxxh    replicate #5", "1h 5", "1h 5", "Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly  mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments  Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "1h2_clean_R2.fq.gz 1h2_clean_R1.fq.gz", "fastq fastq", 5616651266.0, 18598183.0, "1h2 clean R1.fq.gz", "0:151 1:151", "A:1492544948;C:1296049637;G:1317613246;T:1507292547;N:3150888", 151, 151, null, null, 1492544948, 1296049637, 1317613246, 1507292547, 3150888, "SRX5740638", "SRS4676159", "SRA879791", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.93168, 0.93082, 0.12771, 0.12751, 0.75653, 0.75964, 0.508, 0.51051, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2019-04-26", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49830, "SRR8959882", "SRX5739436", "SRS4675912", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "control  replicate #6", "ck 6", null, "replicate:replicate=#6|ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "replicate 6", "ck 6", "ck 6", "Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly  mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments  Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "CK3_clean_R1.fq.gz CK3_clean_R2.fq.gz", "fastq fastq", 6417346282.0, 21249491.0, "CK3 clean R1.fq.gz", "0:151 1:151", "A:1753073270;C:1445910840;G:1452693305;T:1762084157;N:3584710", 151, 151, null, null, 1753073270, 1445910840, 1452693305, 1762084157, 3584710, "SRX5739436", "SRS4675912", "SRA879767", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.92653, 0.92662, 0.11696, 0.11682, 0.75166, 0.75379, 0.50678, 0.50594, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2019-04-26", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49831, "SRR8959883", "SRX5739435", "SRS4675911", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "control  replicate #4", "ck 4", null, "replicate:replicate=#4|ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "replicate 4", "ck 4", "ck 4", "Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly  mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments  Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "CK1_clean_R1.fq.gz CK1_clean_R2.fq.gz", "fastq fastq", 5659831830.0, 18741165.0, "CK1 clean R1.fq.gz", "0:151 1:151", "A:1532952307;C:1289729700;G:1295220307;T:1538761250;N:3168266", 151, 151, null, null, 1532952307, 1289729700, 1295220307, 1538761250, 3168266, "SRX5739435", "SRS4675911", "SRA879767", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.92518, 0.92535, 0.11332, 0.11378, 0.74919, 0.75235, 0.50223, 0.49803, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2019-04-26", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49832, "SRR8959884", "SRX5739434", "SRS4675910", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "control  replicate #5", "ck 5", null, "replicate:replicate=#5|ecotype:not applicable|dev stage:not applicable|sex:not applicable|tissue:ZFL cell line|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "replicate 5", "ck 5", "ck 5", "Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly  mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments  Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "CK2_clean_R1.fq.gz CK2_clean_R2.fq.gz", "fastq fastq", 5880727616.0, 19472608.0, "CK2 clean R1.fq.gz", "0:151 1:151", "A:1575999691;C:1352057289;G:1366253556;T:1583120335;N:3296745", 151, 151, null, null, 1575999691, 1352057289, 1366253556, 1583120335, 3296745, "SRX5739434", "SRS4675910", "SRA879767", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.93653, 0.9349, 0.09037, 0.09026, 0.76262, 0.76572, 0.51143, 0.50376, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2019-04-26", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49833, "SRR8133154", "SRX4954244", "SRS3995636", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "sample exposed to microcystin for xxx hour  replicate #1", "24h 1", null, "isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:exposed to microcystin for xxx hour  replicate #1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample exposed to microcystin for xxx hour   replicate #1", "24h 1", "24h 1", "Sequencing libraries were generated using the  TruSeq RNA Sample Preparation Kit Illumina according to manufacturers  instructions. Three micrograms of total RNA were used as initial material for  library preparation. Briefly  mRNA was purified using poly T oligo attached  magnetic beads. Fragmentation of mRNA was conducted using divalent cations  under elevated temperature in the Illumina proprietary fragmentation buffer.  First strand cDNA was synthesized using random oligonucleotides and  SuperScript II. Second strand cDNA was subsequently synthesized using DNA  Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments   Illumina PE adapter oligonucleotides were ligated and the library fragments  were purified using the AMPure XP system Beckman Coulter. DNA fragments  with ligated adaptors on both ends were selectively enriched using Illumina  PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified  AMPure XP system and quantified using the Agilent high sensitivity DNA  assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were  then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina  by Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "24h-1_R1.fastq.gz 24h-1_R2.fastq.gz", "fastq fastq", 6408674352.0, 21220776.0, "24h 1 R1.fastq.gz", "0:151 1:151", "A:1752104547;C:1447174976;G:1451968217;T:1757298923;N:127689", 151, 151, null, null, 1752104547, 1447174976, 1451968217, 1757298923, 127689, "SRX4954244", "SRS3995636", "SRA800477", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.9212, 0.91969, 0.14419, 0.14446, 0.73677, 0.74363, 0.49228, 0.49725, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2018-10-30", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49834, "SRR8133155", "SRX4954243", "SRS3995635", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "sample exposed to microcystin for xxx hour  replicate #2", "24h 2", null, "isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:exposed to microcystin for xxx hour  replicate #2|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample exposed to microcystin for xxx hour  replicate #2", "24h 2", "24h 2", "Sequencing libraries were generated using the TruSeq RNA Sample  Preparation Kit Illumina according to manufacturers instructions. Three  micrograms of total RNA were used as initial material for library  preparation. Briefly  mRNA was purified using poly T oligo attached magnetic  beads. Fragmentation of mRNA was conducted using divalent cations under  elevated temperature in the Illumina proprietary fragmentation buffer. First  strand cDNA was synthesized using random oligonucleotides and SuperScript II.  Second strand cDNA was subsequently synthesized using DNA Polymerase I and  RNase H. post adenylation of the 3 ends of DNA fragments  Illumina PE  adapter oligonucleotides were ligated and the library fragments were purified  using the AMPure XP system Beckman Coulter. DNA fragments with ligated  adaptors on both ends were selectively enriched using Illumina PCR Primer  Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP  system and quantified using the Agilent high sensitivity DNA assay on a  Bioanalyzer 2100 system Agilent. The sequencing libraries were then  sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by  Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "24h-2_R1.fastq.gz 24h-2_R2.fastq.gz", "fastq fastq", 6331528754.0, 20965327.0, "24h 2 R1.fastq.gz", "0:151 1:151", "A:1725083256;C:1436372645;G:1442486884;T:1727457912;N:128057", 151, 151, null, null, 1725083256, 1436372645, 1442486884, 1727457912, 128057, "SRX4954243", "SRS3995635", "SRA800477", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.92281, 0.92303, 0.13905, 0.14045, 0.73708, 0.74401, 0.50843, 0.50295, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2019-01-01", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49835, "SRR8133156", "SRX4954242", "SRS3995634", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "sample exposed to microcystin for xxx hour  replicate #3", "24h 3", null, "isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:exposed to microcystin for xxx hour  replicate #3|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample exposed to microcystin for xxx hour  replicate #3", "24h 3", "24h 3", "Sequencing libraries were generated using the TruSeq RNA Sample  Preparation Kit Illumina according to manufacturers instructions. Three  micrograms of total RNA were used as initial material for library  preparation. Briefly  mRNA was purified using poly T oligo attached magnetic  beads. Fragmentation of mRNA was conducted using divalent cations under  elevated temperature in the Illumina proprietary fragmentation buffer. First  strand cDNA was synthesized using random oligonucleotides and SuperScript II.  Second strand cDNA was subsequently synthesized using DNA Polymerase I and  RNase H. post adenylation of the 3 ends of DNA fragments  Illumina PE  adapter oligonucleotides were ligated and the library fragments were purified  using the AMPure XP system Beckman Coulter. DNA fragments with ligated  adaptors on both ends were selectively enriched using Illumina PCR Primer  Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP  system and quantified using the Agilent high sensitivity DNA assay on a  Bioanalyzer 2100 system Agilent. The sequencing libraries were then  sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by  Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "24h-3_R1.fastq.gz 24h-3_R2.fastq.gz", "fastq fastq", 6723114940.0, 22261970.0, "24h 3 R1.fastq.gz", "0:151 1:151", "A:1833689339;C:1522824611;G:1529534136;T:1836931192;N:135662", 151, 151, null, null, 1833689339, 1522824611, 1529534136, 1836931192, 135662, "SRX4954242", "SRS3995634", "SRA800477", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.91356, 0.91347, 0.13955, 0.14059, 0.73898, 0.74399, 0.49776, 0.50087, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2019-01-01", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49836, "SRR8133151", "SRX4954241", "SRS3995633", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "sample exposed to microcystin for xxx hour  replicate #3", "12h 3", null, "isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:exposed to microcystin for xxx hour  replicate #3|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample exposed to microcystin for xxx hour  replicate #3", "12h 3", "12h 3", "Sequencing libraries were generated using the TruSeq RNA Sample  Preparation Kit Illumina according to manufacturers instructions. Three  micrograms of total RNA were used as initial material for library  preparation. Briefly  mRNA was purified using poly T oligo attached magnetic  beads. Fragmentation of mRNA was conducted using divalent cations under  elevated temperature in the Illumina proprietary fragmentation buffer. First  strand cDNA was synthesized using random oligonucleotides and SuperScript II.  Second strand cDNA was subsequently synthesized using DNA Polymerase I and  RNase H. post adenylation of the 3 ends of DNA fragments  Illumina PE  adapter oligonucleotides were ligated and the library fragments were purified  using the AMPure XP system Beckman Coulter. DNA fragments with ligated  adaptors on both ends were selectively enriched using Illumina PCR Primer  Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP  system and quantified using the Agilent high sensitivity DNA assay on a  Bioanalyzer 2100 system Agilent. The sequencing libraries were then  sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by  Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "12h-3_R1.fastq.gz 12h-3_R2.fastq.gz", "fastq fastq", 6249709404.0, 20694402.0, "12h 3 R1.fastq.gz", "0:151 1:151", "A:1679876276;C:1439210018;G:1449953029;T:1680544537;N:125544", 151, 151, null, null, 1679876276, 1439210018, 1449953029, 1680544537, 125544, "SRX4954241", "SRS3995633", "SRA800476", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.9318, 0.93185, 0.10315, 0.10397, 0.7499, 0.75513, 0.49669, 0.50516, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2019-01-01", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49837, "SRR8133152", "SRX4954240", "SRS3995632", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "sample exposed to microcystin for xxx hour  replicate #1", "12h 1", null, "isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:exposed to microcystin for xxx hour  replicate #1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample exposed to microcystin for xxx hour   replicate #1", "12h 1", "12h 1", "Sequencing libraries were generated using the  TruSeq RNA Sample Preparation Kit Illumina according to manufacturers  instructions. Three micrograms of total RNA were used as initial material for  library preparation. Briefly  mRNA was purified using poly T oligo attached  magnetic beads. Fragmentation of mRNA was conducted using divalent cations  under elevated temperature in the Illumina proprietary fragmentation buffer.  First strand cDNA was synthesized using random oligonucleotides and  SuperScript II. Second strand cDNA was subsequently synthesized using DNA  Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments   Illumina PE adapter oligonucleotides were ligated and the library fragments  were purified using the AMPure XP system Beckman Coulter. DNA fragments  with ligated adaptors on both ends were selectively enriched using Illumina  PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified  AMPure XP system and quantified using the Agilent high sensitivity DNA  assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were  then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina  by Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "12h-1_R1.fastq.gz 12h-1_R2.fastq.gz", "fastq fastq", 6040713928.0, 20002364.0, "12h 1 R1.fastq.gz", "0:151 1:151", "A:1604304459;C:1407301760;G:1430569355;T:1597934265;N:604089", 151, 151, null, null, 1604304459, 1407301760, 1430569355, 1597934265, 604089, "SRX4954240", "SRS3995632", "SRA800476", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.93665, 0.93821, 0.09301, 0.0957, 0.75284, 0.77169, 0.49115, 0.48606, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2019-01-01", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49838, "SRR8133153", "SRX4954239", "SRS3995631", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "sample exposed to microcystin for xxx hour  replicate #2", "12h 2", null, "isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:exposed to microcystin for xxx hour  replicate #2|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample exposed to microcystin for xxx hour  replicate #2", "12h 2", "12h 2", "Sequencing libraries were generated using the TruSeq RNA Sample  Preparation Kit Illumina according to manufacturers instructions. Three  micrograms of total RNA were used as initial material for library  preparation. Briefly  mRNA was purified using poly T oligo attached magnetic  beads. Fragmentation of mRNA was conducted using divalent cations under  elevated temperature in the Illumina proprietary fragmentation buffer. First  strand cDNA was synthesized using random oligonucleotides and SuperScript II.  Second strand cDNA was subsequently synthesized using DNA Polymerase I and  RNase H. post adenylation of the 3 ends of DNA fragments  Illumina PE  adapter oligonucleotides were ligated and the library fragments were purified  using the AMPure XP system Beckman Coulter. DNA fragments with ligated  adaptors on both ends were selectively enriched using Illumina PCR Primer  Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP  system and quantified using the Agilent high sensitivity DNA assay on a  Bioanalyzer 2100 system Agilent. The sequencing libraries were then  sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by  Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "12h-2_R1.fastq.gz 12h-2_R2.fastq.gz", "fastq fastq", 6340973200.0, 20996600.0, "12h 2 R1.fastq.gz", "0:151 1:151", "A:1704338617;C:1461869913;G:1470728810;T:1703906206;N:129654", 151, 151, null, null, 1704338617, 1461869913, 1470728810, 1703906206, 129654, "SRX4954239", "SRS3995631", "SRA800476", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.93272, 0.93343, 0.10216, 0.10338, 0.74978, 0.75513, 0.50094, 0.51045, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2019-01-01", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49839, "SRR8132757", "SRX4953863", "SRS3995402", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "sample exposed to microcystin for xxx hour  replicate #3", "6h 3", null, "isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:exposed to microcystin for xxx hour  replicate #3|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample exposed to microcystin for xxx hour   replicate #3", "6h 3", "6h 3", "Sequencing libraries were generated using the  TruSeq RNA Sample Preparation Kit Illumina according to manufacturers  instructions. Three micrograms of total RNA were used as initial material for  library preparation. Briefly  mRNA was purified using poly T oligo attached  magnetic beads. Fragmentation of mRNA was conducted using divalent cations  under elevated temperature in the Illumina proprietary fragmentation buffer.  First strand cDNA was synthesized using random oligonucleotides and  SuperScript II. Second strand cDNA was subsequently synthesized using DNA  Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments   Illumina PE adapter oligonucleotides were ligated and the library fragments  were purified using the AMPure XP system Beckman Coulter. DNA fragments  with ligated adaptors on both ends were selectively enriched using Illumina  PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified  AMPure XP system and quantified using the Agilent high sensitivity DNA  assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were  then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina  by Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "6h-3_R1.fastq.gz 6h-3_R2.fastq.gz", "fastq fastq", 6533368340.0, 21633670.0, "6h 3 R1.fastq.gz", "0:151 1:151", "A:1684379253;C:1575728468;G:1593737205;T:1678875387;N:648027", 151, 151, null, null, 1684379253, 1575728468, 1593737205, 1678875387, 648027, "SRX4953863", "SRS3995402", "SRA800451", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.94744, 0.94959, 0.06681, 0.06774, 0.76459, 0.77711, 0.4873, 0.49779, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2019-01-01", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49840, "SRR8132756", "SRX4953862", "SRS3995403", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "sample exposed to microcystin for xxx hour  replicate #1", "6h 1", null, "isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:exposed to microcystin for xxx hour  replicate #1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample exposed to microcystin for xxx hour   replicate #1", "6h 1", "6h 1", "Sequencing libraries were generated using the  TruSeq RNA Sample Preparation Kit Illumina according to manufacturers  instructions. Three micrograms of total RNA were used as initial material for  library preparation. Briefly  mRNA was purified using poly T oligo attached  magnetic beads. Fragmentation of mRNA was conducted using divalent cations  under elevated temperature in the Illumina proprietary fragmentation buffer.  First strand cDNA was synthesized using random oligonucleotides and  SuperScript II. Second strand cDNA was subsequently synthesized using DNA  Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments   Illumina PE adapter oligonucleotides were ligated and the library fragments  were purified using the AMPure XP system Beckman Coulter. DNA fragments  with ligated adaptors on both ends were selectively enriched using Illumina  PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified  AMPure XP system and quantified using the Agilent high sensitivity DNA  assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were  then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina  by Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "6h-1_R1.fastq.gz 6h-1_R2.fastq.gz", "fastq fastq", 6686156482.0, 22139591.0, "6h 1 R1.fastq.gz", "0:151 1:151", "A:1712757343;C:1622803789;G:1646819107;T:1703094369;N:681874", 151, 151, null, null, 1712757343, 1622803789, 1646819107, 1703094369, 681874, "SRX4953862", "SRS3995403", "SRA800449", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.95018, 0.95234, 0.0661, 0.06774, 0.77268, 0.78652, 0.49287, 0.48663, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2018-10-29", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49841, "SRR8132755", "SRX4953861", "SRS3995401", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "sample exposed to microcystin for xxx hour  replicate #2", "6h 2", null, "isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:exposed to microcystin for xxx hour  replicate #2|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample exposed to microcystin for xxx hour   replicate #2", "6h 2", "6h 2", "Sequencing libraries were generated using the  TruSeq RNA Sample Preparation Kit Illumina according to manufacturers  instructions. Three micrograms of total RNA were used as initial material for  library preparation. Briefly  mRNA was purified using poly T oligo attached  magnetic beads. Fragmentation of mRNA was conducted using divalent cations  under elevated temperature in the Illumina proprietary fragmentation buffer.  First strand cDNA was synthesized using random oligonucleotides and  SuperScript II. Second strand cDNA was subsequently synthesized using DNA  Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments   Illumina PE adapter oligonucleotides were ligated and the library fragments  were purified using the AMPure XP system Beckman Coulter. DNA fragments  with ligated adaptors on both ends were selectively enriched using Illumina  PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified  AMPure XP system and quantified using the Agilent high sensitivity DNA  assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were  then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina  by Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "6h-2_R1.fastq.gz 6h-2_R2.fastq.gz", "fastq fastq", 5551304204.0, 18381802.0, "6h 2 R1.fastq.gz", "0:151 1:151", "A:1408740987;C:1361721973;G:1380328727;T:1399965481;N:547036", 151, 151, null, null, 1408740987, 1361721973, 1380328727, 1399965481, 547036, "SRX4953861", "SRS3995401", "SRA800450", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.9506, 0.95313, 0.07031, 0.07155, 0.7739, 0.78591, 0.50125, 0.49851, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2018-10-29", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49842, "SRR8119911", "SRX4946208", "SRS3988532", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "sample exposed to microcystin for xxx hour  replicate #3", "3h 3", null, "isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:exposed to microcystin for xxx hour  replicate #3|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample exposed to microcystin for xxx hour   replicate #3", "3h 3", "3h 3", "Sequencing libraries were generated using the  TruSeq RNA Sample Preparation Kit Illumina according to manufacturers  instructions. Three micrograms of total RNA were used as initial material for  library preparation. Briefly  mRNA was purified using poly T oligo attached  magnetic beads. Fragmentation of mRNA was conducted using divalent cations  under elevated temperature in the Illumina proprietary fragmentation buffer.  First strand cDNA was synthesized using random oligonucleotides and  SuperScript II. Second strand cDNA was subsequently synthesized using DNA  Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments   Illumina PE adapter oligonucleotides were ligated and the library fragments  were purified using the AMPure XP system Beckman Coulter. DNA fragments  with ligated adaptors on both ends were selectively enriched using Illumina  PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified  AMPure XP system and quantified using the Agilent high sensitivity DNA  assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were  then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina  by Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "3h-3_R1.fastq.gz 3h-3_R2.fastq.gz", "fastq fastq", 6249422202.0, 20693451.0, "3h 3 R1.fastq.gz", "0:151 1:151", "A:1700610088;C:1416827975;G:1436930329;T:1694433965;N:619845", 151, 151, null, null, 1700610088, 1416827975, 1436930329, 1694433965, 619845, "SRX4946208", "SRS3988532", "SRA799983", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.924, 0.92633, 0.13412, 0.13864, 0.74158, 0.76489, 0.49551, 0.49903, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2018-10-29", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49843, "SRR8119910", "SRX4946207", "SRS3988531", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "sample exposed to microcystin for xxx hour  replicate #2", "3h 2", null, "isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:exposed to microcystin for xxx hour  replicate #2|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample exposed to microcystin for xxx hour   replicate #2", "3h 2", "3h 2", "Sequencing libraries were generated using the  TruSeq RNA Sample Preparation Kit Illumina according to manufacturers  instructions. Three micrograms of total RNA were used as initial material for  library preparation. Briefly  mRNA was purified using poly T oligo attached  magnetic beads. Fragmentation of mRNA was conducted using divalent cations  under elevated temperature in the Illumina proprietary fragmentation buffer.  First strand cDNA was synthesized using random oligonucleotides and  SuperScript II. Second strand cDNA was subsequently synthesized using DNA  Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments   Illumina PE adapter oligonucleotides were ligated and the library fragments  were purified using the AMPure XP system Beckman Coulter. DNA fragments  with ligated adaptors on both ends were selectively enriched using Illumina  PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified  AMPure XP system and quantified using the Agilent high sensitivity DNA  assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were  then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina  by Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "3h-2_R1.fastq.gz 3h-2_R2.fastq.gz", "fastq fastq", 6691460508.0, 22157154.0, "3h 2 R2.fastq.gz", "0:151 1:151", "A:1817827404;C:1520902100;G:1534921644;T:1817122657;N:686703", 151, 151, null, null, 1817827404, 1520902100, 1534921644, 1817122657, 686703, "SRX4946207", "SRS3988531", "SRA799982", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.92541, 0.92734, 0.13003, 0.1321, 0.7443, 0.76019, 0.50143, 0.4998, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2019-01-01", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49844, "SRR8117643", "SRX4943940", "SRS3986328", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "sample exposed to microcystin for xxx hour  replicate #1", "3h 1", null, "isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:exposed to microcystin for xxx hour  replicate #1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample exposed to microcystin for xxx hour   replicate #1", "3h 1", "3h 1", "Sequencing libraries were generated using the  TruSeq RNA Sample Preparation Kit Illumina according to manufacturers  instructions. Three micrograms of total RNA were used as initial material for  library preparation. Briefly  mRNA was purified using poly T oligo attached  magnetic beads. Fragmentation of mRNA was conducted using divalent cations  under elevated temperature in the Illumina proprietary fragmentation buffer.  First strand cDNA was synthesized using random oligonucleotides and  SuperScript II. Second strand cDNA was subsequently synthesized using DNA  Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments   Illumina PE adapter oligonucleotides were ligated and the library fragments  were purified using the AMPure XP system Beckman Coulter. DNA fragments  with ligated adaptors on both ends were selectively enriched using Illumina  PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified  AMPure XP system and quantified using the Agilent high sensitivity DNA  assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were  then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina  by Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "3h-1_R1.fastq.gz 3h-1_R2.fastq.gz", "fastq fastq", 6151798890.0, 20370195.0, "3h 1 R1.fastq.gz", "0:151 1:151", "A:1649142984;C:1419068750;G:1435991843;T:1646989815;N:605498", 151, 151, null, null, 1649142984, 1419068750, 1435991843, 1646989815, 605498, "SRX4943940", "SRS3986328", "SRA799824", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.92965, 0.93287, 0.12221, 0.12677, 0.73397, 0.75278, 0.50535, 0.50378, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2018-10-28", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49845, "SRR8115441", "SRX4941738", "SRS3985539", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "sample exposed to microcystin for xxx hour  replicate #3", "1h 3", null, "isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:exposed to microcystin for xxx hour  replicate #3|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample exposed to microcystin for xxx hour   replicate #3", "1h 3", "1h 3", "Sequencing libraries were generated using the  TruSeq RNA Sample Preparation Kit Illumina according to manufacturers  instructions. Three micrograms of total RNA were used as initial material for  library preparation. Briefly  mRNA was purified using poly T oligo attached  magnetic beads. Fragmentation of mRNA was conducted using divalent cations  under elevated temperature in the Illumina proprietary fragmentation buffer.  First strand cDNA was synthesized using random oligonucleotides and  SuperScript II. Second strand cDNA was subsequently synthesized using DNA  Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments   Illumina PE adapter oligonucleotides were ligated and the library fragments  were purified using the AMPure XP system Beckman Coulter. DNA fragments  with ligated adaptors on both ends were selectively enriched using Illumina  PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified  AMPure XP system and quantified using the Agilent high sensitivity DNA  assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were  then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina  by Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "1h-3_R2.fastq.gz 1h-3_R1.fastq.gz", "fastq fastq", 7655572254.0, 25349577.0, "1h 3 R2.fastq.gz", "0:151 1:151", "A:2078212614;C:1742053699;G:1754520045;T:2080018836;N:767060", 151, 151, null, null, 2078212614, 1742053699, 1754520045, 2080018836, 767060, "SRX4941738", "SRS3985539", "SRA799651", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.92526, 0.92744, 0.12977, 0.13298, 0.75743, 0.77061, 0.50353, 0.50471, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2019-01-01", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49846, "SRR8115440", "SRX4941737", "SRS3985538", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "sample exposed to microcystin for xxx hour  replicate #2", "1h 2", null, "isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:exposed to microcystin for xxx hour  replicate #2|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample exposed to microcystin for xxx hour  replicate #2", "1h 2", "1h 2", "Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly  mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments  Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "1h-2_R1.fastq.gz 1h-2_R2.fastq.gz", "fastq fastq", 7594153306.0, 25146203.0, "1h 2 R1.fastq.gz", "0:151 1:151", "A:2048228795;C:1739666332;G:1763496812;T:2041988124;N:773243", 151, 151, null, null, 2048228795, 1739666332, 1763496812, 2041988124, 773243, "SRX4941737", "SRS3985538", "SRA799650", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.92922, 0.93046, 0.12988, 0.1333, 0.75657, 0.77684, 0.50439, 0.49684, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2019-01-01", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49847, "SRR8109598", "SRX4936168", "SRS3980334", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "sample exposed to microcystin for xxx hour  replicate #1", "1h 1", null, "isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:exposed to microcystin for xxx hour  replicate #1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample exposed to microcystin for xxx hour  replicate #1", "1h 1", "1h 1", "Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly  mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments  Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "1h-1_R1.fastq.gz 1h-1_R2.fastq.gz", "fastq fastq", 6505465654.0, 21541277.0, "1h 1 R2.fastq.gz", "0:151 1:151", "A:1772064909;C:1473729340;G:1487273483;T:1771747419;N:650503", 151, 151, null, null, 1772064909, 1473729340, 1487273483, 1771747419, 650503, "SRX4936168", "SRS3980334", "SRA798650", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.92342, 0.92707, 0.13549, 0.13873, 0.7555, 0.77106, 0.49839, 0.50202, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2018-10-25", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49848, "SRR8109308", "SRX4935890", "SRS3980091", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "sample not treated  replicate #3", "ck 3", null, "isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:not treated  replicate #3|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample not treated  replicate #3", "ck 3", "ck 3", "Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly  mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments  Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "CK-3_R1.fastq.gz CK-3_R2.fastq.gz", "fastq fastq", 6691086632.0, 22155916.0, "CK 3 R2.fastq.gz", "0:151 1:151", "A:1817102254;C:1525946318;G:1537285128;T:1810073033;N:679899", 151, 151, null, null, 1817102254, 1525946318, 1537285128, 1810073033, 679899, "SRX4935890", "SRS3980091", "SRA798632", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.93213, 0.93388, 0.10099, 0.10342, 0.75828, 0.77035, 0.49928, 0.49506, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2018-10-25", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [49849, "SRR8109041", "SRX4935630", "SRS3979958", "SRP166817", "PRJNA498018", "Danio rerio strain:ZFL cell line Genome sequencing", "PRJNA498018", "Whole Genome Sequencing", "Transcriptional responses of ZFL exposed to microcystin LR", null, null, null, "sample not treated  replicate #2", "ck 2", null, "isolate:ZFL cell line|dev stage:not applicable|sex:not applicable|tissue:cultured cell line|cell line:ZFL|cell type:epithelia|treatment:not treated  replicate #1|BioSampleModel:Model organism or animal", null, null, null, null, null, null, null, null, "sample not treated  replicate #2", "ck 2", "ck 2", "Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit Illumina according to manufacturers instructions. Three micrograms of total RNA were used as initial material for library preparation. Briefly  mRNA was purified using poly T oligo attached magnetic beads. Fragmentation of mRNA was conducted using divalent cations under elevated temperature in the Illumina proprietary fragmentation buffer. First strand cDNA was synthesized using random oligonucleotides and SuperScript II. Second strand cDNA was subsequently synthesized using DNA Polymerase I and RNase H. post adenylation of the 3 ends of DNA fragments  Illumina PE adapter oligonucleotides were ligated and the library fragments were purified using the AMPure XP system Beckman Coulter. DNA fragments with ligated adaptors on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. The products were purified AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system Agilent. The sequencing libraries were then sequenced at both ends for 150 bp using a Hiseq Xten platform Illumina by Shanghai Personal Biotechnology Cp. Ltd.", null, null, "RNA-Seq", "TRANSCRIPTOMIC", "PCR", "PAIRED", "ILLUMINA", "HiSeq X Ten", null, "SRP166817", null, null, "CK-2_R2.fastq.gz CK-2_R1.fastq.gz", "fastq fastq", 6135368580.0, 20315790.0, "CK 2 R2.fastq.gz", "0:151 1:151", "A:1659190299;C:1402338038;G:1422425283;T:1650808795;N:606165", 151, 151, null, null, 1659190299, 1402338038, 1422425283, 1650808795, 606165, "SRX4935630", "SRS3979958", "SRA798622", "Chinese Academy of Fishery Sciences|Yangtze River Fisheries Research Institute", "Chinese Academy of Fishery Sciences", 2, 0.93276, 0.93529, 0.09768, 0.1008, 0.75905, 0.77512, 0.48616, 0.50755, 151, 151, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "random_priming", "trueseq", "bulk", "unknown", "unknown", null, "China", "2019-01-01", "Undetermined", "Undetermined", "Cell Line", "Cell Line"], [67908, "SRR017341", "SRX003632", "SRS002067", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish N", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishN", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "N_fish.tar", "fastq", 40231384.0, 173756.0, "Zebrafish IgH cDNA FishN", "0:4 1:227.54", "A:10436935;C:8800020;G:9512025;T:11471941;N:10463", 4, 227, null, null, 10436935, 8800020, 9512025, 11471941, 10463, "SRX003632", "SRS002067", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.26487, null, 0.0663, null, 0.99304, null, 0.01389, null, 229, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67909, "SRR017340", "SRX003631", "SRS002066", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish M", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishM", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "M_fish.tar", "fastq", 37492198.0, 161639.0, "Zebrafish IgH cDNA FishM", "0:4 1:227.95", "A:9527141;C:8129088;G:9025760;T:10804127;N:6082", 4, 227, null, null, 9527141, 8129088, 9025760, 10804127, 6082, "SRX003631", "SRS002066", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.31521, null, 0.11394, null, 0.99823, null, 0.00291, null, 208, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"], [67910, "SRR017339", "SRX003630", "SRS002065", "SRP000652", "PRJNA79415", "Zebrafish IgH Sequencing", "Zebrafish IgH", "Other", "14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.", null, "pubmed:19423829", null, "Generic sample from Danio rerio", "Fish L", null, null, null, null, null, null, null, null, null, null, "Zebrafish IgH cDNA preparation", "Zebrafish IgH cDNA FishL", "Zebrafish IgH 454", "About 2\u00b5g of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. \"Digital PCR provides sensitive and absolute calibration for high throughput sequencing\" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer\u2019s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.", null, "IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime", "AMPLICON", "TRANSCRIPTOMIC", "PCR", "SINGLE", "LS454", "454 GS FLX", "<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>", "SRP000652", null, "NonStandardReadNameUsed:true", "L_fish.tar", "fastq", 37971443.0, 163701.0, "Zebrafish IgH cDNA FishL", "0:4 1:227.96", "A:9544875;C:8363123;G:9094601;T:10963684;N:5160", 4, 227, null, null, 9544875, 8363123, 9094601, 10963684, 5160, "SRX003630", "SRS002065", "SRA008134", "Stanford University|Quake", "Stanford University", 1, 0.29057, null, 0.07862, null, 0.99636, null, 0.00534, null, 245, null, "B", null, "usable mapping rate", "legacy", "early", "unknown", "random_priming", "unknown", "bulk", "other_seq", "454", null, "United States", "2011-03-31", "Undetermined", "Undetermined", "BCR TCR repertoire", "Hematopoietic System"]], "truncated": false, "filtered_table_rows_count": 129, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"devstage_curation\" = :p0 and \"experiment.library_selection\" = :p1 order by rowid limit 101", "params": {"p0": "Undetermined", "p1": "PCR"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR", "results": [{"value": "RNA-Seq", "label": "RNA-Seq", "count": 91, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR&experiment.library_strategy=RNA-Seq", "selected": false}, {"value": "AMPLICON", "label": "AMPLICON", "count": 14, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR&experiment.library_strategy=AMPLICON", "selected": false}, {"value": "WXS", "label": "WXS", "count": 12, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR&experiment.library_strategy=WXS", "selected": false}, {"value": "miRNA-Seq", "label": "miRNA-Seq", "count": 12, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR&experiment.library_strategy=miRNA-Seq", "selected": false}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 129, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR&experiment.library_source=TRANSCRIPTOMIC", "selected": false}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR", "results": [{"value": "PCR", "label": "PCR", "count": 129, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined", "selected": true}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR", "results": [{"value": "PAIRED", "label": "PAIRED", "count": 103, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR&experiment.library_layout=PAIRED", "selected": false}, {"value": "SINGLE", "label": "SINGLE", "count": 26, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR&experiment.library_layout=SINGLE", "selected": false}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR", "results": [{"value": "ILLUMINA", "label": "ILLUMINA", "count": 115, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR&experiment.platform=ILLUMINA", "selected": false}, {"value": "LS454", "label": "LS454", "count": 14, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR&experiment.platform=LS454", "selected": false}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR", "results": [{"value": "Undetermined", "label": "Undetermined", "count": 99, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR&devstage_curation_coarse=Undetermined", "selected": false}, {"value": "Adult", "label": "Adult", "count": 24, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR&devstage_curation_coarse=Adult", "selected": false}, {"value": "Embryo", "label": "Embryo", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR&devstage_curation_coarse=Embryo", "selected": false}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR", "results": [{"value": "Undetermined", "label": "Undetermined", "count": 129, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_selection=PCR", "selected": true}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR", "results": [{"value": "Cell Line", "label": "Cell Line", "count": 47, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR&tissue_curation_coarse=Cell+Line", "selected": false}, {"value": "Undetermined", "label": "Undetermined", "count": 18, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR&tissue_curation_coarse=Undetermined", "selected": false}, {"value": "Hematopoietic System", "label": "Hematopoietic System", "count": 14, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR&tissue_curation_coarse=Hematopoietic+System", "selected": false}, {"value": "Nervous System", "label": "Nervous System", "count": 12, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR&tissue_curation_coarse=Nervous+System", "selected": false}, {"value": "Reproductive System", "label": "Reproductive System", "count": 12, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR&tissue_curation_coarse=Reproductive+System", "selected": false}, {"value": "Sensory System", "label": "Sensory System", "count": 12, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR&tissue_curation_coarse=Sensory+System", "selected": false}, {"value": "All anatomical structures", "label": "All anatomical structures", "count": 8, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR&tissue_curation_coarse=All+anatomical+structures", "selected": false}, {"value": "Surface Structure", "label": "Surface Structure", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR&tissue_curation_coarse=Surface+Structure", "selected": false}], "truncated": false}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR", "results": [{"value": "Cell Line", "label": "Cell Line", "count": 47, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR&tissue_curation=Cell+Line", "selected": false}, {"value": "Undetermined", "label": "Undetermined", "count": 18, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR&tissue_curation=Undetermined", "selected": false}, {"value": "BCR TCR repertoire", "label": "BCR TCR repertoire", "count": 14, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR&tissue_curation=BCR+TCR+repertoire", "selected": false}, {"value": "Brain", "label": "Brain", "count": 12, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR&tissue_curation=Brain", "selected": false}, {"value": "Eye", "label": "Eye", "count": 12, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR&tissue_curation=Eye", "selected": false}, {"value": "Gonad", "label": "Gonad", "count": 12, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR&tissue_curation=Gonad", "selected": false}, {"value": "Whole Organism", "label": "Whole Organism", "count": 8, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR&tissue_curation=Whole+Organism", "selected": false}, {"value": "Trunk", "label": "Trunk", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR&tissue_curation=Trunk", "selected": false}], "truncated": false}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR", "results": [{"value": "unknown", "label": "unknown", "count": 103, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR&technology=unknown", "selected": false}, {"value": "454", "label": "454", "count": 14, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR&technology=454", "selected": false}, {"value": "bulk", "label": "bulk", "count": 12, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR&technology=bulk", "selected": false}], "truncated": false}}, "suggested_facets": [], "next": "67910", "next_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?devstage_curation=Undetermined&experiment.library_selection=PCR&_next=67910", "private": false, "allow_execute_sql": true, "query_ms": 94.36731600726489}